RESEARCH ARTICLE Open Access
Knobbed ac osome de ec is associa ed wi h a
egion con aining he genes STK17b and HECW2
on po cine ch omosome 15
Anu Si onen
1*
, Pekka Uima i
1
, Szabolcs Nagy
2
, Sándo Paku
3
, Magnus Ande sson
4
, Johanna Vilkki
1
Abs ac
Backg ound: Male in e ili y is an inc easing p oblem in all domes ic species including man. Localiza ion and
iden i ica ion o genes in ol ed in de ec s causing male in e ili y p o ide aluable in o ma ion o speci ic e en s in
spe m de elopmen . Co ec condensa ion o he spe m head and de elopmen o he ac osome a e equi ed o
e ile spe m. In he Finnish Yo kshi e pig popula ion a knobbed ac osome de ec (KAD) has been epo ed which
appea s o be o gene ic o igin. In p e ious s udies we ha e shown ha a la ge numbe o a ec ed spe ma ozoa
ha e a cys ic swelling an e io o he apical pa o he ac osome.
Resul s: Cha ac e iza ion o he knobbed ac osome a ec ed spe m e ealed ha bo h he ac osomal g anules and
ch oma in a e a ec ed. This ype o KAD appea s o be a p e iously unknown and se ious o m o he de ec . A
genome wide scan wi h Po cineSNP60 Geno yping BeadChip de ined he KAD associa ed egion wi hin 0.7 Mbp
on po cine ch omosome 15. Two genes, STK17b and HECW2, loca ed wi hin his egion we e sequenced. The
exp ession o hese genes appea ed compa able in KA-a ec ed and con ol boa s. The known unc ion o HECW2
in ac osome de elopmen highligh ed his gene as a good candida e esponsible o he KAD. One
nonsynonymous SNP was iden i ied wi hin he HECW2 gene. Howe e , as his mu a ion was ound in homozygous
s a e in indi iduals wi h no mal spe m, his is no likely o be he causal mu a ion.
Conclusions: In his s udy we iden i ied wo candida e genes o a se e e de ec a ec ing bo h he spe m
ac osome and ch oma in ha causes in e ili y. One o hese genes, HECW2, plays an impo an ole in
ubiqui ina ion, a p e equisi e o ch oma in emodelling and ac osome o ma ion, highligh ing he in ol emen o
his gene in he knobbed ac osome de ec and male in e ili y.
Backg ound
Male in e ili y is becoming inc easingly p e alen pa ly
due o en i onmen al ac o s, bu many de ec s in
spe m de elopmen a ise om a gene ic cause. P oblems
in he p oduc ion and ma u a ion o spe m a e he mos
common causes o male in e ili y esul ing in low
spe m numbe s, mo phologically abno mal spe m o
low spe m mo ili y [1-3]. Despi e e o s o e eal he
genes and hei unc ions in spe ma ogenesis, li le is
known abou he unde lying causes o male in e ili y.
The e o e, he localiza ion and iden i ica ion o mu a-
ions speci ically a ec ing spe ma ogenesis p o ide
in aluable in o ma ion o in es iga ing he causes o
male in e ili y.
Mammalian spe ma ogenesis is a complex p ocess,
whe e diploid spe ma ogonia de elop in o haploid, highly
specialized spe ma ozoa. Spe ma ogenesis includes many
es is-speci ic p ocesses ha a e con olled by complex
egula o y mechanisms [4,5]. Du ing spe miogenesis, hap-
loid ound spe ma ids unde go d ama ic biochemical and
mo phological changes ha a e go e ned by specialized
gene exp ession and in e ac ions be ween a ious genes
and hei p o ein p oduc s [6]. Iden i ica ion o genes
in ol ed in spe m de elopmen is a p e equisi e o unde -
s anding he molecula mechanisms o spe ma ogenesis.
Spe m de elopmen is known o be dis up ed du ing
spe miogenesis in se e al ac osomal de ec s; e.g. globo-
zoospe mia in humans, whe e spe ma ozoa lack an
* Co espondence: [email p o ec ed]
1
Ag i ood Resea ch Finland, MTT, Bio echnology and Food Resea ch,
Genomics, FI-36100 Jokioinen, Finland
Full lis o au ho in o ma ion is a ailable a he end o he a icle
Si onen e al.BMC Genomics 2010, 11:699
h p://www.biomedcen al.com/1471-2164/11/699
© 2010 Si onen e al; licensee BioMed Cen al L d. This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e Commons
A ibu ion License (h p://c ea i ecommons.o g/licenses/by/2.0), which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in
any medium, p o ided he o iginal wo k is p ope ly ci ed.
ac osome [7-9] and he knobbed ac osome de ec (KAD)
in bulls, boa s, s allions, ams, and dogs [10-15]. The
ac osome is an o ganelle ha de elops o e he an e io
hal o he head in he spe ma ozoa. I is a cap-like
s uc u e de i ed om he Golgi appa a us. The ac o-
some con ains diges i e enzymes, which b eak down he
zona pellucida o he o um, allowing he spe m o deli-
e i s haploid nucleus in o he o a. Dis u bances o
ac osomal de elopmen and unc ion signi ican ly impai
he e ilizing capaci y o spe ma ozoa [16].
