This is a sel -a chi ed e sion o an o iginal a icle. This e sion
may di e om he o iginal in pagina ion and ypog aphic de ails.
Au ho (s):
Ti le:
Yea :
Ve sion:
Copy igh :
Righ s:
Righ s u l:
Please ci e he o iginal e sion:
CC BY 4.0
h ps://c ea i ecommons.o g/licenses/by/4.0/
Mic obes wi hin he building en elope : a case s udy on he pa e ns o coloniza ion and
po en ial sampling bias
© 2023 Da ies e al.
Published e sion
Da ies, Lucy R.; Ba be o-López, Ai o ; Läh eenmäki, Veli-Ma i; Salonen, An i;
Fedo ik, Filip; Haapala, An i; Wa s, Phillip C.
Da ies, L. R., Ba be o-López, A., Läh eenmäki, V.-M., Salonen, A., Fedo ik, F., Haapala, A., &
Wa s, P. C. (2023). Mic obes wi hin he building en elope : a case s udy on he pa e ns o
coloniza ion and po en ial sampling bias. Pee J, 11, A icle e16355.
h ps://doi.o g/10.7717/pee j.16355
2023
Submi ed 21 Ap il 2023
Accep ed 4 Oc obe 2023
Published 17 No embe 2023
Co esponding au ho
Lucy R. Da ies, [email p o ec ed]
Academic edi o
Jona han Thomas
Addi ional In o ma ion and
Decla a ions can be ound on
page 12
DOI 10.7717/pee j.16355
Copy igh
2023 Da ies e al.
Dis ibu ed unde
C ea i e Commons CC-BY 4.0
OPEN ACCESS
Mic obes wi hin he building en elope—a
case s udy on he pa e ns o coloniza ion
and po en ial sampling bias
Lucy R. Da ies1, Ai o Ba be o-López2, Veli-Ma i Läh eenmäki2, An i Salonen3,
Filip Fedo ik3, An i Haapala2and Phillip C. Wa s1
1Depa men o Biological and En i onmen al Science, Uni e si y o Jy äskylä, Jy äskylä, Finland
2Depa men o Chemis y, Uni e si y o Eas e n Finland, Joensuu, Finland
3Ci il Enginee ing, Facul y o Technology, Uni e si y o Oulu, Oulu, Finland
ABSTRACT
Humans a e exposed o di e se communi ies o mic obes e e y day. Wi h mo e ime
spen indoo s by humans, in es iga ions in o he communi ies o mic obes inhabi ing
occupied spaces ha e become impo an o deduce he impac s o hese mic obes
on human heal h and building heal h. S udies so a ha e gi en conside able insigh
in o he communi ies o he indoo mic obio a humans in e ac wi h, bu mainly
ocus on sampling su aces o indoo dus om il e s. Benea h he su aces hough,
building en elopes ha e he po en ial o con ain en i onmen s ha would suppo he
g ow h o mic obial communi ies. Bu due o design choices and dis ance om g ound
mois u e, o example, he empe a u e and humidi y ac oss a building will a y and
cause en i onmen al g adien s. These mic oen i onmen s could hen in luence he
composi ion o he mic obial communi ies wi hin he walls. He e we p esen a case
s udy designed o quan i y any pa e ns in he composi ions o ungal and bac e ial
communi ies exis ing in a building en elope and de e mine some o he key a iables,
such as ca dinal di ec ion, dis ance om loo o dis ance om wall joinings, ha
may in luence any mic obial communi y composi ion a ia ion. By d illing small holes
ac oss walls o a house, we ex ac ed mic obes on o ai il e s and conduc ed amplicon
sequencing. We ound sampling heigh (dis ance om he loo ) and ca dinal di ec ion
he wall was acing caused di e ences in he di e si y o he mic obial communi ies,
showing ha pa e ns in he mic obial composi ion will be dependen on sampling
loca ion wi hin he building. By sampling benea h he su aces, ou app oach p o ides
a mo e comple e pic u e o he mic obial condi ion o a building en i onmen , wi h he
signi ican a ia ion in communi y composi ion demons a ing a po en ial sampling
bias i mul iple sampling loca ions ac oss a building a e no conside ed. By iden i ying
ea u es o he buil en i onmen ha p omo e/ e a d mic obial g ow h, imp o emen s
o building designs can be made o achie e o e all heal hie occupied spaces.
Subjec s Mic obiology, Molecula Biology, En i onmen al Heal h
Keywo ds Indoo mic obio a, Buil en i onmen , Occupan heal h, Building mould
INTRODUCTION
In es iga ions in o mic obial communi ies o occupied spaces o he buil en i onmen
( he indoo mic obio a) ypically use me hods ha collec il e ed ai pa icles o dus ha
How o ci e his a icle Da ies LR, Ba be o-López A, Läh eenmäki V-M, Salonen A, Fedo ik F, Haapala A, Wa s PC. 2023.
Mic obes wi hin he building en elope—a case s udy on he pa e ns o coloniza ion and po en ial sampling bias. Pee J 11:e16355
h p://doi.o g/10.7717/pee j.16355
accumula e on indoo su aces (e.g.,Maes e e al., 2018;Pekkanen e al., 2018;Fu e al.,
2020). These me hods acili a e la ge-scale p ojec s (especially ci izen science (Ba be án e
al., 2015a;Ba be án e al., 2015b) and a e bo h s aigh o wa d and non-des uc i e, bu
hese samples canno sepa a e he mic obial con ibu ions o he s uc u al aspec s o he
building (e.g., he building en elope) om hose de i ed om he building occupan s
(e.g., hai o skin) (Cao e al., 2021) o he su ounding en i onmen (e.g., soil, pollen
g ains) (Ba be án e al., 2015a), wi h limi ed in o ma ion on how any s uc u al aspec s o
he building could be con ibu ing o he mic obio a o he buil en i onmen .
