Hyalu onan-induced masking o E bB2 and CD44-enhanced as uzumab
in e naliza ion in as uzumab esis an b eas cance
Zsuzsanna Pályi-K ekk1, Má k Ba ok1, Jo ma Isola4, Ma kku Tammi3, János Szöllősi1,2, Pe e
Nagy1*
1Depa men o Biophysics and Cell Biology, 2Cell Biophysics Resea ch G oup o he
Hunga ian Academy o Sciences, Uni e si y o Deb ecen, 1 Egye em sq , H-4010 Deb ecen,
Hunga y
3Depa men o Ana omy, Uni e si y o Kuopio, 70211 Kuopio, Finland
4Ins i u e o Medical Technology, Uni e si y and Uni e si y Hospi al o Tampe e, 33520
Tampe e, Finland
Running i le: Masking o E bB2 by hyalu onan
Keywo ds: E bB2, as uzumab esis ance, CD44, hyalu onan, masking
*Co esponding au ho : Depa men o Biophysics and Cell Biology, Medical and Heal h
Science Cen e , Uni e si y o Deb ecen, 1 Egye em squa e, H-4010 Deb ecen, Hunga y. Tel.:
+36-52-412623, ax: +36-52-532201, email: [email p o ec ed]
2
Abs ac
Al hough as uzumab, a ecombinan humanized an i-E bB2 an ibody, is widely used in he
ea men o b eas cance , nei he i s mechanism o ac ion, no he ac o s leading o
esis ance a e ully unde s ood. We ha e p e iously shown ha an ibody-dependen cellula
cy o oxici y is pi o al in he in i o e ec o as uzumab agains JIMT-1, a cell line showing
in i o esis ance o he an ibody, and sugges ed ha masking o he as uzumab-binding
epi ope by MUC-4, a cell su ace mucin, ook place. He e, we u he explo ed he ole o
masking o E bB2 in connec ion wi h CD44 exp ession and syn hesis o i s ligand,
hyalu onan. We show ha high exp ession o CD44 obse ed in JIMT-1 cells co ela es wi h
E bB2 down egula ion in i o, while siRNA-media ed inhibi ion o CD44 exp ession leads o
dec eased a e o as uzumab in e naliza ion and low cell p oli e a ion in i o. An inhibi o
o hyalu onan syn hesis, 4-me hylumbelli e on (4-MU) signi ican ly educed he hyalu onan
le el o JIMT-1 cells bo h in i o and in i o leading o enhanced binding o as uzumab o
E bB2 and inc eased E bB2 down- egula ion. Fu he mo e, he inhibi o y e ec o
as uzumab on he g ow h o JIMT-1 xenog a s was signi ican ly inc eased by 4-MU
ea men . Ou esul s poin o he impo ance o he CD44-hyalu onan pa hway in he escape
o umou cells om ecep o -o ien ed he apy.
3
In oduc ion
O e exp ession o E bB2 has been unques ionably linked o ad e se p ognosis in b eas
cance .1 E bB2 he e odime izes wi h o he membe s o he E bB amily o ecep o y osine
kinases (RTK) leading o enhanced ligand binding a ini y, p o ec ion om lysosomal
deg ada ion and di e si ied signaling.2 E bB2 is iewed as an non-au onomous, ligand-less,
posi i e egula o o E bB signaling,2 bu i s pa icipa ion in non-E bB p o ein-media ed
signaling is a ac ing mo e and mo e in e es as well. Among hese, β-in eg ins,3 MUC-44
and CD445 a e p obably he bes known candida es whose oles in cance p og ession a e
well documen ed.3,6,7 E bB2 is embedded in o his ne wo k o signaling and accesso y
molecules and by i s p omiscuous associa ion p o ile i p omo es cance p og ession.8
CD44 is ecognized as he majo hyalu onan ecep o ha ing se e al, al e na i ely spliced
iso o ms a ying in hei physiological unc ion.9 Binding o hyalu onan ac i a es CD44-
media ed signal ansduc ion pa hways ia in e ac ions be ween CD44, G b2, Va 2 and
E bB2.10 CD44 is in ol ed in he di ec egula ion o E bB211 and mul iple o he RTKs.12 I
has been sugges ed ha liga ion o CD44 by endogenous hyalu onan leads o he ac i a ion o
he phospha idylinosi ol 3-kinase (PI3K)-Ak su i al pa hway,13 and ha displacemen o
endogenous hyalu onan by exogenous hyalu onan oligosaccha ides dis up s he ac i a ion.12
CD44-media ed cy oskele al ea angemen s ha e been obse ed6 implying he in ol emen
o CD44 in cellula adhesion, mig a ion and in asion.14 CD44 is almos absen in no mal
human b eas epi helial cells, eme ges in benign and p emalignan lesions, and is up egula ed
in ca cinomas.15 Howe e , a ecen s udy sugges ed ha CD44 opposes a he han p omo es
he sp eading o b eas ca cinoma in mice.16
While he ole o CD44 in b eas cance p og ession in i o is no comple ely se led, he
accumula ion o hyalu onan a ound malignan cells o in adjacen s oma has been
unambiguously shown o be an indica o o poo p ognosis in b eas cance .17 In line wi h he
indings on human umou s, hyalu onan syn hesis acili a es he in asi e g ow h o g a ed
umou cells in i o,18 and blocking hyalu onan in e ac ions wi h i s ecep o s, using soluble
CD44 o hyalu onan oligome s, inhibi s umou cell g ow h in expe imen al animals.19
Besides c ea ing signals o p e en apop osis 13, hyalu onan is equi ed o ac i a ion o he
E bB2-E bB3 ecep o leading o he o ma ion o ca diac al es.20 Thus, he e is moun ing
e idence ha E bB2, CD44 and hyalu onan a e connec ed bo h in physiological signaling as
well as cance pa hogenesis h ough mechanisms la gely unknown a p esen .5,11
4
Being a memb ane p o ein and a key membe o su i al and p oli e a ion signaling
pa hways E bB2 is he a ge o ecep o -o ien ed an ibody he apy.21 T as uzumab
(He cep in), a humanized monoclonal an i-E bB2 an ibody, induces objec i e clinical
esponses in 40% o pa ien s as a single agen gi en as i s -line ea men o E bB2-
o e exp essing me as a ic b eas cance .22 Al hough combina ion o as uzumab wi h
con en ional chemo he apy inc eases esponse a es d ama ically, he de elopmen o
esis ance seems cu en ly ine i able.23 Di ec ac ion o as uzumab on E bB2 (e.g. E bB2
down- egula ion, inac i a ion o Ak , inhibi ion o me allop o ease-media ed shedding)24 and
an ibody-dependen cellula cy o oxici y (ADCC)25,26 ha e been in oked o explain he
mechanism o ac ion o as uzumab. Despi e in ense in es iga ions as uzumab esis ance
emains enigma ic and unp edic able in he clinical se ing. P oduc ion o EGF-like g ow h
ac o s,27 loss o PTEN,28 masking o E bB24 and impai ed ADCC eac ion29 ha e all been
sugges ed as possible mechanisms.
