Ch omosomal abe a ions induced by double s and DNA b eaks
Tamas Va ga and Pe e D. Aplan
Gene ics B anch, Cen e o Cance Resea ch, Na ional Cance Ins i u e, Na ional Ins i u es o Heal h,
Be hesda, MD 20889, USA
Abs ac
I has been sugges ed ha in oduc ion o double-s and DNA b eaks in o mammalian ch omosomes
can lead o g oss ch omosomal ea angemen s h ough imp ope DNA epai . To s udy his
phenomenon, we employed a model sys em in which a double-s and DNA b eak (DSB) can be
p oduced in human cells in i o a a p ede e mined loca ion. The ensuing ch omosomal changes
lanking he b eakage si e can hen be cloned and cha ac e ized. In his sys em, he ecogni ion si e
o he I-SceI endonuclease, whose 18 bp ecogni ion sequence is no no mally ound in he human
genome, is placed be ween a s ong cons i u i e p omo e and he He pes simplex i us hymidine
kinase (HSV- k) gene, which se es as a nega i e selec able ma ke . We ound ha he mos common
mu a ion ollowing abe an DSB epai was an in e s i ial dele ion; hese dele ions ypically showed
ea u es o non-homologous end joining (NHEJ), such as mic ohomologies and inse ions o di ec
o in e ed epea sequences. We also de ec ed mo e complex ea angemen s, including la ge
inse ions om adjacen o dis an genomic egions. The inse ion e en s ha in ol ed dis an
genomic egions ypically ep esen ed ansc ibed sequences, and included bo h L1 LINE elemen s
and sequences known o be in ol ed in genomic ea angemen s. This ype o abe an epai could
po en ially lead o gene inac i a ion ia dele ion o coding o egula o y sequences, o p oduc ion o
oncogenic usion genes ia inse ion o coding sequences.
Keywo ds
ch omosomal ea angemen ; double s and DNA b eak; non-homologous end joining; inse ion; I-
SceI
1. In oduc ion
DNA double s and b eaks (DSBs) appea in he genome o human cells on a egula basis
[1]. These lesions can lead o cell dea h i le un epai ed, he e o e i is c ucial ha cells epai
b oken ch omosomes. Double s and b eak epai can occu ia ei he homology-dependen o
non-homologous mechanisms [2,3]. Two o ms o homology-di ec ed epai ha e been
iden i ied. An in ac copy o he sequence can be copied in o he DSB om a sis e ch oma id
o homologous ch omosome [4]; his epai p ocess is conse a i e. The e also exis s a non-
conse a i e ype o homologous ecombina ion epai known as single-s and annealing
(SSA), in which DSBs a e p ocessed o single-s anded ails, and epai occu s ia annealing
o he single-s anded ail a a nea by di ec epea sequence [5].
The second majo o m o DSB epai is non-homologous end joining (NHEJ), which does no
equi e he p esence o a homologous dono sequence. Sho segmen s (1–4 nucleo ides) o
o e lapping nucleo ides (mic ohomologies) a e o en p esen a he NHEJ epai si e [6],
Add ess co espondence o: D . Pe e Aplan, NCI/NIH/Gene ics B anch, Na ional Na al Medical Cen e , Building 8 Room 5101, 8901
Rock ille Pike, Be hesda, MD 20889-5105, Tel: 301-435-5005, FAX: 301-496-0047, Email: [email p o ec ed].
NIH Public Access
Au ho Manusc ip
DNA Repai (Ams ). Au ho manusc ip ; a ailable in PMC 2005 Sep embe 29.
Published in inal edi ed o m as:
DNA Repai (Ams ). 2005 Augus 15; 4(9): 1038–1046.
NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip
sugges ing ha a sho DNA o e lap may be impo an o he eliga ion o b oken DNA ends.
Since NHEJ is o en accompanied by dele ion o addi ion o nucleo ides, NHEJ po en ially
comp omises gene ic in o ma ion [7,8]. Despi e he p opensi y o in oducing small gene ic
changes upon epai , NHEJ is hough o ac as a ca e ake o genome, since cells de icien in
NHEJ o en display gene ic ins abili y [9,10]. To explain he p esence o DNA end joining
seen in sys ems lacking componen s o he NHEJ pa hway, an al e na i e, highly e o -p one
NHEJ pa hway has been p oposed [11].
I has been sugges ed ha imp ope DSB epai can lead o g oss ch omosomal ea angemen s
(GCRs), such as ansloca ions, dele ions and in e sions [12]. Indeed, many o he
ch omosomal ansloca ion b eakpoin s seen in pa ien s wi h hema opoie ic malignancies
display hallma ks o NHEJ, sugges ing ha e oneous DNA epai may play a ole in malignan
ans o ma ion [10,13,14]. Se e al model sys ems ha e been employed o in es iga e he link
be ween DSB epai and GCRs. Following inse ion o a complemen a y pai o mu an
neomycin phospho ans e ase genes (neo ) in o mouse ES cells [15,16], p oduc ion o a speci ic
DSB wi hin he mu an neo genes led o econs uc ion o a unc ional neo gene ia
homologous ecombina ion. Al hough his app oach allows one o de ec homologous
ecombina ion, i does no iden i y epai p ocesses such as NHEJ, which do no p oduce a
unc ional neo gene.
