scieee Science in your language
[en] (orig)

Ectopic kit copy number variation underlies impaired migration of primordial germ cells associated with gonadal hypoplasia in cattle

Read accessible full text

Ectopic kit copy number variation underlies impaired migration of primordial germ cells associated with gonadal hypoplasia in cattle

Author: Venhoranta, Heli,Pausch, Hubert,Wysocki, Michal,Szczerbal, Izabela,Hänninen, Reetta,Taponen, Juhani,Uimari, Pekka,Flisikowski, Krzysztof,Lohi, Hannes,Fries, Ruedi,Switonski, Marek,Andersson, Magnus
Year: 2013
Source: https://jukuri.luke.fi/bitstream/10024/482097/1/venhoranta.pdf
Ec opic KIT Copy Numbe Va ia ion Unde lies Impai ed
Mig a ion o P imo dial Ge m Cells Associa ed wi h
Gonadal Hypoplasia in Ca le (Bos au us)
Heli Venho an a1*☯, Hube Pausch2☯, Michal Wysocki2, Izabela Szcze bal3, Ree a Hänninen4, Juhani
Taponen1, Pekka Uima i5, K zysz o Flisikowski6, Hannes Lohi4, Ruedi F ies2, Ma ek Swi onski3, Magnus
Ande sson1
1 Depa men o P oduc ion Animal Medicine, Uni e si y o Helsinki, Saa en aus, Finland, 2 Chai o Animal B eeding, Technische Uni e si ä München,
F eising-Weihens ephan, Ge many, 3 Depa men o Gene icsandAnimal B eeding, Uni e si y o Li e Sciences, Poznań, Poland, 4 Depa men o Ve e ina y
Biosciences, Resea ch P og ams Uni , Molecula Neu ology, Uni e si y o Helsinki and Folkhälsan Resea ch Ins i u e, Helsinki, Finland, 5 Ag i ood Resea ch
Finland, MTT, Bio echnology and Food Resea ch, Jokioinen, Finland, 6 Chai o Li es ock Bio echnology, Technische Uni e si ä München, F eising, Ge many
Abs ac
Impai ed mig a ion o p imo dial ge m cells du ing emb yonic de elopmen causes he edi a y gonadal hypoplasia in
bo h sexes o No he n Finnca le and Swedish Moun ain ca le. The a ec ed gonads exhibi a lack o o , in a e
cases, a educed numbe o ge m cells. Mos a ec ed animals p esen le -sided gonadal hypoplasia. Howe e , igh -
sided and bila e al cases a e also ound. This ype o gonadal hypoplasia p e ails in animals wi h whi e coa colou .
P e ious s udies indica ed ha gonadal hypoplasia is inhe i ed in an au osomal ecessi e ashion wi h incomple e
pene ance. In o de o iden i y gene ic egions unde lying gonadal hypoplasia, a genome-wide associa ion s udy
(GWAS) and a copy numbe a ia ion (CNV) analysis we e pe o med wi h 94 animals, including 21 a ec ed animals,
using bo ine 777,962 SNP a ays. The GWAS and CNV esul s e ealed wo signi ican ly associa ed egions on
bo ine ch omosomes (BTA) 29 and 6, espec i ely (P=2.19 x 10-13 and P=5.65 x 10-6). Subsequen cy ogene ic and
PCR analyses demons a ed ha homozygosi y o a ~500 kb ch omosomal segmen ansloca ed om BTA6 o
BTA29 (Cs29 allele) is he unde lying gene ic mechanism esponsible o gonadal hypoplasia. The duplica ed
segmen includes he KIT gene ha is known o egula e he mig a ion o ge m cells and p ecu so s o melanocy es.
This duplica ion is also one o he wo ansloca ions associa ed wi h colou sidedness in a ious ca le b eeds.
Ci a ion: Venho an a H, Pausch H, Wysocki M, Szcze bal I, Hänninen R, e al. (2013) Ec opic KIT Copy Numbe Va ia ion Unde lies Impai ed Mig a ion o
P imo dial Ge m Cells Associa ed wi h Gonadal Hypoplasia in Ca le (Bos au us). PLoS ONE 8(9): e75659. doi:10.1371/jou nal.pone.0075659
Edi o : Toshi Shioda, Massachuse s Gene al Hospi al, Uni ed S a es o Ame ica
Recei ed Ma ch 8, 2013; Accep ed Augus 16, 2013; Published Sep embe 26, 2013
Copy igh : © 2013 Venho an a e al. This is an open-access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License, which
pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal au ho and sou ce a e c edi ed.
Funding: Funding om he Academy o Finland, Finnish Ve e ina y Founda ion, O ion-Fa mos esea ch ounda ion, Emil Aal onen Founda ion and Niemi
Founda ion is highly app ecia ed. HP was unded by he Ge man Fede al Minis y o Educa ion and Resea ch wi hin he Ag oClus E “Synb eed -
Syne gis ic plan and animal b eeding”. The unde s had no ole in s udy design, da a collec ion and analysis, decision o publish, o p epa a ion o he
manusc ip .
Compe ing in e es s: The au ho s ha e decla ed ha no compe ing in e es s exis .
* E-mail: [email p o ec ed]
☯ These au ho s con ibu ed equally o his wo k.
In oduc ion
Gonadal hypoplasia is cha ac e ised by abe an ly small and
unde de eloped gonads. Fe ili y is gene ally dis u bed when
bo h gonads a e hypoplas ic. Di e en ypes o gonadal
hypoplasia ha e been epo ed in se e al mammalian species,
including ca s, dogs [1], sheep [2], ho ses [3,4] and humans [5].
He edi a y gonadal hypoplasia is a equen diso de in wo
Scandina ian ca le b eeds, No he n Finnca le and Swedish
Moun ain ca le (also called Swedish Highland b eed). The
de ec eme ged in he ea ly 20 h cen u y a e pu e-b eeding o
Swedish Moun ain ca le was implemen ed [6,7]. A ew
decades la e he incidence o gonadal hypoplasia inc eased
hea ily and clinical in es iga ions we e ini ia ed.
