Ec opic KIT Copy Numbe Va ia ion Unde lies Impai ed
Mig a ion o P imo dial Ge m Cells Associa ed wi h
Gonadal Hypoplasia in Ca le (Bos au us)
Heli Venho an a1*☯, Hube Pausch2☯, Michal Wysocki2, Izabela Szcze bal3, Ree a Hänninen4, Juhani
Taponen1, Pekka Uima i5, K zysz o Flisikowski6, Hannes Lohi4, Ruedi F ies2, Ma ek Swi onski3, Magnus
Ande sson1
1 Depa men o P oduc ion Animal Medicine, Uni e si y o Helsinki, Saa en aus, Finland, 2 Chai o Animal B eeding, Technische Uni e si ä München,
F eising-Weihens ephan, Ge many, 3 Depa men o Gene icsandAnimal B eeding, Uni e si y o Li e Sciences, Poznań, Poland, 4 Depa men o Ve e ina y
Biosciences, Resea ch P og ams Uni , Molecula Neu ology, Uni e si y o Helsinki and Folkhälsan Resea ch Ins i u e, Helsinki, Finland, 5 Ag i ood Resea ch
Finland, MTT, Bio echnology and Food Resea ch, Jokioinen, Finland, 6 Chai o Li es ock Bio echnology, Technische Uni e si ä München, F eising, Ge many
Abs ac
Impai ed mig a ion o p imo dial ge m cells du ing emb yonic de elopmen causes he edi a y gonadal hypoplasia in
bo h sexes o No he n Finnca le and Swedish Moun ain ca le. The a ec ed gonads exhibi a lack o o , in a e
cases, a educed numbe o ge m cells. Mos a ec ed animals p esen le -sided gonadal hypoplasia. Howe e , igh -
sided and bila e al cases a e also ound. This ype o gonadal hypoplasia p e ails in animals wi h whi e coa colou .
P e ious s udies indica ed ha gonadal hypoplasia is inhe i ed in an au osomal ecessi e ashion wi h incomple e
pene ance. In o de o iden i y gene ic egions unde lying gonadal hypoplasia, a genome-wide associa ion s udy
(GWAS) and a copy numbe a ia ion (CNV) analysis we e pe o med wi h 94 animals, including 21 a ec ed animals,
using bo ine 777,962 SNP a ays. The GWAS and CNV esul s e ealed wo signi ican ly associa ed egions on
bo ine ch omosomes (BTA) 29 and 6, espec i ely (P=2.19 x 10-13 and P=5.65 x 10-6). Subsequen cy ogene ic and
PCR analyses demons a ed ha homozygosi y o a ~500 kb ch omosomal segmen ansloca ed om BTA6 o
BTA29 (Cs29 allele) is he unde lying gene ic mechanism esponsible o gonadal hypoplasia. The duplica ed
segmen includes he KIT gene ha is known o egula e he mig a ion o ge m cells and p ecu so s o melanocy es.
This duplica ion is also one o he wo ansloca ions associa ed wi h colou sidedness in a ious ca le b eeds.
Ci a ion: Venho an a H, Pausch H, Wysocki M, Szcze bal I, Hänninen R, e al. (2013) Ec opic KIT Copy Numbe Va ia ion Unde lies Impai ed Mig a ion o
P imo dial Ge m Cells Associa ed wi h Gonadal Hypoplasia in Ca le (Bos au us). PLoS ONE 8(9): e75659. doi:10.1371/jou nal.pone.0075659
Edi o : Toshi Shioda, Massachuse s Gene al Hospi al, Uni ed S a es o Ame ica
Recei ed Ma ch 8, 2013; Accep ed Augus 16, 2013; Published Sep embe 26, 2013
Copy igh : © 2013 Venho an a e al. This is an open-access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License, which
pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal au ho and sou ce a e c edi ed.
Funding: Funding om he Academy o Finland, Finnish Ve e ina y Founda ion, O ion-Fa mos esea ch ounda ion, Emil Aal onen Founda ion and Niemi
Founda ion is highly app ecia ed. HP was unded by he Ge man Fede al Minis y o Educa ion and Resea ch wi hin he Ag oClus E “Synb eed -
Syne gis ic plan and animal b eeding”. The unde s had no ole in s udy design, da a collec ion and analysis, decision o publish, o p epa a ion o he
manusc ip .
Compe ing in e es s: The au ho s ha e decla ed ha no compe ing in e es s exis .
* E-mail: [email p o ec ed]
☯ These au ho s con ibu ed equally o his wo k.
In oduc ion
Gonadal hypoplasia is cha ac e ised by abe an ly small and
unde de eloped gonads. Fe ili y is gene ally dis u bed when
bo h gonads a e hypoplas ic. Di e en ypes o gonadal
hypoplasia ha e been epo ed in se e al mammalian species,
including ca s, dogs [1], sheep [2], ho ses [3,4] and humans [5].
He edi a y gonadal hypoplasia is a equen diso de in wo
Scandina ian ca le b eeds, No he n Finnca le and Swedish
Moun ain ca le (also called Swedish Highland b eed). The
de ec eme ged in he ea ly 20 h cen u y a e pu e-b eeding o
Swedish Moun ain ca le was implemen ed [6,7]. A ew
decades la e he incidence o gonadal hypoplasia inc eased
hea ily and clinical in es iga ions we e ini ia ed.
Comp ehensi e heal h con ol e alua ions we e implemen ed
which educed he incidence o gonadal hypoplasia om 17.3%
o Swedish Moun ain ca le bo n be o e 1937 o 7.3% o
animals bo n be ween 1952 and 1954 [8]. The No he n
Finnca le almos became ex inc du ing he Second Wo ld
Wa . Thus conside able in og ession o genes om Swedish
Moun ain ca le ook place du ing he las 65 yea s and likely
in oduced gonadal hypoplasia in o he No he n Finnca le
he d.
