scieee AI-readable full text Open interactive document viewer

The L1Tc non-LTR retrotransposon of Trypanosoma cruzi contains an internal RNA-pol II-dependent promoter that strongly activates gene transcription and generates unspliced transcripts

Rodríguez Heras, Sara

Abstract

This work was supported by BMC2003–00834 from Plan Nacional IþDþI (MEC, Spain) and PAI ref. P05-CVI-01227 (Junta de Andalucı´a, Spain). S.R.H. was supported by a MEC Predoctoral Fellowship, Spain. Funding to pay the Open Access publication charge was provided by PAI CVI-155 (Junta de Andalucia, Spain).

Full text

Nucleic Acids Research, 2007, 1–16 doi:10.1093/nar/gkl1137 The L1Tc non-LTR retrotransposon of Trypanosoma cruzi contains an internal RNA-pol II-dependent promoter that strongly activates gene transcription and generates unspliced transcripts Sara R. Heras, Manuel C. Lo ´pez*, Mo ´nica Olivares 1 and M. Carmen Thomas* Departamento de Biologı ´a Molecular, Instituto de Parasitologı ´a y Biomedicina ‘Lo ´pez Neyra’, CSIC, 18001 Granada, Spain Received August 30, 2006; Revised December 7, 2006; Accepted December 14, 2006 ABSTRACT L1Tc is the best represented autonomous LINE of the Trypanosoma cruzi genome, throughout which several functional copies may exist. In this study, we show that the first 77 bp of L1Tc (Pr77) (also present in the T. cruzi non-autonomous retrotransposon NARTc, in the Trypanosoma brucei RIME/ingi elements, and in the T. cruzi,T. brucei and Leishmania major degenerate L1Tc/ingi-related elements [DIREs]) behave as a promoter element that activates gene transcription. The transcription rate promoted by Pr77 is 10–14-fold higher than that mediated by sequences located upstream from the T. cruzi tandemly repeated genes KMP11 and the GAPDH. The Pr77 promoter-derived mRNAs initiate at nucleotide þ1 of L1Tc, are unspliced and translated. L1Tc transcripts show a moderate half life and are RNA pol II dependent. The presence of an internal promoter at the 50end of L1Tc favors the production of full-length L1Tc RNAs and reinforces the hypothesis that this mobile element may be naturally autonomous in its transposition. INTRODUCTION Trypanosoma cruzi is the etiological agent of Chagas’ disease, which affects between 16 and 18 million people, primarily in Central and South America (1). Apart from its impact on human health, the T. cruzi parasite has been extensively studied because of the interesting molecular characteristics shown by the members of the Trypanosomatidae. It is known that the transcription of protein-coding genes and mRNA maturation processes in this parasite involve mechanisms that are distinct from those in most higher eukaryotes. In fact, most trypanosome mRNAs are synthesized as polycistronic precursors, and mature mRNAs are generated by transsplicing and polyadenylation. The trans-splicing process implies joining two separate RNA precursor transcripts (2). Consequently, mature mRNAs possess a common capped (cap4) 39-nt non-coding mini-exon sequence (called the splice leader sequence [SL]) at the 50end. Polyadenylation is coupled to downstream trans-splicing (3,4). It has also been reported that at least 50% of the T. cruzi genome consists of repeated sequences, such as retrotransposons and gene families of surface proteins. These repeated sequences have been correlated with the significant genomic polymorphism and the high degree of plasticity this parasite shows (5,6). The retrotransposons (both the LTR-retrotransposons and non-LTR retrotransposons) possessed by this parasite may be involved in the generation and maintenance of tandem gene structures as well as in the regulation of gene expression (7). The non-LTR retrotransposons (SINE and LINE) are interspersed replicating elements found in almost all eukaryotes (8). These retroelements are flanked by a variable length target site duplication sequence, are polyadenylated, and lack the long terminal repeat (LTR) observed in retrovirus and LTR-retrotransposons. LINE elements encode the enzymes involved in their own transposition, whereas the non-coding SINE transcripts are recognized by the LINE retrotransposition machinery and mobilized by the LINE-encoded proteins (8–10). The mobilization of non-LTR retrotransposon elements occurs by a mechanism termed target-primed reverse transcription (TPRT), in which the RNA encoded by the element is reverse transcribed. The newly synthesized DNA copy is integrated at a new site in the *To whom correspondence should be addressed. Tel: þ34 958 181 662; Fax: þ34 958 181 632; Email: [email protected] Correspondence may also be addressed to M. Carmen Thomas. Tel: þ34 958 181 662; Fax: þ34 958 181; Email: [email protected] 1 Present address: PulevaBiotech, Camino Purchil 66, 18004 Granada, Spain ß2007 The Author(s). This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Nucleic Acids Research Advance Access published March 16, 2007 genome (11). Retrovirus and LTR-retrotransposons use long terminal repeats to synthesize complete cDNAs which maintain their promoters (12). However, non-LTR retrotransposons do not possess LTRs. Since the initial step in the LINE self-retrotransposition process requires transcription of the full length of the element to guarantee a transcriptionally competent (and autonomous) new version, it has been proposed that these elements ought to contain an internal promoter. To date, the type of RNA polymerase that participates in the transcription of LINEs has not been clearly identified, although both RNA polymerases II and III have been implicated in the transcription of human LINE-L1, and recent data strongly suggest that L1 transcription is mediated by the former (13). L1Tc is the best represented LINE in T. cruzi, and it has been found in most, if not all, of the chromosomes of the T. cruzi strains analyzed to date. It is actively transcribed in all three stages of the parasite’s life cycle (14). At least 15 theoretically retrocompetent L1Tc elements have been identified in the T. cruzi genome (5). L1Tc has been reported as being associated with a gene coding for a transporter protein belonging to the ABC family (15), as being integrated into the coding sequence of the DNAj gene endowed with chaperone activity (16), as present in the expressed RHS multigene family located in a subtelomeric region, and as associated with SINE-like sequences (17–19). It codes for all the enzyme machinery involved in its retrotransposition, including AP endonuclease (20), 30phosphatase, 30phosphodiesterase (21), reverse transcriptase (22), RNAse H (23) and a nucleic acid chaperone (24). The absence of reports on the presence of promoters in genes encoding proteins in the T. cruzi genome, together with the significant role of active LINE elements, raises the question of how the transcription of L1Tc occurs. In the present work we show that the first 77 base pairs of L1Tc, which are identical to the first 77 bp of NARTc (a highly represented non-autonomous retrotransposon of the T. cruzi genome) (25), drive the expression of a downstream gene (CAT), and that transcription initiates at nucleotide þ1. Interestingly, the transcripts produced are unspliced, indicating that a full-length RNA is generated. Similar results were observed after analysis of the expression of the endogenous L1Tc transcripts. The results shown are consistent with the existence of an internal promoter in the L1Tc element. Via run-on experiments, the L1Tc promoter was shown to be RNA pol II dependent. MATERIALS AND METHODS Oligonucleotides 50R77 (50GCATAGATATCCCTGGCTGAG 30) [sense, L1Tc 1–11] 30R77 (50GCATTAAGCTTCAGCAGGCGC 30) [antisense, L1Tc 68–77] CAT1sense (50CCCGCCTGATGAATGCTC 30) [sense, 191–208 from the CAT start codon] CAT1 (50GAGCATTCATCAGGCGGG 30) [antisense, 191–208 from the CAT start codon] CAT2 (50CTGAGACGAAAAACAT 30) [antisense, 424–439 from the CAT start codon] SLTc (50CGCTATTATTGATACAGTTTCTG 30) [sense, 8-30 from the T. cruzi splice leader sequence] L1Tc239 (50ACATACGGCACGCAAACGG 30) [antisense, L1Tc 221–239] L1Tc152 (50TGTAAATGGCTCCATCT 30) [antisense, L1Tc 136–152] L1Tc22 (50GCTCAGCCGGCCACCTC 30) [sense, L1Tc 6–22] kmp182 (50TTGTCGGTGTGCTCCTGAATC 30) [antisense, 162–182 from the KMP11 start codon] kmp21 (50TTCCTCAAGAGTGGTGGC 30) [antisense, 4–21 from the KMP11 start codon] CAT90 (50TTGAGCAACTGACTGAAATG 30) [antisense, 71–90 from the CAT start codon] SK (50CGCTCTAGAACTAGTGGATC 30) CAT-32f (50CGACGAGATTTTCAGGAG 30) [sense, 32 to 15 from the CAT start codon] CAT43r (50GGGATATATCAACGGTGGTA 30) [antisense, 24–43 from the CAT start codon] R77 (50CCCTGGCTCAGCCGGCCACCTCAACGT GGTGCCAGGGTCTAGTACTCTTT GCTAGAGAGGAAGCTAAGCGCCTGCTG 30) MCS (50CGACGGTATCGATAAGC 30) [antisense, 3–19 downstream Pr77 in the pTEX()pR77CAT vector; 3–19 downstream 50UTRKMP11 region in the pTEX()p50KMP11CAT vector] L1Tc70 (50CGCTTAGCTTCCTCTCTAGC 30) [antisense, L1Tc 51–70] The EcoRV and Hind III restriction sites are underlined. The gene name and position to which the primers map in each case are indicated in brackets. Plasmid constructs The chloramphenicol acetyltransferase coding gene (CAT) was excised from the pMSGCAT vector (Pharmacia) by SalI digestion and cloned into a SalI-digested pTEX expression vector (26) to produce the pTEXCAT clone. The 50upstream region of the gGAPDH I gene (p) was removed from this vector by digestion with SacI and BamHI enzymes, and subjected to Klenow treatment and religation to generate the pTEX()pCAT plasmid. The 77 nucleotides located at the L1Tc 50end were amplified by PCR using pSPFM55 (accession number X83098 in the GenBank database) (14) as a template, and the 50R77 and 30R77 primers. These include the EcoRV and HindIII restriction sites, respectively. The amplified fragment was digested with EcoRV and HindIII and directly cloned into pTEX()pCAT digested with the same enzymes to produce pTEX()pR77CAT. The 50upstream sequence from the T. cruzi KMP11 locus (nucleotides 576 to þ37 from the first ATG) was excised from the PS1 clone (accession number AF167435 in the GenBank database) (27) by Klenow-treated-SalI digestion and HindIII digestion, and cloned into an EcoRV and HindIIIdigested pTEX()pCAT vector to produce the 2Nucleic Acids Research, 2007 pTEX()p50KMP11CAT transfection vector. Correct cloning was confirmed in all cases by DNA sequencing. Epimastigote culture and transfection procedure Y strain T. cruzi epimastigotes were grown at 288C in liver infusion tryptone (LIT) medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum (Flow Lab., Irvine, UK). Plasmid DNAs from the pTEX() pR77CAT, pTEX()p50KMP11CAT, pTEX()pCAT and pTEXCAT vectors were purified using the Wizard Plus Maxipreps kit (Promega). Transfection was performed with 100 mg of each vector as previously described (28). The transfectants were selected in the presence of 100 mg/ml of G418. To increase the plasmid copy number, the G418 concentration was increased up to 250 and 500 mg/ml. Northern, Southern and DNA dot blotting The cytoplasmic RNA from T. cruzi transfectants was purified as previously described (29). DNA from transformed and non-transformed parasites was isolated by standard methods (30). Cytoplasmic RNA (5 mg) was size fractionated on 1% agarose/formaldehyde gels. Genomic DNA (2 mg) was HindIII-digested and resolved on 0.8% agarose gels. Both RNA and DNA were transferred to Z-probe membranes (Bio-Rad) using