Loss-o - unc ion epo e sys ems ha e also been used o gain in o ma ion abou mu a ions
accompanying DSB epai in oden cells. In hese s udies, a DSB was in oduced ei he in o
he coding egion o a He pes simplex i us hymidine kinase (Tk) gene [17] o an in on o
he phospho ibosyl ans e ase (APRT) gene [3,18]. Nonconse a i e epai p ocesses
ab oga ed he ac i i y o he epo e genes and enabled cells o su i e in selec ion media. In
ano he expe imen al sys em [19], a DSB was in oduced in an in on o he endogenous Tk
gene o a human lymphoblas oid cell line, and abe an DNA epai e en s we e eco e ed by
selec ing o cells ha had los Tk ac i i y. Howe e , his assay a o s he eco e y o la ge
scale changes, such as long dele ions, and does no p o ide a means o assessing he equency
o sho dele ions.
We epo he e a loss-o - unc ion epo e assay in which he ou come o he non-homologous
epai o one single DSB can be s udied in human cells. This app oach p o ides an oppo uni y
o analyze bo h he sho dele ions and he la ge scale changes ha accompany he epai o a
single, induced DSB.
2. Resul s
2.1 Design o he model sys em
We modi ied an exis ing expe imen al sys em (13, 14) o in oduce a single DSB and iden i y
cells ha ha e sus ained mu a ions accompanying he epai p ocess. We gene a ed a plasmid
(pEF1αTk) ha exp esses he He pes simplex i us hymidine kinase (HSV- k) gene unde he
con ol o he EF1α p omo e ( ig. 1A), wi h he ecogni ion sequence o he es ic ion
endonuclease I-SceI in e posed be ween he EF1α p omo e and he HSV- k gene. The I-SceI
endonuclease, de i ed om he yeas Sacha omyces ce e isiae, has an 18 bp ecogni ion
sequence which is no p esen in he human genome [20]. The pEF1αTk ec o can be
in oduced in o mammalian cells, and hose cells ha ha e s ably in eg a ed he cons uc can
be selec ed wi h G418. These cells will exp ess HSV- k and will he e o e be sensi i e o
gancyclo i (GCV).
We elec opo a ed he human monocy ic cell line U937 [21] wi h he pEF1αTk plasmid and
isola ed clone F5, which con ains a single copy o he cons uc ( ig. 1). In e se PCR
demons a ed ha he cons uc had been in eg a ed in o ch omosome 7 be ween nucleo ides
Va ga and Aplan Page 2
DNA Repai (Ams ). Au ho manusc ip ; a ailable in PMC 2005 Sep embe 29.
NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip
112329914-112329932 (all ch omosomal coo dina es e e o he July 2003 eeze, based on
Human Genome Build 34 om NCBI).
The F5 cells we e hen ans ec ed wi h I-SceI exp ession ec o s. Fo some expe imen s, we
used an episomal ec o (pCEP4-IsceI). As opposed o con en ional plasmid ec o s, in which
only a ac ion o cells ha a e success ully ans ec ed will in eg a e he plasmid ec o and
supply ongoing an ibio ic (eg., hyg omycin) esis ance, episomal ec o s can supply ongoing
an ibio ic esis ance in he absence o in eg a ion. This allows selec ion o ela i ely la ge
numbe s o unique, success ully ans ec ed clones, selec ed solely on he basis o exp ession
o he an ibio ic esis ance ma ke . In o he expe imen s, we used p e iously desc ibed non-
episomal I-SceI ec o s (pPGK3XnlsI-SceI and pCBASce). Since I-SceI clea es DNA be ween
he EF1α p omo e and he HSV- k gene; his clea age migh esul in ch omosomal abe a ions
due o an impe ec epai ha sepa a es he EF1α p omo e om HSV- k coding sequences.
A combina ion o nega i e (GCV) and posi i e selec ion (G418) enabled us o eco e cells
ha sus ained di e en o ms o genomic ea angemen s ( ig. 1B).
2.2 Exp ession o I-SceI in F5 cells
F5 cells we e ans ec ed wi h he episomal exp ession ec o pCEP4-IsceI, which con ains a
hyg omycin esis ance casse e (hyg o ) and exp esses he I-SceI enzyme unde he con ol o
a CMV p omo e . Following ans ec ion, he cells we e g own in bulk, wi hou any selec ion
o 5 days, and we e subsequen ly pla ed in o 96 well pla es a dilu ions o 3, 9, o 27 cells pe
well. These pla es we e hen selec ed wi h hyg omycin alone ( o iden i y cells ha had been
success ully ans ec ed) o hyg omycin and GCV. Al hough app oxima ely 2.5% o he
ans ec ed cells we e hyg omycin esis an , only 0.4 % we e bo h hyg omycin and GCV
esis an , indica ing ha app oxima ely 84 % o he cells (2.5 − 0.4
2.5 ) ha we e success ully
ans ec ed wi h pCEP4-IsceI con inued o exp ess a unc ional HSV- k gene. This inding
sugges ed ha minimal o no gene ic changes had occu ed in mos o he cells ha we e
ans ec ed wi h he I-SceI exp ession ec o .