PLOS ONE | www.plosone.o g 1 Sep embe 2013 | Volume 8 | Issue 9 | e75659
The incidence o gonadal hypoplasia in he men ioned
b eeds is equal in bo h sexes and comp ehensi e b eeding
expe imen s sugges a ecessi e mode o inhe i ance wi h
incomple e pene ance [7]. Pene ance was es ima ed o be 0.5
and E iksson [7] sugges ed ha he incomple e pene ance is
pa ly gene ically de e mined.
Gonadal hypoplasia is unique in No he n Finnca le and
Swedish Moun ain ca le because i is mainly mani es ed on he
le side. The p opo ions o le -, double- and igh -sided
gonadal hypoplasia a e 82%, 15% and 3%, espec i ely [7].
Al hough he absolu e numbe s di e ac oss s udies, le -sided
gonadal hypoplasia always p edomina es [9,10]. Howe e ,
he e is no e idence ha he localiza ion (le and/o igh ) o
hypoplas ic gonads is gene ically de e mined in No he n
Finnca le and Swedish Moun ain ca le [7].
The se e i y o gonadal hypoplasia a ies conside ably om
o al (Figu e 1) o pa ial [6,7] and a ec ed animals lack o ha e
a educed numbe o ge m cells [6]. Bila e ally a ec ed animals
a e o en s e ile and hypoplasia can also a ec seconda y
sexual cha ac e is ics ia impai ed p oduc ion o sexual
ho mones in emales [7,9]. The e a e no epo s ha a ec ed
animals su e om any o he heal h p oblems.
Gonadal hypoplasia o No he n Finnca le and Swedish
Moun ain ca le is a congeni al de ec [7] and Se e g en [6]
ound ha he hypoplas ic o a ies can al eady be iden i ied a
he oe al s age. Foe al es icles we e no s udied. Se e g en
Figu e 1. Le -sided gonadal hypoplasia. (A) Hypoplas ic
o a y (le a ow) and no mal o a y ( igh a ow). (B)
Hypoplas ic es icle (le ) and no mal es icle ( igh ).
doi: 10.1371/jou nal.pone.0075659.g001
[6] concluded ha he eason o gonadal hypoplasia is a ailu e
o he mig a ion and synch onous mi o ic di isions o p imo dial
ge m cells (PGC). Mig a ion and p oli e a ion o PGCs in he
de eloping emb yo is a complex p ocess wi h a ious genes
and signalling pa hways in ol ed [11,12].
Gonadal hypoplasia occu s only in animals ha a e 60-100%
whi e colou ed (Table S1) [6]. The coa colou o he No he n
Finnca le and Swedish Moun ain ca le a ies om whi e o
black o b own wi h nume ous in e media es. Whi e coa wi h
pigmen ed ea s and muzzle is he mos common o m, bu
spo ed sides and colou ed legs a e also commonly ound
(Figu e S1). Pa o his colou a ia ion is likely due he colou -
sided pa e n ha is sugges ed o be caused by a semi-
dominan gene symbolized as Cs [13,14]. Recen ly Du kin e
al. [15] showed ha colou sidedness is de e mined by wo loci
p esen on bo ine ch omosomes, (BTA) 29 and 6. The Cs29
allele in BTA29 esul ed om a duplica ion and ansloca ion
e en o a 492 kb segmen o BTA6 including he KIT gene.
The Cs6 allele esiding on BTA6 is a esul o a subsequen
duplica ion and ansloca ion e en ha mo ed back he
segmen comp ising used sequences o he BTA29 and BTA6
o he KIT locus in BTA6. I is expec ed ha in bo h cases he
dys egula ion o he KIT gene leads o he colou sidedness
[15].
The KIT gene encodes a ype III ecep o p o ein o he
y osine kinase amily. Se e al s udies ha e shown ha KIT
p o ein is c ucial o su i al, p oli e a ion and mig a ion o
melanocy e p ecu so s and p imo dial ge m cells (PGC) du ing
emb yogenesis [16-18]. KIT is also essen ial o egula
de elopmen o hema opoie ic cells [16,19]. In mice, mu a ions
in KIT esul in impai ed pigmen a ion, educed e ili y o
s e ili y, anaemia and dea ness. These mu a ions a e o en
pleio opic (MGI:96677, h p://www.in o ma ics.jax.o g/). KIT
mu a ions also unde lie coa colou a ia ion in o he mammals,
e.g. pig [20,21] and ho se [22]. In humans, KIT mu a ions
cause piebaldism, mas cell disease and se e al ypes o
umou (*164920, h p://omim.o g/).
The aim o his s udy was o iden i y he gene ic cause o he
he edi a y o m o gonadal hypoplasia in No he n Finnca le
and Swedish Moun ain ca le. A genome-wide associa ion
s udy combined wi h a copy numbe a ia ion (CNV) analysis
was pe o med wi h high-densi y SNP a ays o pinpoin he
genomic egion. The esul s we e con i med wi h cy ogene ic
in es iga ions, quan i a i e PCR and con en ional PCR. We
show ha Swedish Moun ain ca le and No he n Finnca le
ca y alleles ha cause colou -sidedness [15] and ha a ec ed
indi iduals a e homozygous o he Cs29 allele ha includes he
ec opic KIT gene.
