scieee Science in your language
[en] (orig)

Critical Role of the Interaction Gut Microbiota – Sympathetic Nervous System in the Regulation of Blood Pressure

Abstract

This work was funded by grants from Comisión Interministerial de Ciencia y Tecnología, Ministerio de Economía y Competitividad (MINECO) (SAF2017-8489-R, AGL2015-67995- C3-3-R, and SAF2014-55523-R), Junta de Andalucía (Proyecto de Excelencia P12-CTS-2722 and CTS-164) with support from the European Union, and Ministerio de Economía y Competitividad, Instituto de Salud Carlos III (CIBER-CV, CIBER-EHD), Spain. MS is a postdoctoral fellow of Junta de Andalucía. MR is postdoctoral fellow of University of Granada. IR-V is a predoctoral fellow of MINECO. The cost of this publication was paid in part with FEDER funds.

Read accessible full text

Critical Role of the Interaction Gut Microbiota – Sympathetic Nervous System in the Regulation of Blood Pressure

Author: Toral Jiménez, Marta,Robles Vera, Iñaki,Visitación Pastor, Néstor de la,Romero Pérez, Miguel,Yang, Tao,Sánchez Santos, Manuel,Gómez Guzmán, Manuel,Jiménez Moleón, Rosario,Raizada, Mohan K,Duarte Pérez, Juan Manuel
Publisher: Frontiers
Year: 2019
DOI: 10.3389/fphys.2019.00231
Source: https://digibug.ugr.es/bitstream/10481/56306/2/%282019%29%20FMT%20y%20SNC%20%28Toral%20M%29.pdf
phys-10-00231 Ma ch 6, 2019 Time: 17:31 # 1
ORIGINAL RESEARCH
published: 08 Ma ch 2019
doi: 10.3389/ phys.2019.00231
Edi ed by:
Kesia Palma-Rigo,
Uni e sidade Es adual de Ma ingá,
B azil
Re iewed by:
Ka ie Sc ogin,
Loyola Uni e si y Chicago,
Uni ed S a es
Luciana Ven u ini Rossoni,
Uni e si y o São Paulo, B azil
*Co espondence:
Juan Dua e
jmdua e@ug .es
†These au ho s ha e con ibu ed
equally o his wo k as i s au ho s
Special y sec ion:
This a icle was submi ed o
In eg a i e Physiology,
a sec ion o he jou nal
F on ie s in Physiology
Recei ed: 10 Sep embe 2018
Accep ed: 21 Feb ua y 2019
Published: 08 Ma ch 2019
Ci a ion:
To al M, Robles-Ve a I,
de la Visi ación N, Rome o M, Yang T,
Sánchez M, Gómez-Guzmán M,
Jiménez R, Raizada MK and Dua e J
(2019) C i ical Role o he In e ac ion
Gu Mic obio a – Sympa he ic
Ne ous Sys em in he Regula ion
o Blood P essu e.
F on . Physiol. 10:231.
doi: 10.3389/ phys.2019.00231
C i ical Role o he In e ac ion Gu
Mic obio a – Sympa he ic Ne ous
Sys em in he Regula ion o Blood
P essu e
Ma a To al1†, Iñaki Robles-Ve a1†, Nés o de la Visi ación1, Miguel Rome o1,2, Tao Yang3,
Manuel Sánchez1,2, Manuel Gómez-Guzmán1, Rosa io Jiménez1,2,4, Mohan K. Raizada3
and Juan Dua e1,2,4*
1Depa men o Pha macology, School o Pha macy, Cen o de In es igación Biomédica, Uni e si y o G anada, G anada,
Spain, 2Ins i u o de In es igación Biosani a ia de G anada, ibs.GRANADA, G anada, Spain, 3Depa men o Physiology
and Func ional Genomics, Uni e si y o Flo ida, Gaines ille, FL, Uni ed S a es, 4CIBERCV, Uni e si y o G anada,
G anada, Spain
Associa ion be ween gu dysbiosis and neu ogenic diseases, such as hype ension,
has been desc ibed. The aim o his s udy was o in es iga e whe he changes in
he gu mic obio a al e gu -b ain in e ac ions inducing changes in blood p essu e
(BP). Recipien no mo ensi e Wis a -Kyo o (WKY) and spon aneously hype ensi e a s
(SHR) we e o ally ga aged wi h dono ecal con en s om SHR and WKY. We di ided
he animals in o ou g oups: WKY ansplan ed wi h WKY mic obio a (W-W), SHR
wi h SHR (S-S), WKY wi h SHR (W-S) and SHR wi h WKY (S-W). Basal sys olic
BP (SBP) and dias olic BP (DBP) we e educed wi h no change in hea a e as
a esul o ecal mic obio a ansplan a ion (FMT) om WKY a s o SHR. Simila ly,
FMT om SHR o WKY inc eased basal SBP and DBP. Inc eases in bo h NADPH
oxidase-d i en eac i e oxygen species p oduc ion and p oin lamma o y cy okines in
b ain pa a en icula nucleus linked o highe BP d op wi h pen olinium and plasma ic
no ad enaline (NA) le els we e ound in he S-S g oup as compa ed o he W-W
g oup. These pa ame e s we e educed by FMT om WKY o SHR. Inc eased le els
o p o-in lamma o y cy okines, y osine hyd oxylase mRNA le els and NA con en in he
p oximal colon, whe eas educed mRNA le els o gap junc ion p o eins, we e ound in
he S-S g oup as compa ed o he W-W g oup. These changes we e inhibi ed by FMT
om WKY o SHR. Acco ding o ou co ela ion analyses, he abundance o Blau ia and
Odo ibac e showed a nega i e co ela ion wi h high SBP. In conclusion, in SHR gu
mic obio a is an impo an ac o in ol ed in BP con ol, a leas in pa , as consequence
o i s e ec on neu oin lamma ion and he sympa he ic ne ous sys em ac i i y.