Using a se ies o PCR assays ( ig. 1A), we ound ha hal o he 22 clones selec ed on he basis
o hyg omycin esis ance alone ( e med 22-1, 2, 3 e c.) showed al e ed DNA sequences
lanking he I-SceI clea age si e, indica ing ha he DNA had been clea ed and impe ec ly
epai ed. Two clones had dele ions o EF1α o HSV- k, as e idenced by he inabili y o ampli y
any o he segmen s indica ed in ig. 1A. Sequence analysis o PCR ampli ied agmen s
demons a ed ha 4 clones displayed a sho dele ion (9, 7, 3 and 1 nucleo ides), 1 clone
displayed a la ge dele ion (55 bp), and 4 clones had mo e complex ea angemen s due o
DNA inse ions a he I-SceI si e. In hese 4 clones he nucleo ide sequence o he inse ed DNA
segmen s ma ched sequences om ei he he ans ec ed episomal ec o (1), o om dis an
egions o he genome (3) ( able. 1).
As indica ed abo e, hal o he 22 clones ha had been success ully ans ec ed wi h he
episomal I-SceI exp ession ec o con ained “ge mline” PCR agmen s and did no show clea
e idence o sequence changes a he I-SceI si e upon sequence analysis. Howe e , he
ch oma og am o se e al clones wi h “ge mline” PCR agmen s exhibi ed an inc ease in
backg ound signal beginning p ecisely a he I-SceI si e (no shown), sugges ing ha hese
ch oma og ams ep esen ed mixed clones, some o which had mu a ions a he I-SceI si e.
These esul s sugges ha I-SceI media ed DSB occu ed in a leas hal o he cells ha we e
success ully ans ec ed.
2.3 Imp o ed eco e y o cells wi h mo e ex ensi e ea angemen s
As shown abo e, 50% o cells ans ec ed wi h he I-SceI exp ession ec o exhibi ed mu a ions
a ound he clea age si e. Gi en ha malignan cells o en display GCRs, we wan ed o
Va ga and Aplan Page 3
DNA Repai (Ams ). Au ho manusc ip ; a ailable in PMC 2005 Sep embe 29.
NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip
de e mine i we could inc ease he eco e y o clones con aining GCRs by modi ying ou
de ec ion scheme. We u ilized he nega i e selec ion p o ided by exp ession o HSV- k, and
ans ec ed cells wi h pCBASce, a non-episomal I-SceI exp ession ec o .
Following ans ec ion wi h he pCBASce ec o , app oxima ely 0.2 % o F5 cells we e GCV
esis an , and had e ained G418 esis ance, indica ing ha GCV esis ance was no acqui ed
h ough loss o he en i e in eg a ed ch omosome. We an icipa ed ha clones isola ed in his
ashion migh ha e mo e ex ensi e mu a ions, as clones wi h sho (i.e., <20–30 bp) dele ions
would con inue o exp ess Hs - k, and he e o e be elimina ed by GCV selec ion. A e 3 weeks
o selec ion in GCV and G418, he ans ec ed cells we e single-cell cloned o ob ain pu e
colonies; 58 GCV and G418 esis an colonies ( e med as 6-1,2,3 e c.) we e assayed o
e idence o GCRs.
2.4 Sc eening s a egy o analyzing GCRs gene a ed by one DSB
We used Sou he n blo hyb idiza ion o dis inguish clones which sus ained an in e s i ial
dele ion om hose ha sus ained mo e complex ea angemen s, such as la ge inse ions o
ansloca ions. To dis inguish be ween hese wo e en s, we hyb idized HindIII-diges ed
genomic DNA om GCV /G418 clones wi h a ch omosome 7 speci ic p obe ha hyb idized
ups eam o he EF1α in eg a ion si e ( e med p obe TV7), and a neo gene speci ic p obe ( ig.
1A). Since HindIII does no clea e wi hin he pEF1αTk cons uc , bo h p obes should iden i y
iden ical genomic DNA agmen s i he clone had sus ained an in e s i ial dele ion. Howe e ,
i a ansloca ion o o he GCR sepa a ed he 3′ and 5′ po ion o he in eg a ed cons uc , he
wo p obes should hyb idize o dis inc genomic DNA agmen s. Fig. 2 shows ha mos o
he clones sus ained an in e s i ial dele ion as e idenced by agmen s o iden ical sizes in he
duplica e hyb idiza ions. In some cases, one hyb idiza ion signal was los , sugges ing ha a
la ge dele ion, p esumably igge ed by I-SceI clea age be ween he hyb idiza ion a ge
sequences, ex ended beyond he a ge sequence o he p obe.