Knobbed ac osome de ec has been ecen ly desc ibed
in he Finnish Yo kshi e pig popula ion [15]. Tes icula
weigh s o boa s wi h KAD did no di e om con ol
boa s. Howe e , a ec ed boa s had a smalle semini e -
ous ubulediame e andlowe numbe o Se olicells
ela i e o con ol boa s [15]. In es iga ion o he pedi-
g ees o KA-a ec ed boa s sugges ed an au osomal
ecessi e inhe i ance o he de ec . Gene ally wo com-
mon boa s we e iden i ied in he pedig ee o he boa s
wi h he KAD. Fe ili y o KA-a ec ed boa s is se e ely
comp omised. Depending on he amoun o knobbed
spe ma ozoa (25-81%) a ec ed boa s had poo non-
e u n a e om no p egnancies o 47%, hus KA-
a ec ed boa s p oduced no o sp ing o on a e age 2.5
ewe pigle s pe li e han con ol boa s. He e we ha e
cha ac e ized u he he se e i y o he spe m head
abno mali ies in KA-a ec ed boa s.
A whole genome scan wi h mic osa elli e ma ke s
showed inc eased homozygosi y in KA-a ec ed boa s in
ch omosomes 3, 8, 14 and 15 [15]. Howe e , no s a is i-
cally signi ican associa ion was de ec ed wi h a ailable
mic osa elli e ma ke s. In his s udy we ha e used he
Po cineSNP60 Geno yping BeadChip (Illumina) in o de
o inc ease ma ke densi y and accu a ely map he KAD
associa ed egion in pigs. All a ec ed boa s we e homo-
zygous o SNPs co e ing 432 kb on po cine ch omo-
some 15. The coding egion o wo genes was loca ed
wi hin his homozygous egion and sequenced om bo h
a KA-a ec ed and con ol boa .
Resul s
Mic oscopical analysis o he KAD
In he con ocal lase scanning mic oscopy h ee-
dimensional econs uc ions o he spe ma ozoa wi h
ac osomal g anules indica ed ha he g anules p o-
uded on bo h sides and con ained a acuolum
(Figu e 1A). TEM analyses con i med he h ee-dimen-
sional p o usion o he g anules and he occu ence o
acuoles wi hin he g anules. The nucleus was also
shown o be a ec ed as e iden om he Y-shaped
o m a he apical end (Figu e 1B) sugges ing ha he
de ec a ec s bo h he ch oma in and ac osome. These
indings highligh ha his pa icula and p e iously
unknown KA-de ec appea s o be a se ious o m o
he ac osomal g anule de ec .
SNP quali y measu es
Based on all a ailable SNPs and he me hod o es ima e
IBDs in he Plink so wa e package (pi_ha ) he a e age
ela edness among cases and con ols was 0.24 and 0.26,
espec i ely. These le els o ela edness a e ypical in
he s udied Finnish Yo kshi e pig popula ion. The a e -
age sample call a e was 95%. The e we e 2815 SNPs
ha did no wo k o any o he samples analysed.
Excluding hese SNPs, he a e age SNP call a e was
0.9982 (s.d. = 0.007) and he a e age mino allele e-
quency was 0.25 (s.d. = 0.14). O e all, he da ase con-
ained 9216 monomo phic SNPs. Obse ed dis ibu ion
o P- alues in he Ha dy-Weinbe g equilib ium es s a-
is ics did no di e om expec a ions. In o al, 183
SNPs (excluding SNPs on he X-ch omosome) had a
P- alue <1.0E-06 being lowe han expec ed.
Genome wide associa ion analysis
The associa ion es was pe o med o 47055 SNPs. The
Manha an plo o he log10 based P- alues is p esen ed
in Figu e 2. The ecessi e model iden i ied a KAD asso-
cia ed egion co e ing app oxima ely 3 Mbp be ween 93
and 96 Mbp (pig genome build 9) on ch omosome 15.
A
B
Figu e 1 Mic oscopical examina ion o he KA-de ec .A.
Con ocal lase scanning mic oscopy images o spe ma ozoa wi h
ac osomal g anule om wo KA-a ec ed boa s. Yellow lines indica e
he pe pendicula planes o he 3d- econs uc ions. A ows indica e
a acuolum inside he g anule. B. TEM analysis o an ac osomal
g anule. Two acuoles a e p esen and he apical pa o he
nucleus shows a Y-shape.
Si onen e al.BMC Genomics 2010, 11:699
h p://www.biomedcen al.com/1471-2164/11/699
Page 2 o 8
A e pe mu a ion, i e SNPs we e s a is ically signi ican
(P- alue = 0.0002, Table 1). Fou o hese SNPs
(ALGA0086494, DRGA0015302, MARC0011300, and
CASI0005693) a e loca ed wi hin a 1.4 Mbp egion and
we e in comple e linkage disequilib ium (D’=1.0,
2
=
1.0). 12 ou o 14 KAD cases had inhe i ed wo iden ical
copies o he haplo ype co e ing hese and o he
SNPs be ween hem, indica ing an ex ended homozygos-
i y in his egion, and hus a common ances al o igin
(Figu e 3). All KA-a ec ed boa s sha ed a 0.7 Mbp
homozygous egion be ween SNPs DIAS0000367
and ALGA0086503 (Figu e 3, addi ional ile 1). The
CASI0005693 SNP was in s onge linkage disequilib ium
wi h ALGA0086494 and o he signi ican SNPs com-
pa ed wi h neighbou ing SNPs, highligh ing ha he
posi ion o CASI0005693 may change ollowing a mo e
e ined genome build in his egion (see addi ional ile 1).
The i h signi ican SNP (MARC0020403) was loca ed
4 Mbp om he o he ou SNPs, and was shown o be in
linkage disequilib ium (D’= 1.0,
2
= 0.13).