In he cu en pape we in es iga ed JIMT-1, a cell line showing in i o esis ance o
as uzumab,30 and ound a high le el o CD44 o e exp ession. We showed p e iously ha
he in i o as uzumab esis ance o he cell line is pa ial, and de elopmen o comple e
as uzumab esis ance akes 5-10 weeks.26 We sugges ed ha masking o E bB2 may be he
culp i .4 Gi en he sugges ed associa ion o CD44 wi h E bB211 we asked whe he CD44
plays any signi ican ole in he su i al o JIMT-1 du ing as uzumab he apy. Using
siRNA-media ed supp ession o CD44 exp ession we showed ha CD44 is necessa y o
as uzumab-induced in e naliza ion o E bB2 and o he su i al o JIMT-1 cells in i o. 4-
me hylumbelli e one (4-MU), a hyalu onan syn hase inhibi o , has been shown o inc ease
he e iciency o chemo he apy.31 We easoned ha hyalu onan may play a ole in masking o
cell su ace E bB2.32 We show ha in i o and in i o ea men wi h 4-MU dec eased he
pe icellula hyalu onan concen a ion in JIMT-1 xenog a s accompanied by inc eased
binding o as uzumab o E bB2. 4-MU ac ed syne gis ically wi h as uzumab in inhibi ing
he p og ession o JIMT-1 umou s. Elucida ion o he ole o CD44 o e exp ession in
as uzumab esis an cell lines may help unde s and he causes o he apeu ic ailu es in
pa ien s wi h his ype o b eas cance .
5
Ma e ials and Me hods
Cells. JIMT-1 cells we e g own in F-12/ DMEM (1:1) supplemen ed wi h 10% FCS, 60
uni s/L insulin and an ibio ics.30 The SKBR-3 cell line was ob ained om he Ame ican Type
Cul u e Collec ion (Rock ille, MD) and g own acco ding o i s speci ica ions.
An ibodies. T as uzumab (He cep in) was pu chased om Roche L d. (Budapes , Hunga y).
Mab 2C4 was a gene ous gi om Genen ech (Sou h San F ancisco, CA). Monoclonal
an ibodies agains E bB2 (E bB2-76.5) and CD44 (He mes-3) we e p oduced om hei
hyb idoma supe na an s (E bB2-76.5 ob ained om Y. Ya den, Weizmann Ins i u e o
Science, Reho o , Is ael; He mes-3 p oduced by he HB-9480 hyb odima ob ained om
ATCC) and pu i ied using p o ein A a ini y ch oma og aphy. He mes-3 was kindly dona ed
by D . Si pa Jalkanen (Uni e si y o Tu ku, Finland). Cy3- and Cy5-conjuga ed goa an i
human IgG (H+L) Fab was ob ained om Jackson ImmunoResea ch Eu ope
(Camb idgeshi e, UK). Conjuga ion o p ima y an ibodies wi h AlexaFluo (Molecula
P obes, Eugene, OR), Cy3 and Cy5 (Ame sham, B aunschweig, Ge many) dyes was ca ied
ou acco ding o he manu ac u e s’ speci ica ions.
Hyalu onan. Highly pu i ied la ge molecula weigh hyalu onan (HA-LMW) wi h an
a e age molecula mass o 1.2×106 Da was dona ed by Genzyme (Camb idge, MA). Pu i ied
hyalu onan decasaccha ides (HA10) we e kindly p o ided by Seikagaku Co po a ion (Tokio,
Japan).
Wes e n blo ing. Whole cell lysa es we e p epa ed in lysis bu e con aining 20 mM T is-
HCl, pH 7.5, 150 mM NaCl, 10% glyce ol, 1 mM EGTA, 1 % T i on X-100, 1 Comple e
Mini (Roche, Mannheim, Ge many) p o ease inhibi o cock ail able /10 mL, 1 mM Na3VO4,
1 mM PMSF, 10 mM NaF, 10 mM β-glyce ol phospha e and 10 mM Na4P2O7.
Immunop ecipi a ion o E bB2 and E bB1 we e ca ied ou wi h Ab3-OP15 an ibody
(Calbiochem-Me ck Biosciences, Schwalbach, Ge many) and F4 (E3138, Sigma,
Schnelldo , Ge many), espec i ely, o 1 h on ice and Sepha ose 4B Fas Flow P o ein G
beads (Sigma). Immunop ecipi a es we e esol ed on SDS-polyac ylamide gels and blo ed o
ni ocellulose memb anes. The ollowing an ibodies we e used o p ima y labelling o he
memb anes a dilu ions sugges ed by he manu ac u e s: Ab3-OP15 o E bB2, F4 o E bB1,
PY99-sc7020 (San a C uz Bio echnology, San a C uz, CA) o phospho y osine and He mes-
6
3 o CD44. Pe oxidase-conjuga ed goa an i-mouse IgG and an enhanced
chemiluminescence ki (Ame sham, F eibu g, Ge many) we e used o de ec ion.