To in es iga e he mechanism o abe an epai ollowing I-SceI clea age, we analyzed he
nucleo ide sequence lanking he I-SceI clea age si e in GCV esis an clones. We used a se ies
o con en ional and in e se PCR eac ions o assess di e en egions o he in eg a ed
pEF1αTk ec o ( ig. 1A). O he 58 clones isola ed, ou we e shown o be a mix u e o wo
independen clones, ou clones we e ep esen ed wice, and one clone was ep esen ed h ee
imes. Six clones showed no mu a ion o he egion su ounding he I-SceI si e. O he 50
independen clones which exhibi ed mu a ions a ound he DSB si e, 48 we e shown by
Sou he n blo and/o PCR, o ha e sus ained an in e s i ial dele ion o DNA lanking he I-
SceI si e. Two clones los he en i e EF1α p omo e and a leas 1 kb o adjacen ch omosome
se en egion, bu e ained he neo gene downs eam o he I-SceI si e. To e i y ha he
dele ions we e gene a ed as a esul o e oneous DSB epai , as well as iden i y any addi ional
mu a ions (such as inse ions, in e sions, duplica ions) accompanying he dele ions, we
de e mined he b eakpoin sequences o 38 independen mu an clones. In one case, due o a
la ge inse ion o ec o sequences a he I-SceI si e, we did no de e mine bo h ends o he
dele ed segmen . Al oge he , he nucleo ide sequence changes om 37 mu an clones we e
comple ely cha ac e ized.
As shown in ig. 3., I-SceI media ed clea age o he in eg a ed pEF1αTk cons uc occu s a
posi ion 1352, be ween he 3′ end o he EF1α p omo e (1304) and he i s ATG codon o he
HSV- k gene (1359). Fine analysis o he dele ions demons a ed ha he pEF1αTk cons uc
sus ained asymme ic dele ions ollowing I-SceI clea age. Ups eam o he I-SceI clea age
si e, owa ds he EF1α p omo e , he mean size o he dele ed segmen was 442 bp. Howe e ,
hese dele ions a e une enly dis ibu ed. A majo i y o he clones (19) sus ained small dele ions,
sho e han 10 bp, whe eas nine clones had dele ions o 11–200 bp and nine clones had much
longe dele ions ha a e aged 1752 bp. The leng h o he dele ed segmen s downs eam o he
Va ga and Aplan Page 4
DNA Repai (Ams ). Au ho manusc ip ; a ailable in PMC 2005 Sep embe 29.
NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip
I-SceI induced DSB, ex ending in o he HSV- k gene, showed a mo e uni o m dis ibu ion. In
con as o he dele ions in ol ing EF1α, no dele ion was sho e han 100 bp o longe han
1700 bp. Six een clones showed sho egions o mic ohomology (1–6 bp) a he b eakpoin
junc ion ( ig. 3), and a sho palind ome sequence (4–8 bp) was ound a he b eakpoin o 14
clones, nine o which also showed mic ohomologies.
In addi ion o he dele ions desc ibed abo e, some clones con ained addi ional ea angemen s
in he egion clea ed by I-SceI. The p edominan ype o addi ional e en was a nucleo ide
inse ion; 18 clones con ained an inse ion in he gap c ea ed by he dele ion. These clones
could be di ided in o se e al g oups acco ding o he cha ac e is ics o he inse ed DNA
segmen .
Six clones showed inse ions o only a ew nucleo ides, and i was no possible o de e mine
whe he hese inse ions we e empla ed o no . A g oup o nine clones had sho inse ions o
11–24 bp. In hese clones, he co e o he inse ed nucleo ides was copied om ei he side o
he b eakpoin junc ion, c ea ing ei he a di ec (8 clones) o in e ed (1 clone) epea wi h he
lanking sequences ( ig. 3 ). Two clones con ained complex ea angemen s wi h inse ions
de i ed om he pEF1αTK ec o . A single clone con ained I-SceI exp ession ec o sequences
inse ed a he b eakpoin junc ion.
2.5 Modi ica ion o he expe imen al sys em
Following cha ac e iza ion o he clones desc ibed abo e, we modi ied he expe imen al
sys em in an e o o iden i y GCV esis an clones ha exhibi ed GCRs. We used di e en
exp ession ec o s (pCEP4-IsceI s. pCBASce), a ied he ans ec ion condi ions (sho e
pe iod o bulk cul u e) and, in some expe imen s omi ed G418 om he selec ion medium.
We eco e ed 76 addi ional clones ( e med 5-1, 2 3, e c. and 29-1, 2, 3, e c.) om hese
expe imen s, and de ec ed p ima ily in e s i ial dele ions simila o hose desc ibed abo e. We
again ound unequal dele ions a ound he I-SceI clea age si e, he p esence o sho di ec
epea sequences, and a e inse ion e en s.
