scieee Science in your language
[en] (orig)

Analyses of association between PPAR gamma and EPHX1 polymorphisms and susceptibility to COPD in a Hungarian cohort, a case-control study

Read accessible full text

Analyses of association between PPAR gamma and EPHX1 polymorphisms and susceptibility to COPD in a Hungarian cohort, a case-control study

Author: Penyige, András; Póliska, Szilárd; Csánky, Eszter; Scholtz, Beáta; Dezső, Balázs; Schmelczer, Iván; Kilty, Iain; Takács, László; Nagy, László
Year: 2010
Source: https://dea.lib.unideb.hu/bitstreams/5ccd867d-954d-4764-80f9-d3c96fc30474/download
RESEARCH ARTICLE Open Access
Analyses o associa ion be ween PPAR gamma
and EPHX1 polymo phisms and suscep ibili y o
COPD in a Hunga ian coho , a case-con ol s udy
And as Penyige
1*†
, Szila d Poliska
2,3†
, Esz e Csanky
5,9
, Bea a Schol z
3
, Balazs Dezso
6
, I an Schmelcze
1
, Iain Kil y
7
,
Laszlo Takacs
8
, Laszlo Nagy
2,3,4*
Abs ac
Backg ound: In addi ion o smoking, gene ic p edisposi ion is belie ed o play a majo ole in he pa hogenesis o
ch onic obs uc i e pulmona y disease (COPD). Gene ic associa ion s udies o new candida e genes in COPD may
lead o imp o ed unde s anding o he pa hogenesis o he disease.
Me hods: Two p oposed casual single nucleo ide polymo phisms (SNP) ( s1051740, s2234922) in mic osomal
epoxide hyd olase (EPHX1) and h ee SNPs ( s1801282, s1800571, s3856806) in pe oxisome p oli e a o -ac i a ed
ecep o gamma (PPARG), a new candida e gene, we e geno yped in a case-con ol s udy (272 COPD pa ien s and
301 con ols subjec s) in Hunga y. Allele equencies and geno ype dis ibu ions we e compa ed be ween he wo
coho s and end es was also used o e alua e associa ion be ween SNPs and COPD. To es ima e he s eng h o
associa ion, odds a ios (OR) (wi h 95% CI) we e calcula ed and po en ial con ounding a iables we e es ed in
logis ic eg ession analysis. Associa ion be ween haplo ypes and COPD ou come was also assessed.
Resul s: The dis ibu ion o impu ed EPHX1 pheno ypes was signi ican ly di e en be ween he COPD and he
con ol g oup (P = 0.041), OR o he slow ac i i y pheno ype was 1.639 (95% CI = 1.08- 2.49; P = 0.021) in ou
s udy. In logis ic eg ession analysis adjus ed o bo h a ian s, also age and pack-yea , he a e allele o His447His
o PPARG showed signi ican associa ion wi h COPD ou come (OR = 1.853, 95% CI = 1.09-3.14, P = 0.0218). In
haplo ype analysis he GC haplo ype o PPARG (OR = 0.512, 95% CI = 0.27-0.96, P = 0.035) con e ed educed isk
o COPD.
Conclusions: The “slow”ac i i y-associa ed geno ypes o EPHX1 we e associa ed wi h inc eased isk o COPD. The
mino His447His allele o PPARG signi ican ly inc eased; and he haplo ype con aining he mino P o12Ala and he
majo His447His polymo phisms o PPARG dec eased he isk o COPD.
Backg ound
Ch onic obs uc i e pulmona y disease (COPD) is an
inc easing and se ious public heal h p oblem ep esen -
ing he ou h leading cause o dea h globally. COPD is
a complex human disease, associa ed wi h pe sis en ai -
way in lamma ion, p o ease-an i-p o ease imbalance,
oxida i e s ess, ch onic obs uc i e b onchi is and
emphysema, esul ing in p og essi e ai low limi a ion
ha is no subs an ially e e sed by b onchodila o s.
Impo an ly, i is a smoking- ela ed diso de and ciga -
e e smoking is he majo en i onmen al isk ac o o
de elopmen o COPD.Howe e , he ac ha onlya
subse o smoke s (15-20%) de elops clinically signi i-
can symp oms sugges s ha gene ic p edisposi ion also
plays ole in he de elopmen o COPD [1,2].
P e ious gene ic associa ion and genome-wide linkage
s udies ha e iden i ied se e al candida e genes ha
migh be in ol ed in he pa hogenesis o COPD [3-7].
In ou case-con ol s udy, i e pu a i e causal single
nucleo ide polymo phisms (SNPs) in wo genes -
* Co espondence: [email p o ec ed]b.hu; [email p o ec ed]
†Con ibu ed equally
1
Depa men o Human Gene ics, Uni e si y o Deb ecen, Deb ecen,
Hunga y
2
Depa men o Biochemis y and Molecula Biology, Resea ch Cen e o
Molecula Medicine, Uni e si y o Deb ecen, Deb ecen, Hunga y
Full lis o au ho in o ma ion is a ailable a he end o he a icle
Penyige e al.BMC Medical Gene ics 2010, 11:152
h p://www.biomedcen al.com/1471-2350/11/152
© 2010 Penyige e al; licensee BioMed Cen al L d. This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e Commons
A ibu ion License (h p://c ea i ecommons.o g/licenses/by/2.0), which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in
any medium, p o ided he o iginal wo k is p ope ly ci ed.
mic osomal epoxide hyd olase (EPHX1) and pe oxisome
p oli e a o -ac i a ed ecep o gamma (PPARG)-we e
chosen o analyze hei associa ion wi h COPD.
PPARG is a membe o nuclea ho mone ecep o s,
implica ed in adipocy e di e en ia ion and in ol ed in
mac ophage ac i a ion and dend i ic cell biology [8]. An
an i-in lamma o y ole o PPARG was also epo ed
based on i s inhibi o y e ec on p o-in lamma o y an-
sc ip ion ac o s such as NF-BandAP-1[9,10].The
NCBI SNP da abase ea u es mo e han 700 polymo ph-
isms o PPARG, many o hem in onic o synonymous
a ian and gene ally lack o in o ma ion ega ding
popula ion di e si y.