Flow cy ome ic measu emen o cell numbe s and ecep o exp ession le els.
Quan i a i e de e mina ion o ecep o exp ession le els was ca ied ou on a FACSCalibu
low cy ome e (Bec on Dickinson, F anklin Lakes, NJ) using Qi iki (DakoCy oma ion,
Glos up, Denma k) acco ding o he manu ac u e ’s ins uc ions. In p oli e a ion assays cells
we e coun ed wi h a FacsA ay low cy ome e (Bec on Dickinson).
Xenog a umou s. The se e e combined immunode iciency (SCID) C.B-17 scid/scid
mouse popula ion o igina ed om he labo a o y o Fox Chase Cance Cen e , Philadelphia,
PA, and we e housed in a pa hogen- ee en i onmen . Only nonleaky mice wi h mu ine IgG
le els below 100 ng/ml we e used in his s udy. Se en-week old emale SCID mice we e
gi en a single subcu aneous injec ion o 5×106 JIMT-1 cells suspended in 150 μl Hank’s
bu e and mixed wi h an equal olume o Ma igel (Basemen Memb ane Ma igel, BD
Biosciences, Bed o d, MA). Tumou olumes we e calcula ed as he p oduc o he leng h,
wid h and heigh o he umou measu ed once a week wi h a calipe . T as uzumab was
adminis e ed a a dose o 5 μg/g by weekly in ape i oneal (i.p.) injec ion. Con ol mice
ecei ed weekly i.p. injec ion o 100 µl physiologic saline. Animals we e eu hanized by CO2
inhala ion. The expe imen s we e done wi h he app o al o he e hical commi ee o he
Uni e si y o Deb ecen.
4-me hylumbelli e one ea men . 4-me hylumbelli e one (4-MU) (Sigma, Budapes ,
Hunga y), an inhibi o o hyalu onan syn hase, was suspended in 1% a abic gum and
adminis e ed o ally a a dose o 3 mg/g body weigh wice daily.33 Fo in i o expe imen s 4-
MU was dissol ed in PBS and added o he cul u e medium a a concen a ion o 1 mM.
Immunohis ochemis y. Subcu aneous umou s we e emo ed om anes he ized mice,
co e ed wi h Shandon C yoma ix (The mo Elec on Co po a ion, Wal ham, MA) and s o ed
in liquid ni ogen. 20-µm hick as ozen samples we e made by Shandon AS-620E
C yo ome (The mo Elec on Co po a ion) on silanized slides, ixed in 4% o maldehyde o
30 min, and washed wice in PBS (pH 7.4) supplemen ed wi h 1% BSA o 20 min a oom
empe a u e. The slides we e labeled wi h a sa u a ing concen a ion (10-20 µg/ml) o
luo opho e-conjuga ed an ibodies in 100 µl PBS con aining 1% BSA (PBS-BSA) o e nigh
on ice. The samples we e washed wice wi h PBS-BSA and co e ed wi h 15 µl Mowiol
(Me ck, Budapes , Hunga y). Fo labelling o hyalu onan issue sec ions we e ea ed wi h
endogenous bio in blocking ki (Molecula P obes) ollowed by labelling wi h 5 μg/ml
7
bio inyla ed HABC (hyalu onan binding complex) a 4 oC o e nigh .34 P io o s aining wi h
luo escein-a idin he samples we e washed i e imes in PBS-BSA.
Con ocal mic oscopy. A Zeiss LSM 510 con ocal lase -scanning mic oscope (Ca l Zeiss
AG, Gö ingen, Ge many) was used o image samples. AlexaFluo 488 was exci ed a 488 nm
and de ec ed be ween 505-530 nm. Cy3 and AlexaFluo 546 we e exci ed wi h he 543 nm
line o a g een He-Ne lase , and emission was measu ed be ween 560-615 nm. Cy5 and
AlexaFluo 647 we e exci ed wi h he 633 nm line o a ed He-Ne lase , and hei emissions
we e measu ed o e 650 nm. Fluo escence images we e aken as 1-μm op ical sec ions using a
63x (NA=1.4) oil imme sion objec i e.
Image analysis. Con ocal mic oscopic images we e analyzed wi h he DipImage oolbox (Del
Uni e si y o Technology, Del , The Ne he lands) unde Ma lab (Ma hwo ks Inc., Na ick, MA).
The cell memb ane was iden i ied by a manually-seeded wa e shed algo i hm35 using a cus om-
w i en in e ac i e algo i hm implemen ed in Dipimage/Ma lab. The luo escence in ensi y was
e alua ed only in pixels co esponding o he cell memb ane. Fo he analysis o he in luence o
CD44 exp ession on he ela i e binding o as uzumab o E bB2 issue sec ions we e iple-
labeled wi h AlexaFluo 488-E bB2-76.5, Cy3-an i-human IgG ( o isualize as uzumab) and
AlexaFluo 647-He mes-3 (agains CD44). A wo-dimensional his og am (do plo ) o
as uzumab s. E bB2 in ensi y was p epa ed using only memb ane pixels. The CD44
exp ession le el was sepa a ely e alua ed in pixels co esponding o high as uzumab/E bB2
and low as uzumab/E bB2 a ios iden i ied based on he do plo .
Colocaliza ion be ween wo di e en luo escen labels was calcula ed acco ding o Pea son’s
o mula:
()( )
()( )
∑∑
∑
−−
−−
kmeank
kmeank
kmeankmeank
JJII
JJII
22
whe e Ik and Jk a e he in ensi ies o he k h pixel in he i s and second image, espec i ely,
Imean and Jmean a e he a e age luo escence in ensi ies o he i s and second image,
espec i ely. Low in ensi y pixels we e excluded om he analysis. The alue o he c oss-
co ela ion coe icien anges om +1 o −1. Values close o 1, 0 and −1 indica e high and
low deg ee o colocaliza ion, and an ico ela ion, espec i ely. Colocaliza ion was e alua ed
using a cus om-made so wa e w i en in LabView (Na ional Ins umen s, Aus in, TX).