Buildings a e complex, h ee-dimensional s uc u es ha con ain signi ican spaces
benea h he occupan accessible su aces. By design, hese a eas a e in ended o be d y
en i onmen s, bu humidi y can be ound in hese spaces due o ai low (Fedo ik e
al., 2021). E idence o mic obial communi es inhabi ing ex eme en i onmen s such as
hype -a id a eas wi hin he A acama dese (Schulze-Makuch e al. 2018;Hwang e al.,
2021) o he In e na ional Space S a ion (Checinska Siela e al., 2019), aises he po en ial
o hese building a eas o hos iable mic obes. Some ungi gene a and ac inomyce es,
o example, ha e been cul u ed om insula ion ma e ial samples (Pessi e al., 2002) and
can pene a e building s uc u es (Pessi e al., 2002;Ai aksinen e al., 2004). The p esence
and po en ial con amina ion o indoo ai o hese mic obes is o signi ican conce n due
o hei de imen al e ec s on heal h (Jä i e al., 2018). In es iga ing ac o s in luencing
mic obio a o ma ion, such as building design, en i onmen al condi ions and ma e ials,
ha ha e an impac on hese mic obial communi ies would allow o be e p edic ions
and con ol o e building heal h p oblems, including ma e ial deg ada ion, indoo ai
quali y and human heal h conce ns due o mic obial in e ac ions. Es ablishing a clea e
pic u e and be e unde s anding o he mic obes occupying he whole buil en i onmen
could in luence building policies and demons a e he need o adap o a heal hie home.
Building design and s uc u al condi ion a e he e o e likely o be a key de e minan
o he mic obio a composi ion wi hin building s uc u es due o mic oen i onmen al
a ia ion. Fo example, g adien s in empe a u e, and/o mois u e in a building will be
an expec ed consequence o ma e ial choice and en elope dep h (Fedo ik e al., 2021), o
ca dinal di ec ion in which a s uc u e is acing (Kabá o áa & Ďu icaa, 2019). Examining
he mic obes ha li e benea h he su ace wi hin an occupied space is essen ial o
es ablishing a ulle pic u e o he mic obio a o he buil en i onmen . In-wall sampling
hough mus ake hese po en ial g adien s in o conside a ion as sampling in jus ew
loca ions may esul in sampling bias.
The goal o his s udy was o in es iga e possible di e ences in mic obial (bac e ia and
ungi) communi ies, ac oss di e en loca ions wi hin a building, ha ha e accumula ed
o e ime; he eby highligh ing he po en ial bias ha may a ise om insu icien in-wall
sampling. Addi ionally, we aimed o iden i y po en ial ac o s d i ing any a ia ion in
mic obial communi ies. To es ou app oach, we selec ed a esiden ial dwelling si ua ed
wi hin a o es ed a ea in Finland. As a s and-alone building wi h walls acing all ca dinal
di ec ions, i se ed as an ideal case-s udy. Samples we e aken by d illing small holes (Ø=
12 mm) in o di e en a eas o a home o make a con as be ween ca dinal di ec ions in
which he wall aces, he dis ance om loo le el and he dis ance om wall join s. Ai
Da ies e al. (2023), Pee J, DOI 10.7717/pee j.16355 2/18
samples we e hen ex ac ed om spaces be ween in e nal and ex e nal walls o ob ain
a sample o mic obes which was hen quan i ied using amplicon sequencing. This no el
app oach iden i ied signi ican spa ial a ia ion in he bac e ial and ungal communi ies o
demons a e he di e si y o mic obes wi hin building ma e ials.
METHODS
Sampling plan and mic obial ex ac ion
On Sep embe 20 h, 2020, we sampled a adi ional Finnish wood- amed house wi h
a na u al g a i y-d i en en ila ion loca ed in municipali y o Vaala, Finland, ha had
adi ional sawdus and wood shi e insula ion om 1962 on cas conc e e ounda ion by
inse ing a s e ile ygon ube in o 12 mm holes ha had been d illed in o he walls, wi h
he hole hen sealed using modelling clay o p e en collec ion o ‘indoo ai ’ om li ing
space. Ai om wi hin he building elemen was pumped (20 min a 3 li es/min) using a
SKC uni e sal ai pump (model 224-PCMTX4K) o e a Su eSeal Blank S y ene casse e
con aining a 25 mm PTFE memb ane il e . Holes we e d illed in di e en sampling a eas:
(1) di ec ion (i.e., he ca dinal di ec ion in which he wall is acing), (2) heigh om loo
le el (lowe , middle and uppe ) and (3) posi ion (nea le wall joining, cen e o he wall
and nea igh wall joining) (Fig. 1). Addi ionally, ai samples we e aken h oughou he
day a ound he ou side o he building and om a ious ooms wi hin he building.