Comp ehensi e heal h con ol e alua ions we e implemen ed
which educed he incidence o gonadal hypoplasia om 17.3%
o Swedish Moun ain ca le bo n be o e 1937 o 7.3% o
animals bo n be ween 1952 and 1954 [8]. The No he n
Finnca le almos became ex inc du ing he Second Wo ld
Wa . Thus conside able in og ession o genes om Swedish
Moun ain ca le ook place du ing he las 65 yea s and likely
in oduced gonadal hypoplasia in o he No he n Finnca le
he d.
PLOS ONE | www.plosone.o g 1 Sep embe 2013 | Volume 8 | Issue 9 | e75659
The incidence o gonadal hypoplasia in he men ioned
b eeds is equal in bo h sexes and comp ehensi e b eeding
expe imen s sugges a ecessi e mode o inhe i ance wi h
incomple e pene ance [7]. Pene ance was es ima ed o be 0.5
and E iksson [7] sugges ed ha he incomple e pene ance is
pa ly gene ically de e mined.
Gonadal hypoplasia is unique in No he n Finnca le and
Swedish Moun ain ca le because i is mainly mani es ed on he
le side. The p opo ions o le -, double- and igh -sided
gonadal hypoplasia a e 82%, 15% and 3%, espec i ely [7].
Al hough he absolu e numbe s di e ac oss s udies, le -sided
gonadal hypoplasia always p edomina es [9,10]. Howe e ,
he e is no e idence ha he localiza ion (le and/o igh ) o
hypoplas ic gonads is gene ically de e mined in No he n
Finnca le and Swedish Moun ain ca le [7].
The se e i y o gonadal hypoplasia a ies conside ably om
o al (Figu e 1) o pa ial [6,7] and a ec ed animals lack o ha e
a educed numbe o ge m cells [6]. Bila e ally a ec ed animals
a e o en s e ile and hypoplasia can also a ec seconda y
sexual cha ac e is ics ia impai ed p oduc ion o sexual
ho mones in emales [7,9]. The e a e no epo s ha a ec ed
animals su e om any o he heal h p oblems.
Gonadal hypoplasia o No he n Finnca le and Swedish
Moun ain ca le is a congeni al de ec [7] and Se e g en [6]
ound ha he hypoplas ic o a ies can al eady be iden i ied a
he oe al s age. Foe al es icles we e no s udied. Se e g en
Figu e 1. Le -sided gonadal hypoplasia. (A) Hypoplas ic
o a y (le a ow) and no mal o a y ( igh a ow). (B)
Hypoplas ic es icle (le ) and no mal es icle ( igh ).
doi: 10.1371/jou nal.pone.0075659.g001
[6] concluded ha he eason o gonadal hypoplasia is a ailu e
o he mig a ion and synch onous mi o ic di isions o p imo dial
ge m cells (PGC). Mig a ion and p oli e a ion o PGCs in he
de eloping emb yo is a complex p ocess wi h a ious genes
and signalling pa hways in ol ed [11,12].
Gonadal hypoplasia occu s only in animals ha a e 60-100%
whi e colou ed (Table S1) [6]. The coa colou o he No he n
Finnca le and Swedish Moun ain ca le a ies om whi e o
black o b own wi h nume ous in e media es. Whi e coa wi h
pigmen ed ea s and muzzle is he mos common o m, bu
spo ed sides and colou ed legs a e also commonly ound
(Figu e S1). Pa o his colou a ia ion is likely due he colou -
sided pa e n ha is sugges ed o be caused by a semi-
dominan gene symbolized as Cs [13,14]. Recen ly Du kin e
al. [15] showed ha colou sidedness is de e mined by wo loci
p esen on bo ine ch omosomes, (BTA) 29 and 6. The Cs29
allele in BTA29 esul ed om a duplica ion and ansloca ion
e en o a 492 kb segmen o BTA6 including he KIT gene.
The Cs6 allele esiding on BTA6 is a esul o a subsequen
duplica ion and ansloca ion e en ha mo ed back he
segmen comp ising used sequences o he BTA29 and BTA6
o he KIT locus in BTA6. I is expec ed ha in bo h cases he
dys egula ion o he KIT gene leads o he colou sidedness
[15].
The KIT gene encodes a ype III ecep o p o ein o he
y osine kinase amily. Se e al s udies ha e shown ha KIT
p o ein is c ucial o su i al, p oli e a ion and mig a ion o
melanocy e p ecu so s and p imo dial ge m cells (PGC) du ing
emb yogenesis [16-18]. KIT is also essen ial o egula
de elopmen o hema opoie ic cells [16,19]. In mice, mu a ions
in KIT esul in impai ed pigmen a ion, educed e ili y o
s e ili y, anaemia and dea ness. These mu a ions a e o en
pleio opic (MGI:96677, h p://www.in o ma ics.jax.o g/). KIT
mu a ions also unde lie coa colou a ia ion in o he mammals,
e.g. pig [20,21] and ho se [22]. In humans, KIT mu a ions
cause piebaldism, mas cell disease and se e al ypes o
umou (*164920, h p://omim.o g/).
The aim o his s udy was o iden i y he gene ic cause o he
he edi a y o m o gonadal hypoplasia in No he n Finnca le
and Swedish Moun ain ca le. A genome-wide associa ion
s udy combined wi h a copy numbe a ia ion (CNV) analysis
was pe o med wi h high-densi y SNP a ays o pinpoin he
genomic egion. The esul s we e con i med wi h cy ogene ic
in es iga ions, quan i a i e PCR and con en ional PCR. We
show ha Swedish Moun ain ca le and No he n Finnca le
ca y alleles ha cause colou -sidedness [15] and ha a ec ed
indi iduals a e homozygous o he Cs29 allele ha includes he
ec opic KIT gene.