Fluo escence esonance ene gy ans e (FRET). Flow cy ome ic FRET measu emen s
we e pe o med on a FACSVan age SE ins umen wi h DiVa op ion (Bec on Dickinson)
8
equipped wi h h ee lase s emi ing a 488, 532 and 633 nm. A de ailed desc ip ion o he
me hod has been published elsewhe e.36 Cellula au o luo escence was measu ed in he FL1
channel (exci ed by he 488 nm lase ) h ough a 530/30 nm band pass il e o disca d deb is
and dead cells. Dono luo escence was exci ed a 532 nm and eco ded in he FL4 channel
h ough a 585/42 nm bandpass il e , while he accep o was exci ed a 633 nm and de ec ed
in he FL6 channel h ough a 650 nm long pass il e . The FRET in ensi y was exci ed a 532
nm and de ec ed in he FL5 channel h ough a 650 nm long pass il e . Calcula ions we e
ca ied ou on a cell-by-cell basis using he ReFlex so wa e.37 FRET e iciencies we e
no malized o a 1:1 dono -accep o a io38 and a e p esen ed as mean alues o FRET
his og ams o 10,000 cells.
In e naliza ion o as uzumab. siRNA- ans ec ed and con ol cells we e incuba ed wi h 20
µg/ml AlexaFluo 647-labeled as uzumab a 37°C. The samples we e ea ed wi h acid s ip
bu e (0.5 M NaCl, 0.1 M glycine, pH 2.5) o 3 minu es on ice ollowed by washing and
esuspension in PBS. Cells we e analyzed by low cy ome y, and he in e nalized ac ion o
as uzumab was calcula ed by di iding he mean luo escence in ensi y o he acid-s ipped
sample wi h ha o he non-acid- ea ed con ol.
RNA in e e ence (RNAi). Small in e e ing RNA (siRNA) agains human CD44 we e
designed and syn hesized by Dha macon (Chicago, IL) using he SMARTselec ion ules. The
sequences o he an i-sense s ands o he siRNAs a e: AUGUCUUCAGGAUUCGUUCUU
(CD44 siRNA-4), UAUUCAAAUCGAUCUG CGCUU (CD44 siRNA-5). An siRNA agains
GFP was used as a nega i e con ol.39 siRNA ans ec ion o JIMT-1 was ca ied ou wi h he
Nucleo ec o de ice o Amaxa (Cologne, Ge many) acco ding o he manu ac u e ’s
speci ica ions. The op imal elec opo a ion condi ions (solu ion V, p og am T-20) we e
selec ed using GFP plasmid ans ec ion.
9
Resul s
CD44 is o e exp essed on as uzumab esis an JIMT-1 cells and associa ed wi h
E bB2. We compa ed he exp ession le els o CD44 in as uzumab esis an and sensi i e
b eas cance cell lines in o de o e eal he possible oles o CD44 in as uzumab
esis ance. Flow cy ome ic da a showed a ~35- imes highe exp ession le el o CD44 in
as uzumab esis an JIMT-1 cells (2.3±0.3 million/cell) han in SKBR-3 (65000±5000/cell),
hei as uzumab-sensi i e coun e pa (Fig.1A). Since CD44 has been shown o in e ac wi h
E bB2 in o a ian cance ,5,10 we in es iga ed he po en ial in e ac ion be ween hem. Analysis
o con ocal mic oscopic images yielded c oss-co ela ion coe icien s o 0.612 and 0.602
be ween CD44 and E bB2 on JIMT-1 and SKBR-3 cells, espec i ely (Fig.1B,C). The c oss-
co ela ion coe icien be ween wo di e en an ibodies agains E bB2 was used as a posi i e
con ol. The ac ha he c oss-co ela ion coe icien o he posi i e con ol was no
subs an ially di e en om ha be ween CD44 and E bB2 implies a s ong colocaliza ion
be ween hese molecules on he mic ome e scale. No malized low cy ome ic luo escence
esonance ene gy ans e (FRET) alues o 16±3% and 10±3% o he associa ion o CD44
and E bB2 in JIMT-1 and SKBR-3, espec i ely, show ha hese molecules a e associa ed a
he molecula le el as well (Fig.1B), since FRET alues abo e 5% a e conside ed o imply
signi ican associa ion.40 The abo e biophysical da a demons a ing associa ion be ween
E bB2 and CD44 in JIMT-1 cells we e ein o ced by molecula biological me hods. E bB2
co-immunop ecipi a ed wi h CD44 (Fig. 1D, le panel), and i s y osine phospho yla ion was
inc eased by la ge molecula weigh hyalu onan, whe eas hyalu onan decasaccha ide
inhibi ed E bB2 y osine phospho yla ion (Fig. 1D, middle panel). Nei he slow, no la ge
molecula weigh hyalu onan modi ied he ac i a ion s a e o E bB1 (Fig. 1D, igh panel).
CD44 exp ession co ela es wi h as uzumab in e naliza ion in JIMT-1 xenog a s. In
o de o s udy he possible ole o CD44 o e exp ession in as uzumab esis ance se en-
week old emale SCID mice we e inocula ed by JIMT-1 cells wi h a single subcu aneous
injec ion. Mice ecei ed as uzumab o physiologic saline weekly s a ing immedia ely a e
umou injec ion. Mice we e ea ed wi h as uzumab o 9 weeks, hen by physiologic
saline o ano he 6 weeks be o e sac i icing. Tumou sec ions we e iple-s ained agains
E bB2, as uzumab and CD44. The wa e shed algo i hm was used o segmen he images.
The seeds o he wa e shed algo i hm we e placed inside cells posi i e o CD44 and E bB2.