a 10 SSC solution. Hybridization was performed using the method of Thomas et al. (27). The probes used were a Sal/Sal fragment from the pMSGCAT vector (Pharmacia) corresponding to the CAT coding sequence, a DNA fragment coding for the T. cruzi 18S small RNA subunit (18S) (31), and a 273-nt DNA fragment corresponding to the T. cruzi KMP11 coding sequence (27). The hybridization products were visualized and quantified using a phosphorimager (Storm, Pharmacia). All analyses were performed using the ImageQuant program (Molecular Dynamics). The local background (PSL-BG) was subtracted from the photo-stimulated luminescence (PSL) to obtain PSL corr . The transcription efficiency was calculated as: ½CAT RNAPSLcorr=½R18S RNAPSLcorr ½CAT DNAPSLcorr=½KMP11 DNAPSLcorr The total RNA and poly(A) þ RNA fractions from 15 10 7 transfectants were isolated and purified using, respectively, the total RNA Mini Kit (Bio-Rad) and the QuickPrep micro mRNA Purification Kit (Amersham Biosciences). Total and polyadenylated RNA (7 and 1 mg respectively) samples were loaded onto 1% agarose/ formaldehyde gels and transferred to Z-Probe nylon membranes (Biorad) (three replicates). One membrane was hybridized under the conditions described above using the CAT-coding region sequence as probe. The other two were hybridized for 2 h in 6 SCC, 0.1% SDS (w/v), 100 mM Tris HCl, pH ¼8 buffer and 100 mg/ml herring sperm DNA at 538C with radiolabeled CAT antisense and CAT sense primers (CAT1 and CAT1sense respectively). These primers have complementary sequences, were used at the same concentration, and showed the same specific activity. Post-hybridization washes were performed in hybridization buffer at 488C. The CAT probe was radiolabeled using [a32 P]-dCTP and the Random Prime Labelling System (Amersham Biosciences). The antisense CAT1 and sense CAT1 oligonucleotides were 50end-labeled with [g32 P]-dATP as described in Heras et al. (24). The hybridization products were visualized using a phosphorimager and quantified using the ImageQuant program as described above. The ability of each radiolabeled oligonucleotide to detect a similar amount of a complementary DNA was determined by DNA dot blotting. Three-fold dilutions of the pTEXCAT vector (from 196 to 2.4 ng) and of the antisense CAT1 or CAT1sense oligonucleotides (from 196 to 0.8 ng) were denatured by treatment with 0.4 N NaOH and 10 mM EDTA for 10 min at 958C or 10 min at 658C respectively, and loaded onto Zeta-Probe Blotting Membranes (Biorad) using a Millipore dot blot manifold. Filters were hybridized with the radiolabeled antisense and sense CAT1 oligonucleotides as described above. The membranes were also visualized using a phosphorimager and quantified using the ImageQuant program as above. RT-PCR To analyze the 50end of the CAT mRNAs, 0.8 mg of poly(A) þ RNA from pTEXCAT-, pTEX() p50KMP11CATand pTEX()pR77CAT-transformed parasites were reverse transcribed using the CAT2 primer and the ThermoScript RT-PCR System (Invitrogen, California) according to the manufacturer’s instructions. PCR was performed using the Expand High Fidelity PCR System (Roche) and employing 2 ml of the synthesized cDNA as the template DNA along with the SLTc and CAT1 primers. The synthesized cDNA from pTEX() pR77CAT transfectants was also PCR amplified using 50R77 and CAT1 primers as a positive control. As a negative control, the product from a parallel reaction without the reverse transcriptase was used. The reaction conditions were 10 cycles at 948C for 30 s, 388C for 1 min and 728C for 1 min, and 25 cycles at 948C for 30 s, 568C for 1 min, and 728C for 1 min. To analyze the 50end of the L1Tc mRNAs (Figure 7), 0.6 mg of RQ1 RNAase-free DNAse-treated cytoplasmic RNA from epimastigotes were reverse transcribed using the L1Tc239 primer. PCR was performed employing the above-mentioned synthesized cDNA as the DNA template and SLTc and L1Tc152 as primers. PCR was also performed with L1Tc22 and L1Tc152 primers or without reverse transcriptase as RT-PCR positive and negative controls respectively. Trans-spliced KMP11 transcripts were also reverse transcribed using the kmp182 oligonucleotide, and PCR performed using the SLTc and kmp21 primers as a control of RNA integrity and proper sample processing. The PCR reaction conditions were 35 cycles of 948C for 30 s, 508C for 30 s, and 728C for 1 min. All the amplified products were cloned into the pGEM TÕ-easy vector (Promega) and sequenced. Nucleic Acids Research, 2007 3 T.cruzi soluble protein extraction and western blotting Soluble proteins were extracted from parasites in the logarithmic phase of growth. The protein concentration was determined by the standard method described by Heras et al. [43]. Briefly, parasites were recovered by centrifugation at 2500 rpm for 30 min, washed in 1 PBS, and resuspended in lysis buffer (50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 0.05% NP-40 supplemented with protease inhibitors, 1 mg/ml leupeptin, 0.7 mg/ml pepstatin and 1 mM PMSF). Total extracts were sonicated for 45 s. The soluble fraction proteins were recovered by centrifugation at 10 000 rpm for 20 min. Soluble proteins (30 mg) were separated by 12% SDS-PAGE and transferred to PVDF membranes (Millipore) using the Miniprotean system (Bio-Rad). Western blots were performed according to standard techniques, employing antichloramphenicol acetyl transferase antibodies (Sigma) at a dilution of 1:1000 and anti-rabbit IgG peroxidase conjugate (Sigma) at a dilution of 1:5000. The blots were subjected to peroxidase and luminol/enhancer solutions using the SuperSignalÕWest Pico Chemiluminescent Reagent kit (Sigma), and subsequently exposed to Kodak X-Omat