Resul s
A genome-wide associa ion s udy maps congeni al
gonadal hypoplasia o BTA29
Gonadal hypoplasia in No he n Finnca le and Swedish
Moun ain ca le is hypo hesized o esul om pleio opic
e ec s o a whi e colou gene because mos o he a ec ed
animals a e p edominan ly whi e [6,23]. To accoun o bo h he
di e en coa colou pa e ns and he a ec ion s a us o he
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 2 Sep embe 2013 | Volume 8 | Issue 9 | e75659
animals, ou di e en case-con ol coho s we e es ablished
(Table 1) and allelic associa ions we e pe o med. P- alues
below 7.71 x 10-8 (Bon e oni-co ec ed h eshold o mul iple
es ing) we e conside ed o be signi ican ly associa ed. A
genome-wide associa ion s udy (GWAS) wi h 20 una ec ed
p edominan ly black and b own animals and 21 a ec ed
p edominan ly whi e animals e ealed 18 signi ican ly
associa ed SNPs on BTA29 be ween 17.69 Mb o 20.50 Mb
(Figu e 2A, Table S2). The SNP showing mos signi ican
associa ion was Bo ineHD2900005672 (19,661,149 bp,
P=2.19 x 10-13). The second GWAS, including all a ailable
una ec ed animals (N=73) and all a ec ed animals, yielded i e
highly signi ican ly associa ed SNPs on BTA29 and one highly
signi ican ly associa ed SNP on BTA23 a 52,435,290 bp,
(P=9.57 x 10-9) (Figu e 2B). This SNP was conside ed o be a
alse posi i e esul because he e we e no o he signi ican ly
associa ed SNPs on BTA23. Mo eo e , e-geno yping he SNP
using Sange -sequencing e ealed disc epan geno ypes
compa ed wi h he geno ypes ob ained wi h he Illumina
Bo ineHD Bead chip in some samples. This indica ed echnical
p oblems. Compa ison o p edominan ly whi e -40 una ec ed
and 21 a ec ed – animals e ealed a sugges i e associa ion
(Table S2). Simila ly, GWAS in he ou h g oup (D) using 40
una ec ed p edominan ly whi e animals and 20 una ec ed
p edominan ly colou ed animals e ealed a sugges i e
associa ion (Table S2). Howe e he SNPs o he las wo
GWAS analysis we e no signi ican ly associa ed a e
Bon e oni-co ec ion (Figu e 2C and 2D). Addi ionally,
associa ion analyses we e epea ed using a geno ypic es .
The esul s we e in line wi h he allelic es , unde lining he
impo ance o he 17.69 Mb o 20.50 Mb a ea in BTA29 (Table
S3). Collec i ely, he analysis o he ou s udied coho s
indica es ha he BTA29 egion is associa ed wi h gonadal
hypoplasia and no only e lec s di e en coa colou pa e ns.
The genomic in la ion ac o s o he g oups anged om 0.94
o 1.02 and indica e he absence o po en ial spu ious
associa ions.
CNV analysis iden i ies a ansloca ed genomic egion
wi h he KIT gene
Du kin e al. [15] showed ha colou sidedness in a ious
ca le b eeds is de e mined by wo CNVs ha duplica e a small
pa o he BTA6 and BTA29. Because o he s ong link
be ween whi e colo a ion and gonadal hypoplasia in No he n
Finnca le and Swedish Moun ain ca le, we ca ied ou CNV
analysis. A o al o 2101 au osomal CNVs we e iden i ied in 94
animals. Among hem a CNV segmen on BTA6, ex ending
om 71.60 Mb o 72.13 Mb and con aining he KIT gene, was
signi ican ly associa ed wi h gonadal hypoplasia (P=5.65 x 10-6)
(Figu e 3, Figu e 4A). The CNV was p esen in all 21 a ec ed
animals and in 52 o 73 animals o he con ol g oup. Also, a
CNV segmen on BTA29, ex ending om 19.86 Mb o 20.32
Mb, appea ed o be equen in he No he n Finnca le. The
CNV segmen on BTA29 was iden i ied in 14 a ec ed and 44
una ec ed animals, bu was no associa ed wi h gonadal
hypoplasia (Figu e S2). This segmen is in he immedia e
icini y o he mos signi ican ly associa ed gonadal hypoplasia
SNPs (Figu e 4B). To ensu e ha CNV segmen on BTA6 was
no associa ed o gonadal hypoplasia nominal p- alues o he
GWAS o he SNPs loca ed icini y o he segmen we e
s udied (Tables S4 and S5). Only wi h he Design D in he
geno ypic es a ew SNPs wi h sugges i e associa ion was
ound. This design included only una ec ed p edominan ly
whi e and colou ed animals so he ound associa ions we e
ela ed o coa colou no gonadal hypoplasia.
Du kin e al. [15] also showed ha he wo colou sidedness
loci esul om a ansloca ion o a ch omosomal segmen ,
encompassing he KIT gene, om BTA6 o BTA29 and a pa
o his agmen back o BTA6 nea he KIT gene. To
in es iga e whe he simila duplica ions a e p esen in No he n
Finnca le and he Swedish Moun ain b eed, we used 38
animals wi h copy numbe (CN) ou on BTA6 as he case
g oup and 21 animals wi h CN wo as a con ol g oup o iden i y
a po en ial ansloca ion. The CN s a us was de e mined based
on he a ay geno ypes. We ound a s ong associa ion on
BTA29 (19,661,149 bp, P = 1.66 x 10-28), indica ing a
ansloca ion o he BTA6 segmen o BTA29 (Figu e S3). We
nex analysed 58 and 36 animals wi h and wi hou CNV on
BTA29, espec i ely, and iden i ied a s ong associa ion on
BTA6 (72,198,048 bp, P=1.69 x 10-14, Figu e S4), indica ing a
ansloca ion om he BTA29 segmen o BTA6. These
posi ions ag ee wi h hose desc ibed by Du kin e al. [15]
indica ing ha he duplica ions iden i ied a e he same.
Table 1. O ganisa ion o ou di e en case-con ol designs.
Con ol coho Case coho
Gonadal hypoplasia UNAFF AFF UNAFF AFF
Coa colou W B U W B U o al W B U W B U o al
Design A 20 20 21 21
Design B 40 20 13 73 21 21
Design C 40 40 21 21
Design D 40 40 20 20
Fou di e en case-con ol coho s we e es ablished (A-D). The coa colou o he animals was assessed as p edominan ly whi e (W), p edominan ly black/b own (B) and
unknown (U). The gonadal hypoplasia s a us was assessed as a bina y ai (a ec ed (AFF) and una ec ed (UNAFF)).
doi: 10.1371/jou nal.pone.0075659. 001
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 3 Sep embe 2013 | Volume 8 | Issue 9 | e75659
Figu e 2. Associa ion o 647,971 SNPs in ou di e en case con ol scena ios. The Manha an plo s ep esen he -log10(P)
alues o associa ion o 647,971 SNPs in ou di e en case-con ol designs (Table 1). The ed do s ep esen signi ican ly
associa ed SNPs (P < 7.71 x 10-8).
