scieee Science in your language
[en] (orig)

Polymodal Transient Receptor Potential Vanilloid (TRPV) Ion Channels in Chondrogenic Cells

Read accessible full text

Polymodal Transient Receptor Potential Vanilloid (TRPV) Ion Channels in Chondrogenic Cells

Author: Somogyi, Csilla; Matta, Csaba; Földvári, Zsófia; Juhász, Tamás; Katona, Éva; Takács, Roland Ádám; Hajdú, Tibor; Dobrosi, Nóra; Gergely, Pál; Zákány, Róza
Year: 2015
Source: https://dea.lib.unideb.hu/bitstreams/3412f7b5-0d23-408c-aeb4-476968b850b8/download
In . J. Mol. Sci. 2015, 16, 18412-18438; doi:10.3390/ijms160818412
In e na ional Jou nal o
Molecula Sciences
ISSN 1422-0067
www.mdpi.com/jou nal/ijms
A icle
Polymodal T ansien Recep o Po en ial Vanilloid (TRPV) Ion
Channels in Chond ogenic Cells
Csilla Szűcs Somogyi 1,*, Csaba Ma a 1,2, Zso ia Fold a i 1, Tamás Juhász 1, É a Ka ona 1,
Ádám Roland Takács 1, Tibo Hajdú 1, Nó a Dob osi 1, Pál Ge gely 3 and Róza Zákány 1,*
1 Depa men o Ana omy, His ology and Emb yology, Facul y o Medicine, Uni e si y o Deb ecen,
Deb ecen H-4032, Hunga y; E-Mails: ma [email protected] (C.M.);
[email p o ec ed] (Z.F.); [email p o ec ed]ed.unideb.hu (T.J.);
[email p o ec ed] (E.K.); akacs. [email protected] (A.R.T.);
[email p o ec ed] (T.H.); dob osi.no [email protected] (N.D.)
2 Depa men o Ve e ina y P eclinical Sciences, School o Ve e ina y Medicine,
Facul y o Heal h and Medical Sciences, Uni e si y o Su ey, Guild o d, Su ey GU2 7XH, UK
3 Cell Biology and Signalling Resea ch G oup o he Hunga ian Academy o Sciences,
Depa men o Medical Chemis y, Resea ch Cen e o Molecula Medicine, Facul y o Medicine,
Uni e si y o Deb ecen, Deb ecen H-4032, Hunga y; E-Mail: [email p o ec ed]
* Au ho s o whom co espondence should be add essed;
E-Mails: [email p o ec ed] (C.S.S.); oza@ana .med.unideb.hu (R.Z.);
Tel.: +36-52-255-567 (C.S.S. & R.Z.); Fax: +36-52-255-115 (C.S.S. & R.Z.).
Academic Edi o : Alan C. Leona d
Recei ed: 8 May 2015 / Accep ed: 7 July 2015 / Published: 7 Augus 2015
Abs ac : Ma u e and de eloping chond ocy es exis in a mic oen i onmen whe e
mechanical load, changes o empe a u e, osmola i y and acidic pH may in luence cellula
me abolism. Polymodal T ansien Recep o Po en ial Vanilloid (TRPV) ecep o s a e
en i onmen al senso s media ing esponses h ough ac i a ion o linked in acellula
signalling pa hways. In chond ogenic high densi y cul u es es ablished om limb buds o
chicken and mouse emb yos, we iden i ied TRPV1, TRPV2, TRPV3, TRPV4 and TRPV6
mRNA exp ession wi h RT-PCR. In bo h cul u es, a swi ch in he exp ession pa e n o
TRPVs was obse ed du ing ca ilage o ma ion. The inhibi ion o TRPVs wi h he
non-selec i e calcium channel blocke u henium ed diminished chond ogenesis and
caused signi ican inhibi ion o p oli e a ion. Incuba ing cell cul u es a 41 °C ele a ed he
exp ession o TRPV1, and inc eased ca ilage ma ix p oduc ion. When chond ogenic cells
OPEN ACCESS
In . J. Mol. Sci. 2015, 16 18413
we e exposed o mechanical load a he ime o hei di e en ia ion in o ma ix p oducing
chond ocy es, we de ec ed inc eased mRNA le els o TRPV3. Ou esul s demons a e ha
de eloping chond ocy es exp ess a ull pale e o TRPV channels and he swi ch in he
exp ession pa e n sugges s di e en ia ion s age-dependen oles o TRPVs du ing ca ilage
o ma ion. As TRPV1 and TRPV3 exp ession was al e ed by he mal and mechanical
s imuli, espec i ely, hese a e candida e channels ha con ibu e o he ansduc ion o
en i onmen al s imuli in chond ogenic cells.
Keywo ds: mechanical loading; hea s imula ion; ca ilage o ma ion; chond ocy e;
high densi y cul u e; mic omass; TRPV
1. In oduc ion
A icula ca ilage is a unique issue wi h a low densi y o chond ocy es, whe e his sole cell ype is
capable o sec e ing and main aining he abundan ca ilaginous ex acellula ma ix (ECM). Since one
o he key oles o a icula ca ilage is o dis ibu e mechanical load and abso b shock gene a ed du ing
physical ac i i y be ween opposing bones, chond ocy es a e inhe en ly adap ed o he demands imposed
by mechanical s imuli. The e o e, despi e hei low me abolic ac i i y, chond ocy es communica e
ex ensi ely wi h hei en i onmen pa ly h ough he dynamically changing ECM and espond o a ange
o mechanical and biochemical s imuli. A icula ca ilage is a b ady oph issue ha does no con ain
blood essels and is supplied wi h nu ien s pa ially om he syno ial luid lub ica ing i s su ace [1].
In ac , he no mal in e nal milieu o a icula ca ilage migh be ega ded as non-physiological compa ed
o o he issues [2]. Towa ds he subchond al bone, oxygen ension is g adually dec easing o as low as
1%, and lac ic acid, he end p oduc o he anae obic me abolism o chond ocy es, accumula es, esul ing
in a pa icula ly acidic en i onmen wi h pH a ound 6.5 [3]. Ma u e chond ocy es a e well adap ed o
hese condi ions bu a ely p oli e a e once hey became ully ma u e. This un a ou able p ope y o i s
esiden cells mani es s in a e y limi ed capaci y o spon aneous egene a ion o a icula ca ilage in
case o join inju y o degene a ion. Despi e he pa ial unc ional es i u ion (i.e., au ologous chond ocy e
implan a ion, au ologous mesenchymal s em cell ansplan a ion o os eochond al au og a s), none o
he cu en ly a ailable op ions o he epai o damaged ca ilage ha e p o ed o be sa is ac o y so a
in a icula ca ilage issue enginee ing [4]. Clea ly, he e is a s ong need o ob ain mo e in o ma ion
abou he di e en ia ion p ocess o hyaline ca ilage o imp o e ou knowledge o cell-based he apies
in he ield o ca ilage egene a ion.
Du ing join mo emen s, a icula issues a e exposed o shea and comp essi e s ess; hese
mechanical s imuli a e impo an no only in he ma u e issue, bu hey a e also indispensable o he
de elopmen o bo h he a icula su ace and he unde lying zones. Fo ins ance, lack o mechanical
s imula ion du ing in i o chond ogenesis o mesenchymal s em cells commonly leads o e minal
hype ophy o chond ocy es [5]. App op ia e equency and s eng h o he mechanical load a e also
essen ial o ma u e chond ocy es o main ain p ope lub ica ion, nou ishmen and emo al o me abolic
was e p oduc s ia he syno ial luid [1,2,6].
In . J. Mol. Sci. 2015, 16 18414
In ensi e physical ac i i ies may cause local ele a ion o empe a u e in a icula issues; howe e ,
li le is known abou he impac o empe a u e change on ca ilage. P i che desc ibed ha in a no mal
hip join he empe a u e o syno ial luid gene ally inc eases 1 °C a e 20 min and 2 °C a e 60 min
o walking, al hough o he ac o s, such as body mass, age, exe cise ype and in ensi y ha e no been
aken in o conside a ion [7–9]. Al hough his is a ela i ely unde s udied a ea and a ailable da a a e
limi ed, we can assume ha hea may al e he me abolic ac i i y o chond ocy es oge he wi h he
mechanical p ope ies o he ECM [10–12].