Candida e genes HECW2 and STK17b
The mos p omising candida e gene Ubiqui in-p o ein
ligase E3 (HECW2) was loca ed wi hin he haplo ype
o wo SNPs wi h he highes P- alues; ALGA0086494
and DRGA001532 (Table 1, addi ional ile 1). All KA-
a ec ed animals we e homozygous o hese SNPs and
only wo con ol animals had he same homozygo e
alleles as KA-a ec ed boa s (Figu e 3). Fu he mo e,
one o hese wo animals appea ed o ha e a SME-
de ec and ano he was emo ed om b eeding a
young age due o weak leg con o ma ion and he e o e
no esh spe m samples we e a ailable o analysis.
The SME-de ec is a cys mal o ma ion in he spe m
head, wi h indica ions ha his is o ac osomal o igin
[17,18].
HECW2 is exp essed in he es is [19] and unc ions in
ubiqui in media ed p o eolysis [20]. Ubiqui in signals
ha e been de ec ed du ing ac osome de elopmen [21]
and deubiqui ina ing enzyme mUBPy is up egula ed in
he es is o wobble mouse, which is in e ile due o he
lack o a unc ional ac osome [22].
Ano he gene wi hin he KAD homozygous egion was
se ine/ h eonine kinase 17b (STK17b, DRAK2, addi ional
ile 1). STK17b is a se ine/ h eonine kinase, which has a
ole in he egula ion o apop osis [23-25]. STK17b is
highly exp essed in he es es whe e he apop osis plays
an impo an ole du ing spe ma ogenesis. E en hough
KAD associa ed
egion
Figu e 2 Manha an plo o he log10 based P- alues ac oss all ch omosomes o he KAD in Finnish Yo kshi e pig popula ion. The KA-
a ec ed haplo ypes o ma ked KAD associa ed egion suppo ed he expec ed ecessi e mode o inhe i ance and had he lowes P- alues.
Table 1 Geno ype coun s o cases and con ols, nominal, and pe mu a ed P- alues om he ecessi e model o he
bes KAD associa ed SNPs.
SNP Ch Posi ion, bp Geno ypes cases Geno ypes con ols Recessi e, P- alue Pe mu a ed P- alue
ALGA0086494 15 93805621 14/0/0 2/8/11 1.41E-07 0.0002
DRGA0015302 15 93835894 14/0/0 2/8/11 1.41E-07 0.0002
MARC0011300 15 94070930 14/0/0 2/8/11 1.41E-07 0.0002
CASI0005693 15 95156189 14/0/0 2/8/11 1.41E-07 0.0002
MARC0020403 15 90155667 12/2/0 0/7/14 1.66E-07 0.0002
Si onen e al.BMC Genomics 2010, 11:699
h p://www.biomedcen al.com/1471-2164/11/699
Page 3 o 8
he pheno ype o KA-a ec ed boa s does no implica e a
de ec in apop osis he exp ession and sequence o
STK17b mRNA was de e mined.
Analysis o he po cine HECW2 gene
The exp ession pa e n o di e en HECW2 agmen s
(Table 2) appea ed o be compa able in he KA-a ec ed
and con ol boa . The ull-leng h mRNA o po cine
HECW2 [GenBank HM562353] was sequenced om he
es is o one KA-a ec ed and one con ol boa . The o al
leng h o he sequenced HECW2 ansc ip was 4802 bp
wi h a high homology wi h o he mammalian species.
When compa ed o he human HECW2 gene, he po cine
sequence s a ed a posi ion 177 bp in he exon 2. In he
pig, exon 1 did no appea o be exp essed in he es is.
Howe e , based on he genome sequence, exon 1 was
highly conse ed compa ed wi h he human sugges ing
ha i may ha e an impo an ole in HECW2 exp ession,
a leas in some issues. In man, he p o ein coding
egion s a s a mRNA posi ion 184 bp (exon 2). The
human HECW2 p o ein consis s o 1572 aa. Cu en da a
sugges s ha he co esponding pig p o ein sequence is
1574 aa wi h a 96% homology o he human sequence.
Simila ly, he ull-leng h HECW2 p o ein in he mouse
includes 1578 aa and has 95% homology o HECW2 in
he pig.
Sequencing o he po cine HECW2 mRNA and he
exon 1 om genomic DNA o a KA-a ec ed and con ol
boa showed wo SNPs a mRNA posi ions 1563 (SNP1)
and 2233 bp (SNP2). SNP1 causes a change in he p o-
ein sequence a posi ion 519 aa om isoleucine o
h eonine (Figu e 4). This SNP was u he geno yped
o all 14 KA-a ec ed and 10 con ol boa s. All KA-
a ec ed boa s we e homozygous o his SNP, bu also
ou con ol boa s had he same homozygous allele, dis-
coun ing his as he causal mu a ion o he KAD. In
Figu e 3 Haplo ype coun s in KAD cases and con ols on ch omosome 15 (91861321-95156189 bp, Pig genome build 9). SNPs ha a e
sha ed among KAD cases a e ma ked in g ey backg ound and he SNPs wi h he smalles P- alue om he ecessi e model a e in bold ace.
Table 2 P ime s used o sequencing o he candida e genes HECW2 and STK17b.
