RESEARCH ARTICLE Open Access
Ag oecosys ems shape popula ion gene ic
s uc u e o he g eenhouse whi e ly in No he n
and Sou he n Eu ope
I ina O ča enko
1,2*
, Despoina E ipidis Kapan aidaki
3,4
, Leena Linds öm
1
, Na halie Gau hie
5
, Anas asia Tsagka akou
3
,
Ka elyn Emily Kno
1
and I ene Vänninen
2
Abs ac
Backg ound: To p edic u he in asions o pes s i is impo an o unde s and wha ac o s con ibu e o he
gene ic s uc u e o hei popula ions. Cosmopoli an pes species a e ideal o s udying how di e en
ag oecosys ems a ec popula ion gene ic s uc u e wi hin a species a di e en clima ic ex emes. We unde ook
he i s popula ion gene ic s udy o he g eenhouse whi e ly (T ialeu odes apo a io um), a cosmopoli an in asi e
he bi o e, and examined he gene ic s uc u e o his species in No he n and Sou he n Eu ope. In Finland, cold
empe a u es limi whi e lies o g eenhouses and p e en hem om o e win e ing in na u e, and in G eece, milde
empe a u es allow whi e lies o inhabi bo h ields and g eenhouses yea ound, p o iding a g ea e po en ial o
connec i i y among popula ions. Using nine mic osa elli e ma ke s, we geno yped 1274 T. apo a io um emales
collec ed om 18 g eenhouses in Finland and eigh g eenhouses as well as eigh ields in G eece.
Resul s: Popula ions om Finland we e less di e se han hose om G eece, sugges ing ha G eek popula ions a e
la ge and subjec ed o ewe bo lenecks. Mo eo e , he e was signi ican popula ion gene ic s uc u e in bo h
coun ies ha was explained by di e en ac o s. Habi a ( ield s. g eenhouse) oge he wi h longi ude explained
gene ic s uc u e in G eece, whe eas in Finland, gene ic s uc u e was explained by hos plan species. Fu he mo e,
he e was no empo al gene ic s uc u e among popula ions in Finland, sugges ing ha yea - ound popula ions a e
able o pe sis in g eenhouses.
Conclusions: Taken oge he ou esul s show ha g eenhouse ag oecosys ems can limi gene low among
popula ions in bo h clima e zones. F agmen ed popula ions in g eenhouses could allow o e icien pes
managemen . Howe e , pes pe sis ence in bo h clima e zones, coupled wi h inc easing oppo uni ies o
na u aliza ion in empe a e la i udes due o clima e change, highligh challenges o he managemen o
cosmopoli an pes s in No he n and Sou he n Eu ope.
Keywo ds: T ialeu odes apo a io um, Pes managemen , Mic osa elli e ma ke s, Clima e zone, Hos adap a ion
Backg ound
The dispe sal o phy ophagous insec pes s can be en-
hanced by wo ldwide ade and human mo emen [1,2].
In addi ion, clima e change acili a es mo emen o a i-
ous axa polewa ds [3,4]. Following in oduc ion o new
habi a s, he es ablishmen o insec pes popula ions can
be a o ed by benign clima es, as well as by monocul u es
in ag oecosys ems, i.e. ag icul u al ields and g eenhouses
[5-7]. Low gene ic di e si y o insec pes popula ions in
newly occupied habi a s sugges s ha e en a single suc-
cess ul ounde e en is enough o es ablish popula ions
[8,9]. Howe e , u he sp ead o in oduced pes s in o
na u al ecosys ems depends on he en i onmen su -
ounding he ini ial in oduc ion and on he o igin o he
in oduced species [10,11]. Fo example, pes s o opical
o igin may be mo e likely o es ablish hemsel es in he
Medi e anean han in he bo eal clima e zone [12,13]. A
* Co espondence: [email p o ec ed]
1
Depa men o Biological and En i onmen al Science, Uni e si y o Jy askyla,
P.O. Box 35, FI-40014 Jy askyla, Finland
2
MTT Ag i ood Resea ch Finland, Plan P oduc ion Resea ch, Tie o ie, Animale
building, FI-31600 Jokioinen, Finland
Full lis o au ho in o ma ion is a ailable a he end o he a icle
© 2014 O ca enko e al.; licensee BioMed Cen al L d. This is an Open Access a icle dis ibu ed unde he e ms o he
C ea i e Commons A ibu ion License (h p://c ea i ecommons.o g/licenses/by/4.0), which pe mi s un es ic ed use,
dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly c edi ed. The C ea i e Commons Public
Domain Dedica ion wai e (h p://c ea i ecommons.o g/publicdomain/ze o/1.0/) applies o he da a made a ailable in his
a icle, unless o he wise s a ed.
O ča enko e al. BMC E olu iona y Biology 2014, 14:165
h p://www.biomedcen al.com/1471-2148/14/165
sou he n la i udes he e a e sui able clima ic condi ions
and yea - ound a ailabili y o hos plan s, in bo h na u al
ecosys ems and densely agg ega ed ag oecosys ems. In
con as , a no he n la i udes, na u al habi a s a e only
seasonally a ailable and g eenhouses a e o en spa sely
dis ibu ed. Thus, he ex en o es ablishmen and sp ead
o in asi e pes s in he No h migh be mo e dependen
on he dis ibu ion o ag oecosys ems, pa icula ly g een-
houses, han i is in he Sou h.
Enclosed g eenhouse en i onmen s a e designed o e-
duce e apo a ion, pes en y [14] and loss o expensi e
biological pes con ol agen s [15], o ensu e e icien c op
main enance. Because g eenhouses a e ela i ely closed
en i onmen s, pes popula ions in g eenhouses migh be
gene ally mo e a ec ed by insec icide applica ions and
hos plan changes han a e pes popula ions in ields.
These c op managemen p ac ices can lead o educ ions
in popula ion size and selec ion o esis an geno ypes in
he pes s leading o inc eased homozygosi y wi hin and
di e en ia ion be ween pes popula ions [16]. Thus, popu-
la ions o insec s inhabi ing g eenhouses migh show mo e
gene ic di e en ia ion han hose in ields. Indeed, popula-
ions o phy ophagous pes s inhabi ing g eenhouses o en
show popula ion gene ic s uc u e, e.g. Te anychus u i-
cae Koch [17,18], al hough dispe sal and gene low can
also be es ic ed among pes popula ions inhabi ing ields,
e.g. Lep ino a sa decemlinea a Say [8].
The g eenhouse whi e ly (T ialeu odes apo a io um
Wes wood) is an in asi e pes which was b ough o
Eu ope (UK) on O chidaceae om Mexico in 1856 [19].
Soon a e in oduc ion, i sp ead o he Eu opean con in-
en , and in 1920 i was eco ded in g eenhouses in Finland
[20]. In Finland, i sp ead h ough anspo a ion on plan
seedlings abo e he A c ic Ci cle o Ro aniemi, b inging
conside able damage o oma o and cucumbe c ops, as
well as o o namen al plan s [21,22]. T. apo a io um was
epo ed om he Medi e anean egion only la e , in
1963 [19]. The species was no iced in G eece (C e e) only
in 1978, when i began o cause pes managemen p ob-
lems due o i s esis ance o insec icides [23,24].
T. apo a io um cu en ly has an almos cosmopol-
i an dis ibu ion [25,26]. I s success can be a ibu ed o
he wo ldwide dis ibu ion o g eenhouse habi a s, po-
lyphagy [27], i s ole ance o highe o lowe empe a-
u es han i s biological con ol agen s [17,26], and i s
haplodiploid mode o ep oduc ion [28]. Howe e , he
absence o an o e win e ing es ing s age [29] po en-
ially limi s i s sp ead o na u al ecosys ems. Since he
de elopmen o T. apo a io um ceases a 8.3°C [30],
yea - ound popula ions migh pe sis a sou he n la i-
udes, whe e some hos plan s a e a ailable du ing win-
e , bu a e no likely o pe sis a no he n la i udes,
whe e c op cul i a ion in ields is seasonal and wild hos
plan s decay du ing win e .