Fi e clones exhibi ed la ge inse ions ha ma ched gene segmen s om dis an ch omosomal
egions; wo addi ional clones sus ained complex ea angemen s in ol ing DNA inse ions
om ch omosome 7 egions adjacen o he pEF1αTk in eg a ion si e ( able 1). The Sou he n
blo hyb idiza ion pa e n o clone 5–22 could no be explained by a simple dele ion ( ig. 2)
and was consis en wi h a ch omosomal ansloca ion, as unique HindIII agmen s hyb idized
o p obes Neo and TV7. PCR eac ions e ealed ha his clone had e ained he EF1α p omo e ,
and sus ained a sho dele ion o HSV- k sequences. In e se PCR eac ions showed ha
EF1α p omo e sequences immedia ely adjacen o he I-SceI si e had been joined o a sequence
o a leas 982 bp de i ed om ch omosome 15 α sa elli e cen ome ic epea sequences,
sugges ing ha his clone had sus ained a ch omosomal ansloca ion. O he clones ha we e
comple ely cha ac e ized, 56% had in e s i ial dele ions, 24 % had dele ions accompanied by
small (<30 bp) inse ions, and 20% dele ions accompanied by la ge (>30 bp) inse ions.
3. Discussion
Impe ec epai o DSBs is hough o play an impo an ole in gene a ing GCRs associa ed
wi h malignan ans o ma ion. To examine how DSBs migh lead o GCRs, we in es iga ed
he ou come o DSB epai in he human monocy ic cell line U937. To ob ain a de ailed analysis
o epai e en s ollowing a single, speci ic DSB, we induced DSBs wi h he I-SceI
endonuclease. The simples mechanism o epai o an I-SceI induced DSB is a pe ec
eliga ion e en , which would ec ea e an I-SceI ecogni ion sequence ha would emain
suscep ible o I-SceI clea age. Howe e , i he clea ed ecogni ion sequence we e epai ed
impe ec ly, no u he I-SceI clea age would be possible, since he I-SceI ecogni ion si e
Va ga and Aplan Page 5
DNA Repai (Ams ). Au ho manusc ip ; a ailable in PMC 2005 Sep embe 29.
NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip

would ha e been des oyed. We ound ha hal (11/22) o he clones success ully ans ec ed
wi h an episomal I-SceI exp ession ec o showed clea e idence o I-SceI clea age, sugges ing
ha I-SceI media ed clea age o genomic a ge s was easonably e icien .
To en ich o clones which may ha e sus ained mo e ex ensi e mu a ions (such as in e sions,
inse ions, ansloca ions, o la ge dele ions) ollowing epai o an I-SceI-induced DSB, we
made use o he nega i e selec ion p o ided by he HSV- k gene. Simila o p io epo s ha
used oden cells[3,18], we ound ha he mos common mu a ion in he human U937 sub-
clones ha su i ed he GCV selec ion was an in e s i ial dele ion, o en accompanied by
addi ional e en s (inse ions, in e sions, duplica ions). Many o he clones showed hallma ks
o NHEJ, such as inse ion o di ec o in e ed epea s o mic ohomologies a he b eakpoin s.
We eco e ed a o al o ou een clones ha con ained la ge segmen s o o eign DNA inse ed
a he I-SceI si e, and a single clone (clone 5–22) wi h a ea angemen consis en wi h a
ch omosomal ansloca ion. Fou clones con ained sequences om he I-SceI exp ession
ec o s, simila o p e ious epo s [22], and wo clones con ained ch omosome se en
sequences de i ed om egions nea he pEF1αTK in eg a ion si e. O in e es , eigh clones
con ained DNA inse ions ha ma ched sequences om dis an egions o he genome ( able
1); se en o he eigh inse ion e en s in ol ed known ansc ibed egions, sugges ing wo
possibili ies as o he sou ce o hese sequences. The inse ed segmen s could ha e been de i ed
om double-s anded DNA agmen s, o DNA/RNA he e o-duplexes, as sugges ed o he
ec o cap u e e en s. In his scena io, RNA molecules may ha e se ed as a sou ce o DNA
“pa ches” ia e e se ansc ip ion, as seen in endonuclease-independen LINE L1
e o ansposi ions [23–25]. A second possibili y is ha dis an genomic egions se ed as a
empla e o hese sequences. These segmen s could ha e been copied in o he gap ini ia ed by
I-SceI clea age o , al e na i ely, could ha e been excised om he genome and inse ed a he
b eakpoin . Two o hese eigh inse ions we e likely he esul o a h ee-way liga ion, since
he inse ed DNA segmen s we e de i ed om wo dis inc egions o he genome. In bo h
ins ances, he e we e no sequence mo i s sha ed be ween he wo inse ed sequences.
Addi ionally, i is in e es ing o no e ha a leas one inse ed DNA segmen (D4Z4) is
associa ed wi h a known in- i o genomic ins abili y phenomenon. This sequence is ound in
andem epea on 4q35.2, a egion ha is hough o ha e been de i ed om an
in e ch omosomal exchange wi h he nea ly iden ical sub elome ic 10q26 [26], and o en
pa icipa es in in ach omosomal ecombina ions ha lead o epea con ac ions [27].