Since mouse s omal cells exp ess nei he CD44 no E bB2, his app oach ensu ed ha he
analysis was es ic ed o JIMT-1 cells. We obse ed a lack o igh co ela ion be ween
as uzumab binding and E bB2 exp ession in hese mice whose as uzumab he apy had
16
Acknowledgemen s
We a e indeb ed o D . Is án Juhász o allowing access o he animal ca e acili y o he
Depa men o De ma ology, Uni e si y o Deb ecen, o D . Si pa Jalkanen (Uni e si y o
Tu ku, Finland) o p o iding he He mes-3 an ibody and o Gábo Ho á h o helping in he
FRET measu emen s. We g a e ully acknowledge he excellen echnical assis ance o Fe enc
Bos yán in he animal expe imen s.
G an suppo : Hunga ian Academy o Sciences (OTKA F049025, T043061, K62648) and
Eu opean Commission (LSHB-CT-2004-503467, LSHC-CT-2005-018914) g an s o PN, JS;
Academy o Finland # 107173 (MT)
Con lic o in e es
None decla ed.
17
Re e ences
1. Ross JS, Fle che JA, Line e GP, S ec J, Cla k E, Aye s M, Symmans WF, Pusz ai L,
Bloom KJ. The He -2/neu gene and p o ein in b eas cance 2003: bioma ke
and a ge o he apy. Oncologis 2003;8:307-325.
2. Ci i A, Ya den Y. EGF-ERBB signalling: owa ds he sys ems le el. Na Re Mol
Cell Biol 2006;7:505-516.
3. Mocanu MM, Fazekas Z, Pe ás M, Nagy P, Sebes yén Z, Isola J, Tima J, Pa k JW,
Ve eb G, Szöllősi J. Associa ions o E bB2, be a1-in eg in and lipid a s on
He cep in (T as uzumab) esis an and sensi i e umo cell lines. Cance Le
2005;227:201-212.
4. Nagy P, F iedlände E, Tanne M, Kapanen AI, Ca away KL, Isola J, Jo in TM.
Dec eased accessibili y and lack o ac i a ion o E bB2 in JIMT-1, a
He cep in- esis an , MUC4-exp essing b eas cance cell line. Cance Res
2005;65:473-482.
5. Bou guignon LY, Zhu H, Chu A, Iida N, Zhang L, Hung MC. In e ac ion be ween he
adhesion ecep o , CD44, and he oncogene p oduc , p185HER2, p omo es
human o a ian umo cell ac i a ion. J Biol Chem 1997;272:27913-27918.
6. Bou guignon LY. CD44-media ed oncogenic signaling and cy oskele on ac i a ion
du ing mamma y umo p og ession. J Mamma y Gland Biol Neoplasia
2001;6:287-297.
7. Ca away KL, Ramsaue VP, Ca away CA. Glycop o ein con ibu ions o mamma y
gland and mamma y umo s uc u e and unc ion: oles o adhe ens junc ions,
E bBs and memb ane MUCs. J Cell Biochem 2005;96:914-926.
8. Holb o T, Ci enni G, Hynes NE. The E bB ecep o s and hei ole in cance
p og ession. Exp Cell Res 2003;284:99-110.
9. Nao D, Siono RV, Ish-Shalom D. CD44: s uc u e, unc ion, and associa ion wi h
he malignan p ocess. Ad Cance Res 1997;71:241-319.
10. Bou guignon LY, Zhu H, Zhou B, Died ich F, Single on PA, Hung MC. Hyalu onan
p omo es CD44 3-Va 2 in e ac ion wi h G b2-p185(HER2) and induces Rac1
and Ras signaling du ing o a ian umo cell mig a ion and g ow h. J Biol
Chem 2001;276:48679-48692.
11. Gha ak S, Mis a S, Toole BP. Hyalu onan cons i u i ely egula es E bB2
phospho yla ion and signaling complex o ma ion in ca cinoma cells. J Biol
Chem 2005;280:8875-8883.
12. Mis a S, Toole BP, Gha ak S. Hyalu onan cons i u i ely egula es ac i a ion o
mul iple ecep o y osine kinases in epi helial and ca cinoma cells. J Biol
Chem 2006;281:34936-34941.
18
13. Gha ak S, Mis a S, Toole BP. Hyalu onan oligosaccha ides inhibi ancho age-
independen g ow h o umo cells by supp essing he phosphoinosi ide 3-
kinase/Ak cell su i al pa hway. J Biol Chem 2002;277:38013-38020.
14. Ma haba R, Zolle M. CD44 in cance p og ession: adhesion, mig a ion and g ow h
egula ion. J Mol His ol 2004;35:211-231.
15. Au inen P, Tammi R, Tammi M, Johansson R, Kosma VM. Exp ession o CD44s,
CD44 3 and CD44 6 in benign and malignan b eas lesions: co ela ion and
colocaliza ion wi h hyalu onan. His opa hology 2005;47:420-428.
16. Lopez JI, Camenisch TD, S e ens MV, Sands BJ, McDonald J, Sch oede JA. CD44
a enua es me as a ic in asion du ing b eas cance p og ession. Cance Res
2005;65:6755-6763.
17. Au inen P, Tammi R, Pa kkinen J, Tammi M, Ag en U, Johansson R, Hi ikoski P,
Eskelinen M, Kosma VM. Hyalu onan in pe i umo al s oma and malignan
cells associa es wi h b eas cance sp eading and p edic s su i al. Am J
Pa hol 2000;156:529-536.
18. Simpson MA, Wilson CM, McCa hy JB. Inhibi ion o p os a e umo cell hyalu onan
syn hesis impai s subcu aneous g ow h and ascula iza ion in
immunocomp omised mice. Am J Pa hol 2002;161:849-857.
19. Pe e son RM, Yu Q, S amenko ic I, Toole BP. Pe u ba ion o hyalu onan
in e ac ions by soluble CD44 inhibi s g ow h o mu ine mamma y ca cinoma
cells in asci es. Am J Pa hol 2000;156:2159-2167.