To da e, popula ion gene ic s uc u e has been analyzed
in only a ew whi e ly species, and li le is known abou
popula ion gene ic s uc u e in T. apo a io um.The e-
la ed Bemisia abaci species complex, pa icula ly Medi e -
anean B. abaci (Med), is cha ac e ized by high gene ic
di e si y and di e en ia ion o popula ions, as indica ed by
bo h mi ochond ial and mic osa elli e ma ke s [31,32] (ex-
cep in ecen ly in oduced popula ions in Taiwan and
F ance [33,34]). Popula ions o B. abaci (Med) in G eece
sepa a ed by jus a ew kilome e s show popula ion gene ic
s uc u e, possibly due o sepa a e ounde e en s o an
olde popula ion his o y in his coun y [35]. Unlike he B.
abaci species complex, T. apo a io um popula ions ha e
low gene ic di e si y in mi ochond ial genes [36,37]. Recen
indings indica e ha sequences o h ee mi ochond ial
genes and composi ion o endosymbion communi ies
om popula ions sampled om di e en con inen s show
li le a ia ion (Kapan aidaki e al., unpubl.). Analysis o a
ew nuclea genes (allozymes) in T. apo a io um popula-
ions om g eenhouses in Sou h Ko ea e ealed hei sub-
di ision possibly due o es ic ed gene low by na u al
geog aphic ba ie s [38]. Howe e , s udies o popula ion
gene ic s uc u e in T. apo a io um wi h o he , mo e
polymo phic gene ic ma ke s, allowing desc ip ion o mo e
ecen e olu iona y p ocesses, ha e no been pe o med
un il now. Recen indings o a ia ion in pheno ypic e-
sponses, pa icula ly di e se esponses o insec icide ea -
men s among geog aphically close popula ions, sugges
di e en ia ion and low gene low among in aded g een-
houses [39].
To unde s and how insec pes s espond o di e en en-
i onmen al condi ions, such as clima e, habi a , and c op
managemen p ac ices, and he ole o ag oecosys ems in
shaping popula ion gene ic s uc u e, compa a i e s udies
o popula ion gene ic di e si y o pes s in di e en clima e
zones a e necessa y. In his s udy we p esen he i s ex-
ensi e gene ic da a on popula ion s uc u e o he g een-
house whi e ly. We compa e he gene ic s uc u e o T.
apo a io um popula ions in Finland and in G eece,
ep esen ing bo eal and Medi e anean clima e zones, and
e alua e he in luence o hos plan s and ag icul u al p ac-
ices on he spa ial and empo al popula ion gene ic s uc-
u e o his in asi e species. We hypo hesize ha T.
apo a io um popula ions in No he n Eu ope a e mo e
likely o be gene ically di e en ia ed han popula ions in
Sou he n Eu ope, because his species is expec ed o be
es ic ed o g eenhouses in he No h.
Me hods
Sampling
In Finland we sampled comme cial g eenhouses ha op-
e a e yea - ound and p oduce p ima ily oma o and cu-
cumbe c ops o a ious cul i a s (Table 1). Samples
we e collec ed om g eenhouses belonging o di e en
O ča enko e al. BMC E olu iona y Biology 2014, 14:165 Page 2 o 17
h p://www.biomedcen al.com/1471-2148/14/165
g owe s. In o al 18 g eenhouses we e sampled in sp ing
o 2010–2012. Ten o hese we e sampled wice: in 2010
and in 2011. Sampling was concen a ed in Os obo hnia
(16 g eenhouses) bu also included wo dis an loca ions in
o he pa s o he coun y (Figu e 1-I). Os obo hnia was
he ocus o ou s udy because in his a ea we could ind
mul iple g eenhouses wi h di e en managemen p ac ices
in e ms o hos plan species, hei cul i a s (Table 1) and
he o igin o seedlings. Two o i e g eenhouses belonging
o di e en g owe s we e sampled wi hin Nä pes, Töjby
and Pjelax illages. The minimum and maximum dis ances
be ween hese illages we e 9 and 32 km, espec i ely,
measu ed as s aigh line dis ance be ween coo dina es.
The dis ances be ween g eenhouses wi hin illages anged
om 1.1 o 3.7 km in Nä pes, 0.4 km in Töjby and om
0.28 o 0.9 km in Pjelax.
In G eece we sampled 16 ag oecosys ems in di e en
seasons o e se e al yea s: 2004–2011. These included
eigh g eenhouses and eigh ields g owing a ious c op
plan s (Table 1) which we e dis ibu ed h oughou
mainland G eece, he Peloponnese and he Island o
C e e (Figu e 1-II). Sampling was concen a ed in he
ields o Wes Peloponnese because open en i onmen s
in his egion co e he expec ed ange (7–20 km) o
he po en ial dispe sal abili ies o whi e lies (na u al o
by wind, as known om he B. abaci species complex;
[40,41]). In Wes Peloponnese, he minimum dis ance
be ween samples anged om 3.4 km (be ween WP3
and WP4) o 24.4 km (be ween WP3 and WP5), and he
maximum dis ance be ween loca ions eached 100 km.
Du ing sampling, bo h gende s o whi e lies we e col-
lec ed using a mou h aspi a o . The whi e lies we e p e-
se ed in 90% E hanol and s o ed a 4°C un il hey we e
sexed and used o geno yping. Since T. apo a io um is
a haplodiploid species, only adul emales we e chosen
o geno yping.
DNA ex ac ion and mic osa elli e geno yping
To al genomic DNA was ex ac ed om each indi idual
emale as desc ibed in Tsagka akou e al. [42]. Nine mic o-
sa elli e ma ke s (Table 2) ou o he 13 cha ac e ized in
Molecula Ecology Resou ces P ime De elopmen Con-
so ium e al. [43] we e used o geno ype 1274 T. apo a -
io um emales, 800 om Finland and 474 om G eece
(Table 3). Fou o he mic osa elli e ma ke s desc ibed
p e iously did no ampli y consis en ly, and hus, we e ex-
cluded om his s udy. Th ee mul iplex ampli ica ion e-
ac ions we e pe o med as desc ibed in Molecula Ecology
Resou ces P ime De elopmen Conso ium e al. [43]
wi h sligh modi ica ions. Dilu ed ampli ica ion p oduc s
we e sepa a ed on an ABI 3130xl gene ic analyze (Ap-
plied Biosys ems). Allele sizes we e sco ed agains GeneS-
can™500 LIZ s anda d using GeneMappe ® 4.0 so wa e
(bo h Applied Biosys ems) and we e con i med manually.
Da a analysis
To analyze gene ic dis ance be ween samples, bo h be-
ween and wi hin coun ies, pai wise es ima es o F
ST
we e calcula ed in A lequin 3.11 [44]. The signi icance
o he gene ic dis ances a he 0.05 le el was es ed by
pe mu ing he indi iduals o geno ypes be ween he
samples 110 imes and adjus ing P alues wi h s ic
Bon e oni co ec ion. Since all pai wise F
ST
be ween
samples om Finland and G eece showed s a is ically
signi ican di e ences, and due o he low p obabili y o
gene low be ween he wo dis an coun ies, all u he
analyses we e done o each coun y sepa a ely.