Se e al s udies on he polymo phisms o PPARG such
as P o12Ala and His447His we e p e iously pe o med
in ela ion o in lamma o y diseases such as IBD, ype 2
diabe es and ecen ly i has been sugges ed ha PPARG
polymo phisms we e associa ed wi h he isk o as hma
[11]. Since PPARG migh bein ol edin he egula ion
o p o-in lamma o y signaling pa hways and i is gene -
ally accep ed ha COPD is associa ed wi h an abno mal
in lamma o y esponse, gene ic polymo phisms in
PPARG could be implica ed in he suscep ibili y o
COPD isk [12]. Tha may p o ide a heo e ical basis
o he s udy o his new candida e gene in COPD
de elopmen . Consequen ly, we examined he associa-
ion be ween h ee SNP polymo phisms o PPARG gene
and COPD.
EPHX1 is an enzyme associa ed wi h he me abolism
and de oxi ica ion o xenobio ic chemicals; i plays an
impo an ole in he gene al oxida i e de ense o lung.
Se e al polymo phisms a e known in EPHX1 including
wo ela i ely common SNPs, he exon 3 Ty 113His
( s1051740) and exon 4 His139A g ( s2234922) a ian s.
These wo a ian alleles ha e been sugges ed o be
associa ed wi h al e ed EPHX1 enzyme ac i i y [13].
Subs i u ion o Ty 113 o His dec eases EPHX1 ac i i y
(slow allele), whe eas subs i u ion o His139 o A g
inc eases EPHX1 ac i i y ( as allele). I was ound ha
he slow me abolizing o m o EPHX1 was associa ed
wi h an inc eased isk o COPD and e idence suppo -
ing his associa ion has been eplica ed in se e al case-
con ol gene ic associa ion s udies [7,14,15]. Howe e ,
he e idence suppo ing his associa ion has no been
consis en , se e al gene ic associa ion s udies ailed o
show associa ion be ween hese polymo phisms and
COPD [16,17]. In his s udy we ha e chosen he
Ty 113His and His139A g polymo phisms o alida e
ou Hunga ian popula ion o COPD associa ion s udies.
All oge he a o al o i e SNPs in wo candida e
genes we e geno yped in o de o examine hei asso-
cia ion wi h COPD suscep ibili y by using Hunga ian
coho s, a p e iously unin es iga ed popula ion wi h
he highes COPD mo ali y a e among men in Eu -
ope [18].
Me hods
S udy popula ions
The s udy is a case-con ol gene ic associa ion s udy in
a Cen al-Eu opean Caucasian popula ion. In ou analy-
sis he cases included 272 and he con ol subjec s
included 301 age-ma ched Hunga ian indi iduals. The
ec ui men and he clinical analyses o pa ien s we e
conduc ed a he Depa men o Pulmonology, Medical
and Heal h Science Cen e , Uni e si y o Deb ecen,
acco ding o he Global Ini ia i e o Ch onic Obs uc-
i e Lung Disease (GOLD) c i e ia. The Resea ch E hics
Commi ee o Uni e si y o Deb ecen Medical and
Heal h Science Cen e app o ed he clinical p o ocol
and he s udy. W i en in o med consen was ob ained
be o e he subjec s en e ed he s udy. The in es iga o
explained he na u e, pu pose and isk o he s udy and
p o ided he subjec wi h a copy o he in o ma ion
shee . The subjec s we e hen gi en ime o conside he
s udy’s implica ion be o e deciding o pa icipa e.
Be o e s a ing sample collec ion, we de ined inclusion
and exclusion c i e ia o diseased and heal hy pa ien s.
Inclusion c i e ia o COPD subjec s we e age 40 o 65
yea s old. Pa ien s mus ha e p edic ed alue o o ced
expi a o y olume a 1 second (FEV1) 50%-80% and
FEV1/FVC% <70% (s age 2 acco ding o GOLD c i e ia).
Inclusion c i e ia o con ol pa ien s we e age be ween
40 and 65 yea s; no mal spi ome y, FEV1 ≥90% (p e-
dic ed alue) and FEV1/FVC% ≥80%. All pa ien s mus
be cu en o ex-smoke (minimum 15 pack yea s).
Exclusion c i e ia o all pa ien s: plasma IgE le el >70
U/ml, alpha1-an ipsin de iciency, e idence o as hma,
a opic disease, his o y o lung diso de s, espi a o y
in ec ion in he pas 3 mon hs, o he in lamma o y dis-
eases (e.g. in lamma o y bowel disease, heuma oid
a h i is, pso iasis e c.), au oimmune diseases (lupus,
scle osis), cance , posi i e plasma es o HIV, Hepa i is
B o Hepa i is C.
Geno yping
Genomic DNA was ex ac ed om pe iphe al blood
using E.Z.N.A. Blood DNA Midi Ki (Peqlab Bio echno-
logie) acco ding o he manu ac u e ’s p o ocol. Quali y
o he DNA samples was checked by aga ose gel-
elec opho esis and quan i a ed by NanoD op1000. All
SNPs we e geno yped using TaqMan geno yping assays
(Addi ional File 1, Table S1). Samples we e measu ed in
duplica es and nuclease- ee wa e was used as no-
empla e con ol. Following PCR ampli ica ion he end-
poin luo escence was ead wi h he ABI 7900 HT
ins umen and geno ypes we e assigned using SDS
Penyige e al.BMC Medical Gene ics 2010, 11:152
h p://www.biomedcen al.com/1471-2350/11/152
Page 2 o 9
so wa e (Applied Biosys ems). The a e age geno yping
success a e o a leas 95% was a ained o each SNP.
Al eola mac ophage (AM) and pe iphe al blood
monocy e (MO) collec ion
B onchoal eola la age luid (BALF) samples we e col-
lec ed by ibe -op ic b onchoscopy om heal hy and
COPD pa ien s. AMs we e sepa a ed by Pe coll (Ame -
sham Biosciences) g adien cen i uga ion. To al cell
numbe was de e mined by coun ing in hemocy ome e .
Di e en ial cell coun was assessed on hema oxylin-
eosin s ained cy ospin slides be o e and a e he g adi-
en sepa a ion. O e 95% AM pu i y was eached a e
sepa a ion.
50 ml hepa in ea ed enous blood was collec ed
om heal hy and diseased pa ien s. MOs we e sepa a ed
by Ficoll g adien cen i uga ion using an i-CD14 conju-
ga ed mic obeads (>98% MO) (Va ioMACS, Mil enyi
Bio ec.). 5-5 con ol and COPD pa ien s we e ec ui ed
in his expe imen .