Resul s
A genome-wide associa ion s udy maps congeni al
gonadal hypoplasia o BTA29
Gonadal hypoplasia in No he n Finnca le and Swedish
Moun ain ca le is hypo hesized o esul om pleio opic
e ec s o a whi e colou gene because mos o he a ec ed
animals a e p edominan ly whi e [6,23]. To accoun o bo h he
di e en coa colou pa e ns and he a ec ion s a us o he
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 2 Sep embe 2013 | Volume 8 | Issue 9 | e75659
animals, ou di e en case-con ol coho s we e es ablished
(Table 1) and allelic associa ions we e pe o med. P- alues
below 7.71 x 10-8 (Bon e oni-co ec ed h eshold o mul iple
es ing) we e conside ed o be signi ican ly associa ed. A
genome-wide associa ion s udy (GWAS) wi h 20 una ec ed
p edominan ly black and b own animals and 21 a ec ed
p edominan ly whi e animals e ealed 18 signi ican ly
associa ed SNPs on BTA29 be ween 17.69 Mb o 20.50 Mb
(Figu e 2A, Table S2). The SNP showing mos signi ican
associa ion was Bo ineHD2900005672 (19,661,149 bp,
P=2.19 x 10-13). The second GWAS, including all a ailable
una ec ed animals (N=73) and all a ec ed animals, yielded i e
highly signi ican ly associa ed SNPs on BTA29 and one highly
signi ican ly associa ed SNP on BTA23 a 52,435,290 bp,
(P=9.57 x 10-9) (Figu e 2B). This SNP was conside ed o be a
alse posi i e esul because he e we e no o he signi ican ly
associa ed SNPs on BTA23. Mo eo e , e-geno yping he SNP
using Sange -sequencing e ealed disc epan geno ypes
compa ed wi h he geno ypes ob ained wi h he Illumina
Bo ineHD Bead chip in some samples. This indica ed echnical
p oblems. Compa ison o p edominan ly whi e -40 una ec ed
and 21 a ec ed – animals e ealed a sugges i e associa ion
(Table S2). Simila ly, GWAS in he ou h g oup (D) using 40
una ec ed p edominan ly whi e animals and 20 una ec ed
p edominan ly colou ed animals e ealed a sugges i e
associa ion (Table S2). Howe e he SNPs o he las wo
GWAS analysis we e no signi ican ly associa ed a e
Bon e oni-co ec ion (Figu e 2C and 2D). Addi ionally,
associa ion analyses we e epea ed using a geno ypic es .
The esul s we e in line wi h he allelic es , unde lining he
impo ance o he 17.69 Mb o 20.50 Mb a ea in BTA29 (Table
S3). Collec i ely, he analysis o he ou s udied coho s
indica es ha he BTA29 egion is associa ed wi h gonadal
hypoplasia and no only e lec s di e en coa colou pa e ns.
The genomic in la ion ac o s o he g oups anged om 0.94
o 1.02 and indica e he absence o po en ial spu ious
associa ions.
CNV analysis iden i ies a ansloca ed genomic egion
wi h he KIT gene
Du kin e al. [15] showed ha colou sidedness in a ious
ca le b eeds is de e mined by wo CNVs ha duplica e a small
pa o he BTA6 and BTA29. Because o he s ong link
be ween whi e colo a ion and gonadal hypoplasia in No he n
Finnca le and Swedish Moun ain ca le, we ca ied ou CNV
analysis. A o al o 2101 au osomal CNVs we e iden i ied in 94
animals. Among hem a CNV segmen on BTA6, ex ending
om 71.60 Mb o 72.13 Mb and con aining he KIT gene, was
signi ican ly associa ed wi h gonadal hypoplasia (P=5.65 x 10-6)
(Figu e 3, Figu e 4A). The CNV was p esen in all 21 a ec ed
animals and in 52 o 73 animals o he con ol g oup. Also, a
CNV segmen on BTA29, ex ending om 19.86 Mb o 20.32
Mb, appea ed o be equen in he No he n Finnca le. The
CNV segmen on BTA29 was iden i ied in 14 a ec ed and 44
una ec ed animals, bu was no associa ed wi h gonadal
hypoplasia (Figu e S2). This segmen is in he immedia e
icini y o he mos signi ican ly associa ed gonadal hypoplasia
SNPs (Figu e 4B). To ensu e ha CNV segmen on BTA6 was
no associa ed o gonadal hypoplasia nominal p- alues o he
GWAS o he SNPs loca ed icini y o he segmen we e
s udied (Tables S4 and S5). Only wi h he Design D in he
geno ypic es a ew SNPs wi h sugges i e associa ion was
ound. This design included only una ec ed p edominan ly
whi e and colou ed animals so he ound associa ions we e
ela ed o coa colou no gonadal hypoplasia.
Du kin e al. [15] also showed ha he wo colou sidedness
loci esul om a ansloca ion o a ch omosomal segmen ,
encompassing he KIT gene, om BTA6 o BTA29 and a pa
o his agmen back o BTA6 nea he KIT gene. To
in es iga e whe he simila duplica ions a e p esen in No he n
Finnca le and he Swedish Moun ain b eed, we used 38
animals wi h copy numbe (CN) ou on BTA6 as he case
g oup and 21 animals wi h CN wo as a con ol g oup o iden i y
a po en ial ansloca ion. The CN s a us was de e mined based
on he a ay geno ypes. We ound a s ong associa ion on
BTA29 (19,661,149 bp, P = 1.66 x 10-28), indica ing a
ansloca ion o he BTA6 segmen o BTA29 (Figu e S3). We
nex analysed 58 and 36 animals wi h and wi hou CNV on
BTA29, espec i ely, and iden i ied a s ong associa ion on
BTA6 (72,198,048 bp, P=1.69 x 10-14, Figu e S4), indica ing a
ansloca ion om he BTA29 segmen o BTA6. These
posi ions ag ee wi h hose desc ibed by Du kin e al. [15]
indica ing ha he duplica ions iden i ied a e he same.
Table 1. O ganisa ion o ou di e en case-con ol designs.