The samples aken in wo consecu i e yea s om he
same g eenhouse in Finland showed no gene ic di e en-
ia ion, excep o one sampling loca ion (TJ-2 a and TJ-
2 b). The e o e, in mos analyses we used a combined
da ase , which pooled samples collec ed om he same
g eenhouse in 2010 and 2011, (excep o TJ-2 a and TJ-
2 b, which we e conside ed as sepa a e samples). Fo
o he analyses (speci ied below) we used a sepa a ed
da ase , in which each sampling e o in Finland was
conside ed a sepa a e sample. Each sampling e o in
G eece was conside ed a sepa a e sample in all analyses,
because none o he loca ions we e sampled in consecu-
i e yea s.
Fo each sample, mean obse ed (H
O
) and expec ed
he e ozygosi y (H
E
), and mean numbe o alleles (N
A
)
pe locus we e calcula ed using GenAlEx . 6.5 [45]. Ob-
se ed and expec ed he e ozygosi ies we e also calcu-
la ed o each locus o e he o al da a om each
coun y. Depa u e om Ha dy-Weinbe g expec a ions
(HWE) was es ed wi h 1000 pe mu a ions using a glo-
bal es ac oss loci o samples as implemen ed in GENE-
POP . 4.2 [46]. The es was pe o med using Fishe ’s
me hod, es ing hypo heses o he e ozygo e de iciency
and he e ozygo e excess [47], and p oducing global p
alue es ima es o each sample o e all loci and o each
locus o e samples om Finland and G eece. Geno ypic
linkage disequilib ium o each pai o loci in he sam-
ples was es ed using he log likelihood a io s a is ic (G-
es ) as implemen ed in GENEPOP . 4.2. Fo mul iple
es s, s a is ical signi icance was adjus ed using s ic
Bon e oni co ec ions [48]. The samples we e analyzed
o po en ial sco ing e o s in all loci using MICRO-
CHECKER . 2.2.3 and he equency o null alleles ( )
was es ima ed [49].
To in es iga e he ela ionship be ween gene ic and geo-
g aphic dis ance, isola ion by dis ance was analyzed in
GenAlEx . 6.5 [45]. Gene ic dis ance was de ined by pai -
wise linea F
ST,
(F
ST
/(1- F
ST
)), and geog aphic dis ance was
de ined as pai wise dis ances gene a ed om geog aphical
coo dina es exp essed in decimal deg ees. The co ela ion
be ween he wo da a ma ices was assessed using a
Man el es and i s signi icance es ima ed by P alues, he
O ča enko e al. BMC E olu iona y Biology 2014, 14:165 Page 3 o 17
h p://www.biomedcen al.com/1471-2148/14/165
Table 1 Desc ip ion o he samples collec ed in Finland and G eece
Geog aphical in o ma ion Hos plan Collec ion
Geog aphical
coo dina es:
Da e:
Coun y/Region Locali y Sample
code
La i ude Longi ude Species Cul i a Family Habi a Mon h-yea
Finland
Os obo hnia Hä kme i HR a 62.165219 21.467372 Cucumbe
1
Imea Cucu bi aceae G May-10
HR b Toma o
1
Espe o Solanaceae G Ap -11
Ko snäs KR a 62.778983 21.204792 Cucumbe Cadense R2 Cucu bi aceae G May-10
KR b Cucumbe Cadense R2 Cucu bi aceae G Ap -11
Malax ML a 62.938797 21.526186 Cucumbe
1
Diliga e Cucu bi aceae G May-10
ML b Toma o
1
DRW Solanaceae G Ap -11
Nä pes NR 1a 62.476119 21.416114 Toma o Enco e Solanaceae G May-10
NR 1b Toma o Enco e Solanaceae G Ap -11
NR 2 62.479328 21.395703 Cucumbe Imea Cucu bi aceae G May-10
NR 3a 62.467842 21.346608 Che y oma o Gonchi a Solanaceae G May-10
NR 3b Toma o Gonchi a Solanaceae G Ap -11
Pjelax PJ 1a 62.393006 21.382206 Toma o Enco e Solanaceae G May-10
PJ 1b Toma o Enco e Solanaceae G Ap -11
PJ 2 62.395511 21.381911 Toma o Enco e Solanaceae G May-10
PJ 3a 62.396372 21.382139 Toma o Enco e Solanaceae G May-10
PJ 3b Toma o Enco e Solanaceae G Ap -11
PJ 4 62.397450 21.375103 Toma o Dome ica Solanaceae G Ap -11
PJ 5 62.389081 21.371075 Toma o Dome ica Solanaceae G Ap -11
Pö om PR a 62.710939 21.623539 Toma o Enco e Solanaceae G May-10
PR b Toma o Enco e Solanaceae G Ap -11
Töjby TJ 1a 62.664411 21.221228 Cucumbe Ven u a Cucu bi aceae G May-10
TJ 1b Cucumbe Logica Cucu bi aceae G Ap -11
TJ 2a 62.661847 21.226625 Cucumbe Annica Cucu bi aceae G May-10
TJ 2b Cucumbe Annica Cucu bi aceae G Ap -11
Ö e ma k OV 62.611700 21.471772 Toma o Se e al cul i a s
4
Solanaceae G Ap -11
Uusimaa Lohja LH 60.176453 23.981306 Cucumbe Imea Cucu bi aceae G Ap -11
No he n Sa onia Nilsiä NL 63.151436 27.987397 Cucumbe
2
Imea Cucu bi aceae G Jul-12
G eece
Wes Peloponnese Kou essi WP 1 37.966667 21.330278 Cucumbe - Cucu bi aceae F Jun-04
Filia a WP 2 37.119983 21.584281 Zuccini - Cucu bi aceae F Jul-04
Elea WP 3 37.372628 21.688894 Eggplan - Solanaceae F Aug-11
P asidaki WP 4 37.397167 21.711822 Bean - Fabaceae F Aug-11
Anemocho i WP 5 37.588725 21.538794 Toma o - Solanaceae F Sep-11
Te psi hea WP 6 37.227417 21.628542 Bean - Fabaceae F Sep-11
And a ida WP 7 38.007222 21.395833 Ma ow - Cucu bi aceae F Sep-11
No h Peloponnese Aigio NP 38.216853 22.114178 Rose - Rosaceae G Aug-11
Wes G eece Ag inio WG 38.579722 21.418056 Toma o - Solanaceae G Jun-11
Eas Peloponnese Na plion EP 37.745556 22.850278 Bean - Fabaceae F Oc -11
A ica A hens AT 37.983147 23.706583 Eggplan - Solanaceae G Ap -05
O ča enko e al. BMC E olu iona y Biology 2014, 14:165 Page 4 o 17
h p://www.biomedcen al.com/1471-2148/14/165
eg ession coe icien (R
2
), and he mean co ela ion coe -
icien (R
XY
) o e 999 andom pe mu a ions o linea F
ST
alues as implemen ed in GenAlex .6.5. Isola ion by dis-
ance was assessed wi h smalle subse s o he da a as well
as using he ull da ase s, o e alua e he in luence o scale
on he ela ionships.
Analyses o molecula a iance (AMOVA) we e pe -
o med using A lequin 3.11 [44] o es ima e and compa e
he pe cen age o gene ic a ia ion explained by di e en
hie a chical g oups (i.e. indi idual, sample, g oup o sam-
ples). Fou analyses we e cons uc ed o es he ollowing
g oups: 1) coun y (Finland s. G eece), 2) hos plan spe-
cies (cucumbe s. oma o) in samples om Finland only,
3) hos plan bo anical amily (Cucu bi aceae s. Solanaceae
s. Fabaceae s. Rosaceae) in samples om G eece only,
and 4) habi a (g eenhouse s. ield) in samples om
G eece only. Fo analysis 2, samples HR, ML and NL we e
excluded since he whi e lies in hese g eenhouses migh
ha e been exposed o bo h cucumbe and oma o g own in
he same compa men o g eenhouse. Howe e , in analysis
3, sample MA 2 was no excluded because se e al hos s
g own in he same compa men belonged o he same
amily (Solanaceae) (see Table 1).