autoradiographic film. RNA ligase-mediated amplification of the cDNA ends To characterize the 50end of the T. cruzi L1Tc transcripts, cytoplasmic RNAs from the T. cruzi pTEX()pR77CAT and pTEX()p50KMP11CAT transfectants were treated with several enzymes to guarantee their monophosphate state and consequently their capacity to bind to a RNA linker. A method similar to that described by Bruderer (32) was employed. Briefly, 15 mg of cytoplasmic RNA from each transfectant were treated with 20U of RQ1 RNAase-free DNAse (Promega) in a final volume of 200 ml. The RNA was subsequently decapped, dephosphorylated and then phosphorylated by treatment with tobacco acid pyrophosphatase (TAP) (Epicentre), alkaline phosphatase (AP) (Roche) and T4 polynucleotide kinase (PNK) (Biolabs) respectively. An RNA linker derived from the EcoRI-digested pBluescripts KSþ plasmid (Stratagene) was synthesized in vitro as described by Heras et al. (24) and ligated to the previously generated monophosphate transcripts using T4 RNA ligase (Roche) following the method described by Bruderer (32). cDNA was synthesized using the CAT1 primer and employed as a template in PCR using SK and CAT90 as primers. Crude PCR products were directly cloned into the pGEM-TÕeasy vector (Promega). Selection was performed after IPTG-X-gal induction by blue/ white screening. White colonies were numbered and grown in triplicate on LB-agar plates and transferred to nitrocellulose membranes. One membrane was hybridized in situ with the CAT coding fragment obtained by PCR using CAT-32f and CAT43r as primers and the pMSGCAT vector as a template. It was then labeled using a random prime kit (Amersham). Two other membranes were in situ hybridized with the SLTc and R77 primers labeled at the 50end. Probe labeling and hybridization were performed as described above. Primer extension analysis About 10 mg of RNase-free DNase I cytoplasmic RNA or 1 mg of poly(A) þ RNA from transformed and non-transfected T. cruzi parasites were extended using an MCS primer (complementary to the multi-cloning region located between the Pr77 or 50UTRKMP11 region and the CAT sequence in the pTEX()pR77CAT and pTEX()p50KMP11CAT vectors respectively), the L1Tc70 or L1Tc152 primers (complementary primers to L1Tc mRNA), and the RT from the avian myeloblastosis virus, as described by Teran et al. (33). Primers were 50end labeled with [g32 P]ATP and T4 polynucleotide kinase. Reactions were resolved in urea–6.5% polyacrylamide sequencing gels. Treatment of parasites with actinomycin D RNA synthesis was inhibited by treating the parasites with actinomycin D as previously described (27). Cytoplasmic RNA was determined by northern blotting. The region between nucleotides 1844 and 3737 of L1Tc (accession code X83098) was employed as a probe. The abundance of the L1Tc mRNAs was standardized relative to the abundance of the T. cruzi KMP11 and ribosomal S6 subunits. All probes were radiolabeled using [a32 P]- dCTP, employing the Random Prime Labelling System (Amersham Biosciences). Nuclear run-on transcription assay Nuclei were isolated and purified from T. cruzi epimastigotes in the logarithmic growth phase and incubated with 83 mM of tagetitoxin (Tagetin TM , Epicenter Biotechnologies), 25 mg/ml of a-amanitin (Sigma) or 0.2% N-lauryl sarcosine (sarkosyl; Sigma) for 30 min at 48C. Nuclear run-on transcription reactions were performed using isolated nuclei, as described by Maran ˜o ´net al. (31). The labeled nascent RNA was hybridized to 3 mg of linearized DNAs (see Figure 9 for details) adsorbed onto Z-probe membranes (Biorad). The hybridization conditions and post-hybridization wash conditions were those as described earlier (29). RESULTS The 77 nucleotides at the 50end of L1Tc activate transcription of a reporter gene While the first 77 bp of the T. cruzi L1Tc (autonomous LINE) and NARTc (non-autonomous retrotransposon) elements are 100% identical, the rest of the L1Tc and NARTc sequences share only 54% similarity (25). To test the ability of Pr77 to induce gene transcription, the pTEX()pR77CAT vector was generated (Figure 1). Several constructs were also produced to allow comparative analyses of CAT transcription. Vectors containing the CAT gene cloned at the pTEX expression site (pTEXCAT vector), and into the pTEX vector lacking the 50UTR of the gGADPH I gene (p) (pTEX()pCAT vector), were used as controls. The sequence located at the 50end of the T. cruzi KMP11 locus was also tested and cloned upstream of the CAT gene to generate 4Nucleic Acids Research, 2007 the pTEX()p50KMP11CAT transfection vector. T. cruzi (Y strain) epimastigotes were electroporated with either pTEXCAT, pTEX()pCAT, pTEX()pR77CAT or pTEX()p50KMP11CAT vectors. Figure 2A shows the CAT cytoplasmic RNA level of each transfectant as determined by northern-blot analysis using the 32 P-labeled CAT coding-region as a probe. A hybridization band showing the expected size of the CAT mRNA, roughly 1200 nt, was detected in pTEXCAT-, pTEX() p50KMP11CATand pTEX()pR77CAT-transformed parasites. However, no CAT hybridization band was detected in pTEX()pCAT transfectants (Figure 2A). As shown in Figure 2A, the CAT expression level was significantly higher in pTEX()pR77CAT-transformed parasites than in pTEXCAT or pTEX()p50KMP11CAT transfectants. The relative plasmid copy number present in each transfectant was determined in the same parasites used for RNA isolation and northern blot analysis to avoid differences in the quantity of transfection vectors, which could have influenced the CAT transcription level. For this purpose, total DNA from the same amount of each transfectant was purified and digested with HindIII. The DNA was analyzed