20. Camenisch TD, Sch oede JA, B adley J, Klewe SE, McDonald JA. Hea - al e
mesenchyme o ma ion is dependen on hyalu onan-augmen ed ac i a ion o
E bB2-E bB3 ecep o s. Na Med 2002;8:850-855.
21. Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Pa on V, Bajamonde A, Fleming T,
Eie mann W, Wol e J, Peg am M, Baselga J, No on L. Use o chemo he apy
plus a monoclonal an ibody agains HER2 o me as a ic b eas cance ha
o e exp esses HER2. N Engl J Med 2001;344:783-792.
22. Tokunaga E, Oki E, Nishida K, Koga T, Egashi a A, Mo i a M, Kakeji Y, Maeha a Y.
T as uzumab and b eas cance : de elopmen s and cu en s a us. In J Clin
Oncol 2006;11:199-208.
23. Ca doso F, Picca MJ, Du becq V, Di LA. Resis ance o as uzumab: a necessa y
e il o a empo a y challenge? Clin B eas Cance 2002;3:247-257.
24. Nah a R, Es e a FJ. He cep in: mechanisms o ac ion and esis ance. Cance Le
2006;232:123-138.
25. Clynes RA, Towe s TL, P es a LG, Ra e ch JV. Inhibi o y Fc ecep o s modula e in
i o cy oxici y agains umo a ge s. Na Med 2000;6:443-446.
26. Ba ok M, Isola J, Pályi-K ekk Z, Nagy P, Juhász I, Ve eb G, Kawano Y, Kau aniemi
P, Kapanen A, Tanne M, Ve eb G, Szöllősi J. T as uzumab causes ADCC-
19
media ed g ow h inhibi ion o submac oscopic JIMT-1 b eas cance
xenog a s despi e in insic d ug esis ance. Mol Cance The 2007;6:2065-
2072.
27. Mo oyama AB, Hynes NE, Lane HA. The e icacy o E bB ecep o - a ge ed
an icance he apeu ics is in luenced by he a ailabili y o epide mal g ow h
ac o - ela ed pep ides. Cance Res 2002;62:3151-3158.
28. Naga a Y, Lan KH, Zhou X, Tan M, Es e a FJ, Sahin AA, Klos KS, Li P, Monia BP,
Nguyen NT, Ho obagyi GN, Hung MC, Yu D. PTEN ac i a ion con ibu es
o umo inhibi ion by as uzumab, and loss o PTEN p edic s as uzumab
esis ance in pa ien s. Cance Cell 2004;6:117-127.
29. Kono K, Takahashi A, Ichiha a F, Sugai H, Fujii H, Ma sumo o Y. Impai ed
an ibody-dependen cellula cy o oxici y media ed by he cep in in pa ien s
wi h gas ic cance . Cance Res 2002;62:5813-5817.
30. Tanne M, Kapanen AI, Jun ila T, Raheem O, G enman S, Elo J, Elenius K, Isola J.
Cha ac e iza ion o a no el cell line es ablished om a pa ien wi h He cep in-
esis an b eas cance . Mol Cance The 2004;3:1585-1592.
31. Nakazawa H, Yoshiha a S, Kudo D, Mo ohashi H, Kakizaki I, Kon A, Takagaki K,
Sasaki M. 4-me hylumbelli e one, a hyalu onan syn hase supp esso , enhances
he an icance ac i i y o gemci abine in human panc ea ic cance cells.
Cance Chemo he Pha macol 2006;57:165-170.
32. Toole BP. Hyalu onan: om ex acellula glue o pe icellula cue. Na Re Cance
2004;4:528-539.
33. Yoshiha a S, Kon A, Kudo D, Nakazawa H, Kakizaki I, Sasaki M, Endo M, Takagaki
K. A hyalu onan syn hase supp esso , 4-me hylumbelli e one, inhibi s li e
me as asis o melanoma cells. FEBS Le 2005;579:2722-2726.
34. Tammi R, Ripellino JA, Ma golis RU, Tammi M. Localiza ion o epide mal
hyalu onic acid using he hyalu ona e binding egion o ca ilage p o eoglycan
as a speci ic p obe. J In es De ma ol 1988;90:412-414.
35. Gonzalez RC, Woods RE, Eddins SL. Segmen a ion using he wa e shed ans o m. In
Digi al image p ocessing using Ma lab. Pea son P en ice Hall, 2004;417-425.
36. Sebes yén Z, Nagy P, Ho á h G, Vámosi G, Debe s R, G a ama JW, Alexande DR,
Szöllősi J. Long wa eleng h luo opho es and cell-by-cell co ec ion o
au o luo escence signi ican ly imp o es he accu acy o low cy ome ic
ene gy ans e measu emen s on a dual-lase bench op low cy ome e .
Cy ome y 2002;48:124-135.
37. Szen esi G, Ho á h G, Bo i I, Vámosi G, Szöllősi J, Gáspá R, Damjano ich S, Jenei
A, Má yus L. Compu e p og am o de e mining luo escence esonance
ene gy ans e e iciency om low cy ome ic da a on a cell-by-cell basis.
Compu e Me hods and P og ams in Biomedicine 2004;75:201-211.
20
38. Ho á h G, Pe ás M, Szen esi G, Fábián Á, Pa k JW, Ve eb G, Szöllősi J. Selec ing
he igh luo opho es and low cy ome e o luo escence esonance ene gy
ans e measu emen s. Cy ome y A 2005;65:148-157.
39. Nagy P, A nd -Jo in DJ, Jo in TM. Small in e e ing RNAs supp ess he exp ession
o endogenous and GFP- used epide mal g ow h ac o ecep o (e bB1) and
induce apop osis in e bB1-o e exp essing cells. Exp Cell Res 2003;285:39-49.
40. Szöllősi J, T ón L, Damjano ich S, Helliwell SH, A nd Jo in D, Jo in TM.
Fluo escence ene gy ans e measu emen s on cell su aces: a c i ical
compa ison o s eady-s a e luo ime ic and low cy ome ic me hods.
Cy ome y 1984;5:210-216.