To assess he le el o gene ic di e en ia ion be ween
g oups de ined abo e o AMOVA, we compa ed sum-
ma y s a is ics calcula ed o he di e en g oups: F
IS
(inb eeding coe icien measu ing he e ozygo e de ici
wi hin popula ions), F
ST
(a measu e o popula ion s uc-
u e and he e ozygo e de ici among popula ions), allelic
ichness (measu e o he numbe o alleles independen
Table 1 Desc ip ion o he samples collec ed in Finland and G eece (Con inued)
Island o C e e Fodele CR 1 35.398228 24.963689 Rose - Rosaceae G Ma -10
Sissi CR 2 35.305961 25.535006 Rose - Rosaceae G Ap -11
Malades CR 3 35.268528 25.104956 Da u a - Solanaceae G Ap -11
Macedonia Se es MA 1 41.225933 23.361469 Toma o - Solanaceae G May-11
D ama MA 2 41.124744 24.162803 Swee peppe
3
- Solanaceae G May-11
Lowe case le e s adjacen o popula ion codes indica e he same loca ion sampled in 2010 and 2011.
G indica es samples collec ed om g eenhouses, F – om ields.
1
Cucumbe and oma o we e g owing in he same g eenhouse compa men .
2
Cucumbe and oma o we e g owing in di e en g eenhouse compa men s.
3
Toma o and eggplan we e g owing in he same g eenhouse compa men .
4
Enco e, Ca eza, Dome ica, Di k and Axxion cul i a s g own in he same g eenhouse compa men .
CR 2
II G eece MA 2
100 Km
AT
WG
MA 1
CR 1 CR 3
20 Km
KR a,b
ML a,b
HR a,b
NR 1,2,3
PJ 1,2,3,4,5
TJ 1, 2
PR
OV
I Finland
100 Km
NL
LH
I
II
EP
50 Km
WP 1
WP 2
WP 3,4
WP 5
WP 6
WP 7 NP
Figu e 1 Maps o sampling loca ions. Sample codes a e lis ed in Table 1. I - Finland, II - G eece.
O ča enko e al. BMC E olu iona y Biology 2014, 14:165 Page 5 o 17
h p://www.biomedcen al.com/1471-2148/14/165

o sample size), H
E
(unbiased expec ed he e ozygosi y)
and H
O
(obse ed he e ozygosi y). FSTAT . 2.9.3 [50]
was used o calcula e he a e age (o e samples and loci;
weigh ed by sample size) o he chosen s a is ics o each
g oup and o hei compa ison. S a is ical signi icance
was assessed a e 1000 pe mu a ions. As in he AMOVA
g oups, some samples we e excluded because mul iple
hos s we e g own in he same compa men o g een-
house (see abo e).
The ela ionship be ween en i onmen al a iables and
gene ic s uc u e o he s udied popula ions was es i-
ma ed using de aul se ings o he so wa e GESTE .
2.0 [51]. The so wa e gi es he highes pos e io p ob-
abili y (P ) o he model explaining gene ic s uc u e he
bes , e alua ing en i onmen al a iables sepa a ely and
in combina ion h ough a gene alized linea model. In
his analysis, he sepa a ed da a se o he samples om
Finland was used. La i ude, hos plan species, cul i a ,
c op sou ce and yea o sampling we e e alua ed as ex-
plana o y a iables o popula ion s uc u e in Finland.
La i ude, longi ude, ou hos plan amilies and habi a
( ield o g eenhouse) we e e alua ed as explana o y a i-
ables o popula ion s uc u e in G eece.
Bayesian clus e ing analysis implemen ed in STRUC-
TURE .2.3.4 [52] was used o in e he numbe o gene -
ically dis inc clus e s (K) in each coun y using a model
o no admix u e, co ela ed allele equencies and includ-
ing he sampling loca ion as a p io [53]. Ini ial analyses
we e pe o med bo h wi h admix u e and no admix u e
models, bu he la e was selec ed since isualiza ion o
he esul s was mo e s aigh o wa d and no di e ences in
he mos likely numbe o clus e s we e obse ed o he
wo models. Analysis pa ame e s included a bu n-in
pe iod o 250,000 ollowed by 500,000 MCMC i e a ions.
Fo each da ase , Finland and G eece, we es ed K om 2
o 10, wi h en eplica e analyses pe alue o K. Subse s o
each da ase we e analyzed wi h he same se ings. The
mos likely numbe o clus e s in ou samples was de e -
mined using he ΔKapp oach [54] as implemen ed in
S uc u e Ha es e . 0.56.3 [55]. Resul s we e isualized
as ba plo s by inding he op imal alignmen o he en
eplica e analyses o he “bes ”Kin CLUMPP . 1.1.2 [56]
using he G eedy algo i hm and 1000 andom inpu o -
de s, and hen by c ea ing g aphics in Dis uc . 1.1 [57].
Fo Finland, he combined da ase was used i s , and hen
wo subse s o he da a we e c ea ed. In hese subse s, he
Table 2 Cha ac e is ics o he nine polymo phic mic osa elli e loci analysed in T. apo a io um
Locus (Genbank Accession no.) P ime sequence (5′-3′) (F: [dye]- o wa d;
R: e e se)
Repea mo i
(cloned allele)
Size ange
(bp)
No. o
alleles
H
0
/H
E
Finland
H
0
/H
E
G eece
T ap-1-1C F: [6-FAM]- GAGACTCCACGATGTCTGTC (GT)
6
GG(GT)
9
195-215 3 0.469/0.499* 0.455/0.461
(GF112015) R: TTCCCCTATCGTATGTTCAC
T ap-1-2 F: [VIC]- CTGTGAATCCCTCAGAAATC (GT)
6
233-236 2 0.094/0.108 0.299/0.308
(GF112025) R: TGACCTCTCTCAGGCTTTTA
T ap-3-1 F: [PET]- GAGATGGACAAACTACAACG (AC)
15
228-230 2 0.246/0.437*0.268/0.355*
(GF112016) R: GATTGGATGTCGTGGTTG
T ap-3-2 F: [6-FAM]- GGAGGTCATTACTCATTTCG (AC)
6
170-182 4 0.401/0.405 0.522/0.581
(GF112017) R: CATAAATTTTCGGCTCACTC
T ap-3-3 F: [VIC]- CGCAAATCATACTTCCTTTC (CA)
5
235-237 2 0.417/0.412 0.496/0.459
(GF112019) R: AAATACAGGCGACTCATGTC
T ap-4-2 F: [NED]- GGTGGTATTGTGGCGTC (GA)
29
298-314 7 0.446/0.468 0.585/0.667
(GF112027) R: CTGCCTCTTATGACTCTTCC
T ap-1-4 F: [PET]- GATTTAGCCCAGTTCATTTG (TG)
5
265-267 2 0.091/0.097 0.137/0.179*
(GF112020) R: CTTCAGTTGAGCTGCTGATG
T ap-1-5 F: [6-FAM]- CAGTTGTGGTAGTGTGGTG (TG)
12
124-146 10 0.416/0.411 0.703/0.757
(GF112028) R: CTCATCGGCTCATACATTC
T ap-2-2C F: [VIC]- CTGAAAGTCTTATTAGAGCC (TC)
8
GC (TC)
10
210-220 6 0.568/0.55 0.588/0.608
(GF112021) R: CTAACTGATTCCATAGTCG
No. o alleles indica es he maximum numbe o alleles ound in his s udy.
H
O
, obse ed he e ozygosi y; H
E
, unbiased expec ed he e ozygosi y.
*indica e H
O
/H
E
alues wi h po en ial p esence o null alleles wi h equency > 0.2.
H
O
/H
E
in bold indica e loci wi h signi ican de ia ions om Ha dy–Weinbe g equilib ium in e ms o he e ozygo e de iciency a e Bon e oni co ec ion
(no signi ican he e ozygo e excess was de ec ed).