Va ious plasma memb ane ecep o s and ion channels a e implica ed o be esponsible o media ing
en i onmen al s imuli in a icula chond ocy es [13–15]. Polymodal T ansien Recep o Po en ial
Vanilloid (TRPV) ion channels a e p omising candida es o ansduce di e se s imuli ( he mal, mechanical
s ess, acidi y and aniso-osmola i y) o chond ocy es. These channels a e cha ac e ised by six pu a i e
ansmemb ane spans (TM) and a ca ion-pe meable po e egion be ween TM5 and TM6. The NH2 and
COOH e mini a e loca ed in acellula ly, a y in leng h, and con ain di e en numbe s o unc ional
domains and mo i s. These ion channels, assembled as homo- o he e o e ame s, a e sensi i e o a
ema kable ange o s imuli [16,17].
Se e al s udies epo ed he p esence o ce ain TRPVs in syno ial join s. Acco ding o Szabo and
his colleagues, TRPV1 has a ole in he de elopmen o ch onic a h i is [18]. Eigh channels o he TRP
supe amily, including TRPV1, ha e been iden i ied in os eoa h i ic ca ilage issue samples [19].
Exp ession o o he anilloid ecep o s, such as TRPV4, TRPV5 and TRPV6, has also been epo ed
in a icula chond ocy es [20]. The ole o TRPV4 in ca ilage is o pa icula in e es , since his
channel seems o be a posi i e egula o o Sox9, a mas e gene o chond ogenic di e en ia ion [21];
gain-o - unc ion mu a ions o his ion channel can cause se e e musculoskele al diseases [22,23] and i
seems o be in ol ed in media ing he me abolic ac i i ies o ma u e ca ilage [24].
This s udy desc ibes he p esence and possible unc ions o TRPV ecep o s du ing in i o
chond ogenesis. We applied a ian and mu ine high densi y cul u es, whe ein spon aneous ca ilage
di e en ia ion occu s. These models display he physiological cou se o chond ogenesis, du ing which
limb bud-de i ed chond op ogeni o mesenchymal cells unde go condensa ion and nodule o ma ion
and di e en ia e in o chond oblas s and chond ocy es, p oducing and sec e ing ca ilage-speci ic ECM
componen s including collagen ype II and agg ecan. We iden i ied se e al anilloid ecep o s a mRNA
le el and analysed hei exp ession pa e n a e he mal and mechanical s imula ion. Based on ou
esul s, we p opose ha he p esence and p ecise egula ion o hei exp ession pa e n may play a ole
du ing ca ilage o ma ion.
2. Resul s
2.1. mRNA Exp ession P o iling o TRPV Ion Channels in Chicken and Mouse Tissue Samples
Fi s , we sc eened he mRNA exp ession o all ypes o anilloid ecep o s in chicken and mouse
ca ilage samples aken om chicken emb yonic limb buds (LB), one-day-old, young chicken a icula
ca ilage (YAC), adul a icula ca ilage (AAC), mouse emb yonic limb buds (LB), wo-day-old, young
mouse a icula ca ilage (YAC), adul mouse a icula ca ilage (AAC). The designed p ime pai s we e
es ed in posi i e con ol issues such as b ain and kidney (Figu e S1). As he chicken TRPV5 sequence
In . J. Mol. Sci. 2015, 16 18415
was no a ailable in GenBank, we we e unable o design speci ic p ime pai s (Table 1). As seen in
Figu e 1, mRNAs o almos all TRPVs we e ound o be exp essed in bo h chicken and mouse dis al
limb buds (LB), whe e he majo i y o he cells a e chond op ogeni o cells. The age o he analysed
limb bud issues was iden ical o hose om which mic omass cell cul u es a e es ablished. In he
a icula ca ilage o young animals (one o wo-day-old animals; YAC; Figu e 1), whe e he dominan
cell ypes a e young and s ill p oli e a ing chond ocy es, he exp ession spec um o TRPVs seemed o
dec ease. An e en na owe subse o TRPV mRNAs was de ec able in a icula ca ilage samples o
adul animals (AAC; Figu e 1) in which a well-de eloped zonal a chi ec u e and ma u e, non-di iding
chond ocy es a e p esen [25].
Figu e 1. Con en ional PCR analysis o TRPV exp ession in chicken (ch) and mouse (m)
issue samples. TRPV mRNA exp ession was moni o ed in chicken and mouse limb buds
(LB), a icula ca ilage de i ed om young (YAC), and adul animals (AAC). Glyce aldehyde
3-phospha e dehyd ogenase (GAPDH) was used as an in e nal con ol. Chicken TRPV5
exp ession was no analysed due o unknown sequence da a. Rep esen a i e da a o h ee
independen expe imen s.
In . J. Mol. Sci. 2015, 16 18416
Table 1. Nucleo ide sequences, ampli ica ion si es, GenBank accession numbe s, amplime sizes and PCR eac ion condi ions o each chicken
p ime pai a e shown. * annealing empe a u e (°C).
Chicken Gene P ime P ime Sequences (5′→3′) GenBank Accession No. * Amplime Size (bp)
T ansien Recep o Po en ial
Vanilloid ype 1 (TRPV1_chick)
o wa d TTCGTTCACTCTTTGCTCCTC (1633–1653) NM_204572.1 58 511
e e se TGCTCACAGTTTCTCCCATCA (2143–2123)
T ansien Recep o Po en ial
Vanilloid ype 2 (TRPV2_chick)
o wa d CCCTTGGAGTCACCTTACC (547–565) XM_004946687.1 54 240
e e se CTTCCCAGTCTTTGCATCT (786–768)
T ansien Recep o Po en ial
Vanilloid ype 3 (TRPV3_chick)
o wa d CCCCTCAATTCACTCCTGC (2794–2812) XM_004946676.1 60 591
e e se GGAAAGGCATTCACCACCA (3384–3366)
T ansien Recep o Po en ial
Vanilloid ype 4 (TRPV4_chick)
o wa d TCGCCGAGAAGACGGGAAAC (733–752) NM_204692.1 60 693
e e se GGCGGTTCTCAATCTTGCTGTT (1425–1404)
T ansien Recep o Po en ial
Vanilloid ype 6 (TRPV6_chick)
o wa d CATGTAGCTGCCTTGTATGA (806–825) o (429–448) XM_004938143.1 52 348
e e se TGATCTTGGTCCCTCTTTG (1153–1135) o (875–857) XM_004938142.1 447
Agg ecan co e p o ein
(ACAN_chick)
o wa d CAATGCAGAGTACAGAGA (435–452) NM_204955.2 54 429
e e se TCTGTCTCACGGACACCG (863–846)
Collagen II (COL2A1_chick) o wa d GGACCCAAAGGACAGACGG (1191–1209) NM_204426.1 59 401
e e se TCGCCAGGAGCACCAGTT (1591–1574)
SRY (sex de e mining egion Y)-box
9 (SOX9_chick)
o wa d CCCCAACGCCATCTTCAA (713–730) NM_204281.1 54 381
e e se CTGCTGATGCCGTAGGTA (1093–1076)
Glyce aldehyde 3-phospha e
dehyd ogenase (GAPDH_chick)
o wa d CTGCCCAGAACATCATCCCA (656–675) NM_204305.1 58 366
e e se CACGGTTGCTGTATCCAAACTCAT (1021–998)

In . J. Mol. Sci. 2015, 16 18417
2.2. mRNA Exp ession P o iling o TRPV in Emb yonic Limb Bud-De i ed Mic omass Cul u es
In he ollowing se o expe imen s, we sc eened he mRNA exp ession o a ious TRPVs in high
densi y mic omass cell cul u es (HD). The ad an age o he a ian model o e he mu ine model is
ha i is cos e ec i e and yields highe ini ial cell numbe o he expe imen s. On he o he hand,
he amino acid sequences o TRPV p o eins a e di e en om he mammalian TRPV o hologues
esul ing in di e en esponses o pha macological modula ions. The e o e, we decided o compa e he
mRNA exp ession o chicken and mouse HD cul u es du ing he se en-day-cul u ing (Figu e 2). The
mRNA exp ession pa e n o TRPV4 was he mos dis inc as i exhibi ed a s eady ele a ion in bo h
models. TRPV2 showed a ela i ely cons an exp ession in bo h chicken and mouse HD cul u es. In bo h
expe imen al models TRPV1 and TRPV3 displayed a weake signal owa ds he end o he cul u ing
pe iod. This was consis en in h ee independen chicken and mouse cul u e se ies and also con i med
by o he TRPV1 and TRPV3 p ime s ha we e designed o ampli y di e en sequences. Chicken
TRPV6 p ime pai s ecognised wo ansc ip a ian s wi h wo di e en p oduc leng hs (348 bp o
XM_004938143.1 and 447 bp o XM_004938142.1). Mu ine HD cul u es displayed bo h TRPV5 and
TRPV6 mRNAs whose exp ession pa e n g adually dec eased by he end o he cul u ing pe iod.