Keywo ds: gu dysbiosis, hype ension, oxida i e s ess, neu oin lamma ion, sympa he ic ne ous sys em
Abb e ia ions: BM, bone ma ow; BP, blood p essu e; DBP, dias olic blood p essu e; DHE, dihyd oe hidium; DNA,
deoxy ibonucleic acid; FMT, ecal mic obio a ansplan a ion; GPR, G-p o ein-coupled ecep o ; HR, hea a e; IFN,
in e e on; IL, in e leukin; LPS, lipopolysaccha ide; MUC, mucin; NA, no ad enaline; O2−, supe oxide anion; o TH, y osine
hyd oxylase; Ol , ol ac o y ecep o ; PRA, plasma enin ac i i y; PVN, pa a en icula nucleus; ROS, eac i e oxygen species;
RT-PCR, e e se ansc ip ase-polyme ase chain eac ion; SBP, sys olic blood p essu e; SCFAs, sho -chain a y acids; SHR,
spon aneously hype ensi e a s; SNS, sympa he ic ne ous sys em; TLR, oll-like ecep o ; TNF-α, umo nec osis ac o -α;
WKY, Wis a -Kyo o; ZO, zonula occludens.
F on ie s in Physiology | www. on ie sin.o g 1Ma ch 2019 | Volume 10 | A icle 231
phys-10-00231 Ma ch 6, 2019 Time: 17:31 # 2
To al e al. Gu -G ain In e ac ion and Blood P essu e
INTRODUCTION
Abundan e idence has demons a ed he associa ion be ween
gu dysbiosis and neu ogenic diseases, such as hype ension
(Mell e al., 2015;Yang e al., 2015). A common cha ac e is ic o
esis an hype ension is ch onically ele a ed sympa he ic
ne ous sys em (SNS) ac i i y accompanied by a high
elease o no ad enaline (NA) (Tsiou is e al., 2011), which
indica es a neu ogenic componen ha con ibu es o he
ini ia ion, main enance and p og ession o hype ension
(Yang and Zubce ic, 2017).
The ac o s ha s imula e sympa he ic one in human
essen ial hype ension a e poo ly unde s ood. A newly iden i ied
in e ac ion be ween he b ain, gu and bone has been iden i ied
as a possible mechanism in he pa hogenesis o hype ension
(San is eban e al., 2016). Fo ins ance, an inc ease in sympa he ic
d i e o bone ma ow (BM) and he gu may also igge a
sequence o signaling e en s ha can, ul ima ely, con ibu e o
an o e all inc ease in blood p essu e (BP) and he es ablishmen
o hype ension, by a ec ing he s uc u e and unc ion o BP
a ge o gans, such as ascula u e, kidney, hea , and b ain.
Inc eased sympa he ic ac i i y o he gu could esul in dysbiosis,
inc eased gu pe meabili y and in lamma o y s a us, leading o an
imbalance in he gu con en o sho -chain a y acids (SCFAs)-
p oducing bac e ia and in he plasma le els o lipopolysaccha ide
(LPS). These me abolic and s uc u al mic obial p oduc s,
wo king oge he , ele a e sympa he ic d i e o he BM and
o he lymphoid o gans, and may ac as modula o s o BM cell
ac i i y by inc easing he p oli e a ion and elease o myeloid
p ogeni o s and o he p o-in lamma o y cells. This inc ease in
myeloid p ogeni o cells con ibu es o an inc ease in pe iphe al
and cen al in lamma ion ha could be a c i ical e en o he
es ablishmen o hype ension.
The immune and sympa he ic sys ems a e ecognized
o con ibu e o he de elopmen o hype ension
(Yang e al., 2017), while he e exis s a bidi ec ional signaling
be ween he b ain and gu mic obio a which can egula e he
BP h ough he modula ion o he in e ac ion be ween SNS and
immune sys em (Yang and Zubce ic, 2017). The e o e, since
a link be ween hype ension and gu dysbiosis has ecen ly
been suspec ed (Mell e al., 2015;Yang e al., 2015), se e al
g oups a e in es iga ing his in e ac ion. In his way, di e en
s udies ha e shown ha ecal mic obio a ansplan a ion
(FMT) om hype ensi e human and a dono s ele a e he
BP o he hos , no mo ensi e mice and a s, espec i ely
(Adnan e al., 2017;Li e al., 2017;To al e al., 2018), poin ing
ou ha gu dysbiosis plays a possible con ibu ing o e en
causal ole in hype ension. Howe e , he communica ion
be ween gu mic obio a and he SNS in hype ension is no
comple ely unde s ood. We hypo hesize ha an inc eased
sympa he ic ac i i y con ibu es o gu dysbiosis, which hen
inc eases in lamma ion and sympa he ic ac i i y. Because o
his, in he p esen s udy, we es ed whe he changes in gu
mic obio a composi ion induced by ecip ocal ecal mic obio a
ansplan a ion om Wis a -Kyo o (WKY) o spon aneously
hype ensi e a s (SHR), could dec ease neu oin lamma ion and
sympa he ic ac i i y and he eby lowe BP. We used SHR as a
model o neu ogenic hype ension cha ac e ized by sus ained
age-dependen ele a ion in sympa he ic ac i i y and dysbiosis
(Judy e al., 1976;Yang and Zubce ic, 2017).
MATERIALS AND METHODS
Animals and Expe imen al G oups
This esea ch was pe o med acco ding o he Na ional Ins i u es
o Heal h (NIH) Guide o he Ca e and Use o Labo a o y
Animals, and app o ed by he E hic Commi ee o Labo a o y
Animals o he Uni e si y o G anada, Spain (Re . 03-CEEA-
OH-2013). Male SHR and WKY we e ob ained om Ha lan
Labo a o ies (Ba celona, Spain). All a s we e ed s anda d a
chow (Ha lan global die 2014, Ha lan Labo a o ies, Inc., Milan,
I aly) ad libi um o he du a ion o he expe imen . S ool samples
we e collec ed and pooled om wen y-week-old WKY and SHR
a s. Dono ecal con en s we e adminis e ed h ough o al ga age
o wen y- i e-weeks-old WKY and SHR a s o 3 consecu i e
days, and once e e y 3 days o a o al ex ension o 4 weeks.
Animals we e andomly assigned o ou di e en g oups o 5–
8 animals each: WKY wi h WKY mic obio a (W-W), WKY wi h
SHR (W-S), SHR wi h SHR (S-S) and SHR wi h WKY (S-W).
Ra s we e kep in indi idually en ila ed cages in a pa hogen- ee
animal acili y. Body weigh , ood and wa e in ake we e eco ded
weekly o all g oups. Du ing he expe imen al pe iods, a s had
ee access o ap wa e and chow. FMT o ecipien a s we e
ca ied ou as p e iously epo ed wi h se e al modi ica ions
(B uce-Kelle e al., 2015).