He e ozygosi ies, de ia ions om HWE and null allele equencies we e es ima ed o e 800 emales om 18 samples in Finland and 474 emales om 16 samples
in G eece.
O ča enko e al. BMC E olu iona y Biology 2014, 14:165 Page 6 o 17
h p://www.biomedcen al.com/1471-2148/14/165
samples we e g ouped by hos plan species and samples
HR a, b and ML a, b we e sepa a ed since hey had been
collec ed om di e en hos s (see Table 1). Samples HR,
ML and NL we e included in bo h da a subse s since hese
samples migh ha e been exposed o se e al hos s g own
in he same compa men o g eenhouse. Fo G eece, all
samples we e i s analyzed oge he , hen da a subse s
we e c ea ed g ouping samples by habi a ( ield o g een-
house). The de ini ion o he da a subse s (by hos plan
species o habi a ) was chosen a e conside ing he esul s
o ini ial analyses wi h he ull da a se s and ou analysis
wi h GESTE . 2.0 [51].
Table 3 Gene ic di e si y es ima ed o e he nine mic osa elli e loci o samples o T. apo a io um
Coun y Region Locali y Sample code NN
A
(±SE) H
O
/H
E
Finland Os obo hnia Hä kme i HR a,b 30 + 30 2.556(±0.294) 0.375/0.435*
Ko snäs KR a,b 29 + 30 2.333(±0.373) 0.222/0.254*
Malax ML a,b 30 + 30 2.667(±0.236) 0.375/0.404
Nä pes NR 1a,b 30 + 30 3.111(±0.423) 0.369/0.406
NR 2 30 2.333(±0.167) 0.256/0.341*
NR 3a,b 30 + 30 2.889(±0.351) 0.308/0.375*
Pjelax PJ 1a,b 30 + 30 2.889(±0.389) 0.375/0.429*
PJ 2 30 2.667(±0.236) 0.422/0.422
PJ 3a,b 30 + 30 3.111(±0.455) 0.396/0.429*
PJ 4 30 2.667(±0.289) 0.359/0.417*
PJ 5 30 2.667(±0.333) 0.407/0.406
Pö om PR a,b 30 + 30 3.444 (±0.669) 0.434/0.484
Töjby TJ 1a,b 30 + 30 3.222 (±0.494) 0.570/0.556*
TJ 2a 30 3.333 (±0.577) 0.465/0.517
TJ 2b 30 3.667 (±0.707) 0.554/0.531*
Ö e ma k OV 30 3.556 (±0.648) 0.511/0.543*
Uusimaa Lohja LH 21 3.667 (±0.799) 0.541/0.529
No he n Sa onia Nilsiä NL 30 3.333 (±0.645) 0.448/0.512
G eece Wes Peloponnese Kou essi WP 1 30 3.222(±0.494) 0.422/0.450
Filia a WP 2 29 3.333 (±0.553) 0.415/0.524
Elea WP 3 30 3.444 (±0.626) 0.459/0.540
P asidaki WP 4 30 2.667 (±0.236) 0.409/0.457
Anemocho i WP 5 30 3.444 (±0.603) 0.437/0.394
Te psi hea WP 6 30 3.222 (±0.494) 0.428/0.469*
And a ida WP 7 30 3.111 (±0.484) 0.441/0.419
No h Peloponnese Aigio NP 30 3.222 (±0.494) 0.277/0.396
Wes G eece Ag inio WG 30 3.444 (±0.689) 0.395/0.455
Eas Peloponnese Na plion EP 30 3.222(±0.494) 0.422/0.450
A ica A hens AT 28 3.333 (±0.553) 0.415/0.524*
Island o C e e Fodele CR 1 30 3.444 (±0.626) 0.459/0.540
Sissi CR 2 30 2.667 (±0.236) 0.409/0.457
Malades CR 3 30 3.444 (±0.603) 0.437/0.394*
Macedonia Se es MA 1 27 3.222 (±0.494) 0.428/0.469*
D ama MA 2 30 3.111 (±0.484) 0.441/0.419
Fo Finland he combined da ase , which pooled samples om consecu i e yea s a he same loca ion (excep TJ 2) is desc ibed, since i was used in he majo i y
o analyses. Lowe case le e s adjacen o popula ion codes indica e he same loca ion sampled in 2010 and 2011. N numbe o analyzed emales, H
O
obse ed
and H
E
expec ed he e ozygosi y and N
A
mean numbe o alleles pe popula ion a e aged o e 9 loci. * indica e H
O
/H
E
alues in samples wi h null allele equency > 0.2.
H
O
/H
E
in bold indica e loci wi h signi ican de ia ions om Ha dy–Weinbe g equilib ium in e ms o he e ozygo e de iciency a e Bon e oni co ec ion (no signi ican
he e ozygo e excess was de ec ed).
O ča enko e al. BMC E olu iona y Biology 2014, 14:165 Page 7 o 17
h p://www.biomedcen al.com/1471-2148/14/165
Resul s
Gene ic di e si y o mic osa elli e loci and samples
Signi ican de ia ions om HWE h ough he e ozygo e
de iciencies we e de ec ed a one locus (T ap 3–1) and 4
loci (T ap-4-2, T ap-1-4, T ap-1-5 and T ap-3-1) in he
Finnish and G eek samples, espec i ely (Table 2). A
he sample le el, a es o HWE ac oss he nine mic o-
sa elli e loci indica ed signi ican he e ozygo e de iciency
in wo Finnish and h ee G eek samples (Table 3). The e
we e no cases o signi ican he e ozygo e excess.
Th ee loci showed a null allele equency > 0.2: T ap-1-
1C (2 samples), T ap-3-1 (12 samples) and T ap-1-4 (1
sample). Fo each o hese loci, he equency o null alleles
wi hin a sample a ied: = 0.110-0.258 (T ap-1-1C), =
0.164-0.401 (T ap-3-1), and = 0.166-0.238 (T ap-1-4),
and he a e age equency o null alleles o e he samples
anged om 0.119 o 0.250. No cases o la ge allele d op
ou we e ound. E en hough null alleles a e p esen , de i-
a ions om HWE could be also due o signi ican homo-
zygosi y in popula ions inhabi ing he human-media ed
en i onmen (i.e. due o popula ion bo lenecks and in-
b eeding), a he han due o signi ican geno yping e o s.
Geno ypic linkage disequilib ium es ed o each pai
o loci o each sample e ealed a po en ial associa ion
be ween loci T ap-1-1 and T ap 3–1 in sample PJ 4.
Since locus T ap-3-1 was cha ac e ized by homozygo e
excess and had a high equency o null alleles only in
sample PJ 4 ( = 0.401), we suspec ha he linkage dis-
equilib ium indica ed o his sample does no e lec a
ue associa ion be ween he loci. The e o e, da a om
all nine loci we e used in he analyses.
Di e ences be ween Finland and G eece
AMOVA indica ed signi ican gene ic s uc u e be ween
he wo geog aphic a eas (Table 4). The pe cen age o a i-
a ion explained by coun y o o igin, Finland s. G eece,
was highe han ha among he samples wi hin each
coun y (9.90% and 6.87%, espec i ely; Table 4), indica ing
ha o e all gene ic a ia ion migh be explained by hese
g oups. T. apo a io um om he wo coun ies also di -
e ed signi ican ly in hei global obse ed and expec ed
he e ozygosi ies (Finland: H
O
/H
E
= 0.350/0.385 s. G eece:
H
O
/H
E
= 0.451/0.496), and in allelic ichness (2.498 s.
3.234 o Finland s. G eece, espec i ely) (all P= 0.001).