(The chicken and mouse TRPV GenBank IDs and he sequences o designed p ime s a e lis ed in
Tables 1 and 2.)
Figu e 2. mRNA exp ession o TRPVs in chicken (ch) and mouse (m) HD cul u es. GAPDH
was applied as an in e nal con ol. Numbe s below gel images ep esen in eg a ed densi ies
o signals de e mined using ImageJ 1.46; da a we e no malised o he alue de ec able on
he ea lies day o cul u ing, i.e., day 0 (1.0) whe e applicable. Chicken TRPV5 exp ession
was no analysed due o unpublished sequence da a. GAPDH was used as an in e nal con ol.
Rep esen a i e da a o h ee independen expe imen s.
In . J. Mol. Sci. 2015, 16 18418
Table 2. Nucleo ide sequences, ampli ica ion si es, GenBank accession numbe s, amplime sizes and PCR eac ion condi ions o each mouse
p ime pai a e shown. * annealing empe a u e (°C).
Mouse Gene P ime P ime Sequences (5′→3′) GenBank
Accession No. * Amplime
Size (bp)
T ansien Recep o Po en ial
Vanilloid ype 1 (TRPV1_mouse)
o wa d CTCTTACAACAGCCTGTATTCC (2130–2151) NM_001001445.2 59 424
e e se ACAGTTGCCTGGGTCCTC (2553–2536)
T ansien Recep o Po en ial
Vanilloid ype 2 (TRPV2_mouse)
o wa d CTTTGCTGTAGCCCTAGTAAGC (2007–2028) NM_011706.2 59 384
e e se CACCACCAGTAACCATTCTCC (2390–2370)
T ansien Recep o Po en ial
Vanilloid ype 3 (TRPV3_mouse)
o wa d AGCAGAACTCCACCTACCC (1998–2016) NM_145099.2 58 296
e e se TTTCCATTCCGTCCACTT (2293–2276)
T ansien Recep o Po en ial
Vanilloid ype 4 (TRPV4_mouse)
o wa d TCTGTCTCGCAAGTTCAAGG (1314–1333) NM_022017.3 59 276
e e se GGCTGATAGTAGGCGGTGA (1589–1571)
T ansien Recep o Po en ial
Vanilloid ype 5 (TRPV5_mouse)
o wa d TCCGAGATGCCAACCGTAC (1108–1126) NM_001007572.2 59 433
e e se GCCATTAGCCAGCAGAAGC (1540–1522)
T ansien Recep o Po en ial
Vanilloid ype 6 (TRPV6_mouse)
o wa d GCTGGCTGATGGCTGTGGT (1773–1791) NM_022413.4 63 456
e e se GGCGGATGCGTTGTCTGTT (2228–2210)
Glyce aldehyde 3-phospha e
dehyd ogenase (GAPDH_mouse)
o wa d TGGCAAAGTGGAGATTGTTG (161–180) NM_001289726.1 58 486
e e se GTCTTCTGGGTGGCAGTGAT (646–627)
In . J. Mol. Sci. 2015, 16 18419
2.3. E ec o Ru henium Red, a Gene al TRPV Inhibi o , on Chond ogenesis
Ru henium ed (RR), a b oad-spec um calcium channel inhibi o , was adminis e ed o 24 h on
di e en days o cul u ing a a concen a ion o 10 µM. We measu ed i s e ec on ma ix p oduc ion and
p oli e a ion. Applica ion o RR on he i s h ee days o cul u ing signi ican ly educed he amoun o
me ach oma ically s ained p o eoglycan- ich ECM (Figu e 3A) and also caused a signi ican decline in
he numbe o p oli e a ing chond ogenic cells (Figu e 3B).
Figu e 3. The e ec o u henium ed (RR) ea men on ca ilage ma ix p oduc ion and
cellula p oli e a ion. (A) The ca ilage ma ix o six-day-old mic omass cul u es we e
s ained wi h acidic dime hyl-me hylene blue (DMMB) a e ea ing he colonies wi h 10 µM
RR o 24 h on days 0, 1, 2 o 3 o cul u ing. Rep esen a i e pho omic og aphs ou o
ou independen expe imen s a e shown. O iginal magni ica ion was 2×. Scale ba , 1 mm.
Op ical densi y (OD625) was de e mined in samples con aining oluidine blue (TB) ex ac ed
wi h 8% HCl dissol ed in absolu e e hanol. Da a a e exp essed as mean ± SEM. As e isks
(**) ep esen signi ican di e ence compa ed o con ol cul u es (** p < 0.01). Displayed
alues a e om one ep esen a i e assay ou o ou independen expe imen s; (B) RR
signi ican ly dec eased cellula p oli e a ion a e (3H-T) in chicken mic omass cul u es.
S a is ically signi ican di e ences a e ma ked by as e isks (** p < 0.01). Da a shown a e
om one ep esen a i e expe imen ou o ou .
In . J. Mol. Sci. 2015, 16 18420
2.4. The E ec o Hea T ea men on Chond ogenesis
Join mo emen s and in lamma ion can aise he local empe a u e in he join s, which may
a ec ca ilage ma ix p oduc ion, cell p oli e a ion and cell me abolism. We aimed o check whe he
hea ea men may in luence ca ilage ma ix p oduc ion in HD cul u es. Ma ix p oduc ion was
app oxima ed wi h me ach oma ic s aining. As seen in Figu e 4A, hea ing o 41 °C signi ican ly
enhanced he amoun o sulpha ed glycosaminoglycans (GAGs) ( o 115% ± 5%). In e es ingly, howe e ,
highe empe a u es did no seem o a ec ca ilage ECM p oduc ion. A sligh dec ease was obse ed in
he case o 45 °C ea ed g oups, bu he mean o 13 independen semi-quan i a i e TB s aining esul s
indica ed non-signi ican change. Nex , we aimed o explo e he exp ession o Sox9, he mas e gene o
chond ogenesis, and he genes encoding ca ilage ECM componen s (i.e., collagen ype II and agg ecan
co e p o ein). Thei ansc ip le els we e moni o ed wi h RT-PCR analysis 90 min a e he hea
ea men . We ailed o de ec any p ominen changes in he mRNA exp essions o hese ma ke s, and
only mode a e al e a ions we e obse ed as seen in Figu e 4B.
Figu e 4. Con .
In . J. Mol. Sci. 2015, 16 18427
modi ica ions, which cause al e a ions in he molecula weigh [60–63]. We also es ed o he an ibodies
agains TRPV3 and TRPV4 in bo h cases, bu showed e y simila esul s, i.e., mul iple bands
(Figu e S4). None heless, he appea ance o mul iple signals does no necessa ily mean ha hese bands
would ep esen non-speci ic signals only, gi en he ac ha he e a e o example pos ansla ional
modi ica ions and splicing a ian s o TRPVs. The bands which appea a highe molecula weigh s
han he p edic ed migh be p esen as he esul o glycosyla ion [45], while he bands ha a e isible a
lowe molecula weigh s han p edic ed (e.g., a ound 75 kDa in case o TPRV4) can ep esen splice
a ian s [64]. O e all, he abo e men ioned p oblems—appea ance o se e al bands, esul ing ei he
om aspeci ic binding, pos - ansla ional modi ica ions, o species di e ences—seem o be gene al in
case o all TRPV wes e n blo s applied in chicken HD cul u es. The e o e, using Wes e n blo ing as he
main app oach o con i m he p esence o TRPV p o eins in chicken chond ogenic cells is challenging.