41. Aus in CD, De Mazie e AM, Pisacane PI, an Dijk SM, Eigenb o C, Sliwkowski
MX, Klumpe man J, Schelle RH. Endocy osis and so ing o E bB2 and he
si e o ac ion o cance he apeu ics as uzumab and geldanamycin. Mol Biol
Cell 2004;15:5268-5282.
42. Nagy P, Ve eb G, Sebes yén Z, Ho á h G, Locke SJ, Damjano ich S, Pa k JW,
Jo in TM, Szöllősi J. Lipid a s and he local densi y o E bB p o eins
in luence he biological ole o homo- and he e oassocia ions o E bB2. J Cell
Sci 2002;115:4251-4262.
43. Knudson W, Chow G, Knudson CB. CD44-media ed up ake and deg ada ion o
hyalu onan. Ma ix Biol 2002;21:15-23.
44. Nagy P, Bene L, Balázs M, Hyun WC, Locke SJ, Chiang NY, Waldman FM,
Feue s ein BG, Damjano ich S, Szöllősi J. EGF-induced edis ibu ion o
e bB2 on b eas umo cells: Flow and image cy ome ic ene gy ans e
measu emen s. Cy ome y 1998;32:120-131.
45. Al-Hajj M, Wicha MS, Beni o-He nandez A, Mo ison SJ, Cla ke MF. P ospec i e
iden i ica ion o umo igenic b eas cance cells. P oc Na l Acad Sci U S A
2003;100:3983-3988.
46. Rod iguez-Boulan E, K ei ze G, Musch A. O ganiza ion o esicula a icking in
epi helia. Na Re Mol Cell Biol 2005;6:233-247.
47. B uno R, Washing on CB, Lu JF, Liebe man G, Banken L, Klein P. Popula ion
pha macokine ics o as uzumab in pa ien s wi h HER2+ me as a ic b eas
cance . Cance Chemo he Pha macol 2005;56:361-369.
48. Toole BP, Wigh TN, Tammi MI. Hyalu onan-cell in e ac ions in cance and ascula
disease. J Biol Chem 2002;277:4593-4596.
49. Rilla K, Pasonen-Seppanen S, Rieppo J, Tammi M, Tammi R. The hyalu onan
syn hesis inhibi o 4-me hylumbelli e one p e en s ke a inocy e ac i a ion and
epide mal hype p oli e a ion induced by epide mal g ow h ac o . J In es
De ma ol 2004;123:708-714.
21
Figu e legends:
Figu e 1 CD44 is o e exp essed in JIMT-1 cells and in e ac s wi h E bB2
A. JIMT-1 (g ey dashed line) and SKBR-3 (black dashed line) cells we e labeled wi h
AlexaFluo 488-He mes-3 an ibody agains CD44, and he luo escence in ensi y was
measu ed by low cy ome y. Unlabeled JIMT-1 (g ey con inuous line) and SKBR-3 (black
con inuous line) cells we e used as a nega i e con ol.
B. JIMT-1 and SKBR-3 cells we e labeled wi h Cy3-2C4 (agains E bB2) and Cy5-He mes-3
(agains CD44), and he FRET e iciency was measu ed by low cy ome y (black ba s) and
he c oss-co ela ion coe icien by con ocal mic oscopy (g ey ba s). Cells labeled wi h wo
non-compe ing an ibodies agains E bB2 (Cy3- as uzumab, Cy5-2C4) we e used as a
posi i e con ol o bo h FRET and c oss-co ela ion measu emen s. E o ba s indica e he
s anda d e o o he mean.
C. JIMT-1 cells we e labeled wi h AlexaFluo 488-2C4 and AlexaFluo 647-He mes-3 agains
E bB2 and CD44, espec i ely. The ed and g een channels co espond o E bB2 and CD44,
espec i ely. The yellow colo ep esen s o e lap be ween he wo luo escence channels.
Quan i a i e e alua ion o colocaliza ion is shown in pa B.
D. Le panel: JIMT-1 cell lysa e was immunop ecipi a ed wi h He mes-3 (agains CD44),
and he memb ane was blo ed wi h He mes-3 and OP15 (agains E bB2). Middle and igh
panels: JIMT-1 cells we e s imula ed wi h 100 μg/ml hyalu onan decasaccha ide (HA10) o
la ge molecula weigh hyalu onan (HA-LMW) o 30 min a 37 oC. E bB2 (middle panel)
and E bB1 ( igh panel) we e immunop ecipi a ed wi h OP15 and F4, espec i ely. The
memb anes we e p obed wi h OP15, F4 and PY99 o de ec E bB2, E bB1 and
phospho y osine, espec i ely.
Figu e 2 CD44 enhances as uzumab in e naliza ion in JIMT-1 xenog a s
A-E. Immuno luo escen s aining o JIMT-1 xenog a s samples was ca ied ou six weeks
a e inishing as uzumab ea men . Sec ions we e iple-s ained wi h AlexaFluo 488-
E bB2-76.5, Cy3-an i-human IgG ( ecognizing as uzumab) and AlexaFluo 647-He mes-3
(agains CD44). The cell memb ane iden i ied by a manually-seeded wa e shed algo i hm is
shown in ed (A). Dual colo images show he co ela ion o signals (B: ed – E bB2, g een –
as uzumab; C: ed – CD44, g een – as uzumab). Ga e 1 and 2 iden i y egions in he
as uzumab-E bB2 con ou plo (D) co esponding o pixels wi h high and low as uzumab-
22
E bB2 a ios, espec i ely. The CD44 in ensi y dis ibu ions co esponding o ga e 1 and 2
a e shown in pa E.
F. Mice xenog a ed wi h JIMT-1 umou s we e ea ed by as uzumab o 15 weeks and
umou samples we e s ained wi h AlexaFluo 488-E bB2-76.5 and Cy3-an i-human IgG
ecognizing as uzumab. The con ou plo shows a much s onge co ela ion be ween he
E bB2 and as uzumab signals compa ed o ha obse ed in pa D.