DNA ex ac ion and sequencing
Fil e s we e soaked in molecula g ade wa e o 12 h. This was o ensu e mic obes we e
washed ‘ou ’ o he il e s and easily accessible o DNA ex ac ion. DNA was ex ac ed
om he il e and i s wa e using Qiagen DNeasy®Powe Soil®P o Ki acco ding o he
manu ac u e ’s p o ocol, bu wi h he ollowing adjus men s: (1) Powe Bead P o Tubes
we e o exed o 20 min a maximum pm speed. DNA was also ex ac ed om con ol
samples: only bu e , molecula g ade wa e and bu e , and unused il e s and bu e .
Bac e ial and ungal axa was hen iden i ied by amplicon sequencing pe o med
on an Illumina No oSeq by No oGene L d (h ps://www.no ogene.com/us-en/).
Bac e ial 16S V4 egion (uni e sal p ime s GTGCCAGCMGCCGCGGTAA and
GGACTACHVGGGTWTCTAAT) and he ungal ITS2 egion (uni e sal p ime s
CATCGATGAAGAACGCAGC, TCCTCCGCTTATTGATATGC) we e a ge ed.
P ocessing and analysing ungal and bac e ial sequences
P ime s we e emo ed using cu adap 1.10 (Ma cel, 2011) on ITS eads, while DADA2
1.18 (Callahan e al., 2016) was used o emo e p ime s and unca e ( o wa d eads a
base 220, e e se eads a base 200) he 16S eads. DADA2 was used o bo h ITS and
16S da a o me ge pai ed-end eads, emo e chimae as and iden i y amplicon sequence
a ian s (ASVs) (Callahan e al., 2016). Taxonomy was assigned o ITS and 16S ASVs using
UNITE . 10.05.2021 (Nilsson e al., 2015) and he SILVA .138 da abase (Quas e al.,
2013) espec i ely. decon am .1.14.0 (Da is e al., 2018) was used o elimina e po en ial
con aminan ASVs iden i ied in he con ol samples, using he p e alence me hod and he
p obabili y ha a ead is a con aminan h eshold o 0.5 (Da is e al., 2018).To emo e low
Da ies e al. (2023), Pee J, DOI 10.7717/pee j.16355 3/18
Figu e 1 Schema ic showing he layou o he sampling si e. Holes we e d illed in o he walls o a adi-
ional Finnish wood- amed house which con ained wo bed ooms, a li ing oom and a ki chen. The oile
was loca ed in an ou -house. Samples we e aken om walls acing di e en ca dinal di ec ion, a di e -
en heigh s (lowe , middle and uppe ), and a di e en posi ions (le , cen e and igh ). The g id squa es
show he di e en a eas sampled. Al hough only shown on a couple o walls, his scheme was ollowed
on all sampled walls. Sampled walls a e highligh ed in yellow. Wall empe a u es and humidi y measu e-
men s, whe e aken, a e labelled in whi e on , ou side empe a u e and humidi y in blue, inside in da k-
g ey, and loo in black. Measu emen s we e aken du ing he day o sampling.
Full-size DOI: 10.7717/pee j.16355/ ig-1
equency ASVs which we e mos likely a esul o sequencing e o s, while also a oiding
he emo al o a e ASVs, ASVs ha had a o al coun o 20 ac oss he en i e da ase we e
emo ed.
S a is ical analysis
S a is ical analysis was pe o med using R .4.1.3 (R Co e Team, 2021). The package FEAST
.1.0 (Fas Expec a ion-mAximiza ion mic obial Sou ce T acking) (Shenha e al., 2019)
was used o es ima e he con ibu ions o he mic obial communi ies om indoo ai and
ou doo ai o he mic obial communi ies o he in-wall samples. To do his, he ai samples
we e labelled as ‘sou ces’, and he wall samples we e as labelled ‘sinks’. To al Sum Scaling
(TSS) no maliza ion was used o emo e any bias ela ed o di e ences in sequencing dep h
in di e en lib a ies by di iding each ASV coun wi h he o al lib a y size pe sample.
Analyses o he mic obial communi ies was hen pe o med on he ela i e abundance
o each ASV using phyloseq .1.38.0 (McMu die & Holmes, 2013) and he package egan
.2.5-7 (Oksanen e al., 2019). The package egan was used o calcula e he alpha di e si y
measu es ( he numbe o di e en axa g oups and hei abundance, and he numbe o
dis inc axa) and be a di e si y measu es ( he di e si y di e ences be ween wo samples).
P edic o s o a ia ion in alpha di e si y was assessed using a gene alized linea model ha
con ained alpha di e si y as he esponse a iable and di ec ion, heigh and posi ion as
p edic o a iables. We de ec ed no o e -dispe sion in he model. We compa ed he ull
Da ies e al. (2023), Pee J, DOI 10.7717/pee j.16355 4/18
model wi h educed models om which a p edic o a iable was omi ed using a F- es
o ob ain p- alues. The package egan was used o conduc PERMANOVA es s (using
he adonis2() command, using he B ay Cu is dis ance me hod, and se ing pe mu a ions
o 999) o assess p edic o s o a ia ion in be a di e si y, and was also used o conduc
a dis ance-based edundancy analysis (dbRDA) o dina ion me hod which we used o
isualise di e ences be ween he mic obial communi ies ac oss di e en g oups (Legend e
& Ande son, 1999). To examine he ASVs d i ing any a ia ion in he be a di e si y, he
SIMPER() command om egan was used o calcula e simila i y pe cen ages (Cla ke,
1993). F om he iden i ied gene a, a K uskal–Wallis es was conduc ed, ollowed by a
Dunn es o assess pai -wise signi ican di e ences (Dinno, 2017). S a is ical signi icance
was based on adjus ed p- alues using he Bon e oni me hod (Dunn, 1961). Plo s we e
p oduced using ggplo 2 .3.3.6 (Wickham, 2016) and pa chwo k .1.1.2 (Pede sen, 2022).