TaqMan RT-QPCR
To al RNA was isola ed om pe iphe al blood mono-
cy es, al eola mac ophages, lung issue and adipose is-
sue using T izol eagen (In i ogen). Fi s s and cDNA
was gene a ed om 5 ug o al RNA using cDNA
A chi e Ki (Applied Biosys ems). Fo RT-QPCR eac-
ion 200 ng cDNA/sample and 2X TaqMan PCR mix
(Applied Biosys ems) was used. Reac ions we e un in
ABI P ism HT 7900 ins umen . We ha e designed p i-
me pai and p obe o measu ing PPARG mRNA le el.
Fo wa d p ime : 5’GATGACAGCGACTTGGCAA,
e e se p ime : 5’CTTCAATGGGCTTCACATTCA,
p obe: 5’FAM-CAAACCTGGGCGGTCTCCACTGAG-
3’TAMRA. The housekeeping gene cyclophilin A was
used as a no malize gene: o wa d p ime : 5’ACGGC-
GAGCCCTTGG, e e se p ime : 5’TTTCTGCTG
TCTTTGGGACCT, p obe: 5’FAM-CGCGTCTCC
TTTGAGCTGTTTGCA-3’TAMRA. Rela i e gene
exp ession le els we e calcula ed by compa a i e
C me hod. S a is ical analysis was pe o med in G aph-
Pad P ism using non-pa ame ic es (Mann-Whi ney
U- es ).
Immunohis ochemis y
Tissues o mo phology and immunos ainings we e
ob ained om he iles o he Pa hology Depa men o
Uni e si y o Deb ecen and we e eshly ixed in 10%
neu al o malinandembeddedinpa a in ollowedby
hema oxyline and eosine (HE) s aining using s anda d
me hods. Immunohis ochemis y (IHC) o al eola
mac ophages (AM) was ca ied ou using PPARG, CD68
and DCSign (San a C uz) monoclonal an ibodies by
means o immunope oxidase s aining as desc ibed
ea lie [19,20]. Double immuno luo escence s aining was
pe o med as desc ibed ea lie [21] using CSAII de ec-
ion ki wi h FITC-labeled y amine ollowed by an
immuno luo escen s aining o DCSign wi h s ep a i-
din- exas ed luo och ome. Nuclea coun e s aining
was made wi h DAPI (blue luo escence).
S a is ical analysis
Di e ences be ween cases and he con ol g oup con-
ce ning demog aphic and main clinical da a we e ana-
lyzed by Mann-Whi ney U- es and Pea son c
2
es .
Geno ype da a o each SNP we e es ed o depa u es
om Ha dy-Weinbe g equilib ium (HWE) sepa a ely in
case and con ol popula ions using a goodness-o - i
c
2
- es o he exac es o es ima e P alues. HWE cal-
cula ionswe edonebyusing heHWE oolh p://ihg.
gs .de/cgi-bin/hw/hwa1.pl. The signi icance o di e -
ences in geno ype and allele equencies be ween
pa ien s and con ols we e es ed by using ei he c
2
ana-
lyses o Fishe ’s exac es whe e app op ia e [22]. To
assess he deg ee o associa ion be ween each o he
SNPs and COPD odds a ios wi h 95% con idence in e -
als (OR, 95% CI) we e calcula ed using logis ic eg es-
sion analysis; he model was adjus ed o SNPs, pack-
yea , age and gende . All single locus associa ion es s
we e pe o med using he STATA 9.0 s a is ical package
(excep whe e o he wise s a ed).
Haplo ype equencies we e es ima ed o con ol and
pa ien g oups sepa a ely wi h he Full-P ecise-I e a ion
algo i hm implemen ed in he SHEsis so wa e h p://
analysis.bio-x.cn/myAnalysis.php. The ex en o linkage
disequilib ium be ween pai s o biallelic ma ke s was
de e mined using bo h he s anda dized disequilib ium
and co ela ion coe icien s (gi en as Lewon in’sD’and
2,
espec i ely) and associa ion be ween haplo ypes and
COPD was assessed by he c
2
- es o he exac es as
implemen ed in he p og am SHEesis [23,24]. Co ec-
ion o mul iple es ing was no used in he analysis o
he associa ion geno ype and allele equencies because:
(i) he EPHX1 polymo phisms we e known o be unc-
ional and (ii) he gene is conside ed a suscep ibili y
gene o COPD; and (iii) in case o he PPARG poly-
mo phisms he s udied indi idual alleles we e no inde-
penden . A pos e io i es ima es o s udy powe we e
assessed by means o Quan o so wa e h p://hyd a.usc.
edu. We ha e es ima ed he powe o ou s udy wi h he
ollowing pa ame e s: sample size o 272 cases; con ol/
case a io o 1.1; mino allele equencies (MAF) a e in
he ange om 0.12 o 0.3; log-addi i e model; disease
p e alence o COPD 5%. Assuming hese pa ame e s
ou s udy had ~50% powe o de ec a geno ype ela i e
isk (GRR) o 1.4 o MAF = 0.12, o ~79% powe o
de ec aGRRo 1.6 o hesameMAF;whilei had
~76% powe o de ec a GRR o 1.4, and ~96% powe o
Penyige e al.BMC Medical Gene ics 2010, 11:152
h p://www.biomedcen al.com/1471-2350/11/152
Page 3 o 9
de ec a GRR o 1.6 o MAF = 0.3 a an a= 0.05 signi -
icance le el.
Resul s
O he 573 subjec s geno yped, 61.8% o he subjec s
we e men. The p opo ion o males was highe among
cases (69.85% o 54.48%) bu he e is no signi ican di -
e ence in he mean age o con ols and cases. Cases
had been exposed o mo e obacco smoke as e idenced
by he di e ence in pack-yea s bu he di e ence is no
signi ican , COPD pa ien s had a much la ge educ ion
in lung unc ion, ypical o a clinical COPD popula ion
(Table 1).
All geno ype equencies we e consis en wi h Ha dy-
Weinbe g equilib ium o bo h SNPs o he EPHX1
gene, and he geno ype and allele equencies did no
di e signi ican ly be ween cases and he con ol g oup
(Table 2). The assessmen o he associa ion o indi i-
dual SNPs wi h COPD showed ha homozygosi y o
he mino allele inc eased he isk o disease in case o
Ty 113His polymo phism ("slow”allele) (OR = 1.345;
95% CI = 0.96 - 1.91; P = 0.095) educed i in case o
he His139A g SNP (" as ”allele) (OR = 0.675; 95% CI =
0.27 - 1.69; P = 0.399). Howe e , none o hese SNPs
we e signi ican ly associa ed wi h COPD e en a e
adjus ing he model o gende , age and pack-yea s in
logis ic eg ession.