Con ol coho Case coho
Gonadal hypoplasia UNAFF AFF UNAFF AFF
Coa colou W B U W B U o al W B U W B U o al
Design A 20 20 21 21
Design B 40 20 13 73 21 21
Design C 40 40 21 21
Design D 40 40 20 20
Fou di e en case-con ol coho s we e es ablished (A-D). The coa colou o he animals was assessed as p edominan ly whi e (W), p edominan ly black/b own (B) and
unknown (U). The gonadal hypoplasia s a us was assessed as a bina y ai (a ec ed (AFF) and una ec ed (UNAFF)).
doi: 10.1371/jou nal.pone.0075659. 001
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 3 Sep embe 2013 | Volume 8 | Issue 9 | e75659
Figu e 2. Associa ion o 647,971 SNPs in ou di e en case con ol scena ios. The Manha an plo s ep esen he -log10(P)
alues o associa ion o 647,971 SNPs in ou di e en case-con ol designs (Table 1). The ed do s ep esen signi ican ly
associa ed SNPs (P < 7.71 x 10-8).
doi: 10.1371/jou nal.pone.0075659.g002
Figu e 3. Associa ion o 2101 au osomal CNVs wi h he a ec ion s a us o 94 animals. The p esence o CNV segmen s was
compa ed in 21 cases and 73 con ols using Fishe exac es s. The do s ep esen SNPs wi hin he CNV segmen s. Red do s
ep esen SNPs in signi ican ly o e ep esen ed CNVs in cases s. con ols (P < 2.38 x 10-5).
doi: 10.1371/jou nal.pone.0075659.g003
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 4 Sep embe 2013 | Volume 8 | Issue 9 | e75659
Cy ogene ic s udies con i m ansloca ions be ween
BTA6 and BTA29
Th ee No he n Finnca le animals we e selec ed o
cy ogene ic in es iga ions based on he CN s a us o he BTA6-
segmen . One o hese animals was a ec ed by gonadal
hypoplasia. A Wes e n Finnca le and an Eas e n Finnca le
animal we e also included in he compa a i e analysis. These
b eeds a e no a ec ed by he gonadal hypoplasia.
T adi ionally, Wes e n Finnca le is a solid b own b eed and
Eas e n Finnca le is a b own b eed wi h he colou -sided
pheno ype. Bac e ial a i icial ch omosome (BAC) clones
speci ic o he CN a eas o ch omosomes BTA6 ( ed FISH
signal) and BTA29 (g een FISH signal) we e used as p obes in
FISH expe imen s. O e lapping ed and g een signals appea
yellow. In he Wes e n Finnca le animal wo ed (BTA6
homologs) and wo g een (BTA29 homologs) signals we e
eco ded. The Eas e n Finnca le animal showed he ollowing
pa e n: wo yellow signals on BTA6 and wo g een signals on
BTA29. All h ee animals om he No he n Finnca le b eed
showed ed and yellow signals on BTA6 while he pa e ns on
BTA29 a ied. The i s una ec ed No he n Finnca le showed
g een and yellow signals on BTA29 whe eas he second
una ec ed No he n Finnca le showed only g een signals. The
a ec ed No he n Finnca le animal had yellow signals on
BTA29 (Figu e S5). Taken oge he , all animals excep he
solid b own Wes e n Finnca le animal had one o se e al
ansloca ions associa ed wi h colou sidedness. The a ec ed
No he n Finnca le was homozygous o he Cs29 allele. This
suppo s ou GWAS and CNV esul s ha showed s ong
associa ion be ween he Cs29 allele and gonadal hypoplasia.
CNV con i ma ion using quan i a i e PCR
The numbe o he Cs29 alleles was analysed by quan i a i e
PCR in nine a ec ed and 21 una ec ed animals. The esul s
ag ee wi h he CNV esul s based on he a ay geno ypes.
Howe e , using qPCR we could no dis inguish be ween
he e ozygous and homozygous animals.
Figu e 4. Schema ic iew o wo CNV segmen s on BTA6 and BTA29. The igu es display 5-SNP-sliding-window log R a ios in
75 una ec ed (g ey) and 21 a ec ed (blue) animals on BTA6 (A) and BTA29 (B). The g ey shaded box ep esen s he ex en o he
wo CNV segmen s. The gene con en was assessed based on he Uni e si y o Ma yland assembly.
doi: 10.1371/jou nal.pone.0075659.g004
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 5 Sep embe 2013 | Volume 8 | Issue 9 | e75659

Con i ma ion o CNV using con en ional PCR
To cha ac e ize he ansloca ion p esen in No he n
Finnca le and Swedish Moun ain ca le we used PCR p ime s
acco ding o Du kin e al. [15] and one addi ional p ime pai
ha lanked he inse ion si e o wild ype BTA29. Analysed
animals included also wo animals ha we e omi ed om he
GWAS analyses because o he geno yping ailu e. Colou o
hese wo animals was p edominan ly b own and whi e. The
esul s showed ha all a ec ed animals we e homozygous o
he Cs29 allele and 15 animals had he Cs6 allele. O he
una ec ed animals, 18 we e homozygous and 37 we e
he e ozygous o he Cs29 allele and 20 did no ha e he Cs29
allele. The Cs6 allele was de ec ed om 44 con ol animals
(Table 2). The a io o he Cs6 allele is sligh ly highe in a ec ed
han in una ec ed animals: 15/21 (71%) and 44/75 (59%)
espec i ely. Mo e impo an ly he occu ence o Cs6 in con ol
animals ha we e homozygous o he Cs29 allele was 14/18
(78%) which is almos he same as in a ec ed animals (Table
2). Like he case animals, all homozygous con ol animals we e
p edominan ly whi e. The a io o he Cs6 allele in whi e con ol
animals ha we e he e ozygous o he Cs29 allele was 11/18
(61%) which is also qui e close o he Cs6 a io o he case
animals (Table S6). These esul s sugges s ha he
homozygous Cs29 allele migh ha e pleio opic e ec s on bo h
coa colou and gonadal hypoplasia bu he Cs6 allele a ec s
only he coa colou . The esul s a e in line wi h he CNV
esul s based on a ay geno ypes and qPCR. Addi ionally, we
de e mined he DNA sequence o all PCR p oduc s ampli ied
om he selec ed 12 animals ( esul s no shown). The
sequences we e compa able wi h hose ob ained by Du kin e
al. [15].
A genome-wide associa ion s udy compa ing he case
and con ol animals homozygous o he Cs29 allele
e ealed no associa ion
Gi en ha he Cs29 allele was associa ed wi h gonadal
hypoplasia we pe o med an addi ional condi ional GWAS
whe e he case animals we e compa ed wi h 18 con ol
animals ha we e homozygous o he Cs29 allele. The only
sugges i ely associa ed allele was he SNP on BTA23 a
52,435,290 bp which was shown o ha e disc epan geno ypes
(Figu e S6).