3.2. The mal and Mechanical S imuli Al e Polymodal TRPV Ion Channel Exp ession in
Mic omass Cul u es
As we ailed o unequi ocally de ec he p esence o TRPV1, 3 and 4 p o eins, we decided o ind
indi ec e idence o he p esence o hese channels. To his end, we aimed o e eal possible connec ions
be ween he al e a ions o he mic oen i onmen su ounding di e en ia ing chond ocy es and TRPV
ecep o s. We ound ha 30 min 41 °C hea s imuli on cul u ing day h ee inc eased cell p oli e a ion
and enhanced me ach oma ic ma ix deposi ion. The e is limi ed da a abou he posi i e e ec o hea
s imula ion on skele al issues, o ins ance, in o o empe a u e manipula ion in luences emb yonic
mo ili y and g ow h o limb issues in he chick [65]. Lo ejoy and his g oup obse ed ha empe a u e
egula es limb leng h in homeo he ms by di ec ly modula ing ca ilage g ow h [66]. They epo ed ha
chond ocy e p oli e a ion and ex acellula ma ix olume s ongly co ela e wi h issue empe a u e in
me a a sals cul u ed wi hou ascula u e in i o [66]. Fu he mo e, Chen and colleagues demons a ed
ha pe iodic hea shock (41 °C o 1 h) accele a ed chond ogenic di e en ia ion o human mesenchymal
s em cells in pelle cul u e [67]. Toge he wi h ou esul s, hese da a clea ly demons a e ha
mode a e empe a u e s imula ions posi i ely in luence ca ilage de elopmen and sugges he ole o
he mosensi i e TRP channels as egula o s o chond ogenesis. While he posi i e e ec o hea
s imula ion in no mal o os eoa h i ic adul a icula ca ilage homeos asis has also been sugges ed by
some labo a o ies [68,69], o he au ho s a gue ha hea ea men alone does no inc ease p o eoglycan
(PG) syn hesis; howe e , in hose cases, he expe imen al condi ions (s imula ion leng h, cul u e sys em
o empe a u e alues) we e di e en om ou s udy [12,70]. Ne e heless, empe a u e is a undamen al
en i onmen al a iable du ing join mo emen and, despi e he ac ha i seems o in luence
chond ogenesis and ca ilage me abolism, i is s ill a ela i ely unde s udied ield a ec ing ca ilage
beha iou [11].
Since TRPVs a e polymodal ion channels ac i a ed by se e al en i onmen al s imuli, we decided o
sc een hei mRNA exp ession pa e n a e hea s imula ion. Al e a ions in he mRNA exp essions o
ce ain TRPV channels seem o be ela ed o he ac i a ion ange o he gi en ion channel. Fo ins ance,
TRPV1 can be cha ac e ised by a empe a u e h eshold a ound 41.5 °C [28,29]. A e he 30 min hea
ea men , TRPV1 exp ession seems o be s ongly modula ed by empe a u es 41 and 43 °C, empe a u e
anges close o equi alen o he ac i a ion h eshold o his channel. TRPV3 wi h an ac i a ion ange o

In . J. Mol. Sci. 2015, 16 18428
a ound 33 °C is he nex anilloid ecep o displaying mode a e mRNA exp ession changes, whe eas
TRPV4, whose ac i a ion is close o oom empe a u e, seems o be less a ec ed by he hea s imulus.
TRPV2 (≥52 °C), whose ac i a ion ange is a om he applied s imulus, o hea shock p o eins display
no changes in hei mRNA exp ession pa e ns. I migh be he case ha du ing he hea s imulus ce ain
enhance s in luence he exp ession o hea sensi i e TRPVs [71]. I is wo h men ioning ha he
ac i a ion h eshold o TRPV1 can change unde ce ain ambien condi ions, such as low pH o he
mic oen i onmen . Du ing in lamma ion o in he deepe zones o a icula ca ilage, he acidic
mic oen i onmen migh lead o he ac i a ion and sensi isa ion o TRPV1 channel a lowe
empe a u es [59]. In ac , he he e ome ic assembly and he high edundancy be ween TRPVs migh
explain why he gene ic dele ion o ce ain TRPVs does no esul in signi ican de ici in he
animals [72].
The e is accumula ing da a abou TRPVs [73,74], and especially abou TRPV1, sugges ing hei
ole in cell p oli e a ion. In ce ain cases TRPV1 s imula ion igge s p oli e a ion [75,76], bu
o e ac i a ion o TRPV1 ion channels and he esul ing inc eased calcium in lux can be oxic o he
cells [77]. Ne e heless, he applied hea s imuli did no exe any oxic e ec in ou expe imen s. As
he TRPV1 mRNA exp ession dec eased in case o he 45 °C g oups compa ed o he o he cul u es,
he al e ed p esence o unc ion o TRPV1 could accoun o he dec eases in p oli e a ion and
me ach oma ic s aining.
P ope mechanical load is essen ial o he heal hy s uc u e o a icula ca ilage in oe al and ma u e
syno ial join s [14,15,78,79]. As a esul o join load he e a e luc ua ions in he osmo ic en i onmen
o chond ocy es elici ing calcium in lux h ough mechanosensi i e ion channels [80]. TRPV4 can ac as
a mechano- and osmosenso in a icula chond ocy es, and i is also ega ded as a egula o o
chond ogenic di e en ia ion [81,82]. Acco dingly, we in es iga ed he mRNA exp ession pa e n o
TRPV ion channels in mechanically loaded HD cul u es. Su p isingly, only he mRNA exp ession o
TRPV3 ose signi ican ly a e mechanical load. The e a e no a icles desc ibing i TRPV3 is linked o
mechano ansduc ion o cells, howe e , we ind i in e es ing ha he mRNA o TRPV3 inc eased
signi ican ly, compa ed o he es o he ion channels. Some a icles men ion ha he mechanical s e ch
inhibi s adipogenesis and s imula es os eogenesis o adipose s em cells [83,84], ano he s udy desc ibes
ha TRPV3 channel ac i a ion supp esses adipogenesis [85]. Since he mesenchymal cells in he
mic omass cul u es ha e he po en ial o di e en ia e owa ds he os eogenic, chond ogenic and
adipogenic lineages [86], i migh be he case ha he e is a connec ion be ween mechanical s imula ion
and adipogenesis h ough TRPV3 mRNA up egula ion.
Ou esul s e lec on he di e si y o he exp essed TRPV channels in de eloping chond ocy es and
p o ide e idence o hei unc ionali y du ing in i o chond ogenesis. Clea ly, u he in es iga ions a e
equi ed o p o e hei ole du ing in i o ca ilage o ma ion and main enance. None heless, he
polymodal na u e o hei ac i a ion and he possibili y o he e o e ame o ma ion inc ease he
di icul ies and he complexi y o hei in es iga ion.