Gene Exons Posi ion, bp Leng h, bp Fo wa d p ime Re e se p ime
HECW2 1 - 404 CTGGGACGTGTTTCAAGGTT GATCTCTGACGCTTGCCTTC
HECW2 2-4 1-351 421 AGACGGGATGGCTAGCTCA GATTTTTATCTCCGGCTCCA
HECW2 4-7 332-744 413 AAAAACAGGGGTGTGACTGG CGGTGCCAGATTGGATTAGT
HECW2 5-2-10 483-1534 1052 TGAAGAACCCTGCTGTGATG GTCTTCCGGCTTTGTCTGAG
HECW2 10-12/13 1403-2609 1207 GAGGAAGACCACGAGTTCCA TACTCTGGTATCGCCGGTTC
HECW2 12-15 2543-2896 354 CCGCAGGTGCTGCAGAGGTC GGTGTCCCGCCGGACTTTGG
HECW2 14-20/21 2783-3560 778 TTCCTCATCAGCCCAGAGTT GCTGAGTACCTGGCGAGTTC
HECW2 20-22/23 3461-3800 340 ATGTCATACGTGCCTCCACA CACTGTAATCCAGCCCTTCC
HECW2 21/22-30 3654-4675 1022 AAGGCCCAGGGAAATTAAAG GGATGGGTATGGAGGGAGAT
HECW2 28- 4567-4815 249 AGGGAGTAATGGCCCAAGAA CTAGAGGGCAGCTTCTGGA
STK17b 1-8 1-927 928 GTAAGCTCCGGTCTCCGTCT TGTTGCTGTGGTAATAGGATCATA
STK17b 3-9 413-1100 707 TTTGCTGTGGTTAGGCAATG AAAAGCCTCTGGATGAAGTCTGT
The exons (based on human AB037722), posi ion o he agmen wi hin he HECW2 [GenBank HM562353] and STK17b [GenBank HM594868] mRNA and he
leng h o he PCR amplicons a e shown.
Si onen e al.BMC Genomics 2010, 11:699
h p://www.biomedcen al.com/1471-2164/11/699
Page 4 o 8
addi ion o hese wo SNPs, a dele ion o nine bp ( h ee
aa) was de ec ed a e he nucleo ide a posi ion 3348
bp (1113 aa) when compa ed o he po cine e e ence
sequence [Ensemble: ENSSSCG00000016068]. This dele-
ion seems o be e y common in mammalian species
(Figu e4).Thepo cine e e encesequence o HECW2
included exons 3-28 (based on human [GenBank
AB037722]), howe e ou sequencing esul s indica e
ha exons 2, 29 and 30 a e also exp essed in he pig
es es.
Analysis o STK17b mRNA
The sequenced es icula mRNA o po cine STK17b
[GenBank HM594868] con ained exons 1-9 (based on
human exon numbe ing, [GenBank NM_004226]) and
1102 bp. T ansla ion s a codon was iden i ied a
posi ion 282 wi hin exon 2. No change in he exp es-
sion p o ile was iden i ied and he p o ein coding
sequence was iden ical in he KA-a ec ed and con ol
boa .
Discussion
While he esul s o homozygosi y mapping o he KAD
in a p e ious s udy [15] we e no s a is ically signi ican ,
hey did indica e he mos p obable posi ions o he
KAD-associa ed ch omosomal segmen s. In his s udy
we con i med he associa ion be ween KAD and po cine
ch omosome 15. The ini ial genome sc een wi h mic o-
sa elli e ma ke s S0004 and SW2608 showed inc eased
homozygosi y in KAD a ec ed boa s [15]. The genome
scan wi h Po cineSNP60 Geno yping BeadChip (Illu-
mina) localized he KAD associa ed egion be ween
hese wo ma ke s on po cine ch omosome 15. The
Po cineSNP60 BeadChip illus a ed a high call a e
(<95%) in he Finnish Yo kshi e pig popula ion and only
15% o he SNPs we e monomo phic. In his s udy we
de ec ed he KAD associa ed egion co e ing 2 Mbp
indica ing ha he ma ke map in he ini ial sc een was
no dense enough o de ec he signi ican inc ease in
homozygosi y.
Wi hin he associa ed egion we iden i ied and
sequenced wo candida e genes Ubiqui in-p o ein ligase
E3 (HECW2) and se ine/ h eonine kinase 17b (STK17b).
The sequencing o hese wo genes e ealed wo SNPs
wi hin HECW2 gene, bu no polymo phisms we e
de ec ed in he p o ein coding sequence o STK17b.
Al hough he iden i ied mu a ions appea ed no o be
he causal cause o he KAD, HECW2 emains a good
candida e gene o his de ec conside ing i s ole in
ac osome de elopmen and ch oma in emodelling.
P o ein ubiqui ina ion is one o he undamen al egula-
o y pos - ansla ional modi ica ions con olling in acellu-
la signalling e en s. Ubiqui in-p o eosome-dependen
p o eolysis plays an impo an ole in selec i ely deg ading
and ecycling p o eins in many basic cellula p ocesses
including spe ma ogenesis [26]. Fo deg ada ion by he
p o eosome, binding o ubiqui in wi h subs a e p o eins
equi es he ac i i y o ubiqui in-ac i a ing enzyme E1,
ubiqui in-conjuga ing enzyme E2, and subs a e-speci ic
ubiqui in ligase E3 [27]. Ubiqui in ligase E3 in combina-
ion wi h an E2 ubiqui in-conjuga ing enzyme causes he
a achmen o ubiqui in o a lysine esidue on he a ge
p o ein.
In spe ma ogenesis ubiqui ina ion is equi ed o a -
ious p ocesses; o example he eplacemen o he spe -
ma ids nuclea his ones wi h p o amines du ing
spe ma id elonga ion [26]. In spe ma ozoa, p o eosomes
a e loca ed on he plasma memb ane o e lying he ac o-
some, in he ac osomal and pos ac osomal egions, in
he head- ail connec ing-piece, middle-piece o he ail,
and esidual bodies [28-32]. P o eosome subuni Psmc3
and an ubiqui in p o ein ligase Rn 19a ha e been loca ed
a he cy osolic side o ou e and inne memb anes o
he ac osome [33]. The co-immunop ecipi a ion and
localiza ion o Psmc3 and Rn 19a in spe miogenesis
poin s o he pa icipa ion o he ubiqui in-p o eosome
sys em in ac osome o ma ion, spe ma id head shaping,
and de elopmen o he head- ail coupling appa a us
and ail [33].