Fecal Mic obio a T ansplan a ion (FMT)
Fecal ic obio a ansplan a ion o ecipien a s was ca ied
ou as p e iously epo ed wi h se e al modi ica ions
(To al e al., 2018). B ie ly, ecal con en s we e isola ed and
pooled om WKY a s and SHR (n= 5). Fecal con en s we e
dilu ed 1:20 in s e ile PBS and cen i uged a 800 pm o
5 min. The supe na an was aliquo ed and s o ed a −80◦C.
S a ing 1 week be o e he adminis a ion, ecipien a s we e
adminis e ed wi h 1 mL ce iaxone sodium (400 mg/Kg/day)
daily o i e consecu i e days by o al ga age. The pu pose o he
an ibio ic ea men was o educe he p e-exis ing mic obio a
and o acili a e he eco e y o he popula ion and di e si y o
in es inal mic obio a om dono a s a e FMT (Li e al., 2017).
Fo y-eigh hou s a e he las an ibio ic ea men , ecipien
a s we e o ally ga aged wi h dono ecal con en s (1 mL) as
explained abo e.
Blood P essu e Measu emen s
Sys olic blood p essu e (SBP) and hea a e (HR) was measu ed
weekly a oom empe a u e using ail-cu ple hysmog aphy
as desc ibed p e iously (Za zuelo e al., 2011). A he end o
he expe imen al pe iod, animals we e subjec ed o iso lu ane
anes hesia, a polye hylene ca he e con aining 100U hepa in in
iso onic, s e ile NaCl solu ion was inse ed in he le ca o id
a e y o moni o in a-a e ial BP. Twen y- ou hou s a e
he implan a ion o he ca he e , we eco ded in a-a e ial
BP unin e up edly o 60 min wi h a sampling equency o
F on ie s in Physiology | www. on ie sin.o g 2Ma ch 2019 | Volume 10 | A icle 231
phys-10-00231 Ma ch 6, 2019 Time: 17:31 # 3
To al e al. Gu -G ain In e ac ion and Blood P essu e
400/s (McLab; AD Ins umen s, Has ings, Uni ed Kingdom).
Fo in e g oup compa isons, BP alues eco ded du ing he las
30 min we e a e aged.
E alua ion o he Con ibu ion o
Sympa he ic Ac i i y
Acu e BP esponses o in a enous injec ion o pen olinium
(10 mg/Kg) we e analyzed in conscious a s. Be o e pen olinium
adminis a ion, a e ial blood samples (0.2 mL) we e d awn ia
he ca he e o measu e NA le els and plasma enin ac i i y
(PRA). The pen olinium dose was selec ed because i p oduces
maximal sympa he ic inhibi ion (Pecháno á e al., 2004). Finally,
he a s we e subjec ed o iso lu ane anes hesia and we e killed
by comple e exsanguina ion, hen he b ain was emo ed, snap-
ozen in liquid ni ogen, and s o ed a −80◦C un il p ocessed o
he e e se ansc ip ase-polyme ase chain eac ion (RT-PCR)
measu emen (Rome o e al., 2016).
Plasma and Colonic De e mina ions
Blood samples we e cooled in ice and cen i uged o 10 min
a 3,500 pm a 4◦C, and he plasma was ozen a −80◦C.
Plasma LPS concen a ion was measu ed using he Limulus
Amebocy e Lys e (LAL) ch omogenic endo oxin quan i a ion Ki
(Lonza, Valais, Swi ze land), acco ding o he ins uc ions o
he manu ac u e .
We used enzyme-linked immunoso ben assay ki s (IBL
In e na ional, Hambu g, Ge many) o measu e bo h plasma
and colonic NA concen a ions ollowing he manu ac u e ’s
p o ocol. Colon samples we e collec ed and imme sed in he
app op ia e conse a ion solu ion. EDTA 1 mM and sodium
me abisul i e 4 mM we e added o p e en he ca echolamine
deg ada ion, hen plasma and issue samples we e s o ed a
−80◦C o la e use.
The Ra Renin Ac i i y Fluo ome ic Assay Ki (BioVision,
Milpi as, CA, Uni ed S a es; K806-100) was used o measu e he
enin ac i i y ollowing he manu ac u e ’s p o ocol.
Measu emen o In acellula Reac i e
Oxygen Species (ROS) Concen a ions
Reac i e oxygen species p oduc ion was measu ed in
homogena es om b ain pa a en icula nucleus (PVN)
using he luo escen p obe 5-(and-6-)chlo ome hyl-20-70-
dichlo odihyd o luo escein diace a e (CM-H2DCFDA). B ain
PVN was homogenized in lysis bu e composed o 50 mM
T is–HCl (pH 7.4) con aining 0.1 mM EDTA, 0.1 mM EGTA,
10 µg/mL ap o inin, 10 µg/mL leupep in and 1 mM PMSF.
F esh homogena es (10 µg o p o ein) in 96-well pla es we e
incuba ed wi h 5 µmol/L CM-H2DCFDA o 30 min a 37◦C, in
he absence o in he p esence o he NADPH oxidase inhibi o
apocynin (50 µM). The luo escen in ensi y was measu ed using
a spec o luo ime e (Fluo os a , BMG Lab ech, O enbe g,
Ge many) (To al e al., 2015).
NADPH Oxidase Ac i i y
The NADPH oxidase ac i i y in homogena es om b ain
PVN was measu ed by dihyd oe hidium (DHE) luo escence
assay in he mic opla e eade , as desc ibed p e iously
(Fe nandes e al., 2007;To al e al., 2015). F esh homogena es
(10 µg o p o ein) we e incuba ed wi h DHE (10 µM) and
deoxy ibonucleic acid (DNA, 1.25 µg/mL) in PBS (100 mM),
pH 7.4, con aining 100 µM DTPA wi h he addi ion o NADPH
(50 µM), a a inal olume o 120 µL. Incuba ions we e
pe o med o 30 min a 37◦C in he da k. To al luo escence
was ollowed in a mic opla e eade using a hodamine il e
(exci a ion 490 nm and emission 590 nm) in a spec o luo ome e
(Fluo os a , BMG Lab ech, O enbe g, Ge many).