Howe e , Fs a is ics calcula ed o each coun y did no
di e s a is ically (Finland/G eece; F
IS
: 0.091/0.090, P=
0.157; F
ST
: 0.093/0.055, P= 0.976). Ne e heless, he ange
o pai wise F
ST
alues be ween samples wi hin coun ies
was b oade o Finland (−0.006 < F
ST
<0.533) han i was
o G eece (−0.007 < F
ST
< 0.164) (Tables 5A and B).
Popula ion s uc u e in Finland
Se en y nine pe cen o pai wise F
ST
compa isons (121 o
154) be ween samples om Finland showed signi ican
popula ion di e en ia ion (Table 5A). Some popula ions
(HR, KR, PR, TJ 2b and LH) we e di e en ia ed om all
o he samples (Table 5A). Howe e , one o he samples
mos dis an om he Os obo hnia egion (NL) was no
signi ican ly di e en in pai wise F
ST
om one o he
Os obo hnian samples (OV). Fo samples collec ed om
di e en g eenhouses a he same loca ion (NR, PJ and
TJ), he e was no signi ican gene ic s uc u e, excep o
TJ: TJ1 was no di e en ia ed om TJ 2a, bu bo h o
Table 4 Dis ibu ion o he molecula a iance be ween and wi hin ou g oups o samples o T. apo a io um
Sou ce o a ia ion d. . Sum o
squa es
Va iance
componen s
Pe cen age o
a ia ion
Fixa ion
indices
P alues
Be ween coun ies 1 275.947 0.221 9.900 F
CT
: 0.099 0 ± 0
Among samples wi hin coun ies 32 425.048 0.153 6.870 F
SC
: 0.076 0 ± 0
Wi hin samples 2514 4665.034 1.856 83.240 F
ST
:0.168 0 ± 0
Be ween hos plan g oups in
Finland
1
1 34.818 0.031 1.690 F
CT
: 0.017 0.036 ± 0.006
Among samples wi hin g oups 13 195.663 0.157 8.590 F
SC
: 0.087 0 ± 0
Wi hin samples 1285 2111.236 1.643 89.720 F
ST
: 0.103 0 ± 0
Among hos plan g oups in G eece
2
3 32.540 0.006 0.250 F
CT
: 0.002 0.266 ± 0.013
Among samples wi hin g oups 12 114.290 0.124 5.330 F
SC
: 0.053 0 ± 0
Wi hin samples 932 2045.532 2.195 94.420 F
ST
: 0.056 0 ± 0
Be ween habi a s in G eece 1 32.665 0.052 2.200 F
CT
: 0.022 0.001 ± 0.001
Among samples wi hin g oups 14 114.165 0.010 4.290 F
SC
: 0.044 0 ± 0
Wi hin samples 932 2045.532 2.195 93.510 F
ST
: 0.065 0 ± 0
1
Be ween g oups o samples collec ed om Cucu bi aceae, Solanaceae hos plan amilies in Finland (samples HR, ML and NL a e no included, see Me hods
o de ails).
2
Among g oups o samples collec ed om Cucu bi aceae, Solanaceae, Fabaceae and Rosaceae hos plan amilies in G eece.
O ča enko e al. BMC E olu iona y Biology 2014, 14:165 Page 8 o 17
h p://www.biomedcen al.com/1471-2148/14/165
Table 5 Pai wise es ima es o F
ST
be ween samples in Finland (A) and G eece (B) o e he nine mic osa elli e loci
A Finland
HR KR ML PJ 1 PJ 2 PJ 3 PJ 4 PJ 5 NR 1 NR 2 NR 3 PR OV TJ 1 TJ 2a TJ 2b LH NL
HR 0.000
KR 0.207 0.000
ML 0.025 0.181 0.000
PJ 1 0.055 0.173 0.024 0.000
PJ 2 0.052 0.222 0.027 0.009 0.000
PJ 3 0.058 0.201 0.022 0.015 0.003 0.000
PJ 4 0.064 0.216 0.027 −0.004 −0.006 0.002 0.000
PJ 5 0.073 0.222 0.044 0.004 0.001 0.018 −0.005 0.000
NR 1 0.050 0.204 0.010 −0.004 0.017 0.012 0.006 0.013 0.000
NR 2 0.095 0.240 0.044 0.036 0.067 0.065 0.052 0.053 0.023 0.000
NR 3 0.079 0.207 0.024 0.029 0.059 0.051 0.044 0.043 0.010 0.001 0.000
PR 0.082 0.212 0.053 0.080 0.109 0.010 0.096 0.116 0.063 0.050 0.045 0.000
OV 0.048 0.217 0.015 0.024 0.026 0.028 0.023 0.033 0.024 0.039 0.027 0.034 0.000
TJ 1 0.113 0.311 0.064 0.077 0.104 0.094 0.088 0.087 0.050 0.011 0.021 0.056 0.044 0.000
TJ 2a 0.085 0.263 0.035 0.051 0.070 0.053 0.058 0.061 0.025 0.003 0.001 0.033 0.030 0.002 0.000
TJ 2b 0.248 0.533 0.236 0.197 0.225 0.215 0.212 0.206 0.193 0.183 0.211 0.232 0.198 0.129 0.185 0.000
LH 0.131 0.293 0.115 0.063 0.073 0.102 0.057 0.055 0.090 0.083 0.104 0.156 0.078 0.119 0.123 0.196 0.000
NL 0.060 0.327 0.031 0.066 0.089 0.045 0.086 0.111 0.034 0.109 0.077 0.050 0.035 0.096 0.061 0.294 0.227 0.000
O ča enko e al. BMC E olu iona y Biology 2014, 14:165 Page 9 o 17
h p://www.biomedcen al.com/1471-2148/14/165
Recei ed: 14 Ap il 2014 Accep ed: 15 July 2014
Published: 29 July 2014
Re e ences
1. Hsieh C-H, Wang C-H, Ko C-C: E idence om molecula ma ke s and
popula ion gene ic analyses sugges s ecen in asions o he Wes e n
No h Paci ic egion by bio ypes B and Q o Bemisia abaci (Gennadius).
En i on En omol 2007, 36:952–961.
2. Ma ga i opoulos JT, Kasp owicz L, Malloch GL, Fen on B: T acking he
global dispe sal o a cosmopoli an insec pes , he peach po a o aphid.
BMC Ecol 2009, 9:13.
3. Bebbe DP, Ramo owski MAT, Gu SJ: C op pes s and pa hogens mo e
polewa ds in a wa ming wo ld. Na Clim Chang 2013, 3:985–988.
4. Hickling R, Roy DB, Hill JK, Fox R, Thomas CD: The dis ibu ions o a wide
ange o axonomic g oups a e expanding polewa ds. Glob Chang Biol
2006, 12:450–455.
5. Hana i A: In asi e pes s and diseases: a challenge o IPM in g eenhouse
c ops. Phy opa asi ica 2005, 33:423–426.
6. Van D iesche R, Enkegaa d E: In asi e Species as Pes s in G eenhouses:
Fo ecas ing, P e en ing and Remedia ing Fu u e In asions. IOBC/WPRS
Bull 2002, 25(1):277–280.
7. Al ie i MA: The ecological ole o biodi e si y in ag oecosys ems. Ag ic
Ecosys En i on 1999, 74:19–31.
8. G appu o A, Boman S, Linds öm L, Lyy inen A, Mappes J: The oyage o
an in asi e species ac oss con inen s: gene ic di e si y o No h
Ame ican and Eu opean Colo ado po a o bee le popula ions. Mol Ecol
2005, 14:4207–4219.
9. Pii oinen S, Linds öm L, Lyy inen A, Mappes J, Chen YH, Izzo V, G appu o A:
P e-in asion his o y and demog aphy shape he gene ic a ia ion in he
insec icide esis ance- ela ed ace ylcholines e ase 2 gene in he in asi e
Colo ado po a o bee le. BMC E ol Biol 2013, 13:13.