Mal unc ion o componen s in ubiqui ina ion sys em
has been shown o be a cause o male in e ili y
[27,34-36]. The e appea s o be a special equi emen o
ce ain componen s o he ubiqui in sys em du ing spe -
miogenesis, in pa icula [37], and i is p obable ha di -
e en spe ma ogenic phases would equi e di e en
specialized ac i i ies o he ubiqui in sys em. Mu a ions
in ubiqui ina ion ela ed p o eins may also a ec speci i-
cally spe ma ogenesis h ough hei es is speci ic in e -
ac ing pa ne s [36]. A mal unc ion o ubiqui ina ion may
cause di e se pheno ypes as exempli ied in he human
and mouse by mu a ion o H 6b and Usp14 [35,38].
SNP DEL
Figu e 4 Alignmen o HECW2 p o ein sequences a he
de ec ed polymo phism posi ions in a ious species. The only
di e ence be ween con ol (Yo kshi e) and KA-a ec ed (Ak ) animals
was a change om isoleucine o h eonine (SNP). Howe e , his
change was also p esen in he human p o ein sequence.
Fu he mo e, a h ee aa dele ion was iden i ied when compa ed
wi h he pig e e ence sequence.
Si onen e al.BMC Genomics 2010, 11:699
h p://www.biomedcen al.com/1471-2164/11/699
Page 5 o 8
Conclusions
In his s udy we demons a e he exac KAD pheno ype
in ma u e spe m. In addi ion o he ac osome, he spe -
ma id ch oma in is also a ec ed. We ha e loca ed he
homozygous egion o KAD wi hin 0.5 Mbp on po cine
ch omosome 15 con aining wo genes STK17b and
HECW2. The ole o ubiqui ina ion in ch oma in emo-
delling and ac osome o ma ion is consis en wi h
HECW2 being in ol ed in his de ec . While a causal
mu a ion o KAD was unable o be iden i ied, ou esul s
indica e ha he obse ed pheno ype may be caused by a
mal unc ion in he ubiqui ina ion sys em. Iden i ica ion
o he causal a ia ion o he KAD equi es u he ana-
lysis o he genomic egion con aining he HECW2 gene.
Me hods
Animal ma e ial
Expe imen al ma e ial included 14 Finnish Yo kshi e
boa s a ec ed wi h KAD and 21 con ol boa s. All a ec ed
boa s we e clinically examined and shown o display
symp oms ypical o he synd ome, bu no o he abno m-
ali ies. Spe m om a ec ed and con ol boa s was
collec ed and he DNA ob ained ollowing phenol/chlo o-
o m ex ac ion. Samples we e dilu ed o 100 ng/μl in TE-
bu e and used as empla es o Po cineSNP60 Geno yp-
ing BeadChip (Illumina). Genomic DNA was also used o
sequencing o he HECW2 exon 1 and SNP1.
Fo mic oscopical examina ion ep esen a i e semen
samples om KA-a ec ed and con ol boa s we e ixed
in o maldehyde o con ocal lase scanning and ans-
mission elec on mic oscopy analyses.
Con ocal lase scanning mic oscopy
Spe ma ozoa we e labeled wi h LIVE/DEAD Reduced Bio-
haza d Viabili y ki ( ed, L23102, In i ogen). The labelling
p o ocol was in acco dance wi h he ecommenda ions o
he manu ac u e . In b ie , 50 μl DMSO was added o one
ial o luo escen dye and ho oughly mixed o make a
s ock solu ion. Spe ma ozoa we e suspended in PBS a
app oxima ely 1 × 10
6
/ml. One μl o luo escen dye was
added o he suspension. A e 30 min incuba ion a oom
empe a u e spe ma ozoa we e washed and esuspended
in 1 ml PBS wice. One d op o suspension was pu on a
Supe os slide and co e slipped and subsequen ly ana-
lyzed on a BioRad MRC 1024 con ocal lase scanning
mic oscope. Th ee-dimensional econs uc ions we e p e-
o med using Voloci y LE ee so wa e (h p://www.
imp o ision.com).
T ansmission elec on mic oscopy (TEM)
Cells we e ixed in 2.5% glu a aldehyde in PBS (pH 7.2)
o 2 hou s a 4°C. A e washing, samples we e pos -
ixed in 1% OsO
4
and 0.5% K- e ocyanide in PBS o
2 hou s, dehyd a ed wi h a g aded se ies o ace one, and
embedded in Spu ’s mix u e. Semi hin sec ions we e
s ained by 0.5% oluidine blue (pH 8.5) A eas o in e es
we e immed ou by compa ing he cu su ace o he
blocks wi h he semi hin sec ions. Ul a hin sec ions
we e cu by an RMC MT-7 ul amic o ome, s ained
wi h 2% u anylace a e and lead ci a e and analyzed on
Philips CM10 elec on mic oscope.
Geno yping
Fo high h oughpu geno yping DNA samples we e
analyzed by Po cineSNP60 Geno yping BeadChip (Illu-
mina L d, San Diego, USA) in he Ins i u e o Molecu-
la Medicine Finland (FIMM, Helsinki, Finland). The
Po cineSNP60 BeadChip has ecen ly been de eloped as
an ou come o he po cine whole genome sequencing
p ojec [39]).