F equencies o he ou SNP based haplo ypes we e
es ima ed o cases and con ols. Al hough he “slow
ac i i y”CA (His
113
-His
139
)haplo ypewasmo e e-
quen among cases (24.8% e sus he 20.8% in con ols),
he o e all dis ibu ion did no di e signi ican ly
be ween he wo g oups (P = 0.736). Fu he mo e,
alleles o he wo loci in EPHX1 a e in comple e linkage
equilib ium as shown by he pai -wise s anda dized dise-
quilib ium coe icien (D’= 0.036).
Due o he p esence o hese coding a ian s, ma ked
a ia ions in EPHX1 ac i i y ha e been epo ed p e-
iously. The e o e we ha e assessed he associa ion o
he p edic ed ( apid”,“no mal”,“slow”and “ e y slow”)
EPHX1 pheno ypes wi h he de elopmen o COPD
[25,26]. The dis ibu ion o p edic ed EPHX1 ac i i y
was signi ican ly di e en be ween con ol subjec s and
COPD pa ien s (P = 0.041). In he analysis o p edic ed
pheno ypes he COPD g oup had highe p opo ion o
he p edic ed “slow”pheno ype. Consequen ly he slow
pheno ype signi ican ly aises he isk o de eloping
COPD [OR = 1.639; 95% CI = 1.06-2.49; P = 0.021)] in
ou case con ol s udy (Table 3).
High exp ession le el o PPARG mRNA in he lung
has been epo ed p e iously [27,28]. We examined
PPARG exp ession a p o ein le el in su gical lung issue
samples. PPARG p o ein is exp essed in he lung and
mos o he PPARG p o ein de i ed signals co-localized
wi h he exp ession o a ypical mac ophage ma ke
CD68 and he dend i ic cell ma ke DCSign (Figu e 1).
PPARG exp ession was also measu ed a mRNA le el.
mRNA exp ession is en iched in AM ela i e o o al
lung issue, howe e we did no ind di e ences in
exp ession le el be ween COPD and heal hy indi iduals
(Figu e 2). Thus, gene ic a ian s, a he han he
exp ession o he PPARG gene could be associa ed wi h
he de elopmen o COPD.
We ha e geno yped h ee exonic SNPs ( s10801282
(P o12Ala), s3856806 (His447His) and s1800571
(P o113Gln))inPPARG gene, bu he s1800571 locus
was le ou om he analysis because i was homozy-
gous o he majo C allele in all indi iduals. The o he
wo SNPs we e in HWE and showed linkage disequili-
b ium, he ex en o LD be ween s10801282 and
s3856806 was ound o be D’= 0.673, al hough he pai
showed lowe LD wi h espec o hei co ela ion coe -
icien (
2
= 0.42).
The single loci allelic and geno ypic analysis ound
no signi ican associa ion be ween he wo coding a -
ian s o PPARG and COPD. In logis ic eg ession
applying a model adjus ed o bo h SNPs, age and
pack-yea s, he a e a ian o His447His polymo ph-
ism was signi ican ly associa ed wi h inc eased odds
o COPD (OR = 1.853, 95% CI = 1.09 - 3.14, P =
0.021). The mino Ala allele o he P o12Ala a ian
had an OR o 0.679, sugges ing a p o ec i e e ec ,
howe e i did no each signi icance (95% CI = 0.40 -
1.14, P = 0.145) (Table 4).
We ha e es ima ed he equency o he possible
wo-SNP haplo ypes o PPARG and assessed he asso-
cia ion be ween haplo ypes and COPD de elopmen .
The e was a signi ican di e ence in he equency o
he GC haplo ype in ol ing he a e G a ian o he
P o12Ala locus be ween he wo g oups (P = 0.035).
The s eng h o associa ion was also assessed, o his
haplo ype (OR = 0.512; 95% CI = 0.27-0.96). This ind-
ing sugges s a p o ec i e e ec o he GC (12Ala/
447His) haplo ype o he PPARG gene o COPD ou -
come (Table 5).
Table 1 Clinical ea u es o he s udy popula ion
Pa ame e Cases
(N = 272)
Con ols
(N = 301)
P alue
Male (%) 190 (69.85) 164 (54.48) 0.781
Age (±SD)* 63.87 (±8.96) 64.29 (±9.07) 0.577
Pack-Yea s (±SD)* 38.75 (±19.91) 34.76 (±14.71) 0.120
FEV1% p edic ed (±SD)* 47.17 (±13.69) 99.28 (±9.76) <0.0001
FEV1/FVC% p edic ed (±SD) * 57.57 (±10.12) 87.10 (±35.24) <0.001
Da a p esen ed as mean ± SD. FEV1: o ced expi a o y olume in one second,
FVC: o ced i al capaci y, *Mann-Whi ney U- es was used.
Penyige e al.BMC Medical Gene ics 2010, 11:152
h p://www.biomedcen al.com/1471-2350/11/152
Page 4 o 9
Discussion
The aims o his s udy we e o in es iga e associa ion o
EPHX1 polymo phisms o COPD in a Hunga ian popu-
la ion and o assess possible associa ion be ween SNPs
o PPARG, a new candida e gene, and COPD ou come.
In ou s udy o indi idual SNPs in EPHX1 ( he exon-3
Ty 113His and exon-4 His139A g a ian s), he homozy-
gous mino Th 113His a ian showed only a bo de line
associa ion wi h he COPD pheno ype (P = 0.095), how-
e e he le el o associa ion was u he educed when
he model was adjus ed o age, sex and pack-yea s.
The e is comple e linkage equilib ium be ween
Ty 113His and His139A g SNPs and no s a is ical sig-
ni icance was ound in haplo ype equency dis ibu ion
and hei associa ion wi h COPD pheno ype.
Since EPHX1 is in ol ed in he de oxi ica ion o epox-
ide in e media es in obacco smoke, he a e o con e -
sion o hese highly eac i e compounds could a ec an
indi idual’s abili y o cope wi h he oxic e ec o ciga -
e e smoke [29]. We ha e econs uc ed he equency o
p edic ed EPHX1 ac i i y in pa ien and con ol g oups
[25,26]. The di e ence in dis ibu ion o p edic ed phe-
no ypes was signi ican be ween he wo g oups. The
COPD g oup had a highe p opo ion o p edic ed slow
and lowe p opo ion o p edic ed no mal and apid
EPHX1 ac i i y. In e es ingly he con ol g oup showed
an excess o e y slow pheno ypes, bu i s equency was
low in bo h g oups. In ou analysis he slow ac i i y a -
ian o EPHX1 enzyme was associa ed wi h a signi ican ly
inc eased he isk o COPD. This esul p o ides addi-
ional suppo o he no ion ha EPHX1 is likely o be
in ol ed in COPD pa hogenesis.