by Southern blotting using radiolabeled CAT and KMP11 coding sequences as probes (Figure 2B). Quantification of the hybridization bands showed the differences in the level of the CAT transcripts not to be a consequence of differences in the transfectant plasmid load (Figure 2A and B). Figure 2C shows that level of CAT mRNAs to be between 10-and 14-fold higher in pTEX()pR77CAT transfectants than in the pTEXCATand pTEX()p50KMP11CAT-transfected parasites respectively. This suggests that the Pr77 sequence actively induces the transcription of a reporter gene, producing a larger quantity of gene transcripts than that induced by other sequences that also activate transcription. To confirm that the detected CAT RNAs in the pTEX()pR77CAT-transfected parasites were driven by the Pr77 region and not by the gGAPDH intergenic region downstream of the CAT gene and upstream of the NEO gene in the pTEX vector, the presence of CAT transcripts from coding and non-coding strands was determined by northern blotting. Total RNA from pTEX()pR77CAT transfectants was separately hybridized with a pair of 50end-labeled complementary oligonucleotides, the antisense CAT1 and CAT1sense probes (Figure 3B and C). The same amount of RNA was hybridized with radiolabeled dsDNA corresponding to the CAT gene coding sequence (Figure 3A). In the membranes hybridized using dsDNA CAT and the antisense CAT1 primer as probes, a single hybridization band of a size compatible with that expected for CAT mRNA, and with approximately the same intensity, was observed (Figure 3A and B). However, no band was detected in the membrane hybridized with the CAT1sense probe (Figure 3C). 5′UTRKMP11 ... neo ... ... R77 neo ... pTEX(−)pR77CAT pTEX(−)p5′KMP11CAT () KMP11 locus n3 AG pTEXCAT ...... neo AG pTEX ... 5UTRgGAPDH ... neo AG a b cd CAT CAT ... neo pTEX(−)pCAT ... CAT CAT 178 250 252239 4866 4879 100% 54% 85 % L1Tc NARTc Figure 1. Diagrammatic illustration of the pTEXCAT, pTEX()pCAT, pTEX()pR77CAT and pTEX()p50KMP11CAT transfection vectors. (a) The chloramphenicol acetyltransferase coding gene (CAT) was cloned into the pTEX expression vector (26) to produce the pTEXCAT clone. (b) The pTEX()pCAT vector was generated by deleting the promoter region (the 50untranslated region of the GAPDH gene) from the pTEXCAT plasmid. (c) Pr77 was amplified from L1Tc and cloned at the 50end of the CAT gene in the pTEX()pCAT vector to produce the pTEX()pR77CAT clone. (d) The 50UTR region from the KMP11 gene tandem repeat was also inserted at the 50end of the CAT gene generating the pTEX()p50KMP11CAT transfection vector. The central part of the figure shows the T. cruzi L1Tc (ACC: AF208537) and NARTc (ACC: AF215898) retroelements. The L1Tc represented is formed by a single long ORF (gray box) and is flanked by untranslated regions (striped boxes). The first 77 bp of L1Tc (Pr77), which are 100% identical to the first 77 bp of NARTc retrotransposons, are indicated by a white box. The regions from NARTc that, respectively, share 54% similarity and 85% homology to L1Tc, are also indicated. The four tandemly repeated copies of KMP11 gene are represented as light gray boxes and the 50UTR region cloned as a white box. Nucleic Acids Research, 2007 5 A similar result was obtained when the RNA from pTEX()p50KMP11CATand pTEXCAT -transfected parasites was hybridized with the dsDNA CAT probe and with the CAT1 antisense and sense probes (Figure 3A–C). The ability of both radiolabeled oligonucleotides to detect similar amounts of the complementary DNA strand under the experimental conditions employed was corroborated by dot-blotting. Thus, serial dilutions of the pTEXCAT vector DNA and of the antisense CAT1 or CAT1sense oligos were made, and all these DNAs fixed onto the membrane. As shown in Figure 3D and E, both probes showed the same capacity to hybridize with CAT DNA; hybridization dots of the same intensity were obtained with each. Similar results were obtained when poly(A) þ RNA from the transfected parasites was used in northern blot analyses (data non shown). Thus, the results suggest that all the detected CAT transcripts corresponded solely to the transcription of the sense CAT strand. The unspliced Pr77-derived transcripts are translated We next examined whether the CAT transcripts derived from the Pr77 promoter in the pTEX()pR77CAT transfectants lacked the splice leader sequence, and also whether they contained the Pr77 sequence. RT-PCR C 0 10000 20000 30000 40000 50000 60000 pTEX(−)p5′KMP11 pTEX(−)pCAT pTEXCAT Photo-stimulated luminescence A 18S pTEX(−)p5′KMP11CAT pTEX(−)pR77CAT pTEXCAT pTEX(−)pCAT 2.40 2.03 1.66 1.20 MW(kb) pTEX(−)pR77 B pTEX(−)p5′KMP11CAT pTEX(−)pR77CAT pTEXCAT pTEX(−)pCAT MW(bp) 23130 9416 6557 4361 2322 2027 504 KMP11 gen Yc Figure 2. Abundance of CAT transcripts in T. cruzi transfectants. (A) northern blot analysis of CAT transcripts from T. cruzi transfectants. 5mg of cytoplasmic RNA from parasites transfected with pTEX()p50KMP11CAT, pTEX()pR77CAT, pTEX()pCAT and pTEXCAT were resolved on 1% agarose-formaldehyde gels and immobilized on a quaternary amine-derived nylon membrane. The filter was hybridized with the radiolabeled CAT coding region as a probe. After phosphorimage analysis, the filter was rehybridized with T. cruzi 18S rDNA (18S) (31). The size of the hybridization bands is indicated in kb (MW). (B) Southern blot analysis of HindIII-digested genomic DNA from non-transformed parasites (Yc) and parasites transfected with pTEX()p50KMP11CAT, pTEX()pR77CAT, pTEX()pCAT and pTEXCAT vectors. Radiolabeled DNA corresponding to the CAT coding region was used as a probe. After phosphorimage analysis, the filter was rehybridized with the radiolabeled coding sequence of KMP11 as a probe. The 0.6-kb hybridization band corresponding to the KMP11 gene is shown at the bottom of the figure. MW, molecular weight markers in bp. (C) Quantification of CAT RNA in T. cruzi transfectants. Photo-stimulated luminescence was determined using phosphorimaging employing ImageQuant software (Molecular Dynamics). 