Exp ession p o iling and sequencing o STK17b and
HECW2
Fo sequencing he ull-leng h mRNA o he candida e
genes STK17b and HECW2, samples o es icula issue
om a KA-a ec ed and a con ol boa we e collec ed
and s o ed in RNAla e bu e (Qiagen). To al RNA pu -
i ica ion was pe o med wi h RNeasy P o ec Mini ki
(Qiagen). Ex ac ed RNA was e e se ansc ibed (RT-
PCR) using oligo T p ime s and an ImP om-II Re e se
T ansc ip ion Sys em (P omega) acco ding o he manu-
ac u e ’s ins uc ions and ampli ied using gene speci ic
p ime s (Table 2). Exp ession o gene agmen s was
assessed by gel elec opho esis. Fo sequencing he PCR
amplicons we e pu i ied using ExoSAP-IT™(Ame sham
Biosciences), while PCR agmen s we e sequenced in
bo h di ec ions wi h he same p ime s used in he
ampli ica ion p ocedu es. Sequencing was pe o med on
MegaBace 500 capilla y DNA sequence (Ame sham
Biosciences) using DYEnamic ET Te mina o Ki s wi h
The mo Sequenase™II DNA Polyme ase (Ame sham
Biosciences).
S a is ical analysis
A ecessi e mode o inhe i ance was es ed o each SNP
sepa a ely. The ecessi e model was selec ed because he
pedig ee o KA-a ec ed boa s sugges ed a ecessi e
mode o inhe i ance and he low equency o he de ec
in he Finnish Yo kshi e pig popula ion. In he ecessi e
model, o each SNP he equency o homozygo e ani-
mals o he mino allele (o o he majo allele) was
compa ed o equency o he e ozygo e and o he homo-
zygo e animals be ween cases and con ols. In o de o
co ec o mul iple es ing a pe mu a ion p ocedu e was
adap ed o c ea e empi ical genome-wide P- alues. Asso-
cia ion es s and pe mu a ion we e ca ied ou using he
Si onen e al.BMC Genomics 2010, 11:699
h p://www.biomedcen al.com/1471-2164/11/699
Page 6 o 8
so wa e package Plink [40]. Haplo ypes, he linkage dise-
quilib ium plo and he Manha an plo we e p oduced
wi h Haplo iew [41].
Addi ional ma e ial
Addi ional ile 1: The KAD associa ed egion in he Finnish
Yo kshi e pig localized on po cine ch omosome 15. The KAD
associa ed homozygous egion in he Finnish Yo kshi e was iden i ied in
ch omosome 15 be ween base pai s 93723216 and 94155055. A
p omising candida e gene Ubiqui in-p o ein ligase E3 (HECW2) is loca ed
wi hin his egion a he same posi ion as wo ma ke s wi h lowes
P- alues (highligh ed by ci cles). Ano he gene STK17b was also loca ed
wi hin he homozygous egion; howe e he known unc ion o his
gene in apop osis would no in e a ole o STK17b in KAD.
Acknowledgemen s
Funding o his s udy was p o ided by he Finnish Minis y o Ag icul u e
and Fo es y (Make a). The assis ance o Tiina Jaakkola and Ta ja Ho i uo i in
DNA ex ac ion and Päi i Lahe mo (Ins i u e o Molecula Medicine Finland,
FIMM) in geno yping wi h Po cineSNP60 Geno yping BeadChip (Illumina) is
g ea ly app ecia ed.
Au ho de ails
1
Ag i ood Resea ch Finland, MTT, Bio echnology and Food Resea ch,
Genomics, FI-36100 Jokioinen, Finland.
2
Uni e si y o Pannonia, Ins i u e o
En i onmen al Sciences, H-8200 Veszp em, Hunga y.
3
Fi s Depa men o
Pa hology and Expe imen al Cance Resea ch, Semmelweis Uni e si y,
H-1085 Budapes , Hunga y.
4
Uni e si y o Helsinki, Depa men o Clinical
Ve e ina y Sciences, Helsinki, Finland.
Au ho s’con ibu ions
AS ca ied ou he molecula gene ics s udies, sequence alignmen s and
d a ed he manusc ip . PU pe o med he s a is ical analysis and pa icipa ed
in d a ing he manusc ip . SN pa icipa ed in he mic oscopical s udies and
con ibu ed o d a ing o he manusc ip (mic oscopical s udies). SP ca ied
ou he mic oscopical s udies. MA pa icipa ed in he design and
coo dina ion o he s udy. JV pa icipa ed in he design and helped o d a
he manusc ip . All au ho s ead and app o ed he inal manusc ip .
Recei ed: 7 July 2010 Accep ed: 9 Decembe 2010
Published: 9 Decembe 2010
Re e ences
1. Boyle CA, Khou y MJ, Ka z DF, Annes JL, K esnow MJ, DeS e ano F,
Sch ade SM: The ela ion o compu e -based measu es o spe m
mo phology and mo ili y o male in e ili y. Epidemiology 1992, 3(3):239-246.
2. Lin o d E, Glo e FA, Bishop C, S ewa DL: The ela ionship be ween
semen e alua ion me hods and e ili y in he bull. J Rep od Fe il 1976,
47(2):283-291.
3. Wallace MS: In e ili y in he male dog. P obl Ve Med 1992, 4(3):531-544.
4. Kimmins S, Ko aja N, Da idson I, Sassone-Co si P: Tes is-speci ic
ansc ip ion mechanisms p omo ing male ge m-cell di e en ia ion.