RESULTS AND DISCUSSION
To quan i y pa e ns o mic obial coloniza ion, we i s measu ed alpha di e si y using
Shannon di e si y ( he numbe o di e en axa g oups and hei abundance), and amplicon
sequence a ian (ASV) ichness ( he numbe o dis inc axa). Fo ungal communi ies,
he heigh a which he samples we e aken had a signi ican e ec on Shannon di e si y
(Table 1), wi h he lowes di e si y ound in he middle o he wall (al hough a Tukey
pos hoc es did no show pai wise signi ican di e ences: Lowe s Middle Padjus ed =0.24;
Middle s Uppe Padjus ed =0.12; Lowe s Uppe Padjus ed =0.96) (Fig. 2B). The e we e no
signi ican di e ences be ween he ca dinal di ec ion o he wall and posi ions (Figs. 2A,
2C;Table 1). Al hough no signi ican (Table 1), heigh om g ound showed a quali a i e
pa e n whe e he alpha di e si y measu emen s o he bac e ial communi ies dec eased
om he lowe o he uppe pa o he wall (Fig. 3B). We we e he e o e in e es ed in
examining whe he he Shannon di e si y and ichness co ela ed wi h a quan i a i e
measu emen o he heigh o he wall. When aking he dis ance om he loo whe eby
he holes we e d illed in o conside a ion as linea a iables (20 cm, 120 cm, 220 cm),
we ound he Shannon di e si y o bac e ial communi ies signi ican ly dec eased as he
dis ance om he loo inc eases (F1,21 =4.12, P<0.04). As wi h he alpha di e si y o
ungal communi ies, he e we e no signi ican di e ences be ween he di ec ions and
posi ions (Figs. 3A,3C;Table 1).
Fungi and bac e ia can inhabi di e se en i onmen s (S o ze & Hengge, 2011;Ha u a &
Kanno, 2015), wi h he communi y composi ion dependen on he ou come o selec ion
and compe i ion among axa. In na u al en i onmen s, en i onmen al a ia ion in,
o example, humidi y (Wang e al., 2021), mois u e (Bo owik & Wyszkowska, 2016),
empe a u e (No ingham e al., 2022), and pH (Scholie e al., 2022) a e impo an d i e s
o ungal and bac e ial composi ion and ac i i y. Jus as he e a e en i onmen al g adien s
in na u e (Wang e al., 2021), ypically, inc easing highe up you go in a wall is associa ed
wi h a d ye and wa me en i onmen (Fedo ik e al., 2021). I is hese a ia ions ha would
elici changes in mic obio a composi ion.
Fo ungal and bac e ial ichness, he a iable ha had he g ea es a iance was he
ca dinal di ec ion in which he sampled wall was acing (Table 1). Samples aken om wes
Da ies e al. (2023), Pee J, DOI 10.7717/pee j.16355 5/18
Table 1 S a is ical esul s om he F- es s o he alpha di e si y o ungal and bac e ia communi ies. Resul s we e ob ained by compa ing a
gene alized linea model con aining ei he Shannon di e si y o numbe o indi idual ASVs as he esponse a iable and di ec ion, heigh and posi-
ion as he p edic o a iables wi h a educed model whe e a p edic o a iable was omi ed.
Shannon di e si y index Numbe o indi idual ASVs
Kingdom Va iable Es ima e ±s.e. R-squa ed Fd. P- alue Es ima e ±s.e. R-squa ed Fd. P- alue
Di ec ion 2.06 ±0.39 0.13 1.841,21 0.16 21.5 ±10.34 0.28 2.091,21 0.12
Fungi Heigh 2.15 ±0.27 0.13 4.111,21 0.03*29.64 ±8.59 0.01 0.381,21 0.69
Posi ion 2.04 ±0.25 0.04 0.371,21 0.68 35.71 ±7.23 0.11 1.671,21 0.21
Di ec ion 3.05 ±0.26 0.13 1.761,21 0.18 202.67 ±38.55 0.18 2.501,21 0.08
Bac e ia Heigh 3.31 ±0.18 0.15 2.881,21 0.08 236.73 ±28.54 0.11 2.841,21 0.08
Posi ion 2.93 ±0.18 0.02 0.991,21 0.38 182.93 ±26.28 0.03 1.571,21 0.23
No es.
*Signi ican P- alue.
acing walls had he highes numbe o indi idual ASVs (Figs. 2B,3A). P e ious s udies
on indoo mic obio a ha e also shown ca dinal di ec ion o ha e an impo an impac
on bac e ial communi ies (Fahimipou e al., 2018;Ho e e al., 2020). Though ocusing
on iable bac e ia on su aces, a he han in-wall sampling, Ho e e al. (2020) ound
wes acing ooms wi h windows o ha e a highe abundance o iable bac e ia compa ed
o ooms acing o he ca dinal di ec ions due o di ec sunligh (Ho e e al., 2020). The
in ensi y o di ec sunligh will a y ac oss di e en seasons and as such, s udies ha e
shown exposu e o indoo mic obes can a y ac oss seasons (Ga e e al., 1997;Rin ala
e al., 2008). The hea gene a ed by di ec sunligh can inc ease indoo humidi y - a ac o
ha con ibu es o hese seasonal a ia ions (F ankel e al., 2012;Knudsen, Gunna sen &
Madsen, 2017). The e o e, when in es iga ing mic obial composi ions, humidi y wi hin
he building en elope would likely be an impo an en i onmen al ac o causing a ia ion.