Table 2. The PCR analysis o CNVs.
A ec ed Una ec ed
+/+ +/Cs29 Cs29/Cs29 +/+ +/Cs29 Cs29/Cs29
+/+ 0 0 6 10 17 4
Cs6/- 0 0 15 10 20 14
o al 0 0 21 20 37 18
The PCR analysis o CNVs based on p ime s designed by Du kin e al. [15] and
us. All 96 animals we e analysed including wo con ol animals whose geno yping
ailed. The animals a e di ided acco ding o alleles in BTA29 and BTA6.
He e ozygous and homozygous ca ie s o he Cs6 allele could no be
dis inguished.
doi: 10.1371/jou nal.pone.0075659. 002
Discussion
The esul s o his s udy s ongly sugges ha he
p edominan ly le -sided gonadal hypoplasia in No he n
Finnca le and Swedish Moun ain ca le is associa ed wi h a
complex ch omosomal ea angemen including a ~500kb
duplica ed segmen om BTA6 which is ansloca ed o BTA29.
This duplica ed segmen includes he en i e coding sequence
o he KIT gene. Gi en ha he a ec ed animals we e
homozygous o he ansloca ed duplica ion, ou s udy
suppo s he ecessi e disease model and highligh s KIT gene
dosage as a signi ican isk ac o .
We showed ha he ansloca ed segmen is he same as
one o he wo p e iously desc ibed ansloca ed segmen s
Cs29 and Cs6 ha a e esponsible o colou sidedness in ca le
[15]. The colou -sided pa e n is demons a ed by a iable
coa ing om colou ed animals wi h a whi e line in he back o
almos whi e animals wi h colou ed pa s only in ea s, muzzle
and ee . The la e coa colou pa e n is common o No he n
Finnca le and Swedish Moun ain ca le b eeds. Se e g en [6]
showed ha he p edominan ly whi e coa colou o Swedish
Moun ain ca le was s ongly associa ed wi h gonadal
hypoplasia. Ou GWAS da a suppo he hypo hesis ha he
Cs29 allele is associa ed wi h bo h whi e coa colou and
gonadal hypoplasia. We did no ind any associa ion when
compa ing p edominan ly whi e a ec ed and una ec ed
animals. Mo eo e , he associa ion signal was s onge when
a ec ed animals we e compa ed wi h colou ed animals han
when a ec ed animals we e compa ed wi h all una ec ed
animals. These esul s a e because mos o he whi e animals
ca y a leas one copy o he Cs29 allele and his implica es
co ela ion o Cs29 allele wi h bo h whi e coa colou and
gonadal hypoplasia. Howe e , compa ison o una ec ed
p edominan ly whi e animals and una ec ed p edominan ly
colou ed animals showed no associa ion ha would ha e
exceeded he genome-wide h eshold le el. This esul was
su p ising bu can be explained wi h he knowing ha some o
he una ec ed p edominan ly colou ed animals we e colou
sided and pa o hem had he Cs29 allele. Mo eo e , some o
he una ec ed p edominan ly whi e animals lacked he Cs29
allele. This indica es s onge co ela ion o Cs29 allele wi h
gonadal hypoplasia han wi h p edominan ly whi e coa colou .
Compa isons ac oss he s udy g oups s ongly sugges ha he
Cs29 allele is associa ed wi h gonadal hypoplasia and no only
e lec s di e en coa colou pa e ns.
I is unlikely ha Cs6 allele is ela ed o gonadal hypoplasia
gi en ha he CNV analyses showed no associa ion be ween
he Cs6 allele and gonadal hypoplasia. Fu he mo e, he
con en ional PCR esul s showed ha he Cs6 allele is only
sligh ly en iched in a ec ed animals when compa ed wi h all
una ec ed animals. Mo e impo an ly, he equency o he Cs6
allele was almos he same in case animals as in con ol
animals ha we e homozygous o he Cs29 allele.
Mu a ions wi hin he KIT gene cause whi e colou also in
ho se and pig, bu he e a e no epo s o associa ed gonadal
hypoplasia. On he o he hand, se e al mouse models
ha bou ing KIT mu a ions show pleio opic e ec s causing
educed e ili y and whi e colou ing. Many o hese mice
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 6 Sep embe 2013 | Volume 8 | Issue 9 | e75659
mu an s su e om anaemia, umou o ma ion and dea ness
(MGI:96677, h p://www.in o ma ics.jax.o g/). We a e no awa e
ha he a ec ed animals in ou s udy had any o he disease
symp oms besides gonadal hypoplasia. Ye he same kind o
gonadal hypoplasia, as in No he n Finnca le and Swedish
Moun ain ca le, has no been obse ed in any mouse s udies.
Only o he Nguni b eed (Bos indicus x Bos au us c oss) a e
he e epo s o a he edi a y o m o gonadal hypoplasia
esembling ha o m ound in No he n Finnca le and Swedish
Moun ain ca le [24-26]. In e es ingly, he Nguni b eed also
p esen s he colou -sided pheno ype.
Du kin e al. [15] implica ed ha loci on BTA6 and BTA29
accoun o mos , i no all, colou sidedness in ca le.
Mo eo e , B enig e al. [27] showed ha in Whi e Galloway
ca le and Whi e Pa k ca le he p edominan ly whi e coa
colou was a ibu ed o he Cs29 allele. This was also shown in
ou s udy whe e only i e animals ou o 62 p edominan ly
whi e animals did no ha e he Cs29 allele. Se e al ca le
b eeds ha e his allele in BTA29, bu he edi a y gonadal
hypoplasia has only been epo ed in No he n Finnca le,
Swedish Moun ain ca le and Nguni ca le. This migh be
because he p opo ion o animals homozygous o he Cs29
allele is oo small in se e al colou sided b eeds o his ype o
ecessi e gonadal hypoplasia wi h incomple e pene ance o be
diagnosed.