Al hough he mu a ions in his s udy ook place wi hin an a i icial DNA cons uc , his ype
o aul y epai could easily lead o inac i a ion o umo supp esso genes o he p oduc ion
o oncogenic usion genes. Fo ins ance, a sho in e s i ial dele ion o he BRCA1 gene, which
shows nucleo ide sequence changes simila o hose desc ibed he e, leads o inac i a ion o he
gene [28], and inse ions o AF5Q31 sequences wi hin he MLL locus can lead o oncogenic
MLL-AF5Q31 usions [29]. The expe imen al sys em desc ibed he e p o ides a pla o m use ul
o elabo a ing he mechanisms by which epai o DSBs by NHEJ may lead o ine and g oss
ch omosomal abe a ions.
4. Ma e ials and Me hods
4.1 Vec o cons uc ion
pEF1α Tk was gene a ed by diges ing pEF1αNUPHOX (a pcDNA3 based ec o con aining
a human EF1α p omo e segmen ) wi h BamHI and No I o emo e he NUPHOX inse and
o p o ide a ec o wi h an EF1α p omo e . The HSV- k gene was ampli ied om he pTkNeo
ec o using p ime s Tk e e se (AATGCGGCCGCAGTTAGCCTCCCCCATCTC) and
TkFwBamHI
(AAGGGATCCTAGGGATAACAGGGTAATGGCTTCGTACCCCTGCCAT), wi h he
Va ga and Aplan Page 6
DNA Repai (Ams ). Au ho manusc ip ; a ailable in PMC 2005 Sep embe 29.
NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip
la e p ime con aining an I-SceI ecogni ion si e immedia ely 5′ o he HSV- k gene. The PCR
p oduc was diges ed wi h No I and BamHI, pu i ied, and liga ed in o he EF1α ec o
backbone. The pCEP4-IsceI plasmid was gene a ed by cloning he 3Xnls-I-SceI agmen om
he pPGK3XnlsI-SceI ec o [30], in o he HindIII (blun ed) and BamHI si es o he episomal
exp ession ec o pCEP4 (In i ogen, Ca lsbad, CA).
4.2 T ans ec ions
The U937 human monocy ic leukemia cell line (main ained in RPMI 1640, supplemen ed wi h
10% e al cal se um, 2 mM L-glu amine, 100 U/ml penicillin and 100 μgml S ep omycin)
was elec opo a ed wi h ScaI linea ized pEF1αTk using he Gene Pulse II elec opo a ion
sys em (Bio-Rad Labo a o ies, Inc., He cules, CA), wi h pulses o 0.4 kV and 975 μF, and
s able G418R clones we e isola ed.
T ans ec ions wi h ec o s pCEP4-IsceI, pPGK3XnlsI-SceI o pCBASce [4]we e pe o med
using DMRIE-C eagen (In i ogen, Ca lsbad, CA). . On he ou h o i h day ollowing
ans ec ion, cells we e expanded in bulk, o we e pla ed in o 96 o 24 well pla es a 3 cells/
well, 9 cells/well and 27 cells/well, o a 250 cells/well, 750 cells/well, 2250 cells/well and
6750 cells/well densi y, espec i ely. Selec ion agen s GCV ( om In i oGen, San Diego, CA,
CAS n°: 82410-32-0), G418 ( om In i ogen, Ca lsbad, CA, CAS n°: 1405-41-0) and
Hyg omycin B ( om In i ogen, Ca lsbad, CA, CAS n°: 31282-04-9) we e added o he wells.
The ollowing selec ion condi ions we e applied: 40 μ M GCV, o 40 μM GCV and 400 μg/
ml G418 in ans ec ions done wi h pCBASce; 200 μg/ml Hyg omycin, 200 μg/ml Hyg omycin
and 20 μM GCV, o 40 μM GCV in ans ec ions done wi h pCEP4-IsceI.
4.3 Con en ional and in e se PCR
The PCR eac ions indica ed in ig. 1A we e ca ied ou using 100 ng o genomic DNA as
empla e in he p esence o 0.2 μM p ime s wi h ei he Taka a LA Taq (PCR #2, 3) (Taka a
Mi us Bio, Madison, WI) o wi h PCR Supe mix ( eac ions 1, 4 and 5) (In i ogen, Ca lsbad,
CA), acco ding o he manu a u e s’ ecommenda ions. Fo in e se PCR eac ions, 1 μg o
genomic DNA was diges ed wi h ei he C oI, HindIII o AluI in 100 μl. The samples we e
ex ac ed wi h phenol-chlo o o m, e hanol p ecipi a ed, and sel -liga ed in 250 μl using T4
Ligase (P omega, Madison, WI). F agmen s con aining EF1α sequences we e ampli ied in
Supe mix (In i ogen) using p ime s designed o a nes ed PCR. De ails o p ime sequences
and ampli ica ion p o ocols a e a ailable upon eques .