P e ious s udies abou he po en an i-in lamma o y
p ope ies o he PPARG agonis s sugges he use o
PPARG ligands in COPD he apy [12,30,31] and associa-
ion o PPARG gene polymo phisms wi h he de elopmen
o as hma has been epo ed [11]. These lines o e idence
p omp ed us o in es iga e PPARG gene associa ion
exis ed be ween he p esence o ce ain PPARG gene poly-
mo phisms and COPD ou come. Using IHC s aining and
RT-QPCR measu emen s, we ha e con i med PPARG
mRNA and p o ein exp ession in lung issues and pa icu-
la in AM [32]. Al hough gene exp ession le el is compa -
able in pa ien s and heal hy indi iduals, polymo phisms o
he gene s ill could be po en ial candida e ma ke s o he
disease i a unc ionally al e ed PPARG has a ole in he
de elopmen in COPD.
Among he h ee SNPs we ha e geno yped in PPARG
- s1801282, s3856806 and s1800571 - he s1800571
was excluded since all indi iduals ca ied an iden ical
homozygous geno ype [33]. Ou single-ma ke es s o
he o he wo coding a ian s yielded a signi ican asso-
cia ion o he mino allele o His447His polymo phism
in logis ic eg ession adjus ed o bo h SNPs, age, sex
and pack-yea s (OR = 1.853; 95% CI = 1.09-3.14; P =
0.02). The His447His a ian did no cause amino acid
change and i has no known unc ion. Howe e , se e al
pape s poin ed ou ha exonic synonymous SNPs can
a ec mRNA splicing o s abili y [34,35]. Any change in
hese p ocesses could exe a signi ican e ec on p o-
ein unc ion, he e o e he e was a eason o in es iga e
he associa ion o his SNP wi h COPD. O cou se he
possibili y, ha he His447His SNP is igh ly linked wi h
an unknown unc ional a ian ha de e mine COPD
suscep ibili y can no be excluded.
A modes pai -wise LD was ound be ween s1801282
and s3856806. Since he use o SNP-based haplo ypes
Table 3 The dis ibu ion o he p edic ed EPHX1
pheno ypes
P edic ed
EPHX1
ac i i y
Con ols
n (%)
Cases
n (%)
§
P
alue
Con ingency
ables
OR (95% CI)
P
alue
No mal 144
(53.1)
123
(48.4)
1 ( e e ence)
Slow 55
(20.2)
77
(30.3)
1.64
(1.08-2.49)
0.021
Ve y slow 17
(6.2)
9
(3.5)
0.041 0.62 (0.27-1.44) 0.306
Rapid 55
(20.2)
45
(17.7)
0.96 (0.59-3.19) 0.855
No mal: exon3 Ty /Ty and exon 4 His/His o exon 3 Ty /His and exon 4 His/
A g; Slow: exon 3 Ty /Ty and exon 4 His/His; Ve y slow: exon 3 His/His and
exon 4 His/His; Rapid: exon 3 y /Ty and exon 4 A g/A g o His/A g
§
c
2
- es was used o he dis ibu ion o p edic ed pheno ypes, OR: odds a io,
CI: con idence in e al
Table 2 Allele and geno ype equencies o examined EPHX1 gene polymo phisms
Gene Symbol SNP ID Allele equency Geno ype equency
§
Ha dy-Weinbe g Equilib ium OR (95% CI)
s1051740 (Ty 113His) T C TT (%) TC (%) CC (%) P alue
Con ols 0.723 0.277 154 (53.3) 110 (38.1 25 (8.7) 0.401 1.11 (0.86-1.44)
Cases 0.701 0.299 127 (47.4) 122 (45.5) 19 (7.1) 0.154
s2234922 (His139A g) A G AA (%) AG (%) GG (%)
Con ols 0.779 0.221 171 (60.0) 102 (35.8) 12 (4.2) 0.507 0.88 (0.66-1.18)
Cases 0.799 0.201 169 (62.8) 92 (64.2) 8 (2.9) 0.280
§
c
2
- es was used, OR: odds a io, CI: con idence in e al
Penyige e al.BMC Medical Gene ics 2010, 11:152
h p://www.biomedcen al.com/1471-2350/11/152
Page 5 o 9

in gene ic associa ion s udies may o e a mo e powe ul
app oach han he use o indi idual SNPs, a haplo ype
analysis was also pe o med. A signi ican di e ence was
ound in he equency o GC haplo ype (con aining he
mino G allele o P o12Ala and majo C o His447His
a ian ) be ween he con ol and COPD g oups and he
associa ion o his haplo ype o COPD ou come was
also de e mined. The GC haplo ype con e s a signi ican
lowe isk o COPD, poin ing o a po en ial unc ional
p o ec i e e ec o his haplo ype.
In e es ingly he mino allele o P o12Ala polymo ph-
ism ha lowe s he binding a ini y o PPARG p o ein o
Figu e 1 Mo phology and immunohis ochemis y o COPD-associa ed lung lesions.A: Ch onic b onchi is. B: Cen iacina emphysema.
C: Ad anced ac i e b onchi is wi h ib osis and emphysema. A-C, hema oxylin-eosin s aining; D: CD68-PPARG coexp ession wi h double IHC
s aining using alkaline phospha ase [ ed cy oplasm-CD68] and diamino-benzidine [b own nuclei-PPARG]. E: Cells wi h ed luo escence and g een
nuclei DCSign-PPARG double luo escence s aining. Nuclea coun e -s aining is DAPI. Indica ions:b, b onchus; a, al eola spaces; a ows, al eola
mac ophages. O iginal magni ica ions: A-D 20×; E40×.
Penyige e al.BMC Medical Gene ics 2010, 11:152
h p://www.biomedcen al.com/1471-2350/11/152
Page 6 o 9
Figu e 2 mRNA exp ession o PPARG. PPARG showed as high as mRNA exp ession le el in al eola mac ophages as in subcu an a and also
showed exp ession in he whole lung issue wi h signi ican ly lowe le el (Mann-Whi ney U es ). Howe e i was no exp essed in pe iphe al
blood monocy es. Da a p esen ed no malized alues o RT-QPCR measu emen s; Cyclophilin A was used as housekeeping gene. G ey ba s
ep esen mean alues o 5 con ol pa ien s; whi e ba s ep esen mean alues o 5 COPD pa ien s. ** p < 0.01.