Ano he hypo hesis o he gene ic cause o he gonadal
hypoplasia is ha Swedish Moun ain ca le and No he n
Finnca le ha e o he b eed speci ic changes in he genome in
addi ion o he Cs29 allele. This conclusion implies ha Nguni
migh ha e di e en mu a ions ha cause he gonadal
hypoplasia. The GWAS s udies showed no o he eliable
associa ion be ween he cases and con ols han he
associa ion o BTA29. Howe e , he addi ional mu a ions migh
emain unde ec ed because o he small sample size in he
p esen s udy o because o he loca ion o he mu a ion. I
mu a ion is wi hin he ansloca ed a ea o in co esponding
a ea in he o iginal ch omosome he mapping wi h GWAS
migh no wo k.
Ou indings ha all a ec ed animals had wo ec opic KIT
genes suppo he pos ula ed mode o ecessi e inhe i ance
[7]. Ne e heless, 17 una ec ed animals also had wo ec opic
KIT genes. This migh be explained by incomple e pene ance
o by he p esence o an addi ional mu a ion o mu a ions
besides he Cs29 allele.
In conclusion, we showed ha a he edi a y o m o gonadal
hypoplasia in Swedish Moun ain ca le and No he n Finnca le
is associa ed wi h homozygosi y o he Cs29 allele. The e is
need o u he in es iga ions o unde s and ully he
mechanisms causing he diso de . Howe e , o ou knowledge,
his is he i s epo indica ing a duplica ion o he KIT gene
wi h p edominan ly le -sided gonadal hypoplasia in mammals.
Ma e ials and Me hods
E hics s a emen
The blood sampling and clinical examina ions we e ca ied
ou ollowing s anda d e e ina y p o ocols in Finland. The
Animal E hics Commi ee o he S a e P o incial O ice o
Sou he n Finland app o ed all animal wo k
(ESAVI-2010-03428/Ym-23).
Gonad examina ion and sampling
Clinical examina ions we e done du ing a m isi s by
expe ienced e e ina ians. Bulls and bull cal es we e palpa ed
o es icle size and symme y. Female animals olde han 16
mon hs, excluding animals mo e han i e mon hs p egnan ,
we e s udied by o a ian palpa ion pe ec um. A e clinical
examina ion, 9 ml o EDTA enous blood we e collec ed om
he animals sui able o his s udy. Semen samples o a i icial
insemina ion bulls included in he s udy we e also collec ed.
F om he pos -mo em s udy animals’ gonads we e examined
isually, palpa ed and weighed. His ological and issue
samples o DNA ex ac ion we e aken om he collec ed
gonads. His ological samples we e subjec ed o s anda d
Bouin’s ixa ion and embedded in pa a in. Sec ions (5 µm)
we e cu and s ained wi h haema oxylin-eosin (HE).
Animals conside ed a ec ed by gonadal hypoplasia
Cows and hei e s wi h one o a y o ex emely small size
we e conside ed o be a ec ed by gonadal hypoplasia. Usually
he hypoplas ic o a y was unde ec able by palpa ion pe
ec um. Bulls and bull cal es we e conside ed o be a ec ed by
unila e al gonadal hypoplasia i hei es icles clea ly di e ed in
size, i.e. one es icle being mo e han wo imes la ge han he
o he es icle in young cal es and o bulls’ one es icle being
mo e han h ee imes la ge han he o he es icle. Bila e al
gonadal hypoplasia was diagnosed only in one bull selec ed o
semen collec ion. Bo h es icles we e e y small and he e
we e no spe m cells in he ejacula e. The es icle his ology only
showed Se oli cells and no spe ma ogonia in semini e ous
ubules in he hypoplas ic es icles. When possible, he
clinically diagnosed a ec ed animals we e e-examined du ing
a second a m isi o he gonads we e s udied a e slaugh e .
DNA ex ac ion
Genomic DNA om blood samples was ex ac ed by
au oma ic isola ion (Magne ic Sepa a ion Module I, Chemagen)
and genomic DNA om issue and semen samples was
ex ac ed using a comme cially a ailable Qiagen Ki (QIAamp
DNA Mini Ki ). Ex ac ions o he blood and issue samples
we e made acco ding o he manu ac u e ’s ins uc ions. The
ex ac ion o DNA om semen samples was made acco ding o
DNA Pu i ica ion om Tissues-p o ocol in QIAamp DNA Mini
Ki handbook wi h some modi ica ions. F om 200 o 500 µl o
ozen semen was cen i uged o 5 min a 100 × g. The
supe na an was mo ed and he pelle was washed wi h 200 µl
o phospha e bu e ed saline (PBS). The Qiagen bu e ALT
was added up o 300 µl and 20 µl o P o einase K and
di hio h ei ol was also added. The mix was incuba ed o 1 h a
56 °C. Du ing incuba ion he sample was pulse o exed ou
imes o 15 sec. 300 µl o Qiagen bu e AL was added and he
pulse o ex epea ed. The sample was incuba ed o 10 min a
56 °C and he ea e 150 µl o 96% alcohol was added. The
sample was pulse o exed and incuba ed o 3 min a oom
empe a u e. The whole mix u e was applied o he QIAamp
Mini spin column and cen i uged a 6,000 × g o 1 min. The
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 7 Sep embe 2013 | Volume 8 | Issue 9 | e75659
il a e was disca ded and he column was washed wice wi h
500 µl o Qiagen bu e AW1 and once wi h 500 µl o Qiagen
bu e AW2 (cen i uga ion a 6,000 × g o 1 min). The column
was d ied wi h cen i uga ion a 20,000 × g o 3 min. The DNA
was elu ed wi h 50 µl o dis illed wa e , incuba ed o 1 min a
oom empe a u e and cen i uged a 20,000 × g o 1 min.
Animals selec ed o geno yping
DNA samples om 96 animals we e included in his s udy.
Animals wi h o al unila e al o bila e al hypoplasia we e
included in he case g oup ha comp ised 21 animals (10
males and 11 emales). O hese animals, one was a ec ed
wi h bila e al, 18 wi h le -sided and wo wi h igh -sided
gonadal hypoplasia. The con ol g oup included 75 una ec ed
animals. Among he s udied animals 91 we e No he n
Finnca le and i e we e Swedish Moun ain ca le ( wo cases
and h ee con ols).