doi: 10.1371/jou nal.pone.0075659.g002
Figu e 3. Associa ion o 2101 au osomal CNVs wi h he a ec ion s a us o 94 animals. The p esence o CNV segmen s was
compa ed in 21 cases and 73 con ols using Fishe exac es s. The do s ep esen SNPs wi hin he CNV segmen s. Red do s
ep esen SNPs in signi ican ly o e ep esen ed CNVs in cases s. con ols (P < 2.38 x 10-5).
doi: 10.1371/jou nal.pone.0075659.g003
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 4 Sep embe 2013 | Volume 8 | Issue 9 | e75659
Cy ogene ic s udies con i m ansloca ions be ween
BTA6 and BTA29
Th ee No he n Finnca le animals we e selec ed o
cy ogene ic in es iga ions based on he CN s a us o he BTA6-
segmen . One o hese animals was a ec ed by gonadal
hypoplasia. A Wes e n Finnca le and an Eas e n Finnca le
animal we e also included in he compa a i e analysis. These
b eeds a e no a ec ed by he gonadal hypoplasia.
T adi ionally, Wes e n Finnca le is a solid b own b eed and
Eas e n Finnca le is a b own b eed wi h he colou -sided
pheno ype. Bac e ial a i icial ch omosome (BAC) clones
speci ic o he CN a eas o ch omosomes BTA6 ( ed FISH
signal) and BTA29 (g een FISH signal) we e used as p obes in
FISH expe imen s. O e lapping ed and g een signals appea
yellow. In he Wes e n Finnca le animal wo ed (BTA6
homologs) and wo g een (BTA29 homologs) signals we e
eco ded. The Eas e n Finnca le animal showed he ollowing
pa e n: wo yellow signals on BTA6 and wo g een signals on
BTA29. All h ee animals om he No he n Finnca le b eed
showed ed and yellow signals on BTA6 while he pa e ns on
BTA29 a ied. The i s una ec ed No he n Finnca le showed
g een and yellow signals on BTA29 whe eas he second
una ec ed No he n Finnca le showed only g een signals. The
a ec ed No he n Finnca le animal had yellow signals on
BTA29 (Figu e S5). Taken oge he , all animals excep he
solid b own Wes e n Finnca le animal had one o se e al
ansloca ions associa ed wi h colou sidedness. The a ec ed
No he n Finnca le was homozygous o he Cs29 allele. This
suppo s ou GWAS and CNV esul s ha showed s ong
associa ion be ween he Cs29 allele and gonadal hypoplasia.
CNV con i ma ion using quan i a i e PCR
The numbe o he Cs29 alleles was analysed by quan i a i e
PCR in nine a ec ed and 21 una ec ed animals. The esul s
ag ee wi h he CNV esul s based on he a ay geno ypes.
Howe e , using qPCR we could no dis inguish be ween
he e ozygous and homozygous animals.
Figu e 4. Schema ic iew o wo CNV segmen s on BTA6 and BTA29. The igu es display 5-SNP-sliding-window log R a ios in
75 una ec ed (g ey) and 21 a ec ed (blue) animals on BTA6 (A) and BTA29 (B). The g ey shaded box ep esen s he ex en o he
wo CNV segmen s. The gene con en was assessed based on he Uni e si y o Ma yland assembly.
doi: 10.1371/jou nal.pone.0075659.g004
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 5 Sep embe 2013 | Volume 8 | Issue 9 | e75659

Con i ma ion o CNV using con en ional PCR
To cha ac e ize he ansloca ion p esen in No he n
Finnca le and Swedish Moun ain ca le we used PCR p ime s
acco ding o Du kin e al. [15] and one addi ional p ime pai
ha lanked he inse ion si e o wild ype BTA29. Analysed
animals included also wo animals ha we e omi ed om he
GWAS analyses because o he geno yping ailu e. Colou o
hese wo animals was p edominan ly b own and whi e. The
esul s showed ha all a ec ed animals we e homozygous o
he Cs29 allele and 15 animals had he Cs6 allele. O he
una ec ed animals, 18 we e homozygous and 37 we e
he e ozygous o he Cs29 allele and 20 did no ha e he Cs29
allele. The Cs6 allele was de ec ed om 44 con ol animals
(Table 2). The a io o he Cs6 allele is sligh ly highe in a ec ed
han in una ec ed animals: 15/21 (71%) and 44/75 (59%)
espec i ely. Mo e impo an ly he occu ence o Cs6 in con ol
animals ha we e homozygous o he Cs29 allele was 14/18
(78%) which is almos he same as in a ec ed animals (Table
2). Like he case animals, all homozygous con ol animals we e
p edominan ly whi e. The a io o he Cs6 allele in whi e con ol
animals ha we e he e ozygous o he Cs29 allele was 11/18
(61%) which is also qui e close o he Cs6 a io o he case
animals (Table S6). These esul s sugges s ha he
homozygous Cs29 allele migh ha e pleio opic e ec s on bo h
coa colou and gonadal hypoplasia bu he Cs6 allele a ec s
only he coa colou . The esul s a e in line wi h he CNV
esul s based on a ay geno ypes and qPCR. Addi ionally, we
de e mined he DNA sequence o all PCR p oduc s ampli ied
om he selec ed 12 animals ( esul s no shown). The
sequences we e compa able wi h hose ob ained by Du kin e
al. [15].
A genome-wide associa ion s udy compa ing he case
and con ol animals homozygous o he Cs29 allele
e ealed no associa ion
Gi en ha he Cs29 allele was associa ed wi h gonadal
hypoplasia we pe o med an addi ional condi ional GWAS
whe e he case animals we e compa ed wi h 18 con ol
animals ha we e homozygous o he Cs29 allele. The only
sugges i ely associa ed allele was he SNP on BTA23 a
52,435,290 bp which was shown o ha e disc epan geno ypes
(Figu e S6).
Table 2. The PCR analysis o CNVs.