RT-PCR Analysis
Fo RT-PCR analysis, o al RNA was ex ac ed om he
colon, and b ain PVN by homogeniza ion and con e ed
o cDNA by s anda d me hods. PVN and colon issue
was homogenized in 1 ml o TRI Reagen (The mo Fishe
Scien i ic Inc., Wal ham, MA, Uni ed S a es). RNA isola ion
was pe o med wi h adi ional me hods using sequen ial
washes wi h b omochlo op opane, isop opanol and e hanol
75%. RNA concen a ions we e measu ed wi h a NanoD opTM
2000 Spec opho ome e (The mo Fishe Scien i ic Inc.,
Wal ham, MA, Uni ed S a es). A Techne Techgene he mocycle
(Techne, Camb idge, Uni ed Kingdom) was used o pe o m
he polyme ase chain eac ion. mRNA exp ession was
analyzed h ough quan i a i e eal- ime RT-PCR. RNA was
e e se ansc ibed using oligo (dT) p ime s, Recombinan
RNasinR
Ribonuclease, dNTP (10 mM) and M-MLV e e se
T ansc ip ase (P omega, Sou hamp on, Uni ed Kingdom).
Re e se esul ing cDNA (2 ng) was ampli ied on op ical
g ade 48-well pla es in an EcoTM Real-Time PCR Sys em
(Illumina, CA, Uni ed S a es), using GoTaqR
qPCR Mas e
Mix, 2x (P omega, Sou hamp on, Uni ed Kingdom). In
Table 1 a e lis ed he sequences o bo h sense and an isense
p ime s used o ampli ica ion. In o de o de e mine non-
sa u a ing condi ions o PCR ampli ica ion o all genes
s udied, p elimina y expe imen s wi h a ious amoun s o
cDNA we e pe o med. Unde hese condi ions, RT-PCR
me hod was used o assess he ela i e quan i ica ion o mRNA.
A s anda d issue sample was used o de e mine he e iciency
o he PCR eac ion. The 11C me hod was pe o med
o quan i ica ion. The housekeeping gen glyce aldehyde-3-
phospha e dehyd ogenase (GAPDH) was used o in e nal
no maliza ion (Rome o e al., 2016).
16S DNA V4-V5 Region Sequencing
Fecal DNA was ex ac ed om he samples collec ed om
5 o 6 animals pe g oup by using a quick-DNA ecal/soil
mic obe ki (Zymo Resea ch, I ine, CA). P ime s compa ible
wi h illumina Miseq 2 2x250bp ki (Illumina, San Diego, CA)
we e used o ampli y bac e ial 16S V4–V5 a iable egions
(Robles-Ve a e al., 2018). The PCR amplicons we e pu i ied
using a QIAquick gel ex ac ion ki (QIAGEN, Hilden, Ge many)
and quan i ied by Qubi ( he mos Fishe Scien i ic, Wal ham,
MA, Uni ed S a es). Equal amoun s o pu i ied PCR p oduc
om each sample we e pooled oge he as one lib a y. The
lib a y was quan i ied by eal ime PCR (Kapa Biosys ems,
Wilming on, MA, Uni ed S a es) p io o Miseq sequencing
F on ie s in Physiology | www. on ie sin.o g 3Ma ch 2019 | Volume 10 | A icle 231
phys-10-00231 Ma ch 6, 2019 Time: 17:31 # 4
To al e al. Gu -G ain In e ac ion and Blood P essu e
TABLE 1 | Oligonucleo ides o eal- ime RT-PCR.
mRNA a ge s Desc ip ions Sense An isense
NOX-1 NOX-1 subuni o NADPH oxidase TCTTGCTGGTTGACACTTGC TATGGGAGTGGGAATCTTGG
NOX-4 NOX-4 subuni o NADPH oxidase ACAGTCCTGGCTTACCTTCG TTCTGGGATCCTCATTCTGG
p22phox p22phox subuni o NADPH oxidase GCGGTGTGGACAGAAGTACC CTTGGGTTTAGGCTCAATGG
p47phox p47phox subuni o NADPH oxidase CCCAGCGACAGATTAGAAGC TGGATTGTCCTTTGAGTCAGG
TNF-αTumo nec osis ac o -alpha ACGATGCTCAGAAACACACG CAGTCTGGGAAGCTCTGAGG
IL-6 In e leukin-6 GATGGATGCTTCCAAACTGG AGGAGAGCATTGGAAGTTGG
IL-10 In e leukin-10 GAATTCCCTGGGAGAGAAGC GCTCCACTGCCTTGCTTTTA
IL-17a In e leukin-17a CTTCACCTTGGACTCTGAGC TGGCGGACAATAGAGGAAAC
IFNγIn e e on gamma GCCCTCTCTGGCTGTTACTG CCAAGAGGAGGCTCTTTCCT
cd11b Cd11b GAGAACTGGTTCTGGCTTGC TCAGTTCGAGCCTTCTT
CCL2 C-C chemokine ligand 2 CCTCCACCACTATGCAGGTC CAGCCGACTCATTGGGATCA
Ol 59 Ol ac o y ecep o 59 CTGCTAGTCATGGGTGTAGATG CAAGGGTGATAGAACGGTAAGG
GPR-41 G-p o ein-coupled ecep o -41 TGACGGTGAGCATAGAACGTTT GCCGGGTTTTGTACCACAGT
GPR-43 G-p o ein-coupled ecep o -43 TCGTGGAAGCTGCATCCA GCGCGCACACGATCTTT
Occludin Occludin AGCCTGGGCAGTCGGGTTGA ACACAGACCCCAGAGCGGCA
Muc2 Mucin-2 CGATCACCACCATTGCCACTG ACCACCATTACCACCACCTCAG
ZO-1 Zonula occludens-1 GCCAGCCAGTTCCGCCTCTG AGGGTCCCGGGTTGGTG
IL-1βIn e leukin-1 be a GTCACTCATTGTGGCTGTGG GCAGTGCAGCTGTCTAATGG
TH Ty osine hyd oxylase GATTGCTACCTGGAAGGAGGT AGTCCAATGTCCTGGGAGAAC
GAPDH Glyce aldehyde-3-Phospha e Dehyd ogenase ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA
(Illumina, San Diego, CA, Uni ed S a es). The sequencing da a
had a Q30 sco e ≥93.5% and 97.17 ±0.34% o o al clus e
passes he il e .
Bioin o ma ics Analysis
The aw pai ed- eads om Miseq we e p ocessed using
QIIME 1.9.1. B ie ly, eads we e immed o emo e bases
wi h Ph ed sco es lowe han 30 and quali y- il e ed wi h
pa ame e s se as p e iously op imized ( e : Quali y- il e ing
as ly imp o es di e si y es ima es om Illumina amplicon
sequencing). Open e e ence OTU-picking was pe o med and
axonomical assignmen o he gene a ed OTUs we e pe o med
wi h 97% iden i y agains G eengenes da abase 13.8. Alpha
di e si y and unweigh ed p incipal coo dina e analyses plo s
using he phylogenic ee-based uni ac dis ance me ic we e
gene a ed using sc ip s om QIIME package.