Table 4 Allele and geno ype equencies o examined PPARG gene polymo phisms
Gene Symbol SNP ID Allele equency Geno ype equency
§
Ha dy-Weinbe g Equilib ium Logis ic Analysis
s1801282 (P o12Ala) C G CC (%) CG (%) GG (%) P alue OR (95% CI)
#
P alue
Con ols 0.864 0.136 217 (75.2) 64 (22.4) 7 (2.4) 0.398 0.68 (0.40-1.14) 0.15
Cases 0.874 0.126 199 (76.2) 67 (22.3) 4 (1.5) 0.869
s3856806 (His447His) C T CC (%) CT (%) TT (%) P alue OR (95% CI)
#
P alue
Con ols 0.882 0.118 224 (78.8) 53 (18.7) 8 (2.5) 0.09 1.85 (1.09-3.14) 0.02
Cases 0.862 0.138 199 (74.0) 65 (24.5) 5 (1.5) 0.57
§
c
2
- es was used, OR: odds a io, CI: con idence in e al
#
Adjus ed o age and pack-yea
Penyige e al.BMC Medical Gene ics 2010, 11:152
h p://www.biomedcen al.com/1471-2350/11/152
Page 7 o 9
pe oxisome p oli e a o esponse elemen was ound o
be associa ed wi h lowe body mass index, imp o ed
insulin sensi i i y, dec eased isk o ype 2 diabe es
[36,37] and educed isk o de elop colo ec al cance
[38]. Highe equency o T allele o he His447His C/T
polymo phism was obse ed in colon cance [39,40].
Wea eawa eo he ac ha signi ican esul s
could p o e o be alse posi i es, and a clea limi a ion
o ou s udy is he ela i ely low sample size. The
s udy has o he limi a ions such as ha popula ion
s a i ica ion should be in es iga ed in hese kinds o
s udies and we did no analyze a second coho o
eplica e ou esul s. Possible gene-gene and gene-
en i onmen in e ac ions pose a di icul y o gene ic
analysis o COPD associa ion s udies, oo. Fu he s u-
dies using la ge popula ions a e needed and o he a -
ian s in he PPARG gene should be in es iga ed in
o de o cla i y he associa ion o PPARG and indi i-
dual suscep ibili y o he de elopmen o COPD.
Conclusions
In summa y, ou s udy p o ided suppo o he sug-
ges ed causa i e ole o EPHX1 polymo phisms and phe-
no ypes impu ed om exon 3 and exon 4 geno ype da a
in COPD ou come in a Hunga ian popula ion.
We ha e ca ied ou he i s in es iga ion o PPARG
gene polymo phisms in a case-con ol COPD s udy and
cha ac e ized he associa ion be ween indi idual SNPs
and haplo ypes in PPARG and suscep ibili y o COPD.
Al hough he GC haplo ype has a modes p o ec i e
e ec , i migh poin owa d he po en ial impo ance o
common alleles wi h weak e ec in he e ogeneous dis-
eases, like COPD. The documen a ion o PPARG haplo-
ype associa ion wi h COPD iden i ies his impo an
gene as a a ge o u he in es iga ion o he pa ho-
genesis o COPD and as a po en ial a ge o he apy.
Addi ional ma e ial
Addi ional File 1: Table S1. Cha ac e is ics o es ed SNP.
Cha ac e is ics, NCBI e e ence numbe s and ABI assays code o
examined single nucleo ide polymo phisms.
Abb e ia ions
COPD: ch onic obs uc i e pulmona y disease; EPHX1: mic osomal epoxide
hyd olase; FEV1: o ced expi a o y olume in one second; FVC: o ced i al
capaci y; PPARG: pe oxisome p oli e a o -ac i a ed ecep o gamma.
Acknowledgemen s
The au ho s a e indeb ed o Zsuzsa Bodná o clinical coo dina ion, D A ila
Vaskó, D Pé e Szabó, D Sándo Sz. Kiss, Ti anilla Tölgyesi, Má ia Ráduly, o
he help wi h clinical sample collec ion. The au ho s would like o hank he
expe echnical assis ance o Júlia Buslig, Ibolya Fü ös and Ma a Béládi.
This wo k was suppo ed by g an s om he Hunga ian Na ional O ice o
Resea ch and Technology (NKFP 1/007/01, NKFP 1A/008/04), Hunga ian
g an o he Na ional Resea ch Fund (NI 67877 and TAMOP-4.2.2/08/1).
Au ho de ails
1
Depa men o Human Gene ics, Uni e si y o Deb ecen, Deb ecen,
Hunga y.
2
Depa men o Biochemis y and Molecula Biology, Resea ch
Cen e o Molecula Medicine, Uni e si y o Deb ecen, Deb ecen, Hunga y.
3
Clinical Genomics Cen e , Medical and Heal h Science Cen e , Resea ch
Cen e o Molecula Medicine, Uni e si y o Deb ecen, Deb ecen, Hunga y.
4
Apop osis and Genomics Resea ch G oup o he Hunga ian Academy o
Sciences, Resea ch Cen e o Molecula Medicine, Uni e si y o Deb ecen,
Deb ecen, Hunga y.
5
Depa men o Pulmonology, Medical and Heal h
Science Cen e , Uni e si y o Deb ecen, Deb ecen, Hunga y.
6
Depa men o
Pa hology, Uni e si y o Deb ecen, Medical and Heal h Science Cen e ,
Deb ecen, Hunga y.
7
P ize Global Resea ch and De elopmen , Sandwich, UK.
8
Biosys ems In e na ional SAS, E y, F ance.
9
Depa men o Pulmonology,
Semmelweis Heal h Ca e Cen e o Miskolc, Miskolc, Hunga y.
Au ho s’con ibu ions
LN is an In e na ional Schola o HHMI and holds a Wellcome T us Senio
Resea ch Fellowship in Biomedical Sciences, he planned and di ec ed he
s udy. AP pe o med da a analyses and p epa ed he manusc ip . SP
pe o med he geno yping measu emen s and RT-QPCR analyses and
p epa ed igu es and ables. ECs o ganized pa ien ec ui men and sample
collec ion. BS o ganized sample p epa a ion. BD pe o med IHC s aining. IS
pe o med da a analyses. IK and LT pa icipa ed in he planning and he
design o he s udy and helped p epa e he manusc ip .
All au ho s ha e ead and app o ed he inal e sion o he manusc ip .
Compe ing in e es s
LN has no con lic s o in e es s (COIs) o disclose. AP has no COIs o
disclose. SP has no COIs o disclose. ECs has no COIs o disclose. BS has no
COIs o disclose. BD has no COIs o disclose. IS has no COIs o disclose. IK is
di ec o o P ize and holde o P ize s ock. LT has no COIs o disclose.