To examine he mos ela i ely abundan axa, we g ouped he ASVs a genus le el
and iden i ied he op i een (see Figs. S1 and S2 o ungi and bac e ia, espec i ely).
Se e al o he op ela i ely abundan gene a iden i ied in his s udy a e associa ed wi h
building and occupan heal h. Fo example, ungal species o An odia, and He e obasidion
a e key house- o ungi, as hey decay wooden building ma e ials (Huck eld & Schmid ,
2006;Schmid , 2007;Schmid & Huck eld , 2011;Gab iel & Š ec, 2017;Haas e al., 2019).
Sa ocladium species a e associa ed wi h p oblems in biodeg ada ion o mine al-based
ma e ials (Ponizo skaya e al., 2019). Species o Aspe gillus a e epo ed om mul iple
s udies o he indoo en i onmen s (Tanaka-Kagawa e al., 2005;Mousa i e al., 2016;
Chen e al., 2017) and some species om his genus, along wi h species o Phialocephala,
a ec he se e i y o as hma ic symp oms (Hedaya i, Mayahi & Denning, 2010;Dannemille
e al., 2016;Mousa i e al., 2016). Many o he op ela i ely abundan bac e ial gene a ha e
also been iden i ied in s udies on he indoo en i onmen . Acine obac e (Hui e al., 2019;
Wu e al., 2022), Cu ibac e ium (Sun e al., 2022), S aphylococcus (Moon, Huh & Jeong,
2014;Madsen e al., 2018) and Blaudia (Fu e al., 2021), o example, occu in samples o
indoo dus and swabs. P e ious s udies ha e also made links be ween hese gene a and
nega i e impac s on human heal h (Kozajda, Jeżak & Kapsa, 2019;Fu e al., 2021;Sun e
al., 2022;Wu e al., 2022). Fu he in es iga ions a e necessa y o de e mine i simila isks
Da ies e al. (2023), Pee J, DOI 10.7717/pee j.16355 6/18
Figu e 2 ITS alpha di e si y analysis: The a e age Shannon di e si y index and numbe o indi id-
ual ASVs (±s anda d e o o mean). Compa ing (A) di ec ion, (B) heigh , (C) posi ion. Smalle poin s
ep esen aw da a om each sample. Sample sizes: in e nal =5, no h =7, wes =6, sou h =4, eas =6;
lowe =11, middle =9, uppe =8; le =8, cen e =14, igh =6. An * indica es a signi ican F- es e-
sul .
Full-size DOI: 10.7717/pee j.16355/ ig-2
exis when hese gene a a e inhabi ing a eas ha a e no equen ly in di ec con ac wi h
humans. Rega ding ungal gene a, i is possible ha hey may emain do man and only
become p oblema ic when ce ain en i onmen al changes occu , such as excess mois u e.
Bu iden i ying he p esence o hese mic obial gene a is impo an because i p o ides
aluable insigh s in o he po en ial isks and could allow o mi iga ion o p oblems.
As he mic obial communi ies obse ed in household su aces can be sou ced om
building occupan s (Cao e al., 2021), o he su ounding en i onmen (Ba be án e al.,
2015a) and geog aphic loca ion (Chen e al., 2017), we wan ed o examine he po en ial
impac o he indoo and ou doo mic obial communi ies on he communi ies ound
wi hin he walls. Sou ce acking e ealed ha he ungal communi ies ound wi hin he
wall a e likely o be independen o he communi ies ound in he indoo and ou doo ai
(Fig. S3). Wi hin he bac e ial communi ies, hal o he wall samples had mo e han 50% o
ASVs ha could no be sou ced o he ai samples (Fig. S4), while he emaining had mo e
Da ies e al. (2023), Pee J, DOI 10.7717/pee j.16355 7/18
Figu e 3 16S alpha di e si y analysis: The a e age Shannon di e si y index and numbe o indi id-
ual ASVs (±s anda d e o o mean). Compa ing (A) di ec ion, (B) posi ion, (C) heigh . Smalle poin s
ep esen aw da a om each sample. Sample sizes: in e nal =5, no h =7, wes =6, sou h =4, eas =6;
lowe =11, middle =9, uppe =8; le =8, cen e =14, igh =6.
Full-size DOI: 10.7717/pee j.16355/ ig-3
o a mix o ai and unknown sou ces (Fig. S4). O he op i een bac e ial gene a (Fig. S4),
a numbe o hese could be aced o human as a sou ce, such as Faecalbac e ium (Bai e al.,
2023), Blaudia (Dobay e al., 2019) and Cu ibac e ium (Sun e al., 2022), o could be aced
o soil, o example Sphingomonas (Whi e, Su on & Ringelbe g, 1996) and Acine obac e
(Hui e al., 2019). Unde s anding when mic obes could colonize he building, such as
du ing ma e ial p ocessing o when being s o ed on a building si e, and in es iga ing i
hei ela i e abundance inc eases o e ime, would p o ide in o ma ion on hei po en ial
sou ces and dynamics wi hin he buil en i onmen . This knowledge could con ibu e o a
be e unde s anding o he ac o s in luencing he mic obio a o a building. Addi ionally,
as many mic obes ha e do man s ages, i would be in e es ing o de e mine which o hese
axa a e iable.