Reagen s
All eagen s we e pu chased om Sigma-Ald ich (Ba celona,
Spain) unless o he wise speci ied.
S a is ical Analysis
S a is ical analyses we e pe o med wi h G aphPad P ism 7
so wa e. Resul s a e exp essed as means ±SEM. To es i
he alues come om a gaussian dis ibu ion a Shapi o-Wilk
no mali y es was used. Fo compa isons o he ou g oups
wi h wo a iables (s ain and ea men ) we used a wo-way
ANOVA (wi h Sidak’s co ec ion o compa ison o mul iple
means). Fac o s we e pa i ioned in o s ain (WKY-SHR) and
FMT ( om WKY/ om SHR). A p alue o less han 0.05 was
conside ed signi ican conside ing he main e ec s o he s ain
(WKY-SHR), FMT ( om WKY/ om SHR) and hei in e ac ion
(I; s ain s. FMT).
RESULTS
BP Is Con olled by Gu Mic obio a
Fecal exchange om SHR o WKY enhanced basal SBP
(149.8 ±4 mm Hg) by 16 ±2 mm Hg (pFMT <0.01), measu ed
by ail-cu ple hysmog aphy. Simila ly, FMT om WKY a s
o SHR lowe ed SBP by 38 ±4 mm Hg (pFMT <0.01) he
basal (199.5 ±6 mm Hg, ps ain <0.01) (Figu e 1A) esul ing
in a signi ican s ain e sus FMT in e ac ion (pi <0.05). In
conscious a s, di ec SBP and DBP alues we e also inc eased
by FMT om SHR o WKY as compa ed o he W-W g oup
(pFMT <0.01), and educed in SHR a e FMT om WKY as
compa ed o FMT om SHR o SHR (pFMT <0.01), leading
o a signi ican s ain e sus FMT in e ac ion (pi <0.05). No
signi ican changes (pFMT = 0.62, ps ain = 0.44) we e obse ed
among all expe imen al g oups in HR ob ained by di ec egis e
(Figu e 1B). No in e ac ion was obse ed be ween s ain and
FMT (pi = 0.39).
Sympa he ic Ac i i y, B ain PVN NADPH
Oxidase, In lamma ion, and
Mac ophages and T Cells In il a ion A e
Regula ed by Gu Mic obio a
We used a ganglionic blocke , pen olinium, in conscious a s
o de e mine he e ec o FMT on sympa he ic ou low. The
educ ion on SBP a e ganglionic blockade was highe in he
S-S g oup as compa ed o he W-W g oup (−113.3 ±5.3 mm
F on ie s in Physiology | www. on ie sin.o g 4Ma ch 2019 | Volume 10 | A icle 231
phys-10-00231 Ma ch 6, 2019 Time: 17:31 # 5
To al e al. Gu -G ain In e ac ion and Blood P essu e
FIGURE 1 | E ec s o ecal mic obio a ansplan a ion (FMT) on blood p essu e. Sys olic blood p essu e (SBP), measu ed by ail-cu ple hysmog aphy du ing
4 weeks o FMT (A), and SBP, dias olic blood p essu e (DBP), and hea a e (HR), measu ed by di ec egis e (B), in spon aneously hype ensi e a s (SHR) wi h
s ool ansplan om SHR (S-S) o om Wis a Kyo o a s (WKY) (S-W) and in WKY wi h s ool ansplan om WKY (W-W) o om SHR (W-S) a he end o he
expe imen al pe iod. S ain ac o , FMT ac o and I in e ac ion be ween s ain and FMT ac o s. ++p<0.01, +p<0.05 and ns (no signi ican ) o he p obabili y
based on a wo-way analysis o a iance. Values a e means ±SEM (n= 5–8). ∗P<0.05 and ∗∗P<0.01 s. W-W; ##P<0.01 s. S-S s a is ical signi icance o he
p obabili y based on a Sidak’s co ec ion mul iple compa isons es .
Hg s. −59.8 ±2.5 mm Hg, ps ain <0.01). FMT om
WKY o SHR inhibi ed o he decay in SBP a e pen olinium
(−83.6 ±4.1 mm Hg, pFMT <0.01) as compa ed o he S-S
g oup, whe eas in W-S a s his educ ion was also highe
(−79.4 ±3.6 mm Hg, pFMT <0.05) han ha ound in he W-W
g oup (Figu e 2A), which led o a signi ican s ain e sus FMT
in e ac ion (pi <0.05). Simila quali a i e changes among g oups
in DBP educ ions a e pen olinium injec ion we e obse ed
(ps ain <0.01, pFMT <0.01), wi hou in e ac ion be ween s ain
and FMT (pi = 0.83). No changes in HR educ ions (pFMT = 0.24,
ps ain = 0.63) and no in e ac ion we e obse ed be ween s ain
and FMT (pi = 0.42) (Figu e 2A). Plasma NA concen a ion
(ps ain <0.01), ano he ma ke o sympa he ic ne e ac i i y,
was educed ≈65 % by FMT om WKY o SHR (pFMT <0.05)
and inc eased ≈2.5 imes by FMT om SHR o WKY a s
(pFMT <0.05) (Figu e 2B). PRA was ound ≈2 imes highe in
he S-S g oups as compa ed o he W-W g oup (ps ain <0.05).
Howe e , nei he FMT om SHR o WKY inc eased PRA, as
compa ed wi h W-W, no FMT om WKY signi ican ly educed
PRA as compa ed wi h S-S g oup (pFMT = 0.52) (Figu e 2C),
which no led o a signi ican s ain e sus FMT in e ac ion (NA
concen a ion: pi = 0.46; PRA: pi = 0.55).
We ound ha ROS p oduc ion (ps ain <0.01) (Figu e 3A),
NADPH oxidase ac i i y (ps ain <0.01) (Figu e 3B) and he
mRNA le els o NADPH oxidase subuni s, NOX-1, NOX-
4, p47phox, and p22phox (ps ain <0.01) (Figu e 3C) and
p o-in lamma o y cy okines ( umo nec osis ac o -α(TNF-α),
in e leukin (IL)-1β, IL-6, IL-17a, and in e e on (IFN)-γ
(ps ain <0.01) (Figu es 4A–E) in b ain PVN we e highe
in he S-S g oup han hose ound in he W-W g oup, and
we e educed by FMT om WKY a s o SHR (pFMT <0.05).