A ec ed Una ec ed
+/+ +/Cs29 Cs29/Cs29 +/+ +/Cs29 Cs29/Cs29
+/+ 0 0 6 10 17 4
Cs6/- 0 0 15 10 20 14
o al 0 0 21 20 37 18
The PCR analysis o CNVs based on p ime s designed by Du kin e al. [15] and
us. All 96 animals we e analysed including wo con ol animals whose geno yping
ailed. The animals a e di ided acco ding o alleles in BTA29 and BTA6.
He e ozygous and homozygous ca ie s o he Cs6 allele could no be
dis inguished.
doi: 10.1371/jou nal.pone.0075659. 002
Discussion
The esul s o his s udy s ongly sugges ha he
p edominan ly le -sided gonadal hypoplasia in No he n
Finnca le and Swedish Moun ain ca le is associa ed wi h a
complex ch omosomal ea angemen including a ~500kb
duplica ed segmen om BTA6 which is ansloca ed o BTA29.
This duplica ed segmen includes he en i e coding sequence
o he KIT gene. Gi en ha he a ec ed animals we e
homozygous o he ansloca ed duplica ion, ou s udy
suppo s he ecessi e disease model and highligh s KIT gene
dosage as a signi ican isk ac o .
We showed ha he ansloca ed segmen is he same as
one o he wo p e iously desc ibed ansloca ed segmen s
Cs29 and Cs6 ha a e esponsible o colou sidedness in ca le
[15]. The colou -sided pa e n is demons a ed by a iable
coa ing om colou ed animals wi h a whi e line in he back o
almos whi e animals wi h colou ed pa s only in ea s, muzzle
and ee . The la e coa colou pa e n is common o No he n
Finnca le and Swedish Moun ain ca le b eeds. Se e g en [6]
showed ha he p edominan ly whi e coa colou o Swedish
Moun ain ca le was s ongly associa ed wi h gonadal
hypoplasia. Ou GWAS da a suppo he hypo hesis ha he
Cs29 allele is associa ed wi h bo h whi e coa colou and
gonadal hypoplasia. We did no ind any associa ion when
compa ing p edominan ly whi e a ec ed and una ec ed
animals. Mo eo e , he associa ion signal was s onge when
a ec ed animals we e compa ed wi h colou ed animals han
when a ec ed animals we e compa ed wi h all una ec ed
animals. These esul s a e because mos o he whi e animals
ca y a leas one copy o he Cs29 allele and his implica es
co ela ion o Cs29 allele wi h bo h whi e coa colou and
gonadal hypoplasia. Howe e , compa ison o una ec ed
p edominan ly whi e animals and una ec ed p edominan ly
colou ed animals showed no associa ion ha would ha e
exceeded he genome-wide h eshold le el. This esul was
su p ising bu can be explained wi h he knowing ha some o
he una ec ed p edominan ly colou ed animals we e colou
sided and pa o hem had he Cs29 allele. Mo eo e , some o
he una ec ed p edominan ly whi e animals lacked he Cs29
allele. This indica es s onge co ela ion o Cs29 allele wi h
gonadal hypoplasia han wi h p edominan ly whi e coa colou .
Compa isons ac oss he s udy g oups s ongly sugges ha he
Cs29 allele is associa ed wi h gonadal hypoplasia and no only
e lec s di e en coa colou pa e ns.
I is unlikely ha Cs6 allele is ela ed o gonadal hypoplasia
gi en ha he CNV analyses showed no associa ion be ween
he Cs6 allele and gonadal hypoplasia. Fu he mo e, he
con en ional PCR esul s showed ha he Cs6 allele is only
sligh ly en iched in a ec ed animals when compa ed wi h all
una ec ed animals. Mo e impo an ly, he equency o he Cs6
allele was almos he same in case animals as in con ol
animals ha we e homozygous o he Cs29 allele.
Mu a ions wi hin he KIT gene cause whi e colou also in
ho se and pig, bu he e a e no epo s o associa ed gonadal
hypoplasia. On he o he hand, se e al mouse models
ha bou ing KIT mu a ions show pleio opic e ec s causing
educed e ili y and whi e colou ing. Many o hese mice
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 6 Sep embe 2013 | Volume 8 | Issue 9 | e75659
mu an s su e om anaemia, umou o ma ion and dea ness
(MGI:96677, h p://www.in o ma ics.jax.o g/). We a e no awa e
ha he a ec ed animals in ou s udy had any o he disease
symp oms besides gonadal hypoplasia. Ye he same kind o
gonadal hypoplasia, as in No he n Finnca le and Swedish
Moun ain ca le, has no been obse ed in any mouse s udies.
Only o he Nguni b eed (Bos indicus x Bos au us c oss) a e
he e epo s o a he edi a y o m o gonadal hypoplasia
esembling ha o m ound in No he n Finnca le and Swedish
Moun ain ca le [24-26]. In e es ingly, he Nguni b eed also
p esen s he colou -sided pheno ype.
Du kin e al. [15] implica ed ha loci on BTA6 and BTA29
accoun o mos , i no all, colou sidedness in ca le.
Mo eo e , B enig e al. [27] showed ha in Whi e Galloway
ca le and Whi e Pa k ca le he p edominan ly whi e coa
colou was a ibu ed o he Cs29 allele. This was also shown in
ou s udy whe e only i e animals ou o 62 p edominan ly
whi e animals did no ha e he Cs29 allele. Se e al ca le
b eeds ha e his allele in BTA29, bu he edi a y gonadal
hypoplasia has only been epo ed in No he n Finnca le,
Swedish Moun ain ca le and Nguni ca le. This migh be
because he p opo ion o animals homozygous o he Cs29
allele is oo small in se e al colou sided b eeds o his ype o
ecessi e gonadal hypoplasia wi h incomple e pene ance o be
diagnosed.