Recei ed: 10 May 2010 Accep ed: 2 No embe 2010
Published: 2 No embe 2010
Re e ences
1. Sand o d AJ, Sil e man EK: Ch onic obs uc i e pulmona y disease. 1:
Suscep ibili y ac o s o COPD he geno ype-en i onmen in e ac ion.
Tho ax 2002, 57(8):736-741.
2. Sei a C, Plagens A: Gene ics o ch onic obs uc i e pulmona y disease.
In J Ch on Obs uc Pulmon Dis 2007, 2(4):541-550.
3. Joos L, Pa e PD, Sand o d AJ: Gene ic isk ac o s o ch onic obs uc i e
pulmona y disease. Swiss Med Wkly 2002, 132(3-4):27-37.
4. Sand o d AJ, Joos L, Pa e PD: Gene ic isk ac o s o ch onic obs uc i e
pulmona y disease. Cu Opin Pulm Med 2002, 8(2):87-94.
5. Mol ino NA: Gene ics o COPD. Ches 2004, 125(5):1929-1940.
6. He sh CP, DeMeo DL, Sil e man EK: Na ional Emphysema T ea men T ial
s a e o he a : gene ics o emphysema. P oc Am Tho ac Soc 2008,
5(4):486-493.
7. He sh CP, Demeo DL, Lange C, Li onjua AA, Reilly JJ, Kwia kowski D,
Lai d N, Syl ia JS, Spa ow D, Speize FE: A emp ed eplica ion o
epo ed ch onic obs uc i e pulmona y disease candida e gene
associa ions. Am J Respi Cell Mol Biol 2005, 33(1):71-78.
8. Sza ma i I, Nagy L: Nuclea ecep o signalling in dend i ic cells connec s
lipids, he genome and immune unc ion. EMBO J 2008, 27(18):2353-2362.
Table 5 The dis ibu ion and s eng h o associa ion o
PPARG haplo ypes
Haplo ypes COPD ( eq.) Con ol ( eq.)
§
P alue OR (95% CI)
CC 0.834 0.832 0.914 1.02 (0.74-1.40)
CT 0.039 0.030 0.424 1.31 (0.68-2.50)
GC 0.028 0.053 0.035 0.51 (0.27-0.96)
GT 0.098 0.085 0.429 1.18 (0.78-1.77)
§
c
2
- es was used, OR: odds a io, CI: con idence in e al
Penyige e al.BMC Medical Gene ics 2010, 11:152
h p://www.biomedcen al.com/1471-2350/11/152
Page 8 o 9
9. Asada K, Sasaki S, Suda T, Chida K, Nakamu a H: An iin lamma o y oles o
pe oxisome p oli e a o -ac i a ed ecep o gamma in human al eola
mac ophages. Am J Respi C i Ca e Med 2004, 169(2):195-200.
10. Spea s M, McSha y C, Thomson NC: Pe oxisome p oli e a o -ac i a ed
ecep o -gamma agonis s as po en ial an i-in lamma o y agen s in
as hma and ch onic obs uc i e pulmona y disease. Clin Exp Alle gy 2006,
36(12):1494-1504.
11. Oh SH, Pa k SM, Lee YH, Cha JY, Lee JY, Shin EK, Pa k JS, Pa k BL, Shin HD,
Pa k CS: Associa ion o pe oxisome p oli e a o -ac i a ed ecep o -
gamma gene polymo phisms wi h he de elopmen o as hma. Respi
Med 2009, 103(7):1020-1024.
12. S andi o d TJ, Keshamouni VG, Reddy RC: Pe oxisome p oli e a o -
ac i a ed ecep o -{gamma} as a egula o o lung in lamma ion and
epai . P oc Am Tho ac Soc 2005, 2(3):226-231.
13. Kiyoha a C, Yoshimasu K, Takayama K, Nakanishi Y: EPHX1 polymo phisms
and he isk o lung cance : a HuGE e iew. Epidemiology 2006,
17(1):89-99.
14. He sh CP, Demeo DL, Laza us R, Celedon JC, Raby BA, Bendi JO, C ine G,
Make B, Ma inez FJ, Scanlon PD: Gene ic associa ion analysis o
unc ional impai men in ch onic obs uc i e pulmona y disease. Am J
Respi C i Ca e Med 2006, 173(9):977-984.
15. He sh CP, DeMeo DL, Reilly JJ, Sil e man EK: Xenobio ic me abolizing
enzyme gene polymo phisms p edic esponse o lung olume
educ ion su ge y. Respi Res 2007, 8:59.
16. B ogge J, S een VM, Eiken HG, Guls ik A, Bakke P: Gene ic associa ion
be ween COPD and polymo phisms in TNF, ADRB2 and EPHX1. Eu Respi
J2006, 27(4):682-688.
17. Chappell S, Daly L, Mo gan K, Gue a-Ba anes T, Roca J, Rabino ich R,
Lo ya J, Milla AB, Donnelly SC, Kea ings V: Gene ic a ian s o mic osomal
epoxide hyd olase and glu ama e-cys eine ligase in COPD. Eu Respi J
2008, 32(4):931-937.
18. Hu d S: The impac o COPD on lung heal h wo ldwide: epidemiology
and incidence. Ches 2000, 117(2 Suppl):1S-4S.
19. Sza ma i I, Gogolak P, Im JS, Dezso B, Rajna olgyi E, Nagy L: Ac i a ion o
PPARgamma speci ies a dend i ic cell sub ype capable o enhanced
induc ion o iNKT cell expansion. Immuni y 2004, 21(1):95-106.
20. Tsaki is I, Soos G, Nemes Z, Kiss SS, And as C, Szan o J, Dezso B: The
p esence o ca boxypep idase-M in umou cells signi ies epide mal
g ow h ac o ecep o exp ession in lung adenoca cinomas: he
coexis ence p edic s a poo p ognosis ega dless o EGFR le els. J Cance
Res Clin Oncol 2008, 134(4):439-451.
21. Gogolak P, Re hi B, Sza ma i I, Lanyi A, Dezso B, Nagy L, Rajna olgyi E:
Di e en ia ion o CD1a- and CD1a+ monocy e-de i ed dend i ic cells is
biased by lipid en i onmen and PPARgamma. Blood 2007,
109(2):643-652.
22. Chiano MN, Clay on DG: Geno ypic ela i e isks unde o de ed
es ic ion. Gene Epidemiol 1998, 15(2):135-146.