In . J. Mol. Sci. 2015, 16 18429
4. Expe imen al Sec ion
4.1. Tissue Sample Collec ion
Limb buds we e collec ed om ou -day-old chicken emb yos a e Ross hyb id chicken eggs we e
incuba ed in a comme cial ha che a 39 °C, unde 85% humidi y in ou labo a o y. Tissue samples om
eshly ha ched chicks and om chickens o 12 weeks o age we e kindly p o ided by he labo a o y o
János Oláh (Cen e o Ag icul u al Sciences, Uni e si y o Deb ecen, Deb ecen, Hunga y). Animals
we e ea ed acco ding o he egula ions de ined in he licence ob ained om he Uni e si y o
Deb ecen, Commi ee o Animal Resea ch (XXVI-KÁT/2013) and we e sac i iced by ce ical
disloca ion. Fo mouse limb bud-de i ed HD cul u es NMRI (Na al Medical Resea ch Ins i u e)
labo a o y s ain mice we e ma ed o e nigh and ma ing was con i med by he p esence o a aginal
plug (conside ed as day 0 o ges a ion). On day 11.5 o ges a ion, mouse emb yos we e emo ed om
he u e ine ho ns, washed in s e ile calcium and magnesium- ee phospha e bu e ed saline (CMF-PBS)
se e al imes, and hen he dis al limb buds we e ha es ed. Tissue samples om wo-day-old and
12-week-old mice we e also collec ed. As he issues/o gans (limb buds, a icula ca ilage om knee
join s) we e emo ed hey we e immedia ely snap ozen in liquid ni ogen and s o ed a −80 °C un il
use. Animals we e ea ed acco ding o he egula ions de ined in he licence ob ained om he
Uni e si y o Deb ecen, Commi ee o Animal Resea ch (11/2010/DE MÁB) and we e sac i iced by
ce ical disloca ion.
4.2. Chicken and Mouse HD P ime Cell Cul u es
Chicken and mouse HD cul u es we e p epa ed as desc ibed p e iously [13,87]. B ie ly, dis al pa s
o ou -day-old Ross hyb id chicken emb yo limb buds (Hambu ge -Hamil on s ages 22–24) we e
isola ed and diges ed wi h 0.25% ypsin-EDTA (Sigma-Ald ich, S . Louis, MO, USA; pH 7.4)
solu ion a 37 °C o one hou . A e e mina ing diges ion wi h an equal amoun o oe al bo ine
se um (FBS; Gibco, Gai he sbu g, MD, USA), cells we e il e ed h ough a 20-μm plas ic il e uni
(Millipo e, Bille ica, MA, USA) and seeded on o he su ace o cell cul u e dishes a a concen a ion o
1.5 × 107 cells/mL. These chond i ying mesenchymal cells we e allowed o a ach o he su ace o
wo hou s, and hen we e g own in Ham’s F12 medium (Sigma-Ald ich) supplemen ed wi h 10% FBS
and kep a 37 °C in a CO2 incuba o (5% CO2 and 80% humidi y). The medium was changed on e e y
second day o a e ea men s. The day o seeding was conside ed as day 0. Fo some colonies,
u henium ed (RR) (Sigma-Ald ich) as a gene al TRPV inhibi o was added o he medium on ce ain
cul u ing days o a single 24 h applica ion a a inal concen a ion o 10 μM (s ock: 10 mM dissol ed
in wa e ).
Mouse HD cul u es we e es ablished om cells ob ained om he dis al limb buds o 11.5-day-old
NMRI labo a o y mouse emb yos. The isola ion and cul u ing o hese HD cul u es we e simila o
chicken HD cul u es wi h mino modi ica ions [86,88,89].
In . J. Mol. Sci. 2015, 16 18430
4.3. mRNA Exp ession Analysis Followed by Re e se T ansc ip ion Polyme ase Chain Reac ion
Tissue samples, HD colonies om each day o cul u ing ( om day 0 o day 6), as well as con ol and
hea s essed cul u es on he 3 d day o cul u ing we e collec ed, ozen in liquid ni ogen, and s o ed a
−80 °C un il use. Then samples we e dissol ed in TRIzol (Applied Biosys ems, Fos e Ci y, CA, USA),
and ollowing addi ion o 20% RNase- ee chlo o o m (Sigma-Ald ich) samples we e cen i uged a
10,000× g o 15 min a 4 °C. To al RNA-con aining samples we e incuba ed in 500 μL RNase- ee
isop opanol a −20 °C o 1 h, o al RNA was dissol ed in nuclease- ee wa e (P omega, Madison, WI,
USA) and s o ed a −80 °C [86,87].
The assay mix u e o e e se ansc ip ase eac ions con ained 1000 ng RNA, 1 μL RNase inhibi o
0.8 µL 25× dNTP Mix (100 mM), 2 μL RT andom p ime s, 1 μL Mul iSc ibe Re e se T ansc ip ase,
2 μL 10× RT Bu e illed up o 20 μL wi h Nuclease F ee Wa e (P omega) (High Capaci y RT ki ;
Applied Biosys ems). cDNA was ansc ibed a 37 °C o 2 h.
Ampli ica ion o speci ic cDNA sequences was ca ied ou using speci ic p ime pai s designed by
P ime P emie 5.0 so wa e (P emie Bioso , Palo Al o, CA, USA) based on chicken and mouse
nucleo ide sequences published in GenBank. P ime s we e o de ed om In eg a ed DNA Technologies,
Inc. (IDT; Co al ille, IA, USA). The speci ici y o cus om-designed p ime pai s was con i med
in silico by using he P ime -BLAST se ice o NCBI. Nucleo ide sequences o o wa d and e e se
p ime s and eac ion condi ions a e shown in Tables 1 and 2. Ampli ica ions we e pe o med by GoTaq
DNA Polyme ase (P omega) acco ding o he manu ac u e ’s p o ocol in a Labne Mul iGene™ 96-well
G adien The mal Cycle (Labne In e na ional, Edison, NJ, USA), as ollows: ini ial dena u a ion o
2 min a 95 °C, ollowed by 35 cycles (dena u a ion o 30 s a 95 °C, p ime speci ic annealing
empe a u e o 30 s, ex ension o 30 s a 72 °C) and hen 5 min o inal ex ension a 72 °C. PCR
p oduc s we e analysed by elec opho esis in 1.2% aga ose gel con aining e hidium b omide. Finally,
op ical densi y o PCR p oduc signals was de e mined by using ImageJ eewa e (Image P ocessing
and Analysis in Ja a, NIH, Be hesda, MD, USA) e sion1.46.
4.4. Hea T ea men o Chicken HD Cul u es
Chicken HD cul u es we e incuba ed a 41, 43 and 45 °C o 30 min on he 3 d day o cul u ing.
Samples we e aken o RT-PCR a di e en ime pe iods: 0, 30, 60, 90, 180 and 240 min and one day
(24 h) a e he hea shock. On he 6 h day o cul u ing, hese colonies we e s ained wi h DMMB
and TB.
4.5. Assessmen o Chond ogenic Di e en ia ion by Me ach oma ic S aining
Fo he quali a i e and semi-quan i a i e e alua ion o ca ilage ma ix p oduc ion, six-day-old cell
cul u es om di e en expe imen al g oups (hea ea ed and mechanically loaded g oups) we e s ained
wi h DMMB (pH 1.8; Sigma-Ald ich) and wi h TB (pH 2; Reanal, Budapes , Hunga y) me ach oma ic
dyes as p e iously desc ibed [13,90]. Mic opho og aphs o me ach oma ic ca ilaginous nodules we e
aken wi h an Olympus DP72 came a on a Nikon Eclipse E800 mic oscope; image acquisi ion was
pe o med by Spo Ad anced so wa e ( e sion 4.6; Diagnos ic Ins umen s, Inc., Bu oughs, S e ling
In . J. Mol. Sci. 2015, 16 18431
Heigh s, MI, USA). Op ical densi y o ex ac ed TB o di e en expe imen al g oups was de e mined in
h ee cul u es o each expe imen al g oup in 13 independen expe imen s.
4.6. Measu ing Cell P oli e a ion wi h 3H-Thymidine Labelling and Mi ochond ial Ac i i y
wi h MTT Assay
3H- hymidine inco po a ion se es as a me hod o de e mining he a e o cell p oli e a ion.