10. Richa dson DM, Pyšek P, Rejmánek M, Ba bou MG, Pane a FD, Wes CJ:
Na u aliza ion and in asion o alien plan s: concep s and de ini ions.
Di e s Dis ib 2000, 6:93–107.
11. Loxdale H, Lushai G: Sla es o he en i onmen : he mo emen o
he bi o ous insec s in ela ion o hei ecology and geno ype. Philos
T ans R Soc Lond B Biol Sci 1999, 354(Janua y):1479–1495.
12. F eeman J: P oblems o s o ed p oduc s en omology in B i ain a ising
ou o he impo o opical p oduc s. Ann Appl Biol 1976, 84:120–124.
13. Hill DS: Pes s o C ops in Wa me Clima es and Thei Con ol. Do d ech , The
Ne he lands: Sp inge ; 2008.
14. Muñoz P, An ón A, Nuñez M, Pa anjpe A, A iño J, Cas ells X, Mon e o JI,
Rie ade all J: En i onmen al impac s o g eenhouse e sus open- ield
oma o p oduc ion in he Medi e anean egion. Ac a Ho 2008,
801:1591–1596.
15. Pe dikis D, Kapaxidi E, Papadoulis G: Biological con ol o insec and mi e
pes s in g eenhouse Solanaceous c ops. Eu J Plan Sci Bio ech 2008,
2:125–144.
16. Ho mann AA, Willi Y: De ec ing gene ic esponses o en i onmen al
change. Na Re Gene 2008, 9:421–432.
17. Tsagka akou A, Na ajas M: Gene ic di e en ia ion in Te anychus u icae
(Aca i: Te anychidae) om g eenhouses in F ance. Exp Appl Aca ol 1999,
23:365–378.
18. Tsagka akou A, Na ajas M, Papaioannou-Soulio is P, Pas eu N: Gene low
among Te anychus u icae (Aca i: Te anychidae) popula ions in G eece.
Mol Ecol 1998, 7:71–79.
19. Mound LA, Halsey SH: Whi e ly o he wo ld. a sys ema ic ca alogue o he
Aley odidae (Homop e a) wi h hos plan and na u al enemy da a. B i ish
Museum (Na u al His o y): John Wiley and Sons; 1978.
20. Linnaniemi WM: Äs e ochi on apo io um (Wes w.) Suomessa. Medd Soc
Fauna Flo a Fenn 1921, 7:66–68.
21. Hulden L: The whi e lies and hei pa asi es in Finland. No En omol 1986,
66:1–40.
22. Vappula NA: Pes s o cul i a ed plan s in Finland. Ac a En omol Fenn 1965,
19:163–169.
23. Michelakis SE: P oblems in he applica ion o biological con ol agains
T ialeu odes apo a io um in unhea ed plas ic glasshouses in C e e.
Bull OEPP 1986, 16:423–427.
24. Pelekassis C: A ca alogue o he mo e impo an insec s and o he
animals ha m ul o he ag icul u al c ops o G eece du ing he las
hi y-yea pe iod. Ann Ins Phy opa hol Benaki 1962, 5:9–75.
25. Ma in JH, Mi sud D, Rapisa da C: The whi e lies (Hemip e a: Aley odidae)
o Eu ope and he Medi e anean Basin. Bull En omol Res 2000, 90:407–448.
26. Van Len e en JC, Van Roe mund H, Sü e lin S: Biological Con ol o
G eenhouse Whi e ly (T ialeu odes apo a io um) wi h he Pa asi oid
Enca sia o mosa: How Does I Wo k? Biol Con ol 1996, 6:1–10.
27. Inba M, Ge ling D: Plan -media ed in e ac ions be ween whi e lies,
he bi o es, and na u al enemies. Annu Re En omol 2008, 53:431–448.
28. Van Len e en JC, Noldus LPJJ: Whi e ly Plan Rela ionships, Beha io al and
Ecological Aspec s. In Whi e lies: Thei Bionomics, Pes S a us and
Managemen . Edi ed by Ge ling D. Ando e , UK: In e cep L d; 1990:47–49.
29. S ense h C: Cold-ha diness in eggs o G eenhouse Whi e ly (T ialeu odes
apo io um). IOBC-WPRS Bull 1983, 6:84–86.
30. Osbo ne L: Tempe a u e-dependen de elopmen o g eenhouse whi e ly
and i s pa asi e, Enca sia o mosa.En i on En omol 1982, 11:483–485.
31. Boykin LM, Bell CD, E ans G, Small I, De Ba o PJ: Is ag icul u e d i ing he
di e si ica ion o he Bemisia abaci species complex (Hemip e a:
S e no hyncha: Aley odidae)?: Da ing, di e si ica ion and biogeog aphic
e idence e ealed. BMC E ol Biol 2013, 13:228.
32. Gau hie N, Cloue C, Pe akis A, Kapan aidaki D, Pe e schmi M,
Tsagka akou A: Gene ic s uc u e o Bemisia abaci Med popula ions om
home ange coun ies in e ed by nuclea and cy oplasmic ma ke s:
impac on he dis ibu ion o he insec icide esis ance genes. Pes
Manag Sci 2014, in p ess.
33. Hsieh C-H, Chiang Y-H, Ko C-C: Popula ion gene ic s uc u e o he newly
in asi e Q bio ype o Bemisia abaci in Taiwan. En omol Exp Appl 2011,
138:263–271.
34. Dalmon A, Halke F, G anie M, Dela e H, Pe e schmi M: Gene ic
s uc u e o he in asi e pes Bemisia abaci: e idence o limi ed bu
pe sis en gene ic di e en ia ion in glasshouse popula ions. He edi y
2008, 100:316–325.
35. Tsagka akou A, Mou on L, K is o e sen JB, Dokianakis E, G ispou M, Bou zis
K: Popula ion gene ic s uc u e and seconda y endosymbion s o Q
Bemisia abaci (Hemip e a: Aley odidae) om G eece. Bull En omol Res
2012, 102:353–365.
36. P ijo ićM, Skaljac M, D obnjako ićT, ZanićK, Pe ićP, Ma čićD, Puizina J:
Gene ic a ia ion o he G eenhouse Whi e ly, T ialeu odes apo a io um
(Hemip e a: Aley odidae), among popula ions om Se bia and
neighbo ing coun ies, as in e ed om COI sequence a iabili y.
Bull En omol Res 2014, 1:1–10.
37. Roopa HK, Kuma NKK, Asokan R, Rebiji h KB, Mahmood R, Ve ghese A:
Phylogene ic Analysis o T ialeu odes Spp. (Hemip e a: Aley odidae)
om India Based on Di e ences in Mi ochond ial and Nuclea DNA.
Fla En omol 2012, 95:1086–1094.
38. Shin D, Mo H, Lee S-E, Pa k J-J, Cho K: Elucida ion o he gene ic
di e ences in T ialeu odes apo a io um popula ions unde ege able
g eenhouse condi ions by using he allozyme app oach. En omol Res
2013, 43:271–281.
39. O ca enko I, Linds öm L, Saikkonen K, Vänninen I: Va ia ion in mo ali y
among popula ions is highe o pyme ozine, han o imidaclop id and
spi omesi en in T ialeu odes apo a io um in g eenhouses in Finland.
Pes Manag Sci 2014, in p ess.
40. By ne DN, Bellows TS: Whi e ly biology. Annu Re En omol 1991,
36:431–457.
41. Be linge MJ, Lehmann-Sigu a N, Taylo RAJ: Su i al o Bemisia abaci
adul s unde di e en clima ic condi ions. En omol Exp Appl 1996,
80:511–519.
42. Tsagka akou A, Tsigenopoulos CS, Go man K, Lagnel J, Bed o d ID: Bio ype
s a us and gene ic polymo phism o he whi e ly Bemisia abaci
(Hemip e a: Aley odidae) in G eece: mi ochond ial DNA and
mic osa elli es. Bull En omol Res 2007, 97:29–40.