We nex quan i ied pa e ns in be a di e si y ( he di e si y be ween wo mic obial
communi ies). To de e mine he sampling a iable mos in luencing di e ences in
communi ies, we analysed B ays-Cu is dissimila i y (index based on he abundance
o indi idual ASV g oups) and Jacca d dis ance (index based on he p esence and absence
Da ies e al. (2023), Pee J, DOI 10.7717/pee j.16355 8/18
Gab iel J, Š ec K. 2017. Occu ence o indoo wood decay basidiomyce es in Eu ope.
Fungal Biology Re iews 31:212–217 DOI 10.1016/j. b .2017.05.002.
Galazzo G, an Bes N, Benedik e BJ, Janssen K, Be oe s L, D iessen C, Oomen M,
Lucchesi M, an Eijck PH, Becke HEF, Ho ne MW, Sa elkoul PH, S assen FRM,
Wol s PF, Pende s J. 2020. How o coun ou mic obes? The e ec o di e en
quan i a i e mic obiome p o iling app oaches. F on ie s in Cellula and In ec ion
Mic obiology 10:403 DOI 10.3389/ cimb.2020.00403.
Ga e MH, Hoope BM, Cole FM, Hoope MA. 1997. Ai bo ne ungal spo es in 80
homes in he La obe Valley, Aus alia: le els, seasonali y and indoo -ou doo
ela ionship. Ae obiologia 13:121–126 DOI 10.1007/BF02694428.
Haas D, May ho e H, Habib J, Galle H, Rein hale FF, Fuxjäge ML, Buzina W.
2019. Dis ibu ion o building-associa ed wood-des oying ungi in he ede al
s a e o S y ia, Aus ia. Eu opean Jou nal o Wood and Wood P oduc s 77:527–537
DOI 10.1007/s00107-019-01407-w.
Ha u a S, Kanno N. 2015. Su i abili y o mic obes in na u al en i onmen s and hei
ecological impac s. Mic obes and En i onmen s 30:123–125
DOI 10.1264/jsme2.ME3002 h.
Hedaya i MT, Mayahi S, Denning DW. 2010. A s udy on Aspe gillus species in houses
o as hma ic pa ien s om Sa i Ci y, I an and a b ie e iew o he heal h e ec s
o exposu e o indoo Aspe gillus.En i onmen al Moni o ing and Assessmen
168:481–487 DOI 10.1007/s10661-009-1128-x.
Ho e PF, Die z LG, Ishaq SL, Kline J, F e z M, Van Den Wymelenbe g KG. 2020.
Viable bac e ial communi ies on hospi al window componen s in pa ien ooms.
Pee J 8:e9580 DOI 10.7717/pee j.9580.
Huck eld T, Schmid O. 2006. Iden i ica ion key o Eu opean s and- o ming house-
o ungi. Mycologis 20(2):42–56 DOI 10.1016/j.mycol.2006.03.012.
Hui N, Pa ajuli A, Puhakka R, G ön oos M, Roslun MI, Va i HK, Selonen VAO, Yan G,
Si e N, Nu minen N, Oika inen S, Lai inen OH, Rajaniemi J, Hyö y H, Sinkkonen
A. 2019. Tempo al a ia ion in indoo ans e o di -associa ed en i onmen al
bac e ia in ag icul u al and u ban a eas. En i onmen In e na ional 132:105069
DOI 10.1016/j.en in .2019.105069.
Hwang Y, Schulze-Makuch D, A ens FL, Saenz JS, Adam PS, Sage C, Bo ne-
mann TLV, Zhao W, Zhang Y, Ai o A, Schlo e M, P obs AJ. 2021. Lea e no
s one un u ned: indi idually adap ed xe o ole an Thauma chaeo a shel e ed
below he boulde s o he A acama Dese hype a id co e. Mic obiome 9:234
DOI 10.1186/s40168-021-01177-9.
Jä i K, Hy ä inen A, Täubel M, Ka onen AM, Tu unen M, Jalkanen K, Pa o i a
R, Sy jänen T, Pi inen J, Salonen H, Ne alainen A, Pekkanen J. 2018. Mic obial
g ow h in building ma e ial samples and occupan s’ heal h in se e ely mois u e-
damaged homes. Indoo Ai 28:287–297 DOI 10.1111/ina.12440.
Kabá o áa V, Ďu icaa P. 2019. Measu ed and simula ed empe a u e alues in he
chosen wall o a wooden building conside ing ca dinal di ec ion. T ansp 40:718–723
DOI 10.1016/j. p o.2019.07.101.
Da ies e al. (2023), Pee J, DOI 10.7717/pee j.16355 15/18
Knudsen SM, Gunna sen L, Madsen AM. 2017. Ai bo ne ungal species associa ed wi h
mouldy and non-mouldy buildings—e ec s o ai change a es, humidi y, and ai e-
loci y. Building and En i onmen 122:161–170 DOI 10.1016/j.builden .2017.06.017.
Kozajda A, Jeżak K, Kapsa A. 2019. Ai bo ne S aphylococcus au eus in di e -
en en i onmen s—a e iew. En i onmen al Science and Pollu ion Resea ch
26:34741–34753 DOI 10.1007/s11356-019-06557-1.