Howe e , hese pa e ns did no led o a signi ican s ain
e sus FMT in e ac ion. By con as , he an i-in lamma o y
cy okine IL-10 was educed in he S-S g oup as compa ed
o he W-W g oup (ps ain <0.05) and inc eased a e FMT
om WKY o SHR (pFMT <0.05) (Figu e 4F) leading
o a signi ican s ain e sus FMT in e ac ion (pi <0.05).
In addi ion, he mRNA le els o CCL2 (ps ain <0.05)
(Figu e 4G) and CD11b (ps ain <0.01) (Figu e 4H) we e also
inc eased a e FMT om SHR o WKY and dec eased a e
FMT om WKY o SHR (pFMT <0.05), wi hou signi ican
in e ac ion (pi = 0.10).
We sough o de e mine whe he he e we e al e a ions
in he gene ic exp ession o ol ac o y ecep o s a he PVN.
In e es ingly, we ound an inc ease o Ol 59 (ps ain <0.01) in
PVN accompanied by a down egula ion o GPR-41 and GPR-43
(ps ain <0.05) (Figu es 5A,B) in SHR as compa ed o he W-W
g oup. FMT om WKY o SHR es o ed he mRNA le els o
F on ie s in Physiology | www. on ie sin.o g 5Ma ch 2019 | Volume 10 | A icle 231

phys-10-00231 Ma ch 6, 2019 Time: 17:31 # 6
To al e al. Gu -G ain In e ac ion and Blood P essu e
FIGURE 2 | E ec s o ecal mic obio a ansplan a ion (FMT) on sympa he ic one. Dec ease induced by acu e in a enous adminis a ion o pen olinium (10 mg/kg)
on sys olic blood p essu e (SBP), dias olic blood p essu e (DBP), and hea a e (HR), in conscious a s (A). Plasma no ad enaline (NA) le els (B), and plasma enin
ac i i y (PRA) (C) ound in all expe imen al g oups. S ain ac o , FMT ac o and I in e ac ion be ween s ain and FMT ac o s. ++p<0.01, +p<0.05 and ns (no
signi ican ) o he p obabili y based on a wo-way analysis o a iance. Values a e means ±SEM (n= 5–8). ∗P<0.05 and ∗∗P<0.01 s. WKY wi h s ool ansplan
om WKY (W-W); #P<0.05 and ##P<0.01 s. SHR wi h s ool ansplan om SHR (S-S), s a is ical signi icance o he p obabili y based on a Sidak’s co ec ion
mul iple compa isons es .
hese ecep o s (pFMT <0.01, pi = 0.37; pFMT <0.05, pi = 0.08;
pFMT <0.05, pi <0.03, espec i ely) (Figu es 5A,B).
FMT Induced Changes in he Gu
Mic obio a Composi ion
To de e mine he dynamics o gu mic obio a du ing he
exchange o gu mic obio a be ween SHR and WKY, we analyzed
ecal DNA isola ed om all expe imen al g oups. Figu e 6A
shows he bac e ial axa (class, o de , amily, and genus) ha
we e al e ed by ecal exchange om SHR o WKY, acco ding
o LE Se analysis. P ominen shi s in bac e ial communi y we e
obse ed a e 4 weeks o ea men be ween he W-W and S-S
g oups, wi h an inc ease in he ela i e abundance o 10 bac e ial
axa (g een) and a dec easing o 6 axa ( ed) compa ing wi h he
W-W g oup. Se e al changes in mic obial axa we e also d i en
by ecal exchange om SHR o WKY wi h an inc ease in he
ela i e abundance o 3 bac e ial axa (g een) and a educ ion
o 7 axa ( ed) (Figu e 6B). While S-W compa ed o he S-S
g oup, only ela i e abundance o 2 axa we e inc eased (g een)
and 22 we e dec eased ( ed) (Figu e 6C). In e es ingly, we ound
an associa ion be ween a majo abundance o bu y a e-p oducing
amily Odo ibac e eae and he genus o Odo ibac e wi h low
BP le els p esen in he W-W and S-W g oups. In con as ,
we obse ed a co ela ion be ween Blau ia and Pep ococcaceae
abundance and ele a ed BP in he S-S and W-S g oups (Figu e 6).
When compa ing he bac e ial composi ion e olu ion, a he
amily le el, in he gu mic obio a be ween all expe imen al
g oups, we ound ha W-S had a signi ican ly lowe abundance o
Bac e oidaceae, and g ea e abundance o Clos idiacea in he gu
mic obio a han he W-W g oup a 4 weeks o ea men . While
S-W showed a deple ion o abundance o Lac obacillales and an
inc ease o E ysipelo ichaceae compa ed o he S-S g oup a he
end o he expe imen (Figu e 7).
Gu In eg i y and In lamma ion A e
Regula ed by Gu Mic obio a
In concu ence wi h p e ious da a (San is eban e al., 2017)
he le els o occludin (ps ain <0.05) (Figu e 8A), and zonula
occludens (ZO)-1 (ps ain <0.01) (Figu e 8B), and mucin
(MUC)-2 (ps ain <0.05) (Figu e 8C) we e signi ican ly educed
in he S-S g oup as compa ed o he W-W g oup. The exp ession
o colonic ZO-1 and MUC-2 (pFMT <0.05) we e also educed
when FMT om SHR o WKY was pe o med, which we e
accompanied o a signi ican s ain e sus FMT in e ac ion
(pi <0.05), whe eas FMT om WKY o SHR ended o inc ease
hese pa ame e s bu wi hou s a is ical signi icance, as compa ed
o he S-S g oup. Simila ly, inc eased mRNA exp ession o
p o-in lamma o y TNF-α(ps ain <0.05) (Figu e 8D) and IL-
6 (ps ain <0.05) (Figu e 8E), wi hou signi ican change in
IL-1β(Figu e 8F) was also obse ed in he S-S g oup as
F on ie s in Physiology | www. on ie sin.o g 6Ma ch 2019 | Volume 10 | A icle 231
phys-10-00231 Ma ch 6, 2019 Time: 17:31 # 7
To al e al. Gu -G ain In e ac ion and Blood P essu e
FIGURE 3 | E ec s o ecal mic obio a ansplan a ion (FMT) on ROS p oduc ion and NADPH oxidase pa hway in he b ain PVN. CM-H2DCFDA-de ec ed
in acellula ROS in absence and p esence o NADPH oxidase inhibi o apocynin (50 µM) (A) and NADPH oxidase ac i i y measu ed by DHE luo escence measu ed
in he mic opla e eade (B) in homogena es om b ain PVN. mRNA le els o NADPH oxidase subuni s NOX-1, NOX-4, p47phox and p22phox (C) in he b ain PVN
om all expe imen al g oups. S ain ac o , FMT ac o and I in e ac ion be ween s ain and FMT ac o s. ++p<0.01 and ns (no signi ican ) o he p obabili y based
on a wo-way analysis o a iance. Values a e means ±SEM (n= 5–8). ∗P<0.05 and ∗∗P<0.01 s. WKY wi h s ool ansplan om WKY (W-W); #P<0.05 s.