Rep oduc ion 2004, 128(1):5-12.
5. Kimmins S, Sassone-Co si P: Ch oma in emodelling and epigene ic
ea u es o ge m cells. Na u e 2005, 434(7033):583-589.
6. Hoge een KN, Sassone-Co si P: Regula ion o gene exp ession in pos -
meio ic male ge m cells: CREM-signalling pa hways and male e ili y.
Hum Fe il (Camb) 2006, 9(2):73-79.
7. Ai ken RJ, Ke L, Bol on V, Ha g ea e T: Analysis o spe m unc ion in
globozoospe mia: implica ions o he mechanism o spe m-zona
in e ac ion. Fe il S e il 1990, 54(4):701-707.
8. Mo e i E, Collodel G, Scapiglia i G, Cosci I, Sa ini B, Bacce i B: ’Round
head’spe m de ec . Ul as uc u al and meio ic seg ega ion s udy.
J Submic osc Cy ol Pa hol 2005, 37(3-4):297-303.
9. Dam AH, Koscinski I, K eme JA, Mou ou C, Jaege AS, Oudakke AR,
Tou naye H, Cha le N, Lagie -Tou enne C, an Bokho en H, Vi ille S:
Homozygous mu a ion in SPATA16 is associa ed wi h male in e ili y in
human globozoospe mia. Am J Hum Gene 2007, 81(4):813-820.
10. Hu gen JP, Johnson LA: Fe ili y o s allions wi h abno mali ies o he
spe m ac osome. J Rep od Fe il Suppl 1982, 32:15-20.
11. Toyama Y, I oh Y: Ul as uc u al ea u es and pa hogenesis o knobbed
spe ma ozoa in a boa . Am J Ve Res 1993, 54(5):743-749.
12. Sode quis L: Reduced e ili y a e a i icial insemina ion in a am wi h a
high incidence o knobbed ac osomes. Ve Rec 1998, 143(8):227-228.
13. Chenowe h PJ: Gene ic spe m de ec s. The iogenology 2005, 64(3):457-468.
14. San os NR, K ekele N, Sch amme-Jossen A, Volkmann DH: The knobbed
ac osome de ec in ou closely ela ed dogs. The iogenology 2006,
66(6-7):1626-1628.
15. Kopp C, Si onen A, Ijas R, Taponen J, Vilkki J, Suku a A, Ande sson M:
In e ile boa s wi h knobbed and immo ile sho - ail spe m de ec s in
he Finnish Yo kshi e b eed. Rep od Domes Anim 2008, 43(6):690-695.
16. Schill WB: Some dis u bances o ac osomal de elopmen and unc ion in
human spe ma ozoa. Hum Rep od 1991, 6(7):969-978.
17. Blom E, Bi ch-Ande sen A: The ul as uc u e o a cha ac e is ic
spe mhead-de ec in he boa : he SME-de ec . And ologia 1975,
7(3):199-209.
18. Ande sen K, Filse h O: The occu ence o a “SME"-de ec -like abno mali y
in he head o spe ma ozoa om a No wegian Land ace boa . No d Ve
Med 1976, 28(10):511-514.
19. Nagase T, Kikuno R, Ishikawa KI, Hi osawa M, Oha a O: P edic ion o he
coding sequences o uniden i ied human genes. XVI. The comple e
sequences o 150 new cDNA clones om b ain which code o la ge
p o eins in i o. DNA Res 2000, 7(1):65-73.
20. Miyazaki K, Ozaki T, Ka o C, Hanamo o T, Fuji a T, I ino S, Wa anabe K,
Nakagawa T, Nakagawa a A: A no el HECT- ype E3 ubiqui in ligase,
NEDL2, s abilizes p73 and enhances i s ansc ip ional ac i i y. Biochem
Biophys Res Commun 2003, 308(1):106-113.
21. Ha aguchi CM, Mabuchi T, Hi a a S, Shoda T, Hoshi K, Yoko a S: Ubiqui in
signals in he de eloping ac osome du ing spe ma ogenesis o a es is:
an immunoelec on mic oscopic s udy. J His ochem Cy ochem 2004,
52(11):1393-1403.
22. Chianese R, Sca pa D, Be u i G, Cobellis G, Pie an oni R, Fasano S,
Mecca iello R: Exp ession and localiza ion o he deubiqui ina ing
enzyme mUBPy in wobble mouse es is du ing spe miogenesis. Gen
Comp Endoc inol 2010, 166(2):289-95.
23. Sanjo H, Kawai T, Aki a S: DRAKs, no el se ine/ h eonine kinases ela ed
o dea h-associa ed p o ein kinase ha igge apop osis. J Biol Chem
1998, 273(44):29066-29071.
24. Dohe y GA, By ne SM, Aus in SC, Scully GM, Sadlie DM, Neilan TG, Kay EW,
Mu ay FE, Fi zge ald DJ: Regula ion o he apop osis-inducing kinase DRAK2
by cyclooxygenase-2 in colo ec al cance . B J Cance 2009, 101(3):483-491.
25. Kuwaha a H, Nakamu a N, Kanazawa H: Nuclea localiza ion o he se ine/
h eonine kinase DRAK2 is in ol ed in UV-induced apop osis. Biol Pha m
Bull 2006, 29(2):225-233.
26. Su o sky P: Ubiqui in-dependen p o eolysis in mammalian
spe ma ogenesis, e iliza ion, and spe m quali y con ol: killing h ee
bi ds wi h one s one. Mic osc Res Tech 2003, 61(1):88-102.