Immedia ely a e hea s ess on he 3 d day o cul u ing medium con aining 1 mCi/mL 3H- hymidine
(dilu ed om me hyl-3H- hymidine; 185 GBq/mmol; Ame ican Radiolabeled Chemicals, Inc., S . Louis,
MO, USA) was added o he cell cul u es o a 16-hou -long pe iod. In he case o 24-hou -long
u henium ed ea men 3H- hymidine was kep on he colonies o 24 h. A e washing wice wi h
phospha e bu e ed saline (PBS), p o eins we e p ecipi a ed wi h ice-cold 5% ichlo oace ic acid,
washed wi h PBS again and placed in o special, opaque 96 well mic o i e pla es (Wallac, Pe kinElme
Li e and Analy ical Sciences, Shel on, CT, USA). Then hese pla es we e placed in o an exsicca o
con aining phospho ous pen oxide in o de o abso b mois u e. P io o measu emen s, 50 µL
scin illa ion solu ion (Maxiligh ; Hidex, Tu ku, Finland) was added o each well and adioac i i y was
measu ed by a liquid scin illa ion coun e (Chameleon; Hidex, Tu ku, Finland). Da a shown o hea
ea men a e he a e age o se en independen expe imen s; o RR ea men , da a o one ep esen a i e
expe imen is shown ou o ou .
Fo he in es iga ion o cellula iabili y mi ochond ial ac i i y was de ec ed wi h MTT-assays
pe o med immedia ely a e hea shock on day 3, as i was desc ibed p e iously [90]. Th ee-day-old
HD cul u es ha had no ecei ed hea s ess we e used as con ols. Measu emen s we e ca ied ou in
ou samples o each expe imen al g oup in se en independen expe imen s. The esul s we e s a is ically
analysed wi h S uden ’s - es .
4.7. Mechanical Loading o HD Cul u es
Chicken HD cul u es g own in six-well pla es we e subjec ed o uniaxial cyclic comp essi e o ce
(0.05 Hz, 600 Pa) on cul u ing days wo and h ee o 30 min using a cus om-made mechanical s imula o
uni . Fo a de ailed desc ip ion o he s imula o uni please see Juhasz e al. [15]. Mechanical s imula ion
was ca ied ou on bo h cul u ing days wo and h ee o 30 min in a CO2 incuba o (37 °C, 5% CO2,
80% humidi y). Con ol cul u es we e g own unde iden ical cul u e condi ions wi hou mechanical
s imula ion. Mechanically s imula ed samples we e collec ed o PCR analysis.
4.8. S a is ical Analysis
S a is ical signi icance o di e ences was e alua ed using S uden ’s - es . Di e ences we e
conside ed signi ican when p was less han 0.05 o 0.01 and ma ked by as e isks * (i p < 0.05) o
** (i p < 0.01) on he g aphs. Resul s a e exp essed as mean ± SEM alues.
5. Conclusions
In summa y, we p o ed ha bo h chicken and mouse p ima y chond ogenic cells exp ess nea ly he
ull pale e o TRPV ion channels. A swi ch in he mRNA exp ession o TRPV1 and TRPV4 du ing he
In . J. Mol. Sci. 2015, 16 18432
cou se o chond ogenesis sugges s a dis inc ole o hese channels in young and ma u e chond ocy es.
Non-selec i e inhibi ion o TRPV ecep o s wi h RR esul ed in a enua ed ca ilage o ma ion and cell
p oli e a ion. The he mo- and mechanosensi i e ion channels TRPV1 and TRPV3 esponded wi h an
al e ed mRNA exp ession o hea and/o mechanical s imula ion, espec i ely, e lec ing on he
unc ionali y o he exp essed ecep o s. Conside ing he high sequence and unc ional simila i y, he
possibili y o he e o e ame o ma ion, and ha mul iple TRPVs a e exp essed by bo h undi e en ia ed
and ma u e chond ocy es, a simul aneous analysis o he TRPV amily membe s in u u e s udies o
ca ilage o ma ion is p oposed.
Supplemen a y Ma e ials
Supplemen a y ma e ials can be ound a h p://www.mdpi.com/1422-0067/16/08/18412/s1.
Acknowledgmen s
The au ho s hank K isz ina Bí ó o he excellen and p ecise echnical wo k. The au ho s would like
o exp ess hei g a i ude o he Head o he Depa men and all colleagues o he Depa men . We uly
app ecia e ha Oláh János (Cen e o Ag icul u al Sciences, Uni e si y o Deb ecen) gene ously
p o ided he chicken issue samples. We a e also e y g a e ul o Nicolai Miosge o his inspi ing suppo .
Csaba Ma a is suppo ed by he Eu opean Union h ough a Ma ie Cu ie In a-Eu opean Fellowship
o ca ee de elopmen (p ojec numbe : 625746; ac onym: CHONDRION; FP7-PEOPLE-2013-IEF).
Tamás Juhász was suppo ed by Szodo ay Lajos Fund, Bólyai János Schola ship and by he Eu opean
Union and he S a e o Hunga y, co- inanced by he Eu opean Social Fund in he amewo k o
TÁMOP 4.2.4. A/2-11-1-2012-0001 “Na ional Excellence P og am”. Csilla Szűcs Somogyi, Csaba Ma a,
Tamás Juhász and Róza Zákány a e suppo ed by GOP-1.1.1-11-2012-0197 by he Hunga ian go e nmen
and he EU. Csilla Szűcs Somogyi was also co- inanced by he TÁMOP-4.2.2/B-10/1-2010-0024 and
Zso ia Fold a i by he TÁMOP-4.2.4.A/2-11/1-2012-0001 “Na ional Excellence P og am”. The p ojec
is co- inanced by he Eu opean Union and he Eu opean Social Fund.
Au ho Con ibu ions
Csilla Szűcs Somogyi designed and pe o med he expe imen s, analyzed he da a and w o e he
pape ; Csaba Ma a designed he expe imen s and w o e he pape ; Tamás Juhász pa icipa ed in
expe imen al design and da a analysis; Csilla Szűcs Somogyi, Zso ia Fold a i, Tibo Hajdú and
Nó a Dob osi pe o med he expe imen s; É a Ka ona and Ádám Roland Takács analyzed he da a;
Pál Ge gely con ibu ed analysis ools; Róza Zákány concei ed and designed he expe imen s, ook pa
in da a analysis and w o e he pape .
Con lic s o In e es
The au ho s decla e no con lic o in e es .

In . J. Mol. Sci. 2015, 16 18433
Abb e ia ions
AAC, adul a icula ca ilage; YAC, young a icula ca ilage; CREB, cAMP esponse
elemen -binding p o ein; CMF-PBS, calcium and magnesium- ee phospha e bu e ed saline;
DMMB, dime hyl-me hylene blue; ECM, ex acellula ma ix; FBS, oe al bo ine se um; GAG,
glycosaminoglycan; GAPDH, glyce aldehyde 3-phospha e dehyd ogenase; HSP, hea shock p o ein;
HD, high densi y; LB, limb bud; MTT, 3-(4,5-dime hyl hiazol-2-yl)-2,5-diphenyl e azolium b omide;
NMRI, Na al Medical Resea ch Ins i u e; PBS, phospha e bu e ed saline; NMDA, N-me hyl-D-aspa a e;
PG, p o eoglycan; PKA, p o ein kinase A; RR, u henium ed; TB, oluidine blue; TRPV, ansien
ecep o po en ial ecep o anilloid; TM, ansmemb ane.
Re e ences
1. Ba e -Jolley, R.; Lewis, R.; Fallman, R.; Mobashe i, A. The eme ging chond ocy e channelome.
F on . Physiol. 2010, 1, 135.
2. Lee, R.B.; U ban, J.P. E idence o a nega i e pas eu e ec in a icula ca ilage. Biochem. J. 1997,
321, 95–102.
3. B ucke , P.U.; Izzo, N.J.; Chu, C.R. Tonic ac i a ion o hypoxia-inducible ac o 1α in a ascula
a icula ca ilage and implica ions o me abolic homeos asis. A h i is Rheum. 2005, 52,
3181–3191.
4. Olde shaw, R.A. Cell sou ces o he egene a ion o a icula ca ilage: The pas , he ho izon and
he u u e. In . J. Exp. Pa hol. 2012, 93, 389–400.
5. G ad, S.; Eglin, D.; Alini, M.; S odda , M.J. Physical s imula ion o chond ogenic cells in i o:
A e iew. Clin. O hop. Rela . Res. 2011, 469, 2764–2772.