SHR wi h s ool ansplan om SHR (S-S), s a is ical signi icance o he p obabili y based on a Sidak’s co ec ion mul iple compa isons es .
compa ed o he W-W g oup. FMT om WKY o SHR educed
he le els o hese p o-in lamma o y cy okines (pFMT <0.05,
pi <0.05; pFMT <0.01, pi <0.01, espec i ely). We ound
educed GPR-43 mRNA le els in he gu om bo h SHR g oups
as compa ed o he W-W g oup (ps ain <0.05) (Figu e 8G).
GPR-43 ansc ip le el ended o be educed in WKY a s a e
FMT om SHR (pFMT = 0.057) wi hou in e ac ion be ween
s ain and FMT (pi = 0.11). In addi ion, an inc ease in in es inal
pe meabili y has been p oposed as a c ucial mechanism o
he de elopmen o endo oxemia (Cani e al., 2008). In ac ,
we ound inc eased plasma LPS le els Figu e 8H) in a s wi h
high BP (W-S and S-S g oups) (ps ain <0.05; pFMT <0.05;
pi = 0.19), quali a i ely associa ed wi h impai ed colonic
in eg i y. In e es ingly, FMT ansplan a ion om WKY o SHR
educed plasma LPS le els despi e no signi ican inc ease in gu
in eg i y. Fu he mo e, bo h he colonic exp ession o y osine
hyd oxylase (TH) (ps ain <0.05) (Figu e 8I) and he colonic
NA concen a ion (ps ain <0.01) (Figu e 8J) we e signi ican ly
up- egula ed in bo h g oups ha ecei ed ecal con en s om
SHR. In e es ingly, he long- e m ea men wi h s ool om
WKY signi ican ly dec eased bo h TH le els (pFMT <0.01;
pi = 0.62) and NA con en (pFMT <0.01; pi <0.05) in he
S-W g oup.
DISCUSSION
Fecal ansplan a ion om animals (Adnan e al., 2017;To al
e al., 2018) and subjec s (Li e al., 2017) wi h hype ension o
no mo ensi e animals can ele a e BP. Howe e , he mechanisms
by which bac e ia con ol BP ha e no been elucida ed. Ou
esul s demons a e, o he i s ime, ha al e a ion o gu
mic obio a composi ion induced by ecip ocal FMT be ween
WKY and SHR in luences he b ain, and SNS impac ing BP.
The mos signi ican indings o his s udy a e; (1) Mic obio a
a ec s b ain PVN NADPH oxidase ac i i y, neu oin lamma ion
and sympa he ic ac i i y in bo h s ain o a s, (2) Lowe Blau ia
and Odo ibac e con en in eces is in e sely co ela ed wi h high
SBP, and (3) Loss o gu in eg i y in SHR seems o be independen
o sympa he ic one, BP, and mic obio a composi ion.
I is pe inen o no e ha ele a ed SNS ac i i y is a hallma k
o bo h animal and human hype ension (DiBona, 2013;
F on ie s in Physiology | www. on ie sin.o g 7Ma ch 2019 | Volume 10 | A icle 231
phys-10-00231 Ma ch 6, 2019 Time: 17:31 # 8
To al e al. Gu -G ain In e ac ion and Blood P essu e
FIGURE 4 | E ec s o ecal mic obio a ansplan a ion (FMT) on b ain PVN p o-in lamma o y ma ke s exp ession. mRNA le els o TNF-α(A), IL-β(B), IL-6 (C), IL-17a
(D), in e e on-γ(IFNγ)(E), IL-10 (F), C-C chemokine ligand 2 (CCL2) (G) and mac ophage ma ke CD11b (H) measu ed by RT-PCR in b ain PVN om all
expe imen al g oups. S ain ac o , FMT ac o and I in e ac ion be ween s ain and FMT ac o s. ++p<0.01, +p<0.05 and ns (no signi ican ) o he p obabili y
based on a wo-way analysis o a iance. Values a e means ±SEM (n= 5–8). ∗P<0.05 and ∗∗P<0.01 s. WKY wi h s ool ansplan om WKY (W-W); #P<0.05
s. SHR wi h s ool ansplan om SHR (S-S), s a is ical signi icance o he p obabili y based on a Sidak’s co ec ion mul iple compa isons es .
G assi e al., 2015). San is eban e al. (2017) obse ed enhanced
gu -neu onal communica ion in hype ension o igina ing
om he PVN o he hypo halamus and p esen ing as
inc eased sympa he ic d i e o he gu . P e ious s udies
ha e also cha ac e ized hype ension wi h al e a ions in he gu
mic obio a and sympa he ic dys egula ion (Zubce ic e al., 2014;
Yang e al., 2015;San is eban e al., 2017). Ou cu en s udy,
demons a ing bo h highe BP educ ions a e pen olinium
adminis a ion and plasma NA le els, bo h ma ke s o inc eased
sympa he ic d i e, associa ed wi h mic obial dysbiosis, p o ides
new e idence in suppo o ha p oposal. This highe SNS
ac i i y co ela es wi h highe SBP and DBP in he W-S g oup
compa ed o W-W. Simila ly, FMT om SHR o SHR showed
highe le els o hese sympa he ic d i e pa ame e s han ha
ound in he W-W g oup. The changes induced by FMT om
WKY o SHR and ice e sa in BP seem o be independen
o sys emic enin-angio ensin sys em, since PRA was no
signi ican ly a ec ed. Mo eo e , inc eased ca echolamine gic
neu o ansmission has been epo ed in SHR, cha ac e ized by
inc eased TH ac i i y as well as gene and p o ein exp ession
(Yu e al., 1996;Reja e al., 2002;Lopez Ve illi e al., 2009),
sugges ing ha TH plays a key ole in he genesis, de elopmen
F on ie s in Physiology | www. on ie sin.o g 8Ma ch 2019 | Volume 10 | A icle 231
phys-10-00231 Ma ch 6, 2019 Time: 17:31 # 9
To al e al. Gu -G ain In e ac ion and Blood P essu e
FIGURE 5 | E ec s o ecal mic obio a ansplan a ion (FMT) on b ain PVN SCFA-sensing ecep o s exp ession. mRNA le els o Ol 59 (A), GPR-41 and GPR-43 (B)
measu ed by RT-PCR in b ain PVN om all expe imen al g oups. S ain ac o , FMT ac o and I in e ac ion be ween s ain and FMT ac o s. ++p<0.01, +p<0.05
and ns (no signi ican ) o he p obabili y based on a wo-way analysis o a iance. Values a e means ±SEM (n= 5–8). ∗P<0.05 and ∗∗P<0.01 s. WKY wi h
s ool ansplan om WKY (W-W); #P<0.05 and ##P<0.01 s. SHR wi h s ool ansplan om SHR (S-S), s a is ical signi icance o he p obabili y based on a
Sidak’s co ec ion mul iple compa isons es .