27. Yi YJ, Manandha G, Su o sky M, Li R, Jonako a V, Oko R, Pa k CS,
P a he RS, Su o sky P: Ubiqui in C- e minal hyd olase-ac i i y is in ol ed
in spe m ac osomal unc ion and an i-polyspe my de ense du ing
po cine e iliza ion. Biol Rep od 2007, 77(5):780-793.
28. Mo ales P, Kong M, Piza o E, Pas en C: Pa icipa ion o he spe m
p o easome in human e iliza ion. Hum Rep od 2003, 18(5):1010-1017.
29. Su o sky P, Manandha G, McCauley TC, Caamano JN, Su o sky M,
Thompson WE, Day BN: P o easomal in e e ence p e en s zona pellucida
pene a ion and e iliza ion in mammals. Biol Rep od 2004,
71(5):1625-1637.
30. Mo ales P, Piza o E, Kong M, Ja a M: Ex acellula localiza ion o
p o easomes in human spe m. Mol Rep od De 2004, 68(1):115-124.
31. Bialy LP, Ziemba HT, Ma ianowski P, F acki S, Bu y M, Wojcik C: Localiza ion
o a p o easomal an igen in human spe ma ozoa: immunohis ochemical
elec on mic oscopic s udy. Folia His ochem Cy obiol 2001, 39(2):129-130.
32. Ziemba H, Bialy LP, F acki S, Bablok L, Wojcik C: P o easome localiza ion
and ul as uc u e o spe ma ozoa om pa ien s wi h
Si onen e al.BMC Genomics 2010, 11:699
h p://www.biomedcen al.com/1471-2164/11/699
Page 7 o 8
a icocele–immunoelec on mic oscopic s udy. Folia His ochem Cy obiol
2002, 40(2):169-170.
33. Ri kin E, Kie szenbaum AL, Gil M, T es LL: Rn 19a, a ubiqui in p o ein
ligase, and Psmc3, a componen o he 26S p o easome, e he o he
ac osome memb anes and he head- ail coupling appa a us du ing a
spe ma id de elopmen . De Dyn 2009, 238(7):1851-1861.
34. Lee KH, Song GJ, Kang IS, Kim SW, Paick JS, Chung CH, Rhee K: Ubiqui in-
speci ic p o ease ac i i y o USP9Y, a male in e ili y gene on he Y
ch omosome. Rep od Fe il De 2003, 15(1-2):129-133.
35. Roes HP, an Kla e en J, de Wi J, an Gu p CG, Koken MH, Ve mey M, an
Roijen JH, Hooge b ugge JW, V eebu g JT, Baa ends WM, Boo sma D,
G oo egoed JA, Hoeijmake s JH: Inac i a ion o he HR6B ubiqui in-
conjuga ing DNA epai enzyme in mice causes male s e ili y associa ed
wi h ch oma in modi ica ion. Cell 1996, 86(5):799-810.
36. Wong EY, Tse JY, Yao KM, Tam PC, Yeung WS: VCY2 p o ein in e ac s wi h
he HECT domain o ubiqui in-p o ein ligase E3A. Biochem Biophys Res
Commun 2002, 296(5):1104-1111.
37. Baa ends WM, an de Laan R, G oo egoed JA: Speci ic aspec s o he
ubiqui in sys em in spe ma ogenesis. J Endoc inol In es 2000,
23(9):597-604.
38. C immins S, Su o sky M, Chen PC, Hu man A, Wheele C, Swing DA,
Ro h K, Wilson J, Su o sky P, Wilson S: T ansgenic escue o a axia mice
e eals a male-speci ic s e ili y de ec . De Biol 2009, 325(1):33-42.
39. Ramos AM, C ooijmans RP, A a a NA, Ama al AJ, A chibald AL, Bee e JE,
Bendixen C, Chu che C, Cla k R, Dehais P, Hansen MS, Hedegaa d J, Hu ZL,
Ke s ens HH, Law AS, Megens HJ, Milan D, Nonneman DJ, Roh e GA,
Ro hschild MF, Smi h TP, Schnabel RD, Van Tassell CP, Taylo JF,
Wiedmann RT, Schook LB, G oenen MA: Design o a high densi y SNP
geno yping assay in he pig using SNPs iden i ied and cha ac e ized by
nex gene a ion sequencing echnology. PLoS One 2009, 4(8):e6524.
40. Pu cell S, Neale B, Todd-B own K, Thomas L, Fe ei a MA, Bende D, Malle J,
Skla P, de Bakke PI, Daly MJ, Sham PC: PLINK: a ool se o whole-
genome associa ion and popula ion-based linkage analyses. Am J Hum
Gene 2007, 81(3):559-575.
41. Ba e JC, F y B, Malle J, Daly MJ: Haplo iew: analysis and isualiza ion o
LD and haplo ype maps. Bioin o ma ics 2005, 21(2):263-265.
doi:10.1186/1471-2164-11-699
Ci e his a icle as: Si onen e al.: Knobbed ac osome de ec is
associa ed wi h a egion con aining he genes STK17b and HECW2 on
po cine ch omosome 15. BMC Genomics 2010 11:699.
Submi you nex manusc ip o BioMed Cen al
and ake ull ad an age o :
• Con enien online submission
• Tho ough pee e iew
• No space cons ain s o colo igu e cha ges
• Immedia e publica ion on accep ance
• Inclusion in PubMed, CAS, Scopus and Google Schola
• Resea ch which is eely a ailable o edis ibu ion
Submi you manusc ip a
www.biomedcen al.com/submi
Si onen e al.BMC Genomics 2010, 11:699
h p://www.biomedcen al.com/1471-2164/11/699
Page 8 o 8