Legend e P, Ande son MJ. 1999. Dis ance-based edundancy analysis: es ing mul i-
species esponses in mul i ac o ial ecological expe imen s. Ecological Monog aphs
69:1–24 DOI 10.1890/0012-9615(1999)069[0001:DBRATM]2.0.CO;2.
Madsen AM, Moslehi-Jenabian S, Islam MDZ, F ankel M, Spilak M, F ede iksen MW.
2018. Concen a ions o S aphylococcus species in indoo ai as associa ed wi h o he
bac e ia, season, ela i e humidi y, ai change a e, and S. au eus-posi i e occupan s.
En i onmen al Resea ch 160:282–291 DOI 10.1016/j.en es.2017.10.001.
Maes e JP, Jennings W, Wylie D, Ho ne SD, Siegel J, Kinney KA. 2018. Fil e
o ensics: mic obio a eco e y om esiden ial HVAC il e s. Mic obiome 6:22
DOI 10.1186/s40168-018-0407-6.
Ma cel M. 2011. Cu adap emo es adap e sequences om high- h oughpu sequencing
eads. EMBne .Jou nal [S.L.] . 17(n. 1):10–12 DOI 10.14806/ej.17.1.200.
McMu die PJ, Holmes S. 2013. Phyloseq: an R package o ep oducible in e ac-
i e analysis and g aphics o mic obiome census da a. PLOS ONE 8:e61217
DOI 10.1371/jou nal.pone.0061217.
Moon KW, Huh EH, Jeong HC. 2014. Seasonal e alua ion o bioae osols om indoo ai
o esiden ial apa men s wi hin he me opoli an a ea in Sou h Ko ea. En i onmen-
al Moni o ing and Assessmen 186:2111–2120 DOI 10.1007/s10661-013-3521-8.
Mousa i B, Hedaya i MT, Hedaya i N, Ilki M, Syedmousa i S. 2016. Aspe gillus species
in indoo en i onmen s and hei possible occupa ional and public heal h haza ds.
Cu en Medical Mycology 1:36–42 DOI 10.18869/acadpub.cmm.2.1.36.
Nilsson RH, Tede soo L, Rybe g M, K is iansson E, Ha mann M, Un e sehe M,
Po e TM, Beng sson-Palme J, Walke DM, de Sousa F, Gampe HA, La sson E,
La sson KH, Kõljalg U, Edga RC, Aba enko K. 2015. A comp ehensi e, au o-
ma ically upda ed ungal ITS sequence da ase o e e ence-based chime a con ol
in en i onmen al sequencing e o s. Mic obes and En i onmen s 30(2):145–150
DOI 10.1264/jsme2.ME14121.
No ingham AT, Sco JJ, Sal ons all K, B ode s K, Mon e o-Sanchez M, Puspök J,
Båå h E, Mei P. 2022. Mic obial di e si y declines in wa med opical soil and
espi a ion ise exceed p edic ions as communi ies adap . Na u e Mic obiology
7:1650–1660 DOI 10.1038/s41564-022-01200-1.
Oksanen J, Guillaume Blanche F, F iendly M, Kind R, Legend e P, McGlinn D,
Minchin P, O’Ha a B, Simpson GL, Solymos P, S e ens MHH, Szöcs E, Wagene
H. 2019. egan: communi y ecology package. R package 2.5-7. A ailable a h ps:
//CRAN.R-p ojec .o g/package= egan (accessed on Janua y 2022).
Pede sen TL. 2022. pa chwo k: he compose o plo s. R package e sion 1.1.2. A ailable
a h ps://CRAN.R-p ojec .o g/package=pa chwo k (accessed on Decembe 2022).
Da ies e al. (2023), Pee J, DOI 10.7717/pee j.16355 16/18
Pekkanen J, Valkonen M, Täubel M, Tische C, Leppänen H, Kä kkäinen PM, Rin ala
H, Zock J-P, Casas L, P obs -Hensch N, Fo sbe g B, Holm M, Janson C, Pin I,
Gislason T, Ja is D, Hein ich J, Hy ä inen A. 2018. Indoo bac e ia and as hma
in adul s: a mul icen e case—con ol s udy wi hin ECRHS II. Eu opean Respi a o y
Jou nal 51(2):1701241 DOI 10.1183/13993003.01241-2017.
Pessi AM, Suonke o J, Pen i M, Ku kilah i M, Pel ola K, Ran io-Leh imäki A. 2002.
Mic obial g ow h inside insula ed ex e nal walls as an indoo ai biocon amina ion
sou ce. AEM 68:963–967 DOI 10.1128/AEM.68.2.963-967.2002.
Ponizo skaya VB, Reb iko a NL, Kachalkin AV, An opo a AB, Bilanenko
EN, Mokee a VL. 2019. Mic omyce es as colonize s o mine al building ma-
e ials in his o ic monumen s and museums. Fungal Biology 123:290–306
DOI 10.1016/j. unbio.2019.01.002.
Quas C, P uesse E, Yilmaz P, Ge ken J, Schwee T, Ya za P, Peplies J, Glöck-
ne F. 2013. The SILVA ibosomal RNA gene da abase p ojec : imp o ed
da a p ocessing and web-based ools. Nucleic Acids Resea ch 41(D1):590–596
DOI 10.1093/na /gks1219.
R Co e Team. 2021. R: a language and en i onmen o s a is ical compu ing. R Founda-
ion o S a is ical Compu ing. A ailable a h ps://www.R-p ojec .o g/ (accessed on
Janua y 2022).