6. B owning, J.A.; Saunde s, K.; U ban, J.P.; Wilkins, R.J. The in luence and in e ac ions o
hyd os a ic and osmo ic p essu es on he in acellula milieu o chond ocy es. Bio heology 2004,
41, 299–308.
7. Tepic, S.; Maci owski, T.; Mann, R.W. Expe imen al empe a u e ise in human hip join in i o
in simula ed walking. J. O hop. Res. 1985, 3, 516–520.
8. P i che , J. Hea gene a ed by hip esu acing p os heses: An in i o pilo s udy. J. Long Te m. E .
Med. Implan s 2011, 21, 55–62.
9. Fialho, J.C.; Fe nandes, P.R.; Eca, L.; Folgado, J. Compu a ional hip join simula o o wea and
hea gene a ion. J. Biomech. 2007, 40, 2358–2366.
10. Usuba, M.; Miyanaga, Y.; Miyakawa, S.; Maeshima, T.; Shi asaki, Y. E ec o hea in inc easing
he ange o knee mo ion a e he de elopmen o a join con ac u e: An expe imen wi h an animal
model. A ch. Phys. Med. Rehabil. 2006, 87, 247–253.
11. June, R.K.; Fyh ie, D.P. Tempe a u e e ec s in a icula ca ilage biomechanics. J. Exp. Biol. 2010,
213, 3934–3940.
12. I o, A.; Aoyama, T.; Iijima, H.; Nagai, M.; Yamaguchi, S.; Tajino, J.; Zhang, X.; Akiyama, H.;
Ku oki, H. Op imum empe a u e o ex acellula ma ix p oduc ion by a icula chond ocy es. In .
J. Hype h. 2014, 30, 96–101.
In . J. Mol. Sci. 2015, 16 18434
13. Ma a, C.; Fodo , J.; Szijgya o, Z.; Juhasz, T.; Ge gely, P.; Cse noch, L.; Zakany, R. Cy osolic ee
Ca2+ concen a ion exhibi s a cha ac e is ic empo al pa e n du ing in i o ca ilage di e en ia ion:
A possible egula o y ole o calcineu in in Ca-signalling o chond ogenic cells. Cell Calcium 2008,
44, 310–323.
14. OʼCono , C.J.; Case, N.; Guilak, F. Mechanical egula ion o chond ogenesis. S em Cell Res. The .
2013, 4, 61.
15. Juhasz, T.; Ma a, C.; Somogyi, C.; Ka ona, E.; Takacs, R.; Soha, R.F.; Szabo, I.A.; Cse ha i, C.;
Szody, R.; Ka acsonyi, Z.; e al. Mechanical loading s imula es chond ogenesis ia he PKA/
CREB-Sox9 and PP2A pa hways in chicken mic omass cul u es. Cell Signal. 2014, 26, 468–482.
16. V iens, J.; Appendino, G.; Nilius, B. Pha macology o anilloid ansien ecep o po en ial ca ion
channels. Mol. Pha macol. 2009, 75, 1262–1279.
17. Vennekens, R.; Owsianik, G.; Nilius, B. Vanilloid ansien ecep o po en ial ca ion channels:
An o e iew. Cu . Pha m. Des. 2008, 14, 18–31.
18. Szabo, A.; Helyes, Z.; Sando , K.; Bi e, A.; Pin e , E.; Neme h, J.; Ban olgyi, A.; Bolcskei, K.;
Elekes, K.; Szolcsanyi, J. Role o ansien ecep o po en ial anilloid 1 ecep o s in adju an -induced
ch onic a h i is: In i o s udy using gene-de icien mice. J. Pha macol. Exp. The . 2005, 314, 111–119.
19. Ga enis, K.; Schumache , C.; Schneide , U.; Eis eld, J.; Mollenhaue , J.; Schmid -Rohl ing, B.
Exp ession o ion channels o he TRP amily in a icula chond ocy es om os eoa h i ic pa ien s:
Changes be ween na i e and in i o p opaga ed chond ocy es. Mol. Cell. Biochem. 2009, 321, 135–143.
20. Hdud, I.M.; El-Sha ei, A.A.; Loughna, P.; Ba e -Jolley, R.; Mobashe i, A. Exp ession o ansien
ecep o po en ial anilloid (TRPV) channels in di e en passages o a icula chond ocy es. In . J.
Mol. Sci. 2012, 13, 4433–4445.
21. Mu ama su, S.; Wakabayashi, M.; Ohno, T.; Amano, K.; Ooishi, R.; Sugaha a, T.; Shioji i, S.;
Tashi o, K.; Suzuki, Y.; Nishimu a, R.; e al. Func ional gene sc eening sys em iden i ied TRPV4
as a egula o o chond ogenic di e en ia ion. J. Biol. Chem. 2007, 282, 32158–32167.
22. Kang, S.S.; Shin, S.H.; Auh, C.K.; Chun, J. Human skele al dysplasia caused by a cons i u i e
ac i a ed ansien ecep o po en ial anilloid 4 (TRPV4) ca ion channel mu a ion. Exp. Mol. Med.
2012, 44, 707–722.
23. Rock, M.J.; P enen, J.; Funa i, V.A.; Funa i, T.L.; Me iman, B.; Nelson, S.F.; Lachman, R.S.;
Wilcox, W.R.; Reyno, S.; Quad elli, R.; e al. Gain-o - unc ion mu a ions in TRPV4 cause
au osomal dominan b achyolmia. Na . Gene . 2008, 40, 999–1003.
24. Eleswa apu, S.V.; A hanasiou, K.A. TRPV4 channel ac i a ion imp o es he ensile p ope ies o
sel -assembled a icula ca ilage cons uc s. Ac a Bioma e . 2013, 9, 5554–5561.
25. Ko honen, R.K.; Julkunen, P.; Wilson, W.; He zog, W. Impo ance o collagen o ien a ion and
dep h-dependen ixed cha ge densi ies o ca ilage on mechanical beha io o chond ocy es.
J. Biomech. Eng. 2008, 130, 021003.
26. Wagne , M.; He manns, I.; Bi inge , F.; Ki kpa ick, C.J. Induc ion o s ess p o eins in human
endo helial cells by hea y me al ions and hea shock. Am. J. Physiol. 1999, 277, L1026–L1033.
27. Kaa ni an a, K.; Elo, M.; Si onen, R.; Lammi, M.J.; Gold ing, M.B.; E iksson, J.E.; Sis onen, L.;
Helminen, H.J. Hsp70 accumula ion in chond ocy ic cells exposed o high con inuous hyd os a ic
p essu e coincides wi h mRNA s abiliza ion a he han ansc ip ional ac i a ion. P oc. Na l. Acad.
Sci. USA 1998, 95, 2319–2324.
In . J. Mol. Sci. 2015, 16 18435
28. Cao, E.; Co de o-Mo ales, J.F.; Liu, B.; Qin, F.; Julius, D. TRPV1 channels a e in insically hea
sensi i e and nega i ely egula ed by phosphoinosi ide lipids. Neu on 2013, 77, 667–679.
29. Ca e ina, M.J.; Schumache , M.A.; Tominaga, M.; Rosen, T.A.; Le ine, J.D.; Julius, D. The
capsaicin ecep o : A hea -ac i a ed ion channel in he pain pa hway. Na u e 1997, 389, 816–824.
30. G ache a, E.O.; Co de o-Mo ales, J.F.; Gonzalez-Ca cacia, J.A.; Ingolia, N.T.; Manno, C.;
A angu en, C.I.; Weissman, J.S.; Julius, D. Ganglion-speci ic splicing o TRPV1 unde lies in a ed
sensa ion in ampi e ba s. Na u e 2011, 476, 88–91.
31. Pe al a ez-Ma in, A.; Dona e-Macian, P.; Gaude , R. Wha do we know abou he ansien ecep o
po en ial anilloid 2 (TRPV2) ion channel? FEBS J. 2013, 280, 5471–5487.
32. Sha i -Naeini, R.; Dedman, A.; Folge ing, J.H.; Dup a , F.; Pa el, A.; Nilius, B.; Hono e, E. TRP
channels and mechanosenso y ansduc ion: Insigh s in o he a e ial myogenic esponse. P lug. A ch.