Ano he hypo hesis o he gene ic cause o he gonadal
hypoplasia is ha Swedish Moun ain ca le and No he n
Finnca le ha e o he b eed speci ic changes in he genome in
addi ion o he Cs29 allele. This conclusion implies ha Nguni
migh ha e di e en mu a ions ha cause he gonadal
hypoplasia. The GWAS s udies showed no o he eliable
associa ion be ween he cases and con ols han he
associa ion o BTA29. Howe e , he addi ional mu a ions migh
emain unde ec ed because o he small sample size in he
p esen s udy o because o he loca ion o he mu a ion. I
mu a ion is wi hin he ansloca ed a ea o in co esponding
a ea in he o iginal ch omosome he mapping wi h GWAS
migh no wo k.
Ou indings ha all a ec ed animals had wo ec opic KIT
genes suppo he pos ula ed mode o ecessi e inhe i ance
[7]. Ne e heless, 17 una ec ed animals also had wo ec opic
KIT genes. This migh be explained by incomple e pene ance
o by he p esence o an addi ional mu a ion o mu a ions
besides he Cs29 allele.
In conclusion, we showed ha a he edi a y o m o gonadal
hypoplasia in Swedish Moun ain ca le and No he n Finnca le
is associa ed wi h homozygosi y o he Cs29 allele. The e is
need o u he in es iga ions o unde s and ully he
mechanisms causing he diso de . Howe e , o ou knowledge,
his is he i s epo indica ing a duplica ion o he KIT gene
wi h p edominan ly le -sided gonadal hypoplasia in mammals.
Ma e ials and Me hods
E hics s a emen
The blood sampling and clinical examina ions we e ca ied
ou ollowing s anda d e e ina y p o ocols in Finland. The
Animal E hics Commi ee o he S a e P o incial O ice o
Sou he n Finland app o ed all animal wo k
(ESAVI-2010-03428/Ym-23).
Gonad examina ion and sampling
Clinical examina ions we e done du ing a m isi s by
expe ienced e e ina ians. Bulls and bull cal es we e palpa ed
o es icle size and symme y. Female animals olde han 16
mon hs, excluding animals mo e han i e mon hs p egnan ,
we e s udied by o a ian palpa ion pe ec um. A e clinical
examina ion, 9 ml o EDTA enous blood we e collec ed om
he animals sui able o his s udy. Semen samples o a i icial
insemina ion bulls included in he s udy we e also collec ed.
F om he pos -mo em s udy animals’ gonads we e examined
isually, palpa ed and weighed. His ological and issue
samples o DNA ex ac ion we e aken om he collec ed
gonads. His ological samples we e subjec ed o s anda d
Bouin’s ixa ion and embedded in pa a in. Sec ions (5 µm)
we e cu and s ained wi h haema oxylin-eosin (HE).
Animals conside ed a ec ed by gonadal hypoplasia
Cows and hei e s wi h one o a y o ex emely small size
we e conside ed o be a ec ed by gonadal hypoplasia. Usually
he hypoplas ic o a y was unde ec able by palpa ion pe
ec um. Bulls and bull cal es we e conside ed o be a ec ed by
unila e al gonadal hypoplasia i hei es icles clea ly di e ed in
size, i.e. one es icle being mo e han wo imes la ge han he
o he es icle in young cal es and o bulls’ one es icle being
mo e han h ee imes la ge han he o he es icle. Bila e al
gonadal hypoplasia was diagnosed only in one bull selec ed o
semen collec ion. Bo h es icles we e e y small and he e
we e no spe m cells in he ejacula e. The es icle his ology only
showed Se oli cells and no spe ma ogonia in semini e ous
ubules in he hypoplas ic es icles. When possible, he
clinically diagnosed a ec ed animals we e e-examined du ing
a second a m isi o he gonads we e s udied a e slaugh e .
DNA ex ac ion
Genomic DNA om blood samples was ex ac ed by
au oma ic isola ion (Magne ic Sepa a ion Module I, Chemagen)
and genomic DNA om issue and semen samples was
ex ac ed using a comme cially a ailable Qiagen Ki (QIAamp
DNA Mini Ki ). Ex ac ions o he blood and issue samples
we e made acco ding o he manu ac u e ’s ins uc ions. The
ex ac ion o DNA om semen samples was made acco ding o
DNA Pu i ica ion om Tissues-p o ocol in QIAamp DNA Mini
Ki handbook wi h some modi ica ions. F om 200 o 500 µl o
ozen semen was cen i uged o 5 min a 100 × g. The
supe na an was mo ed and he pelle was washed wi h 200 µl
o phospha e bu e ed saline (PBS). The Qiagen bu e ALT
was added up o 300 µl and 20 µl o P o einase K and
di hio h ei ol was also added. The mix was incuba ed o 1 h a
56 °C. Du ing incuba ion he sample was pulse o exed ou
imes o 15 sec. 300 µl o Qiagen bu e AL was added and he
pulse o ex epea ed. The sample was incuba ed o 10 min a
56 °C and he ea e 150 µl o 96% alcohol was added. The
sample was pulse o exed and incuba ed o 3 min a oom
empe a u e. The whole mix u e was applied o he QIAamp
Mini spin column and cen i uged a 6,000 × g o 1 min. The
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 7 Sep embe 2013 | Volume 8 | Issue 9 | e75659
il a e was disca ded and he column was washed wice wi h
500 µl o Qiagen bu e AW1 and once wi h 500 µl o Qiagen
bu e AW2 (cen i uga ion a 6,000 × g o 1 min). The column
was d ied wi h cen i uga ion a 20,000 × g o 3 min. The DNA
was elu ed wi h 50 µl o dis illed wa e , incuba ed o 1 min a
oom empe a u e and cen i uged a 20,000 × g o 1 min.
Animals selec ed o geno yping
DNA samples om 96 animals we e included in his s udy.
Animals wi h o al unila e al o bila e al hypoplasia we e
included in he case g oup ha comp ised 21 animals (10
males and 11 emales). O hese animals, one was a ec ed
wi h bila e al, 18 wi h le -sided and wo wi h igh -sided
gonadal hypoplasia. The con ol g oup included 75 una ec ed
animals. Among he s udied animals 91 we e No he n
Finnca le and i e we e Swedish Moun ain ca le ( wo cases
and h ee con ols).