23. Shi YY, He L: SHEsis, a powe ul so wa e pla o m o analyses o linkage
disequilib ium, haplo ype cons uc ion, and gene ic associa ion a
polymo phism loci. Cell Res 2005, 15(2):97-98.
24. Li Z, Zhang Z, He Z, Tang W, Li T, Zeng Z, He L, Shi Y: A pa i ion-liga ion-
combina ion-subdi ision EM algo i hm o haplo ype in e ence wi h
mul iallelic ma ke s: upda e o he SHEsis [h p://analysis.bio-x.cn]. Cell
Res 2009, 19(4):519-523.
25. Smi h CA, Ha ison DJ: Associa ion be ween polymo phism in gene o
mic osomal epoxide hyd olase and suscep ibili y o emphysema. Lance
1997, 350(9078):630-633.
26. Benhamou S, Reinikainen M, Boucha dy C, Daye P, Hi onen A: Associa ion
be ween lung cance and mic osomal epoxide hyd olase geno ypes.
Cance Res 1998, 58(23):5291-5293.
27. Huang TH, Razmo ski-Naumo ski V, Ko a BP, Lin DS, Rou ogalis BD: The
pa hophysiological unc ion o pe oxisome p oli e a o -ac i a ed
ecep o -gamma in lung- ela ed diseases. Respi Res 2005, 6:102.
28. Bel isi MG, Hele DJ, Bi ell MA: Pe oxisome p oli e a o -ac i a ed ecep o
gamma agonis s as he apy o ch onic ai way in lamma ion. Eu J
Pha macol 2006, 533(1-3):101-109.
29. Omiecinski CJ, Hasse C, Hosag aha a V: Epoxide hyd olase–
polymo phism and ole in oxicology. Toxicol Le 2000, 112-113:365-370.
30. Cai o S, Yang SR, Kode A, Edi isinghe I, Rajend asozhan S, Phipps RP,
Rahman I: Rosigli azone and 15-deoxy-Del a12,14-p os aglandin J2,
PPARgamma agonis s, di e en ially egula e ciga e e smoke-media ed
p o-in lamma o y cy okine elease in monocy es/mac ophages. An ioxid
Redox Signal 2008, 10(2):253-260.
31. Pa el HJ, Bel isi MG, Bishop-Bailey D, Yacoub MH, Mi chell JA: Ac i a ion o
pe oxisome p oli e a o -ac i a ed ecep o s in human ai way smoo h
muscle cells has a supe io an i-in lamma o y p o ile o co icos e oids:
ele ance o ch onic obs uc i e pulmona y disease he apy. J Immunol
2003, 170(5):2663-2669.
32. Reddy RC: Immunomodula o y ole o PPAR-gamma in al eola
mac ophages. J In es ig Med 2008, 56(2):522-527.
33. Ris ow M, Mulle -Wieland D, P ei e A, K one W, Kahn CR: Obesi y
associa ed wi h a mu a ion in a gene ic egula o o adipocy e
di e en ia ion. N Engl J Med 1998, 339(14):953-959.
34. Capon F, Allen MH, Ameen M, Bu den AD, Tillman D, Ba ke JN,
T emba h RC: A synonymous SNP o he co neodesmosin gene leads o
inc eased mRNA s abili y and demons a es associa ion wi h pso iasis
ac oss di e se e hnic g oups. Hum Mol Gene 2004, 13(20):2361-2368.
35. Sauna ZE, Kimchi-Sa a y C, Ambudka SV, Go esman MM: Silen
polymo phisms speak: how hey a ec pha macogenomics and he
ea men o cance . Cance Res 2007, 67(20):9609-9612.
36. Deeb SS, Fajas L, Nemo o M, Pihlajamaki J, Mykkanen L, Kuusis o J,
Laakso M, Fujimo o W, Auwe x J: A P o12Ala subs i u ion in
PPARgamma2 associa ed wi h dec eased ecep o ac i i y, lowe body
mass index and imp o ed insulin sensi i i y. Na Gene 1998,
20(3):284-287.
37. Al shule D, Hi schho n JN, Klannema k M, Lindg en CM, Vohl MC,
Nemesh J, Lane CR, Scha ne SF, Bolk S, B ewe C: The common
PPARgamma P o12Ala polymo phism is associa ed wi h dec eased isk
o ype 2 diabe es. Na Gene 2000, 26(1):76-80.
38. Landi S, Mo eno V, Gioia-Pa icola L, Guino E, Na a o M, de Oca J,
Capella G, Canzian F: Associa ion o common polymo phisms in
in lamma o y genes in e leukin (IL)6, IL8, umo nec osis ac o alpha,
NFKB1, and pe oxisome p oli e a o -ac i a ed ecep o gamma wi h
colo ec al cance . Cance Res 2003, 63(13):3560-3566.
39. Jiang J, Gajalakshmi V, Wang J, Ku iki K, Suzuki S, Nakamu a S, Akasaka S,
Ishikawa H, Tokudome S: In luence o he C161T bu no P o12Ala
polymo phism in he pe oxisome p oli e a o -ac i a ed ecep o -gamma
on colo ec al cance in an Indian popula ion. Cance Sci 2005,
96(8):507-512.
40. Siezen CL, an Leeuwen AI, K am NR, Luken ME, an K anen HJ,
Kampman E: Colo ec al adenoma isk is modi ied by he in e play
be ween polymo phisms in a achidonic acid pa hway genes and ish
consump ion. Ca cinogenesis 2005, 26(2):449-457.
P e-publica ion his o y
The p e-publica ion his o y o his pape can be accessed he e:
h p://www.biomedcen al.com/1471-2350/11/152/p epub
doi:10.1186/1471-2350-11-152
Ci e his a icle as: Penyige e al.: Analyses o associa ion be ween PPAR
gamma and EPHX1 polymo phisms and suscep ibili y o COPD in a
Hunga ian coho , a case-con ol s udy. BMC Medical Gene ics 2010
11:152.
Submi you nex manusc ip o BioMed Cen al
and ake ull ad an age o :
• Con enien online submission
• Tho ough pee e iew
• No space cons ain s o colo igu e cha ges
• Immedia e publica ion on accep ance
• Inclusion in PubMed, CAS, Scopus and Google Schola
• Resea ch which is eely a ailable o edis ibu ion
Submi you manusc ip a
www.biomedcen al.com/submi
Penyige e al.BMC Medical Gene ics 2010, 11:152
h p://www.biomedcen al.com/1471-2350/11/152
Page 9 o 9