43. Molecula Ecology Resou ces P ime De elopmen Conso ium, Aksoy S,
Almeida-Val VMF, Aze edo VCR, Baucom R, Bazaga P, Behe ega ay LB,
Benne zen JL, B assalo i RA, Bu gess TI, Caccone A, Chang S-M, Ciampi AY,
Ciancaleoni S, Clímaco GT, Cloue C, Coimb a MRM, Cou inho LL, Dan as HL,
De Vega C, Echodu R, Enya u J, Figuei a A, Filho MAG, Fol z B, F essigné L,
Gadomski M, Gau hie N, He e a CM, Hyseni C, e al:Pe manen gene ic
esou ces added o molecula ecology esou ces da abase 1 Oc obe
2012–30 No embe 2012. Mol Ecol Resou 2013, 13:341–343.
44. Exco ie L, La al G, Schneide S: A lequin e . 3.0: an in eg a ed so wa e
package o popula ion gene ics da a analysis. E ol Bioin o m Online 2005,
1:47–50.
O ča enko e al. BMC E olu iona y Biology 2014, 14:165 Page 16 o 17
h p://www.biomedcen al.com/1471-2148/14/165

45. Peakall R, Smouse PE: GenAlEx 6.5: gene ic analysis in Excel. Popula ion
gene ic so wa e o eaching and esea ch–an upda e. Bioin o ma ics
2012, 28:2537–2539.
46. Rousse F: Genepop’007: a comple e eimplemen a ion o he Genepop
so wa e o Windows and Linux. Mol Ecol Resou 2008, 8:103–106.
47. Raymond M, Rousse F: An exac es o popula ion di e en ia ion.
E olu ion 1995, 49:1280–1283.
48. Rice WR: Analyzing ables o s a is ical es s. E olu ion 1989, 43:223–225.
49. Oos e hou C, Van Hu chinson WF, Wills DPM, Shipley P: Mic o-checke :
so wa e o iden i ying and co ec ing geno yping e o s in
mic osa elli e da a. Mol Ecol No es 2004, 4:535–538.
50. Goude J: Fs a 2.9.3: A P og am o Es ima e and Tes Gene Di e si ies and
Fixa ion Indices (Upda ed om Goude 1995). Lausanne: Swi ze land; 2002.
51. Foll M, Gaggio i O: Iden i ying he en i onmen al ac o s ha de e mine
he gene ic s uc u e o popula ions. Gene ics 2006, 174:875–891.
52. P i cha d JK, S ephens M, Donnelly P: In e ence o popula ion s uc u e
using mul ilocus geno ype da a. Gene ics 2000, 155:945–959.
53. Hubisz MJ, Falush D, S ephens M, P i cha d JK: In e ing weak popula ion
s uc u e wi h he assis ance o sample g oup in o ma ion. Mol Ecol
Resou 2009, 9:1322–1332.
54. E anno G, Regnau S, Goude J: De ec ing he numbe o clus e s o
indi iduals using he so wa e STRUCTURE: a simula ion s udy. Mol Ecol
2005, 14:2611–2620.
55. Ea l DA, VonHold BM: STRUCTURE HARVESTER: a websi e and p og am
o isualizing STRUCTURE ou pu and implemen ing he E anno
me hod. Conse Gene Resou 2011, 4:359–361.
56. Jakobsson M, Rosenbe g NA: CLUMPP: a clus e ma ching and
pe mu a ion p og am o dealing wi h label swi ching and
mul imodali y in analysis o popula ion s uc u e. Bioin o ma ics 2007,
23:1801–1806.
57. Rosenbe g NA: Dis uc : a p og am o he g aphical display o
popula ion s uc u e. Mol Ecol No es 2004, 4:137–138.
58. Pa ella MP: A h opod Fauna. In Ecosys ems o he Wo ld. G eenhouse
Ecosys ems. Edi ed by S anhill G, Enoch HZ. Ams e dam; New Yo k: Else ie
Science Publishe s; 1999:213–250.
59. Dela e H, Da id P, G anie M, Le JM, Goldbach R, Pe e schmi M,
Reynaud B: Mic osa elli es e eal ex ensi e geog aphical, ecological and
gene ic con ac s be ween in asi e and indigenous whi e ly bio ypes in
an insula en i onmen . Gene Res 2006, 87:109–124.
60. Saleh D, Laa i A, Cloue C, Gau hie N: Spa ial and hos -plan pa i ioning
be ween coexis ing Bemisia abaci c yp ic species in Tunisia. Popul Ecol
2012, 54:261–274.
61. Rodi akis NE: Hos plan s o g eenhouse whi e ly T ialeu odes
apo a io um wes wood (Homop e a: Aley odidae) in C e e.
A ac i eness and impac on whi e ly li e s ages. Ag ic Ecosys En i on
1990, 31:217–224.
62. F anklin MT, Ri land CE, Mye s JH: Spa ial and empo al changes in
gene ic s uc u e o g eenhouse and ield popula ions o cabbage
loope , T ichoplusia ni.Mol Ecol 2010, 19:1122–1133.
63. Dickey AM, Osbo ne LS, Sha e s RG, Hall PM, Mckenzie CL: Popula ion
gene ics o in asi e Bemisia abaci (Hemip e a: Aley odidae) c yp ic
species in he Uni ed S a es based on mic osa elli e ma ke s. J Econ
En omol 2013, 106:1355–1364.
64. Simón B, Cenis JL, De La Rúa P: Dis ibu ion pa e ns o he Q and B
bio ypes o Bemisia abaci in he Medi e anean Basin based on
mic osa elli e a ia ion. En omol Exp Appl 2007, 124:327–336.
65. Na ajas M, Tsagka akou A, Lagnel J, Pe o -Minno MJ: Gene ic
di e en ia ion in Te anychus u icae (Aca i: Te anychidae): polymo phism,
hos aces o sibling species? Exp Appl Aca ol 2000, 24:365–376.
66. Ma R-Y, Kong W-N, Hao L-J: Hos p e e ence o G eenhouse Whi e ly
(T ialeu odes apo a io um) o se e al ho icul u al plan s in g eenhouse.
En omol Knowl 2005, 3:016.
67. Thomas DC: Hos plan adap a ion in he Glasshouse Whi e ly. J Appl
En omol 1993, 115:405–415.
68. O icial S a is ics o Finland. [h p://www.maa alous ilas o . i/en/
ho icul u al-s a is ics]
69. Whi lock M: Selec ion and D i in Me apopula ions. In Ecology, Gene ics
and E olu ion o Me apopula ions. Edi ed by Gaggio i O, Hanski I.
Ams e dam: Else ie Academic P ess; 2004:153–173.
70. Sakai A, Allendo F, Hol J: The popula ion biology o in asi e species.
Annu Re Ecol Sys 2001, 32:305–332.
doi:10.1186/s12862-014-0165-4
Ci e his a icle as: O ča enko e al.:Ag oecosys ems shape popula ion
gene ic s uc u e o he g eenhouse whi e ly in No he n and Sou he n
Eu ope. BMC E olu iona y Biology 2014 14:165.
Submi you nex manusc ip o BioMed Cen al
and ake ull ad an age o :
• Con enien online submission
• Tho ough pee e iew
• No space cons ain s o colo figu e cha ges
• Immedia e publica ion on accep ance
• Inclusion in PubMed, CAS, Scopus and Google Schola
• Resea ch which is eely a ailable o edis ibu ion
Submi you manusc ip a
www.biomedcen al.com/submi
O ča enko e al. BMC E olu iona y Biology 2014, 14:165 Page 17 o 17
h p://www.biomedcen al.com/1471-2148/14/165