Rin ala H, Pi kä an a M, Toi ola M, Paulin L, Ne alainen A. 2008. Di e si y and sea-
sonal dynamics o bac e ial communi y in indoo en i onmen . BMC Mic obiology
8:56 DOI 10.1186/1471-2180-8-56.
Schmid O. 2007. Indoo wood-decay basidiomyce es: damage, causal ungi, physiology,
iden i ica ion and cha ac e iza ion, p e en ion and con ol. Mycological P og ess
6:261–279 DOI 10.1007/s11557-007-0534-0.
Schmid O, Huckeld . 2011. Cha ac e is ics and iden i ica ion o indoo wood-
decaying basidiomyce es. In: Fundamen als o mold g ow h in indoo en i onmen s
and s a egies o heal hy li ing. Wageningen: Wageningen Academic Publishe s
DOI 10.3920/978-90-8686-722-6_6.
Scholie T, La inienko A, B ila I, Tukalenko E, Hinds öm R, Vasylenko A, Cayol C,
Ecke F, Sing NJ, Fo sman JT, Tol anen A, Ma ala J, Hui u O, Kallio ER, Koskela
E, Mappes T, Wa s PC. 2022. U ban o es soils ha bou dis inc and mo e di e se
communi ies o bac e ia and ungi compa ed o less dis u bed o es soils. Molecula
Ecology 32:504–517 DOI 10.1111/mec.16754.
Schulze-Makuch D, Wagne D, Kouna es SP, Mangelsdo K, Deine KG, de Ve a J-P,
Scmi -Kopplin P, G ossa H-P, Pa o V, Kaupenjohann M, Galy A, Schneide
B, Ai o A, F ösle J, Da ila AF, A ens FL, Ca ce es L, Co njeo FS, Ca izo D,
Da nell L, Di Ruggie o J, Flu y M, Ganze L, Gessne MO, G a hwohl P, Guan
L, Heinz J, Hess M, Kepple F, Maus D, McKay CP, Meckens ock RU, Mon -
gome y W, Obe lin EA, P obs AJ, Saenz JS, Sa le T, Shi mack J, Seph on MA,
Schlo e M, Uhl J, Valenzuela B, Ves e gaa d G, Wö me L, Zamo ano P. 2018.
T ansi o y mic obial habi a in he hype a id A acama Dese . P oceedings o he
Da ies e al. (2023), Pee J, DOI 10.7717/pee j.16355 17/18
Na ional Academy o Sciences o he Uni ed S a es o Ame ica 115(11):2670–2675
DOI 10.1073/pnas.1714341115.
Shenha L, Thompson M, Jospeh TA, B iscoe L, Fu man O, Bogumil D, Miz ahi I,
Pe’e I, Halpe in E. 2019. FEAST: as expec a ion—maximiza ion o mic obial
sou ce acking. Na u e Me hods 16:627–632 DOI 10.1038/s41592-019-0431-x.
S o ze G, Hengge R. 2011. Bac e ial s ess esponses. Washing on, D.C.: ASM P ess
DOI 10.1128/9781555816841.
Sun Y, Meng Y, Ou Z, Li Y, Zhang M, Chen Y, Zhang Z, Chen X, Mu P, No bäck D,
Zhao Z, Zhang X, Fu X. 2022. Indoo mic obiome, ai pollu an s and as hma,
hini is and eczema in p eschool child en—a epea ed c oss-sec ional s udy.
En i onmen In e na ional 161:107137 DOI 10.1016/j.en in .2022.107137.
Tanaka-Kagawa T, Uchiyama S, Ma sushima E, Sasaki A, Kobayashi H, Kobayashi
H, Yagi M, Tsuno M, A ao M, Ikemo o K, Yamasaki M, Nakashima A, Shimizu
Y, O subo Y, Ando M, Jinno H, Tokunaga H. 2005. Su ey o ola ile o ganic
compounds ound in indoo and ou doo ai samples om Japan. Koku i su
Iyakuhin Shokuhin Eisei Kenkyujo Hokoku = Bulle in o Na ional Ins i u e o Heal h
Sciences 123:27–31.
Wang S, Zuo X, Awada T, Medima-Roldan E, F eng K, Yue P, Lian J, Zhao S. 2021.
Changes o soil bac e ial and ungal communi y s uc u e along a na u al a idi y
g adien in dese g assland ecosys ems, Inne Mongolia. Ca ena 205:105470
DOI 10.1016/j.ca ena.2021.105470.
Whi e DC, Su on SD, Ringelbe g DB. 1996. The genus Sphingomonas: physiology and
ecology. Cu en Opinion in Bio echnology 7(3):301–306
DOI 10.1016/S0958-1669(96)80034-6.
Wickham H. 2016. ggplo 2: elegan g aphics o da a analysis. New Yo k: Sp inge -
Ve lag. A ailable a h ps://ggplo 2. idy e se.o g (accessed on Janua y 2022).
Wu Z, Lyu H, Ma X, Ren G, Song J, Jing X, Liu Y. 2022. Compa a i e e ec s o
en i onmen al ac o s on bac e ial communi ies in wo ypes o indoo dus :
po en ial isks o uni e si y s uden s. En i onmen al Resea ch 203:111869
DOI 10.1016/j.en es.2021.111869.
Da ies e al. (2023), Pee J, DOI 10.7717/pee j.16355 18/18