6Nucleic Acids Research, 2007 using the purified poly(A) þ RNA fraction from the pTEX()pR77CAT, pTEXCAT and pTEX() p50KMP11CAT transfectants was performed as described in the Materials and Methods section (see diagram in Figure 4A). As shown in Figure 4B, an amplification band of the expected size was observed when the pTEXCAT and pTEX()p50KMP11CAT transfectants were used (Figure 4B). Cloning and sequencing of the amplified bands showed that CAT transcripts contained, respectively, the SL sequence at the KMP11 and the GADPH splicing acceptor sites as described earlier (27,34). However, when poly(A) þ RNA from pTEX() pR77CAT transfectants was employed, no band was amplified with the SLTc and CAT1 primers despite the fact that the amount of CAT mRNA was sufficient for reverse transcription and subsequent PCR-amplification using primer mapping at the 50end of the Pr77 sequence (50R77) and the CAT1 oligo (Figure 4B (Cþ)). The next question to be answered was whether the unspliced Pr77-derived CAT transcripts were able to be translated. To answer this, total protein extracts were purified from the transfectants and analyzed by western blotting employing an anti-CAT antibody. As shown in Figure 4C, this antibody recognized a 26 kDa protein in the pTEX()pR77CAT and pTEXCAT parasites. However, no CAT protein was detected either in the pTEX()pCAT transfectants or in the wild type parasites (Figure 4C). The CAT expression level was significantly higher in the parasites that contained a spliced messenger (pTEXCAT transfectants) than in those that had unspliced CAT transcripts (the pTEX()pR77CAT transfectants). 2.40 2.03 1.66 1.20 pTEX(−)p5′KMP11CAT pTEX(−)pR77CAT pTEXCAT pTEX(−)pCAT pTEX(−)p5´KMP11CAT pTEX(−)pR77CAT pTEXCAT pTEX(−)pCAT pTEX(−)p5′KMP11CAT pTEX(−)pR77CAT pTEXCAT pTEX(−)pCAT dsDNA CAT probe antisense CAT1 probe CAT1sense oligo ABC D E pTEXCAT TEXCAT sense CAT1 probe sense CAT1 p robe MW(kb) antisense CAT1 probe CAT1 oligo [nucleic acids] [nucleic acids] Immobilized nucleic acid Figure 3. Analysis of activation of sense and antisense transcription of CAT in T. cruzi transfectants. (A–C) Detection of sense and antisense CAT RNA by northern blot analysis. 7 mg of total RNA from parasites transfected with pTEX()pCAT, pTEX()p50KMP11CAT, pTEXCAT and pTEX()pR77CAT vectors were loaded in triplicate and size-fractioned on 1% agarose/formaldehyde gels and subsequently immobilized on nylon membranes. Each membrane was hybridized with the radiolabeled CAT coding sequence (dsDNA CAT probe) (A), a 50end labeled antisense CAT oligo mapping at position 191–208 from the CAT start codon (antisense CAT1 probe) (B), and a 50end radiolabeled sense CAT oligo (CAT1sense probe) mapping at position 191–208 from the CAT start codon (C) as probes. The size of the hybridization bands is indicated in kb (MW). (D and E) Hybridization of sense and antisense CAT1 primers to the CAT sequence. Three-fold dilutions, from 196 ng to 2.4 ng for the pTEXCAT vector, and from 196 ng to 0.8 ng for the CAT1sense (D) or antisense CAT1 (E) oligos, were denatured and fixed on Zeta-Probe Blotting Membranes. The DNA filters were hybridized with 50end labeled antisense CAT1 oligo (D) or 50end labeled CAT1sense oligo (E) as probes. Nucleic Acids Research, 2007 7 To further corroborate that the Pr77-derived CAT transcripts from pTEX()pR77CAT transfectants were unspliced, the approach outlined in Figure 5A was followed. Accordingly, an RNA linker was ligated to the cytoplasmic RNA of the pTEX()pR77CAT transfectants. The RNA 50ends were reverse transcribed, PCR amplified, and then cloned into the pGEM vector. RNA isolated from the pTEX()p50KMP11CAT transfectants was employed as a positive control. Screening was then performed by hybridizing to the CAT, R77 and SLTc probes. Interestingly, no hybridization with the SLTc probe was seen for any clone derived from the pTEX()pR77CAT transfectants. Ten colonies showing positive hybridization with either the R77 probe (the pTEX()pR77CAT transfectants) or the SL probe (the pTEX()p50KMP11CAT transfectants) were AB MW bp 900 692 501/489 404 320 242 pTEX(−)p5′KMP11CAT pTEXCAT pTEX(−)pR77CAT C+ C− 1114 pTEXCAT +500G418 pTEX(−)pR77CAT +500G418 T. cruziY strain (C−) pTEX(−)pR77CAT +250G418 pTEX(−)pCAT +250G418 pTEX(−)pCAT +500G418 Mk (kDa) 75 50 150 100 37 25 20 15 C (A)n mRNA SLTc (A)n reverse transcription PCR amplification sequencing and identification CAT2 CAT1 Figure 4. Detection of the splice leader sequence at the 50end of CAT transcripts in T. cruzi transfectants. (A) Diagram of reverse transcriptase-PCR assay. Poly(A) þ RNAs purified from pTEX()pR77CAT, pTEXCAT and pTEX()p50KMP11CAT transfectants were employed as templates for reverse transcription of CAT mRNAs using a CAT antisense primer that maps at position 424–439 from the CAT start codon (CAT2 oligo). PCR was subsequently performed using the SLTc primer and the CAT1 oligo which maps at position 191–208 from the CAT start codon. The amplified products were sequenced. (B) Ethidium bromide staining of amplicons derived from CAT transcripts. Amplification products were resolved in 2% agarose gel. The poly(A) þ RNA purified fractions from pTEX()pR77CAT, pTEXCAT and pTEX()p50KMP11CAT transformants employed as templates for reverse transcription are indicated. As a positive control, the cDNA synthesized employing the CAT2 primer and polyadenylated RNA from pTEX()pR77CAT transfectants was PCR-amplified using 50R77 as a forward primer mapping at position 1–11 from L1Tc, and the CAT1 oligo (Cþ). The sample with no reverse transcriptase was used as a negative control (C). (MW): molecular weight marker in kb. (C) Analysis of CAT expression in T. cruzi transfectants. Expression of the CAT gene was detected by western blot analysis employing 30 mg of total soluble proteins from T. cruzi transfectants (pTEX()pCAT, pTEX()pR77CAT, grown in 250 and 500 m/ml of G418, and pTEXCAT, grown in 500 mg/ml G418) and non-transfected parasites. Anti-chloramphenicol acetyl transferase antibodies were used (Sigma) in all cases. The molecular weight marker (kDa) is shown at the right side of the figure. The arrow indicates the 26 kDa CAT protein. 