High-densi y geno yping and quali y con ol
Nine y-six animals (21 a ec ed / 75 una ec ed) we e
geno yped wi h he Illumina Bo ineHD Bead chip in e oga ing
geno ypes o 777,962 SNPs. Geno ype calling was pe o med
using de aul pa ame e s o Illumina’s BeadS udio. Quali y
con ol was ca ied ou wi h PLINK 1.07 [28]. We excluded
1224, 343 and 1735 SNPs wi h Y-ch omosomal, mi ochond ial
and unknown ch omosomal posi ion, espec i ely, o u he
analysis. The geno ypes o wo una ec ed animals we e
omi ed because geno yping ailed in mo e han 10% o he
SNPs. We u he excluded 6229 SNPs because geno yping
ailed in mo e 10% o he indi iduals and 121,657
monomo phic SNPs. The inal da ase comp ised 94 animals
and 647,971 SNPs wi h an a e age call- a e o 99.67%. The
ch omosomal posi ion o he SNPs was de e mined based on
he UMD3.1 assembly o he bo ine genome [29].
Genome-wide associa ion s udy
Fishe exac es s o allelic and geno ypic associa ions we e
pe o med o compa e geno ypes in cases s. con ols a each
SNP in u n using PLINK [28]. We conside ed SNPs wi h P <
7.71 x 10-8 as signi ican ly associa ed (Bon e oni-co ec ed
h eshold o mul iple es ing). Quan ile-quan ile plo s we e
inspec ed and genomic in la ion ac o s we e calcula ed
acco ding o De lin and Roede [30] o assess he ex en o
alse posi i e associa ion signals.
De ec ion o copy numbe a ian s
Geno ype signal in ensi ies ob ained om geno yping wi h
he Illumina Bo ineHD Bead chip (see abo e) we e analysed
wi h PennCNV [31] o iden i y copy numbe a ia ions (CNV).
B ie ly, he implemen ed CNV-de ec ion algo i hm conside s
bo h he log R a io (LRR) and he B allele equency (BAF), as
well as he allele equency and he dis ance o adjacen SNPs.
Two indi iduals and 6229 SNPs wi h poo geno yping quali y
(see abo e) we e no conside ed o he iden i ica ion o CNVs.
The p esence o CNVs con aining a minimum numbe o 10
SNPs co esponding o a minimum leng h o app oxima ely 35
Kb was compa ed in cases s. con ols using Fishe exac
es s.
Cy ogene ic analysis
Me aphase sp eads we e ob ained om sho - e m
lymphocy e cul u es, es ablished o i e animals. The FISH
s udy was ca ied ou acco ding o a p o ocol desc ibed by
Du kin e al. [15]. Two BAC clones (RP42-160M9,
RP42-156I13) co e ing he egion o in e es on ch omosome
BTA6 ( egion 72,566,605–72,817,995bp, UMD 3.0) and wo
BAC clones (RP42-37P11, RP42-116G8) co e ing he egion
o in e es on BTA29 ( egion 20,772,406–21,035,251bp, UMD
3.0) we e de i ed om he RPCI-42 Bo ine BAC Lib a y (h p://
bacpac.cho i.o g/home.h m). BAC DNA was isola ed using an
alkaline lysis me hod and labelled by andom p iming. The
isola ed DNAs om wo BAC clones speci ic o BTA6 we e
mixed equally and labelled using bio in-11-dUTP, while DNA
om wo BAC clones speci ic o BTA29 was also mixed and
labelled wi h digoxigenin-11-dUTP. The labelled p obes wi h an
excess o bo ine Co -1 DNA we e sepa a ely dena u ed o 10
min a 70°C and applied on dena u ed ch omosome slides.
Hyb idiza ion was ca ied ou o e nigh a 37°C. A e slide
washing, bio in-labelled p obes we e de ec ed using
s ep a idin-Cy3 (Ame sham, 1:200, ed colou ) and
digoxigenin-labelled p obes we e de ec ed wi h an idigoxigenin-
luo escein Fab agmen s (Roche, 1:200, g een colou ). The
slides we e coun e s ained wi h Vec ashield con aining DAPI
(Vec o Labo a o ies) and examined wi h an epi luo escence
Nikon E600 Eclipse mic oscope equipped wi h a cooled digi al
CCD came a and Lucia so wa e.
QPCR
QPCR was used o alida e CNV iden i ied a e
bioin o ma ics analysis. Al oge he 30 samples we e analysed:
nine cases and 21 con ols. A simple me hod based on
Weksbe e al. [32] and Lachman e al. [33] was applied o
analysis. Two p ime pai s designed using P ime 3 [34] we e
loca ed in he KIT egion: p ecisely in exon 8
(GGGCCAGTGGATGTACAGAT) and 9
(TGCAAAGTTAAAAGAGGCAGA); he second pai in exon 18
(CACATTTGAAAGTGATGTCTGG) and 19
(AGAACTTAGAATCGACTGGCATT). 10 µl o QPCR eac ion
was composed om he Fas SYBR® G een Mas e Mix (Li e
Technologies) and 2.5 pmol o each p ime . All ampli ica ions
we e ca ied ou in Applied Biosys ems 7500 Fas Real-Time
PCR Sys em (Li e Technologies) acco ding o manu ac u e ’s
ecommenda ions. H6PD was used as a e e ence gene; bo h
p ime s we e loca ed in he i s exon
(AAGGTCCTGGAGTCCCTGTC,
GTAGAAAATTCGGCCGGTCT).