4.4 Sou he n Blo analysis
Duplica e samples con aining 10 μg o genomic DNA om GCV esis an clones we e diges ed
wi h HindIII, size- ac ioned on 0.8% aga ose gels, and ans e ed o a ni ocellulose
memb ane and hyb idized o a ch omosome 7 speci ic agmen (p obe TV7; nuc
112330867-112331229) o a NcoI-SmaI G418 agmen isola ed om pPRC/CMV
(In i ogen, Ca lsbad, CA). The agmen s we e labeled wi h 32P using Ready-To-Go DNA
labelling beads (Ame sham Biosciences) and hyb idized as p e iously desc ibed [31]. Final
washing condi ions we e 0.1% SDS/0.1x SSC a 52°C o bo h p obes.
4.5 Sequence Analysis
Nucleo ide sequences we e de e mined using an Applied Biosys ems 3730 and compa ed o
he human genome assembly (Uni e si y o San a C uz July 2003 eeze, based on NCBI
Human Genome Build 34) [32].
Va ga and Aplan Page 7
DNA Repai (Ams ). Au ho manusc ip ; a ailable in PMC 2005 Sep embe 29.
NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip
Acknowledgemen s
The au ho s hank Ma ia Jasin o p o iding he I-SceI exp ession ec o , pCBASce and G eg Donoho o p o iding
he I-SceI exp ession ec o , pPGK3XnlsI-SceI. We also hank Ilan Ki sch and Michael Kuehl o help ul and
s imula ing discussions.
Re e ences
1. Vilenchik MM, Knudson AG. Endogenous DNA double-s and b eaks: p oduc ion, ideli y o epai ,
and induc ion o cance . P oc Na l Acad Sci U S A 2003;100:12871–12876. [PubMed: 14566050]
2. Liang F, Han M, Romanienko PJ, Jasin M. Homology-di ec ed epai is a majo double-s and b eak
epai pa hway in mammalian cells. P oc Na l Acad Sci U S A 1998;95:5172–5177. [PubMed:
9560248]
3. Sa gen RG, B enneman MA, Wilson JH. Repai o si e-speci ic double-s and b eaks in a mammalian
ch omosome by homologous and illegi ima e ecombina ion. Mol Cell Biol 1997;17:267–277.
[PubMed: 8972207]
4. Richa dson C, Moynahan ME, Jasin M. Double-s and b eak epai by in e ch omosomal
ecombina ion: supp ession o ch omosomal ansloca ions. Genes De 1998;12:3831–3842.
[PubMed: 9869637]
5. Lin FL, Spe le K, S e nbe g N. In e molecula ecombina ion be ween DNAs in oduced in o mouse
L cells is media ed by a nonconse a i e pa hway ha leads o c osso e p oduc s. Mol Cell Biol
1990;10:103–112. [PubMed: 2294396]
6. Ro h DB, Wilson JH. Nonhomologous ecombina ion in mammalian cells: ole o sho sequence
homologies in he joining eac ion. Mol Cell Biol 1986;6:4295–4304. [PubMed: 3025650]
7. Liebe MR, Ma Y, Pannicke U, Schwa z K. Mechanism and egula ion o human non-homologous
DNA end-joining. Na Re Mol Cell Biol 2003;4:712–720. [PubMed: 14506474]
8. Gu H, Fo s e I, Rajewsky K. Sequence homologies, N sequence inse ion and JH gene u iliza ion in
VHDJH joining: implica ions o he joining mechanism and he on ogene ic iming o Ly1 B cell and
B-CLL p ogeni o gene a ion. Embo J 1990;9:2133–2140. [PubMed: 2113468]
9. Smi h J, Riballo E, Kysela B, Baldey on C, Manolis K, Masson C, Liebe MR, Papadopoulo D, Jeggo
P. Impac o DNA ligase IV on he ideli y o end joining in human cells. Nucleic Acids Res
2003;31:2157–2167. [PubMed: 12682366]
10. Fe guson DO, Al FW. DNA double s and b eak epai and ch omosomal ansloca ion: lessons om
animal models. Oncogene 2001;20:5572–5579. [PubMed: 11607810]
11. Lee GS, Neidi ch MB, Salus SS, Ro h DB. RAG p o eins shephe d double-s and b eaks o a speci ic
pa hway, supp essing e o -p one epai , bu RAG nicking ini ia es homologous ecombina ion. Cell
2004;117:171–184. [PubMed: 15084256]
12. Mo gan WF, Co co an J, Ha mann A, Kaplan MI, Limoli CL, Ponnaiya B. DNA double-s and
b eaks, ch omosomal ea angemen s, and genomic ins abili y. Mu a Res 1998;404:125–128.
[PubMed: 9729329]
13. Zucman-Rossi J, Legoix P, Vic o JM, Lopez B, Thomas G. Ch omosome ansloca ion based on
illegi ima e ecombina ion in human umo s. P oc Na l Acad Sci U S A 1998;95:11786–11791.