G-I. Mice injec ed wi h JIMT-1 cells we e ea ed wi h saline (G) o as uzumab (H) o 15
weeks. In ano he g oup mice we e sac i iced 6 weeks a e a 9-week long as uzumab
ea men was s opped (I), and he co ela ion be ween CD44 and E bB2 exp ession le els
was analyzed in he h ee samples.
Figu e 3 siRNA-media ed supp ession o CD44 exp ession inhibi s as uzumab
in e naliza ion
A. JIMT-1 cells we e ans ec ed wi h an i ele an siRNA agains GFP (black), CD44
siRNA-4 (whi e) and CD44 siRNA-5 (g ey). The ba s show he exp ession le els o CD44
and an i ele an p o ein, MHC-I, calcula ed om low cy ome ic his og ams analyzed 48
hou s a e ans ec ion.
B. In e naliza ion o as uzumab was measu ed in mock- ans ec ed cells (●), cells
ans ec ed wi h GFP siRNA (○), CD44 siRNA-4 (▼) o CD44 siRNA-5 (◊). The ac ion o
in e nalized as uzumab (100%=amoun o as uzumab bound o he cell su ace a 0 min) is
plo ed as a unc ion o he du a ion o as uzumab ea men . The 30 min alues o bo h
CD44 siRNA- ans ec ed samples we e s a is ically signi ican ly di e en om he GFP
siRNA- ans ec ed one (S uden ’s es , p<0.05). E o ba s indica e he s anda d e o o he
mean.
Figu e 4 4-me hylumbelli e one ac s syne gis ically wi h as uzumab in inhibi ing
umou g ow h and down- egula ing E bB2 exp ession
A. Mice we e xenog a ed wi h JIMT-1 cells, and ea ed wi h saline (●), as uzumab (○), 4-
me hylumbelli e one (▼) o as uzumab+4-me hylumbelli e one (◊). 4-me hylumbelli e one
ea men was ca ied ou daily. A he imes o weekly saline and as uzumab ea men s
indica ed by he a ows he size o umou s was measu ed, and i is displayed as unc ion o
ime.
B. Tissue sec ions we e iple-labeled wi h bio in-HABC and luo escein-a idin o isualize
hyalu onan, and an ibodies agains CD44 and E bB2. The cell memb ane o JIMT-1 cells was
23
iden i ied by he manually-seeded wa e shed algo i hm. The mean (±s anda d e o o he
mean) exp ession le els o hyalu onan, CD44 and E bB2 measu ed a ound he cell
memb ane in as uzumab (whi e), 4-me hylumbelli e one (le -ha ched) and as uzumab+4-
me hylumbelli e one (g ey) ea ed animals we e no malized o he saline- ea ed xenog a
samples (black). The means we e calcula ed om 6 images aken o issue sec ions o 3
animals.
Figu e 5 Inhibi ion o hyalu onan syn hase inc eases binding o as uzumab o E bB2
A-C. JIMT-1 umou samples o saline- ea ed animals we e s ained o hyalu onan wi h
bio in-HABC (A) and o CD44 (B). The colo composi e image shows he o e lap o he
dis ibu ion o he hyalu onan (g een) and CD44 ( ed) signals.
D-F. Tumou sec ions o mice ea ed wi h as uzumab (D) o as uzumab+4-
me hylumbelli e one (E) we e s ained wi h an i-human IgG ( ecognizing as uzumab, g een)
and E bB2-76.5 ( ed) an ibodies. The con ou plo (F) shows inc eased binding o
as uzumab o E bB2 in samples aken om he as uzumab+4-me hylumbelli e one- ea ed
animals ( ed con ou s) compa ed o he as uzumab- ea ed ones (black con ou s). The axes
o he con ou plo show luo escence in ensi y alues o as uzumab and E bB2-76.5
an ibodies eco ded in memb ane pixels which we e iden i ied by manually-seeded wa e shed
segmen a ion.
G. Cul u ed JIMT-1 cells we e ea ed wi h 4-me hylumbelli e one o 2 days. Bo h con ol
(black con ou s) and 4-me hylumbelli e one- ea ed ( ed con ou s) cells we e s ained wi h
AlexaFluo 488- as uzumab and AlexaFluo 647-2C4. The la e an ibody measu ed he
amoun o E bB2.
Figu e 6 RNA in e e ence-media ed supp ession o CD44 exp ession inhibi s
p oli e a ion o JIMT-1 cells
An equal numbe o mock- ans ec ed cells (whi e ba s) and cells ans ec ed wi h GFP
siRNA (black ba s) o CD44 siRNA-4 (g ey ba s) we e seeded in o 6-well pla es 24 hou s
a e ans ec ion, and cul u ed in he absence (– as ) o p esence (+ as ) o 20 μg/ml
as uzumab o 72 hou s. Cell numbe s a e no malized o he numbe ound in mock-
ans ec ed, as uzumab-un ea ed cells 72 hou s a e ans ec ion.
JIMT-1 SKBR-3 pos. con .
FRET e iciency (%)
0
5
10
15
20
25
30
C ossco ela ion coe icien
0.0
0.2
0.4
0.6
0.8
1.0
Fig. 1
Pályi-K ekk e al.
B
Fluo escence in ensi y
1 10 100 1000 10000
Rela i e equency o cells
0.000
0.005
0.010 A
JIMT-1,
He mes-3
SKBR-3,
He mes-3
unlabeled JIMT-1
and SKBR-3 cells
E bB2
0 10000 20000 30000 40000 50000
T as uzumab
0
10000
20000
30000
40000
50000
60000
70000 F
Fig. 5F-G
Pályi-K ekk e al.
E bB2
0 1000 2000 3000
T as uzumab
0
1000
2000
3000 G
Rela i e numbe o cells (%)
0
20
40
60
80
100
120
140
Fig. 6
Pályi-K ekk e al.
JIMT-1 SKBR-3
+ as .- as . + as .- as .