8Nucleic Acids Research, 2007 TAP mGppp 3′ 3′ ppp 3′ OH 3′ p p3′ 3′ ppp 3′OH 3′ p AP 3′ 3′ 3′ OH 3′ OH OH OH PNK 3′ 3′ 3′ 3′p p p p 3′ OH T4 RNA ligase RNA linker Cytoplasmic RNA of T. cruzi transfected with pT EX(−)pR77CAT and pTEX(−)p5′KMP11CAT A BSequence of the 5′ end of CAT transcripts in: (b) pTEX(−)pR77CAT transfectants RT PC R screening by hybridization with dsDNACAT probe cloning of the PCR amplified products screening by hybridization with R77 and SLTcoligos 3′ 3′ sequencing of clones with positive hybridization CAT1 SK primer CAT190 amplified product (a) pTEX(−)p5′KMP11CAT transfectants ..AACGC TATTATTGAT ACAGTTTCTG TACTATATT GTTTAACACGCTCA... (2) (1) (2) (4) (1) RNA linker SL 5′UTRKMP11/CAT +5 +8 +10 +14 +21 ..TTGCTAGAGAGGAAGCTAAGCGCCTGCTGAAGCTTATC... (3) (2)(3) (2) RNA linker Pr77 MCS/CAT +48 +53 +67 +68 Figure 5. Analysis of the 50end of CAT mRNAs derived from the 50UTRKPM11 region and the Pr77 promoter. (A) Outline of the method used. Cytoplasmic RNA from T. cruzi transfected with pTEX()pR77CAT and pTEX()p50KMP11CAT (used as a control) was decapped with tobacco acid pyrophosphatase (TAP), dephosphorylated with alkaline phosphatase enzyme (AP) and phosphorylated by polynucleotide kinase (PNK) treatment. The changes produced in each case at the 50end of the treated RNAs are indicated. A linker RNA was ligated at the 50end of the transcripts using T4 RNA ligase. cDNA was synthesized by reverse transcription (RT) using a CAT gene specific primer (CAT1) that maps at position 191–208 from the CAT start codon, followed by PCR-amplification using a second CAT gene antisense primer (CAT90) mapping at position 71–90 from the CAT start codon, and finally an oligo corresponding to the sequence of the linker RNA. PCR products were cloned into the pGEM-TÕ-easy vector. Plasmid DNAs from the transfected bacteria selected by positive hybridization to CAT (ds DNA) and SLTc or R77 probes were sequenced. (B) Sequence at the 50end of processed CAT transcripts in pTEX()p50KMP11CAT (a) and pTEX()pR77CAT (b) transfectants. The sequences shown are those downstream of the RNA linker sequence. Arrows indicate the first nucleotide of the 50end of the CAT transcripts derived from the 50UTRKMP11 and Pr77 sequences. The position of the first nucleotide of each transcript, with respect to the 50end of SL and Pr77 sequences, is shown in italics. The number below the arrows corresponds to the quantity of clones starting at this position. Sequences corresponding to the splice leader sequence (SL), 50UTRKMP11 (50UTRKMP11CAT), L1TcPr77 (Pr77) and multi-cloning site – CAT region (MCS-CAT) are indicated. Nucleic Acids Research, 2007 9 30-phosphodiesterase enzymatic activities. J. Biol. Chem.,274, 23883–23886. 22. Garcia-Perez,J.L., Gonzalez,C.I., Thomas,M.C., Olivares,M. and Lopez,M.C. (2003) Characterization of reverse transcriptase activity of the L1Tc retroelement from Trypanosoma cruzi. Cell. Mol. Life Sci.,60, 2692–2701. 23. Olivares,M., Garcia-Perez,J.L., Thomas,M.C., Heras,S.R. and Lopez,M.C. (2002) The non-LTR (long terminal repeat) retrotransposon L1Tc from Trypanosoma cruzi codes for a protein with RNase H activity. J. Biol. Chem.,277, 28025–28030. 24. Heras,S.R., Lopez,M.C., Garcia-Perez,J.L., Martin,S.L. and Thomas,M.C. (2005) The L1Tc C-terminal domain from Trypanosoma cruzi non-long terminal repeat retrotransposon codes for a protein that bears two C2H2 zinc finger motifs and is endowed with nucleic acid chaperone activity. Mol. Cell. Biol.,25, 9209–9220. 25. Bringaud,F., Garcia-Perez,J.L., Heras,S.R., Ghedin,E., ElSayed,N.M., Andersson,B., Baltz,T. and Lopez,M.C. (2002) Identification of non-autonomous non-LTR retrotransposons in the genome of Trypanosoma cruzi.Mol. Biochem. Parasitol.,124, 73–78. 26. Kelly,J.M., Ward,H.M., Miles,M.A. and Kendall,G. (1992) A shuttle vector which facilitates the expression of transfected genes in Trypanosoma cruzi and Leishmania.Nucleic Acids Res.,20, 3963–3969. 27. Thomas,M.C., Garcia-Perez,J.L., Alonso,C. and Lopez,M.C. (2000) Molecular characterization of KMP11 from Trypanosoma cruzi: a cytoskeleton-associated protein regulated at the translational level. DNA Cell. Biol.,19, 47–57. 28. Cooper,R., de Jesus,A.R. and Cross,G.A. (1993) Deletion of an immunodominant Trypanosoma cruzi surface glycoprotein disrupts flagellum-cell adhesion. J. Cell. Biol.,122, 149–156. 29. Maranon,C., Thomas,M.C., Puerta,C., Alonso,C. and Lopez,M.C. (2000) The stability and maturation of the H2A histone mRNAs from Trypanosoma cruzi are implicated in their post-transcriptional regulation. Biochim. Biophys. Acta,1490, 1–10. 30. Maniatis,T., Fritsch,E.F. and Sambrook,J. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA. 31. Maranon,C., Puerta,C., Alonso,C. and Lopez,M.C. (1998) Control mechanisms of the H2A genes expression in Trypanosoma cruzi. Mol. Biochem. Parasitol.,92, 313–324. 