High-densi y geno yping and quali y con ol
Nine y-six animals (21 a ec ed / 75 una ec ed) we e
geno yped wi h he Illumina Bo ineHD Bead chip in e oga ing
geno ypes o 777,962 SNPs. Geno ype calling was pe o med
using de aul pa ame e s o Illumina’s BeadS udio. Quali y
con ol was ca ied ou wi h PLINK 1.07 [28]. We excluded
1224, 343 and 1735 SNPs wi h Y-ch omosomal, mi ochond ial
and unknown ch omosomal posi ion, espec i ely, o u he
analysis. The geno ypes o wo una ec ed animals we e
omi ed because geno yping ailed in mo e han 10% o he
SNPs. We u he excluded 6229 SNPs because geno yping
ailed in mo e 10% o he indi iduals and 121,657
monomo phic SNPs. The inal da ase comp ised 94 animals
and 647,971 SNPs wi h an a e age call- a e o 99.67%. The
ch omosomal posi ion o he SNPs was de e mined based on
he UMD3.1 assembly o he bo ine genome [29].
Genome-wide associa ion s udy
Fishe exac es s o allelic and geno ypic associa ions we e
pe o med o compa e geno ypes in cases s. con ols a each
SNP in u n using PLINK [28]. We conside ed SNPs wi h P <
7.71 x 10-8 as signi ican ly associa ed (Bon e oni-co ec ed
h eshold o mul iple es ing). Quan ile-quan ile plo s we e
inspec ed and genomic in la ion ac o s we e calcula ed
acco ding o De lin and Roede [30] o assess he ex en o
alse posi i e associa ion signals.
De ec ion o copy numbe a ian s
Geno ype signal in ensi ies ob ained om geno yping wi h
he Illumina Bo ineHD Bead chip (see abo e) we e analysed
wi h PennCNV [31] o iden i y copy numbe a ia ions (CNV).
B ie ly, he implemen ed CNV-de ec ion algo i hm conside s
bo h he log R a io (LRR) and he B allele equency (BAF), as
well as he allele equency and he dis ance o adjacen SNPs.
Two indi iduals and 6229 SNPs wi h poo geno yping quali y
(see abo e) we e no conside ed o he iden i ica ion o CNVs.
The p esence o CNVs con aining a minimum numbe o 10
SNPs co esponding o a minimum leng h o app oxima ely 35
Kb was compa ed in cases s. con ols using Fishe exac
es s.
Cy ogene ic analysis
Me aphase sp eads we e ob ained om sho - e m
lymphocy e cul u es, es ablished o i e animals. The FISH
s udy was ca ied ou acco ding o a p o ocol desc ibed by
Du kin e al. [15]. Two BAC clones (RP42-160M9,
RP42-156I13) co e ing he egion o in e es on ch omosome
BTA6 ( egion 72,566,605–72,817,995bp, UMD 3.0) and wo
BAC clones (RP42-37P11, RP42-116G8) co e ing he egion
o in e es on BTA29 ( egion 20,772,406–21,035,251bp, UMD
3.0) we e de i ed om he RPCI-42 Bo ine BAC Lib a y (h p://
bacpac.cho i.o g/home.h m). BAC DNA was isola ed using an
alkaline lysis me hod and labelled by andom p iming. The
isola ed DNAs om wo BAC clones speci ic o BTA6 we e
mixed equally and labelled using bio in-11-dUTP, while DNA
om wo BAC clones speci ic o BTA29 was also mixed and
labelled wi h digoxigenin-11-dUTP. The labelled p obes wi h an
excess o bo ine Co -1 DNA we e sepa a ely dena u ed o 10
min a 70°C and applied on dena u ed ch omosome slides.
Hyb idiza ion was ca ied ou o e nigh a 37°C. A e slide
washing, bio in-labelled p obes we e de ec ed using
s ep a idin-Cy3 (Ame sham, 1:200, ed colou ) and
digoxigenin-labelled p obes we e de ec ed wi h an idigoxigenin-
luo escein Fab agmen s (Roche, 1:200, g een colou ). The
slides we e coun e s ained wi h Vec ashield con aining DAPI
(Vec o Labo a o ies) and examined wi h an epi luo escence
Nikon E600 Eclipse mic oscope equipped wi h a cooled digi al
CCD came a and Lucia so wa e.
QPCR
QPCR was used o alida e CNV iden i ied a e
bioin o ma ics analysis. Al oge he 30 samples we e analysed:
nine cases and 21 con ols. A simple me hod based on
Weksbe e al. [32] and Lachman e al. [33] was applied o
analysis. Two p ime pai s designed using P ime 3 [34] we e
loca ed in he KIT egion: p ecisely in exon 8
(GGGCCAGTGGATGTACAGAT) and 9
(TGCAAAGTTAAAAGAGGCAGA); he second pai in exon 18
(CACATTTGAAAGTGATGTCTGG) and 19
(AGAACTTAGAATCGACTGGCATT). 10 µl o QPCR eac ion
was composed om he Fas SYBR® G een Mas e Mix (Li e
Technologies) and 2.5 pmol o each p ime . All ampli ica ions
we e ca ied ou in Applied Biosys ems 7500 Fas Real-Time
PCR Sys em (Li e Technologies) acco ding o manu ac u e ’s
ecommenda ions. H6PD was used as a e e ence gene; bo h
p ime s we e loca ed in he i s exon
(AAGGTCCTGGAGTCCCTGTC,
GTAGAAAATTCGGCCGGTCT).