PCR and sequencing
All animals we e analysed wi h s anda d PCR ca ied ou
using b eakpoin p ime s designed by Du kin e al. (Table 2)
[15] and one addi ional p ime pai PSK_α-β2_R
(TGGGTAGACAGGTTTGTTTCC and
TCTTGACCACTTGCATTGGA) ha lanked he inse ion si e
o he wild ype BTA29. A PCR eac ion o 20 µl olume
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 8 Sep embe 2013 | Volume 8 | Issue 9 | e75659
con aining 20 ng genomic DNA, 1x Qiagen PCR bu e , 1.5 mM
MgCl2, 200 µM o each nucleo ide, 5 pmol o each o wa d and
e e se p ime (Sigma) and 0.5 uni s o Taq Polyme ase
(Qiagen) was pe o med unde he ollowing condi ions: ini ial
dena u ing a 95 °C o 3 min, ollowed by 35 cycles a 94 °C
o 30 sec, 60 °C o 1 min, 72 °C o one minu e and he inal
ex ension a 72 °C o 3 min. PCR p oduc s we e isualized
oge he wi h GeneRule TM100bp DNA Ladde (Fe men as,
The mo Scien i ic) on 1.5% aga ose gel.
Fi e case samples, wo con ol samples wi h a duplica ion o
he BTA6 segmen , wo con ol samples wi h bo h s udied
duplica ions and h ee con ol samples wi hou he duplica ions
we e subjec ed o sequencing. A 10-20 ng o pu i ied PCR
p oduc was mixed wi h 0.5 µl BigDye® Te mina o 3.1 (Li e
Technologies) and 0.5 µl o he o wa d o e e se PCR p ime
(2.5 pmol). The sequencing eac ion was pe o med unde he
ollowing condi ions: ini ial dena u ing a 96 °C o 10 sec,
ollowed by 35 cycles, including 10 sec in 96 °C, 5 sec in 50 °C,
and 4 min in 60 °C. The gel il a ion o he sequencing eac ion
was applied using he Mul iSc een il a ion pla e
(MAHVN4510; Millipo e) and Sephadex G-50 Fine (Sigma)
ollowed by capilla y elec opho esis ca ied ou on 3130xl
Gene ic Analyze (Li e Technologies). Base calling, sequence
alignmen and polymo phism de ec ion we e made using he
Ph ed/Ph ap/Polyph ed so wa e [35-37]. Sequences we e
inspec ed using Consed [38].
Se en cases and en con ols we e sequenced (see abo e)
wi h p ime s CAATTTTAAGCATGTGCTGAGG and
ACAGCCTCTGGTCTGTCTGG o alida e he geno ype calls
o he SNP on BTA23 a 52,435,290 bp.
Suppo ing In o ma ion
Figu e S1. Examples o he common colou pa e n in
No he n Finnca le. Mos commonly, No he n Finnca le is
almos whi e wi h black o b own in ea s and muzzle. The
lanks and legs can also be pa ly colou ed o spo ed.
(TIF)
Figu e S2. A e age log R a io o animals ca ying he
ec opic BTA29 segmen . The a e age log R a io was
calcula ed om 15 a ec ed and 44 una ec ed animals ha
ca y he duplica ed segmen o BTA29. The 5-SNP-sliding
window log R a io is p esen ed o 563 SNPs.
(PNG)
Figu e S3. Localisa ion o a ansloca ion o a KIT
con aining segmen o ch omosome 29. Animals ca ying
wo and ou copies o he BTA6 segmen we e compa ed
using Fishe exac es s. The ed do s ep esen signi ican ly
associa ed SNPs (P < 7.71 x 10-8).
(EPS)
Figu e S4. Localisa ion o a ansloca ion o a BTA29
segmen o ch omosome 6. Animals wi h and wi hou he
p esence o a BTA29 CNV we e compa ed using Fishe exac
es s. The ed do s ep esen signi ican ly associa ed SNPs (P
< 7.71 x 10-8).
(EPS)
Figu e S5. FISH s udies. Th ee No he n Finnca le (NFC)
animals wi h di e en combina ions o he Cs29 allele and one
animal o he Wes e n Finnca le (WFC) and Eas e n Finnca le
(EFC) we e analysed by FISH wi h wo BAC p obes. The Cs29
allele is associa ed wi h bo h colou sidedness and gonadal
hypoplasia and i co esponds o he ed FISH signal o he ed
ba . The Cs6 allele is associa ed wi h colou sidedness and
co esponds o he g een FISH signal o he g een ba .
O e lapping ed and g een signals appea yellow. All animals
excep he solid b own Wes e n Finnca le had one o se e al
Cs alleles. The animal NFC 164 is a ec ed wi h gonadal
hypoplasia and i is homozygous o he Cs29 allele.
(TIF)
Figu e S6. Associa ion o 647,971 SNPs wi h he a ec ion
s a us o 39 animals homozygous o he Cs29 allele.
Associa ion analysis was pe o med using Fishe exac es s o
allelic associa ion o 21 a ec ed and 18 una ec ed animals
homozygous o he Cs29 allele.
(JPG)
Table S1. The associa ion be ween he p opo ion o coa
pigmen a ion and o al (unila e al o bila e al) gonadal
hypoplasia in he Swedish Moun ain b eed emales
(modi ied om Se e g en [6]).
(DOCX)
Table S2. Nominal p- alues o he SNPs signi ican ly
associa ed o gonadal hypoplasia in BTA29 (allelic es ). P-
alues we e calcula ed wi h Fishe exac es s in PLINK o
de e mine allelic associa ion in ou di e en case-con ol
coho s (Table 1).
(XLSX)
Table S3. Nominal p- alues o he SNPs signi ican ly
associa ed o gonadal hypoplasia in BTA29 (geno ypic
es ). P- alues we e ob ained using a 2d geno ypic es
implemen ed in PLINK o de e mine associa ion in ou di e en
case-con ol coho s (Table 1).
(XLSX)
Table S4. Nominal p- alues o he SNPs loca ed be ween
71502659 bp and 71990541 bp in BTA6 (allelic es ). P-
alues we e calcula ed wi h Fishe exac es s in PLINK o
de e mine allelic associa ion in ou di e en case-con ol
coho s (Table 1).
(XLS)
Table S5. Nominal p- alues o he SNPs loca ed be ween
71502659 bp and 71990541 bp in BTA6 (geno ypic es ). P-
alues we e ob ained using a 2d geno ypic es implemen ed
in PLINK o de e mine associa ion in ou di e en case-con ol
coho s (Table 1).
(XLS)
He edi a y Gonadal Hypoplasia in Ca le
PLOS ONE | www.plosone.o g 9 Sep embe 2013 | Volume 8 | Issue 9 | e75659