32. Bruderer,T., Tu,L.C. and Lee,M.G. (2003) The 50end structure of transcripts derived from the rRNA gene and the RNA polymerase I transcribed protein coding genes in Trypanosoma brucei.Mol. Biochem. Parasitol.,129, 69–77. 33. Teran,W., Felipe,A., Segura,A., Rojas,A., Ramos,J.L. and Gallegos,M.T. (2003) Antibiotic-dependent induction of Pseudomonas putida DOT-T1E TtgABC efflux pump is mediated by the drug binding repressor TtgR. Antimicrob. Agents Chemother., 47, 3067–3072. 34. Kendall,G., Wilderspin,A.F., Ashall,F., Miles,M.A. and Kelly,J.M. (1990) Trypanosoma cruzi glycosomal glyceraldehyde-3-phosphate dehydrogenase does not conform to the ‘hotspot’ topogenic signal model. EMBO. J.,9, 2751–2758. 35. Archambault,J. and Friesen,J.D. (1993) Genetics of eukaryotic RNA polymerases I, II, and III. Microbiol. Rev.,57, 703–724. 36. Steinberg,T.H., Mathews,D.E., Durbin,R.D. and Burgess,R.R. (1990) Tagetitoxin: a new inhibitor of eukaryotic transcription by RNA polymerase III. J. Biol. Chem.,265, 499–505. 37. Bringaud,F., Ghedin,E., Blandin,G., Bartholomeu,D.C., Caler,E., Levin,M.J., Baltz,T. and El-Sayed,N.M. (2006) Evolution of non-LTR retrotransposons in the trypanosomatid genomes: Leishmania major has lost the active elements. Mol. Biochem. Parasitol.,145, 158–170. 38. Olivares,M., Lopez,M.C., Garcia-Perez,J.L., Briones,P., Pulgar,M. and Thomas,M.C. (2003) The endonuclease NL1Tc encoded by the LINE L1Tc from Trypanosoma cruzi protects parasites from daunorubicin DNA damage. Biochim. Biophys. Acta,1626, 25–32. 39. Garcı´a-Salcedo,J.A., Gijo ´n,P., Amiguet-Vercher,A. and Pays,E. (2003) Searching for promoter activity in RIME/Ingi retrotransposons from Trypanosoma brucei: binding of a protein to their 50extremity. Exp. Parasitol.,104, 140–148. 40. Swergold,G.D. (1990) Identification, characterization, and cell specificity of a human LINE-1 promoter. Mol. Cell. Biol.,10, 6718–6729. 41. Athanikar,J.N., Badge,R.M. and Moran,J.V. (2004) A YY1-binding site is required for accurate human LINE-1 transcription initiation. Nucleic. Acids Res.,32, 3846–3855. 42. Arkhipova,I.R. and Ilyin,Y.V. (1991) Properties of promoter regions of mdg1 Drosophila retrotransposon indicate that it belongs to a specific class of promoters. EMBO. J.,10, 1169–1177. 43. Takahashi,H. and Fijiwara,H. (1999) Transcription analysis of the telomeric repeat-specific retrotransposons TRAS1 and SART1 of the silkworm Bombyx mori.Nucleic Acids Res.,27, 1021–2015. 44. Bringaud,F., Bartholomeu,D.C., Blandin,G., Delcher,A., Baltz,T., El-Sayed,N.M. and Ghedin,E. (2006) The Trypanosoma cruzi L1Tc and NARTc non-LTR retrotransposons show relative site specificity for insertion. Mol. Biol. Evol.,23, 411–420. 45. Clayton,C.E. (2002) Life without transcriptional control? From fly to man and back again. EMBO. J.,21, 1881–1888. 46. Heras,S.R., Thomas,M.C., Garcia-Can ˜adas,M., Felipe,P.D., Garcia-Perez,J.L., Ryan,M.D. and Lopez,M.C. (2006) L1Tc non-LTR retrotransposons from Trypanosoma cruzi contain a functional viral-like self-cleaving 2A sequence in frame with the active proteins they encode. Cell. Mol. Life Sci.,63, 1449–1460. 47. Kimberland,M.L., Divoky,V., Prchal,J., Schwahn,U., Berger,W. and Kazazian,H.H.,Jr (1999) Full-length human L1 insertions retain the capacity for high frequency retrotransposition in cultured cells. Hum. Mol. Genet.,8, 1557–1560. 48. Paule,M.R. and White,R.J. (2000) Survey and summary: transcription by RNA polymerases I and III. Nucleic Acids Res.,28, 1283–1298. 49. Mizrokhi,L.J., Georgieva,S.G. and Ilyin,Y.V. (1988) jockey, a mobile Drosophila element similar to mammalian LINEs, is transcribed from the internal promoter by RNA polymerase II. Cell,54, 685–691. 50. McLean,C., Bucheton,A. and Finnegan,D.J. (1993) The 50 untranslated region of the I factor, a long interspersed nuclear element-like retrotransposon of Drosophila melanogaster, contains an internal promoter and sequences that regulate expression. Mol. Cell. Biol.,13, 1042–1050. 51. Minchiotti,G., Contursi,C. and Di Nocera,P.P. (1997) Multiple downstream promoter modules regulate the transcription of the Drosophila melanogaster I, Doc and F elements. J. Mol. Biol.,267, 37–46. 52. Contursi,C., Minchiotti,G. and Di Nocera,P.P. (1995) Identification of sequences which regulate the expression of Drosophila melanogaster Doc elements. J. Biol. Chem.,270, 26570–26576. 53. Kelly,S., Wickstead,B. and Gull,K. (2005) An in silico analysis of trypanosomatid RNA polymerases: insights into their unusual transcription. Biochem. Soc. Trans.,33, 1435–1437. 54. Gilinger,G. and Bellofatto,V. (2001) Trypanosome spliced leader RNA genes contain the first identified RNA polymerase II gene promoter in these organisms. Nucleic Acids Res.,29, 1556–1564. 55. Ghedin,E., Bringaud,F., Peterson,J., Myler,P., Berriman,M., Ivens,A., Andersson,B., Bontempi,E., Eisen,J. et al. (2004) Gene synteny and evolution of genome architecture in trypanosomatids. Mol. Biochem. Parasitol.,134, 183–191. 56. Martinez-Calvillo,S., Yan,S., Nguyen,D., Fox,M., Stuart,K. and Myler,P.J. (2003) Transcription of Leishmania major Friedlin chromosome 1 initiates in both directions within a single region. Mol. Cell,11, 1291–1299. 57. El-Sayed,N.M., Myler,P.J., Blandin,G., Berriman,M., Crabtree,J., Aggarwal,G., Caler,E., Renauld,H., Worthey,E.A. et al. (2005) Comparative genomics of trypanosomatid parasitic protozoa. Science,309, 404–409. 58. Soares,C.M., de Carvalho,E.F., Urmenyi,T.P., Carvalho,J.F., de Castro,F.T. and Rondinelli,E. (1989) Alphaand beta-tubulin mRNAs of Trypanosoma cruzi originate from a single multicistronic transcript. FEBS Lett.,250, 497–502. 16 Nucleic Acids Research, 2007