2008, 456, 529–540.
33. Ah ens, P.B.; Solu sh, M.; Rei e , R.S. S age- ela ed capaci y o limb chond ogenesis in cell
cul u e. De . Biol. 1977, 60, 69–82.
34. San An onio, J.D.; Tuan, R.S. Chond ogenesis o limb bud mesenchyme in i o: S imula ion by
ca ions. De . Biol. 1986, 115, 313–324.
35. Jo d , S.E.; Julius, D. Molecula basis o species-speci ic sensi i i y o “ho ” chili peppe s. Cell
2002, 108, 421–430.
36. Wach, J.; Ma in-Bu gin, A.; Klusch, A.; Fo s e , C.; Enge , S.; Schwab, A.; Pe e sen, M.
Low- h eshold hea ecep o in chick senso y neu ons is up egula ed independen ly o ne e g ow h
ac o a e ne e inju y. Neu oscience 2003, 117, 513–519.
37. Xu, H.; Blai , N.T.; Clapham, D.E. Campho ac i a es and s ongly desensi izes he ansien
ecep o po en ial anilloid sub ype 1 channel in a anilloid-independen mechanism. J. Neu osci.
2005, 25, 8924–8937.
38. Dona e-Macian, P.; Pe al a ez-Ma in, A. Dissec ing domain-speci ic e olu iona y p essu e p o iles
o ansien ecep o po en ial anilloid sub amily membe s 1 o 4. PLoS ONE 2014, 9, e110715.
39. Ru e , A.R.; Ma, Q.P.; Le e idge, M.; Bonne , T.P. He e ome iza ion and colocaliza ion o
TRPV1 and TRPV2 in mammalian cell lines and a do sal oo ganglia. Neu o epo 2005, 16,
1735–1739.
40. Hellwig, N.; Alb ech , N.; Ha eneck, C.; Schul z, G.; Schae e , M. Homo- and he e ome ic
assembly o p channel subuni s. J. Cell Sci. 2005, 118, 917–928.
41. Du, J.; Ma, X.; Shen, B.; Huang, Y.; Bi nbaume , L.; Yao, X. TRPV4, TRPC1, and TRPP2 assemble
o o m a low-sensi i e he e ome ic channel. FASEB J. 2014, 28, 4677–4685.
42. Smi h, G.D.; Gun ho pe, M.J.; Kelsell, R.E.; Hayes, P.D.; Reilly, P.; Face , P.; W igh , J.E.;
Je man, J.C.; Walhin, J.P.; Ooi, L.; e al. TRPV3 is a Tempe a u e-sensi i e anilloid
ecep o -like p o ein. Na u e 2002, 418, 186–190.
43. Came on, T.L.; Belluoccio, D.; Fa lie, P.G.; B ach ogel, B.; Ba eman, J.F. Global compa a i e
ansc ip ome analysis o ca ilage o ma ion in i o. BMC De . Biol. 2009, 9, 20.
44. Camacho, N.; K akow, D.; Johnyku y, S.; Ka zman, P.J.; Pepkowi z, S.; V iens, J.; Nilius, B.;
Boyce, B.F.; Cohn, D.H. Dominan TRPV4 mu a ions in nonle hal and le hal me a opic dysplasia.
Am. J. Med. Gene . A 2010, 152A, 1169–1177.
In . J. Mol. Sci. 2015, 16 18436
45. Lamande, S.R.; Yuan, Y.; G essho , I.L.; Rowley, L.; Belluoccio, D.; Kalua achchi, K.;
Li le, C.B.; Bo zenha , E.; Ze es, K.; Amo , D.J.; e al. Mu a ions in TRPV4 cause an inhe i ed
a h opa hy o hands and ee . Na . Gene . 2011, 43, 1142–1146.
46. Phan, M.N.; Leddy, H.A.; Vo a, B.J.; Kuma , S.; Le y, D.S.; Lipshu z, D.B.; Lee, S.H.;
Lied ke, W.; Guilak, F. Func ional cha ac e iza ion o TRPV4 as an osmo ically sensi i e ion
channel in po cine a icula chond ocy es. A h i is Rheum. 2009, 60, 3028–3037.
47. Shibasaki, K.; Mu ayama, N.; Ono, K.; Ishizaki, Y.; Tominaga, M. TRPV2 enhances axon
ou g ow h h ough i s ac i a ion by memb ane s e ch in de eloping senso y and mo o neu ons.
J. Neu osci. 2010, 30, 4601–4612.
48. Mo elli, M.B.; Aman ini, C.; Libe a i, S.; San oni, M.; Nabissi, M. TRP channels: New po en ial
he apeu ic app oaches in cns neu opa hies. CNS Neu ol. Diso d. D ug Ta ge s 2013, 12, 274–293.
49. Le ine, J.D.; Alessand i-Habe , N. TRP channels: Ta ge s o he elie o pain. Biochim. Biophys. Ac a
2007, 1772, 989–1003.
50. Numazaki, M.; Tominaga, M. Nocicep ion and TRP channels. Cu . D ug Ta ge s CNS Neu ol. Diso d.
2004, 3, 479–485.
51. Gau ie , M.; Dhennin-Du hille, I.; Ay, A.S.; Ryba czyk, P.; Ko ichne a, I.; Ouadid-Ahidouch, H.
New insigh s in o pha macological ools o TR(I)P cance up. B . J. Pha macol. 2014, 171, 2582–2592.
52. Waning, J.; V iens, J.; Owsianik, G.; S uwe, L.; Mally, S.; Fabian, A.; F ippia , C.; Nilius, B.;
Schwab, A. A No el unc ion o capsaicin-sensi i e TRPV1 channels: In ol emen in cell
mig a ion. Cell Calcium 2007, 42, 17–25.
53. Ma in, E.; Dahan, D.; Ca doua , G.; Gillibe -Duplan ie , J.; Ma han, R.; Sa ineau, J.P.;
Duc e , T. In ol emen o TRPV1 and TRPV4 channels in mig a ion o a pulmona y a e ial
smoo h muscle cells. P lug. A ch. 2012, 464, 261–272.
54. El Andaloussi-Lilja, J.; Lundq is , J.; Fo sby, A. TRPV1 exp ession and ac i i y du ing e inoic
acid-induced neu onal di e en ia ion. Neu ochem. In . 2009, 55, 768–774.
55. Mo gan, P.J.; Hubne , R.; Rol s, A.; F ech, M.J. Spon aneous calcium ansien s in human neu al
p ogeni o cells media ed by ansien ecep o po en ial channels. S em Cells De . 2013, 22,
2477–2486.
56. Wang, C.; Hu, H.Z.; Col on, C.K.; Wood, J.D.; Zhu, M.X. An al e na i e splicing p oduc o he
mu ine TRPV1 gene dominan nega i ely modula es he ac i i y o TRPV1 channels. J. Biol. Chem.
2004, 279, 37423–37430.
57. Tian, W.; Fu, Y.; Wang, D.H.; Cohen, D.M. Regula ion o TRPV1 by a no el enally exp essed a
TRPV1 splice a ian . Am. J. Physiol. Ren. Physiol. 2006, 290, F117–F126.
58. Eile s, H.; Lee, S.Y.; Hau, C.W.; Log ino a, A.; Schumache , M.A. The a anilloid ecep o splice
a ian VR.5′s blocks TRPV1 ac i a ion. Neu o epo 2007, 18, 969–973.
59. Schumache , M.A.; Eile s, H. TRPV1 splice a ian s: S uc u e and unc ion. F on . Biosci.
(Landma k Ed.) 2010, 15, 872–882.
60. Mis y, S.; Paule, C.C.; Va ga, A.; Pho iou, A.; Jenes, A.; A elino, A.; Buluwela, L.; Nagy, I.
P olonged exposu e o b adykinin and p os aglandin E2 inc eases TRPV1 mRNA bu does no al e
TRPV1 and TRPV1b p o ein exp ession in cul u ed a p ima y senso y neu ons. Neu osci. Le .
2014, 564, 89–93.