PCR and sequencing
All animals we e analysed wi h s anda d PCR ca ied ou
using b eakpoin p ime s designed by Du kin e al. (Table 2)
[15] and one addi ional p ime pai PSK_α-β2_R
(TGGGTAGACAGGTTTGTTTCC and
TCTTGACCACTTGCATTGGA) ha lanked he inse ion si e
o he wild ype BTA29. A PCR eac ion o 20 µl olume
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 8 Sep embe 2013 | Volume 8 | Issue 9 | e75659
con aining 20 ng genomic DNA, 1x Qiagen PCR bu e , 1.5 mM
MgCl2, 200 µM o each nucleo ide, 5 pmol o each o wa d and
e e se p ime (Sigma) and 0.5 uni s o Taq Polyme ase
(Qiagen) was pe o med unde he ollowing condi ions: ini ial
dena u ing a 95 °C o 3 min, ollowed by 35 cycles a 94 °C
o 30 sec, 60 °C o 1 min, 72 °C o one minu e and he inal
ex ension a 72 °C o 3 min. PCR p oduc s we e isualized
oge he wi h GeneRule TM100bp DNA Ladde (Fe men as,
The mo Scien i ic) on 1.5% aga ose gel.
Fi e case samples, wo con ol samples wi h a duplica ion o
he BTA6 segmen , wo con ol samples wi h bo h s udied
duplica ions and h ee con ol samples wi hou he duplica ions
we e subjec ed o sequencing. A 10-20 ng o pu i ied PCR
p oduc was mixed wi h 0.5 µl BigDye® Te mina o 3.1 (Li e
Technologies) and 0.5 µl o he o wa d o e e se PCR p ime
(2.5 pmol). The sequencing eac ion was pe o med unde he
ollowing condi ions: ini ial dena u ing a 96 °C o 10 sec,
ollowed by 35 cycles, including 10 sec in 96 °C, 5 sec in 50 °C,
and 4 min in 60 °C. The gel il a ion o he sequencing eac ion
was applied using he Mul iSc een il a ion pla e
(MAHVN4510; Millipo e) and Sephadex G-50 Fine (Sigma)
ollowed by capilla y elec opho esis ca ied ou on 3130xl
Gene ic Analyze (Li e Technologies). Base calling, sequence
alignmen and polymo phism de ec ion we e made using he
Ph ed/Ph ap/Polyph ed so wa e [35-37]. Sequences we e
inspec ed using Consed [38].
Se en cases and en con ols we e sequenced (see abo e)
wi h p ime s CAATTTTAAGCATGTGCTGAGG and
ACAGCCTCTGGTCTGTCTGG o alida e he geno ype calls
o he SNP on BTA23 a 52,435,290 bp.
Suppo ing In o ma ion
Figu e S1. Examples o he common colou pa e n in
No he n Finnca le. Mos commonly, No he n Finnca le is
almos whi e wi h black o b own in ea s and muzzle. The
lanks and legs can also be pa ly colou ed o spo ed.
(TIF)
Figu e S2. A e age log R a io o animals ca ying he
ec opic BTA29 segmen . The a e age log R a io was
calcula ed om 15 a ec ed and 44 una ec ed animals ha
ca y he duplica ed segmen o BTA29. The 5-SNP-sliding
window log R a io is p esen ed o 563 SNPs.
(PNG)
Figu e S3. Localisa ion o a ansloca ion o a KIT
con aining segmen o ch omosome 29. Animals ca ying
wo and ou copies o he BTA6 segmen we e compa ed
using Fishe exac es s. The ed do s ep esen signi ican ly
associa ed SNPs (P < 7.71 x 10-8).
(EPS)
Figu e S4. Localisa ion o a ansloca ion o a BTA29
segmen o ch omosome 6. Animals wi h and wi hou he
p esence o a BTA29 CNV we e compa ed using Fishe exac
es s. The ed do s ep esen signi ican ly associa ed SNPs (P
< 7.71 x 10-8).
(EPS)
Figu e S5. FISH s udies. Th ee No he n Finnca le (NFC)
animals wi h di e en combina ions o he Cs29 allele and one
animal o he Wes e n Finnca le (WFC) and Eas e n Finnca le
(EFC) we e analysed by FISH wi h wo BAC p obes. The Cs29
allele is associa ed wi h bo h colou sidedness and gonadal
hypoplasia and i co esponds o he ed FISH signal o he ed
ba . The Cs6 allele is associa ed wi h colou sidedness and
co esponds o he g een FISH signal o he g een ba .
O e lapping ed and g een signals appea yellow. All animals
excep he solid b own Wes e n Finnca le had one o se e al
Cs alleles. The animal NFC 164 is a ec ed wi h gonadal
hypoplasia and i is homozygous o he Cs29 allele.
(TIF)
Figu e S6. Associa ion o 647,971 SNPs wi h he a ec ion
s a us o 39 animals homozygous o he Cs29 allele.
Associa ion analysis was pe o med using Fishe exac es s o
allelic associa ion o 21 a ec ed and 18 una ec ed animals
homozygous o he Cs29 allele.
(JPG)
Table S1. The associa ion be ween he p opo ion o coa
pigmen a ion and o al (unila e al o bila e al) gonadal
hypoplasia in he Swedish Moun ain b eed emales
(modi ied om Se e g en [6]).
(DOCX)
Table S2. Nominal p- alues o he SNPs signi ican ly
associa ed o gonadal hypoplasia in BTA29 (allelic es ). P-
alues we e calcula ed wi h Fishe exac es s in PLINK o
de e mine allelic associa ion in ou di e en case-con ol
coho s (Table 1).
(XLSX)
Table S3. Nominal p- alues o he SNPs signi ican ly
associa ed o gonadal hypoplasia in BTA29 (geno ypic
es ). P- alues we e ob ained using a 2d geno ypic es
implemen ed in PLINK o de e mine associa ion in ou di e en
case-con ol coho s (Table 1).
(XLSX)
Table S4. Nominal p- alues o he SNPs loca ed be ween
71502659 bp and 71990541 bp in BTA6 (allelic es ). P-
alues we e calcula ed wi h Fishe exac es s in PLINK o
de e mine allelic associa ion in ou di e en case-con ol
coho s (Table 1).
(XLS)
Table S5. Nominal p- alues o he SNPs loca ed be ween
71502659 bp and 71990541 bp in BTA6 (geno ypic es ). P-
alues we e ob ained using a 2d geno ypic es implemen ed
in PLINK o de e mine associa ion in ou di e en case-con ol
coho s (Table 1).
(XLS)
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 9 Sep embe 2013 | Volume 8 | Issue 9 | e75659