and/o main enance o hype ension. In ag eemen wi h his
in o ma ion, ou da a showed inc eased colonic exp ession o
TH and NA con en om he S-S and W-S g oups compa ed o
W-W, showing inc eased sympa he ic ac i i y in his issue.
The gu mic obio a in luences he hos s in lamma o y
esponse (Cani e al., 2007) and in lamma ion induces
oxida i e s ess and ice e sa. In b ain, angio ensin II
ia an AT1 ecep o mechanism ac i a es he sympa he ic
ou low by s imula ion o he NADPH oxidase-dependen
ROS p oduc ion (Gao e al., 2005). In b ain om he S-S
g oup we ound inc eased NADPH oxidase ac i i y d i en-
ROS p oduc ion, exp ession o NADPH oxidase subuni s,
p o-in lamma o y cy okines (TNF-α, IL-1β, and IL-6) and
sympa he ic ac i i y, as compa ed o W-W a s. These da a
could be ela ed o highe PRA ound in he S-S g oup
as compa ed o he W-W g oup. Con e sely, FMT om
SHR o WKY also esul ed in highe PVN in lamma ion,
NADPH-oxidase ac i i y and sympa he ic ou low han induced
by FMT om WKY o WKY. Taken oge he , ou da a
sugges ha gu mic obio a is in ol ed in he egula ion o
b ain in lamma o y and oxida i e s a us, and he subsequen
sympa he ic ac i i y.
The inc eased sympa he ic ac i i y also a ec s he BM
esul ing in an inc ease in in lamma o y cells, which
mig a e o he PVN and enhance neu oin lamma ion
(San is eban e al., 2016). Acco dingly, we ound inc eased
in lamma ion in b ain PVN om he S-S and W-S g oups,
associa ed o an inc eased exp ession o CCL2, which acili a es
BM cells en e ing he b ain’s pa enchymal space; CD11b, a
mac ophage ma ke ; and IL-17a, mainly p oduced by Th17
cells, ha migh con ibu e o neu oin lamma ion. O e all, all
his da a showed a gu -b ain communica ion cha ac e ized
by inc eased p o-oxidan , p o-in lamma o y and immune
cell in il a ion p o ile in b ain PVN a e FMT om SHR o
WKY. In e es ingly, ch onic no mal mic obio a ansplan a ion
o hype ensi e a s induced a s able BP educ ion linked o
educed b ain PVN in lamma ion, NADPH oxidase ac i i y
and sympa he ic exci a ion. Taken oge he , ou p esen esul s
demons a e ha hype ension is, a leas in pa , a esul o
pa hophysiological changes in he gu mic obio a, a ec ing b ain
a eas o ca dio ascula con ol such as PVN.
The mechanisms in ol ed in he p o-hype ensi e e ec s
o gu mic obio a om SHR a e unknown. The e is g owing
e idence ha gu mic obio a has eme ged as an impo an
ac o ha can in luence he hos ’s physiology h ough bac e ial
me abolic p oduc s such as SCFAs (Pluznick e al., 2013).
Gu dysbiosis in SHR is cha ac e ized by educed ace a e-
and bu y a e-p oducing bac e ia han hei WKY no mo ensi e
coun e pa s (Yang e al., 2015). These SCFAs induced an i-
in lamma o y e ec s in he gu , media ed by GPR-43 ac i a ion
(Yang e al., 2018). SCFAs, in addi ion o p o iding ene gy o
gu epi helium and pe iphe al issues, also p omo e in es inal
epi helial in eg i y and aid in he epai o wounded epi helium,
mainly h ough GPR-43 ac i a ion (D’Souza e al., 2017). We can
hypo hesize ha insu icien signaling h ough SCFAs-ac i a ed
GPR-43 pa hway in he gu , media ed by bo h lowe SCFAs-
p oducing bac e ia and lowe colonic GPR-43 exp ession in
SHR, can lead o comp omised gu in eg i y, dys egula ed
in lamma ion, and passage o subs ances such as LPS in o he
blood. The inc ease in BP in SHR was associa ed wi h gu
pa hology ha included inc eased in es inal pe meabili y and
dec eased igh junc ion p o eins (San is eban e al., 2017). We
analyzed he in eg i y o he gu epi helial ba ie measu ing
he mRNA le els o igh junc ion p o eins and mucins, which
a e in ol ed in mucus p oduc ion, in he p oximal colon.
We ound ha FMT om SHR o WKY signi ican ly educed
colonic ZO-1 and MUC-2, inc eased colonic TNF-αand plasma
le els o LPS. LPS migh be in ol ed in he pa hogenesis o
hype ension, h ough oll-like ecep o (TLR)-4 s imula ion in
he ascula u e (Liang e al., 2013), and by inducing sys emic
in lamma ion, accompanied by mic oglia ac i a ion, oxida i e
s ess in ca dio ascula egions o he b ain, such as os al
en ola e al medulla (Wu e al., 2012) and PVN (Zhang e al.,
2010). Howe e , high le els o plasma ic LPS, as a consequence
o an in ec ion, can lead o sep ic shock and hypo ension
(Be mejo e al., 2003).
F on ie s in Physiology | www. on ie sin.o g 9Ma ch 2019 | Volume 10 | A icle 231