[PubMed: 9751743]
14. Ellio B, Jasin M. Double-s and b eaks and ansloca ions in cance . Cell Mol Li e Sci 2002;59:373–
385. [PubMed: 11915950]
15. Richa dson C, Jasin M. F equen ch omosomal ansloca ions induced by DNA double-s and b eaks.
Na u e 2000;405:697–700. [PubMed: 10864328]
16. Richa dson C, Jasin M. Coupled homologous and nonhomologous epai o a double-s and b eak
p ese es genomic in eg i y in mammalian cells. Mol Cell Biol 2000;20:9068–9075. [PubMed:
11074004]
17. Lukacso ich T, Yang D, Waldman AS. Repai o a speci ic double-s and b eak gene a ed wi hin a
mammalian ch omosome by yeas endonuclease I-SceI. Nucleic Acids Res 1994;22:5649–5657.
[PubMed: 7838718]
18. Phillips JW, Mo gan WF. Illegi ima e ecombina ion induced by DNA double-s and b eaks in a
mammalian ch omosome. Mol Cell Biol 1994;14:5794–5803. [PubMed: 8065314]
Va ga and Aplan Page 8
DNA Repai (Ams ). Au ho manusc ip ; a ailable in PMC 2005 Sep embe 29.
NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip
19. Honma M, Izumi M, Saku aba M, Tadoko o S, Sakamo o H, Wang W, Ya agai F, Hayashi M.
Dele ion, ea angemen , and gene con e sion; gene ic consequences o ch omosomal double-s and
b eaks in human cells. En i on Mol Mu agen 2003;42:288–298. [PubMed: 14673874]
20. Jasin M. Gene ic manipula ion o genomes wi h a e-cu ing endonucleases. T ends Gene
1996;12:224–228. [PubMed: 8928227]
21. Sunds om C, Nilsson K. Es ablishmen and cha ac e iza ion o a human his iocy ic lymphoma cell
line (U-937). In J Cance 1976;17:565–577. [PubMed: 178611]
22. Lin Y, Waldman AS. Cap u e o DNA sequences a double-s and b eaks in mammalian
ch omosomes. Gene ics 2001;158:1665–1674. [PubMed: 11514454]
23. Syme DE, Connelly C, Szak ST, Capu o EM, Cos GJ, Pa migiani G, Boeke JD. Human l1
e o ansposi ion is associa ed wi h gene ic ins abili y in i o. Cell 2002;110:327–338. [PubMed:
12176320]
24. Mo ish TA, Gilbe N, Mye s JS, Vincen BJ, S ama o TD, Taccioli GE, Ba ze MA, Mo an JV.
DNA epai media ed by endonuclease-independen LINE-1 e o ansposi ion. Na Gene
2002;31:159–165. [PubMed: 12006980]
25. Eickbush TH. Repai by e o ansposi ion. Na Gene 2002;31:126–127. [PubMed: 12006979]
26. an Geel M, Dickson MC, Beck AF, Bolland DJ, F an s RR, an de Maa el SM, de Jong PJ, Hewi
JE. Genomic analysis o human ch omosome 10q and 4q elome es sugges s a common o igin.
Genomics 2002;79:210–217. [PubMed: 11829491]
27. Lemme s RJ, Van O e eld PG, Sandkuijl LA, V ieling H, Padbe g GW, F an s RR, an de Maa el
SM. Mechanism and iming o mi o ic ea angemen s in he sub elome ic D4Z4 epea in ol ed in
acioscapulohume al muscula dys ophy. Am J Hum Gene 2004;75:44–53. [PubMed: 15154112]
28. Ha douin A, Baumann J, Roussel G, Quillien V, Dugas C, Be he P. A new mu a ion in he BRCA1
gene (g.5196–5201del6, 5195–5202ins12), a 6 bp dele ion eplaced by he duplica ion o a 12 bp
adjacen ups eam in onic sequence. Hum Mu a 2001;17:154. [PubMed: 11180603]
29. De eney R, Che insky DS, Jani-Sai SN, G ossi M, Aplan PD. Inse ion o MLL sequences in o
ch omosome band 5q31 esul s in an MLL-AF5Q31 usion and is a a e bu ecu en abno mali y
associa ed wi h in an leukemia. Genes Ch omosomes Cance 2003;37:326–331. [PubMed:
12759932]
30. Donoho G, Jasin M, Be g P. Analysis o gene a ge ing and in ach omosomal homologous
ecombina ion s imula ed by genomic double-s and b eaks in mouse emb yonic s em cells. Mol Cell
Biol 1998;18:4070–4078. [PubMed: 9632791]
31. Aplan PD, Che insky DS, S anulla M, Bu hans WC. Si e-speci ic DNA clea age wi hin he MLL
b eakpoin clus e egion induced by opoisome ase II inhibi o s. Blood 1996;87:2649–2658.
[PubMed: 8639880]
32. Ken WJ. BLAT-- he BLAST-like alignmen ool. Genome Res 2002;12:656–664. [PubMed:
11932250]
Va ga and Aplan Page 9
DNA Repai (Ams ). Au ho manusc ip ; a ailable in PMC 2005 Sep embe 29.
NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip NIH-PA Au ho Manusc ip