scieee Science in your language
[de] (orig)

Polyelectrolyte Complexes and their Therapeutic Potential

Read accessible full text

Polyelectrolyte Complexes and their Therapeutic Potential

Author: Synatschke, Christopher V.
Year: 2014
Source: https://epub.uni-bayreuth.de/id/eprint/78/1/diss.pdf
Polyelec oly e Complexes and hei The apeu ic Po en ial
Disse a ion
zu E langung des akademischen G ades eines
Dok o s de Na u wissenscha en (D . e . na .)
an de Bay eu he G aduie enschule ü Ma hema ik und
Na u wissenscha en de Uni e si ä Bay eu h
o geleg on
Ch is ophe Volke Syna schke
gebo en in Lemgo
Bay eu h, 2013
Die o liegende A bei wu de in de Zei on Sep embe 2009 bis Feb ua 2013 am
Leh s uhl ü Mak omolekula e Chemie II de Uni e si ä Bay eu h un e Be euung
du ch He n P o . D . Axel H. E. Mülle ange e ig .
Volls ändige Abd uck de on de Bay eu he G aduie enschule ü Ma hema ik und
Na u wissenscha en de Uni e si ä Bay eu h genehmig en Disse a ion zu E langung
des akademischen G ades eines Dok o s de Na u wissenscha en (D . e . na .).
Disse a ion einge eich am: 12. Ap il 2013
Zulassung du ch die P ü ungskommision: 16. Ap il 2013
Wissenscha liches Kolloquium: 10. Juni 2013
Ko igie e Ve sion de Disse a ion: 13. Janua 2014
P ü ungsausschuss:
P o . D . Axel H. E. Mülle (E s gu ach e )
P o . D . Ru h F ei ag (Zwei gu ach e in)
P o . D . Pa ick Thea o (D i gu ach e )
P o . D . S ephan Fö s e
P o . D . And eas Fe y (Vo si z)
“I you li e each day as i i was you las ,
someday you'll mos ce ainly be igh .”
― Unknown
“Why do you go away?
So ha you can come back. So ha you can see he place
you came om wi h new eyes and ex a colo s. And he
people he e see you di e en ly, oo.
Coming back o whe e you s a ed is no he same as ne e
lea ing.”
― Te y P a che , A Ha Full o Sky

Fü meine Mu e Elisabe h
Table o Con en s
i
Table o Con en s
Summa y ................................................................................................................................. 1
Zusammen assung ............................................................................................................... 5
Glossa y ................................................................................................................................... 9
Chap e 1 – In oduc ion ................................................................................................ 13
1. Polyme -Aided D ug Deli e y .............................................................................................. 13
1.1. Polyme -D ug Conjuga es ................................................................................... 13
1.2 Impo an Concep s in D ug Deli e y: S eal h E ec and EPR ........................... 14
1.3 Polyme Micelles and Vesicles ............................................................................. 16
1.4 Pho odynamic The apy ......................................................................................... 19
1.5 Complex D ug Deli e y Sys ems: Mul icompa men Micelles ........................... 20
2. Deli e y o Genes ................................................................................................................. 23
2.1 Vi al Vec o s ......................................................................................................... 24
2.2 Non-Vi al Vec o s ................................................................................................. 24
2.3 Ba ie s o a Success ul Deli e y o Genes .......................................................... 25
2.4 Polyme ic Vec o s ................................................................................................. 28
3. Aim o his Thesis ................................................................................................................. 32
4. Re e ences ............................................................................................................................. 33
Chap e 2 - O e iew o e he Thesis ........................................................................ 39
1. In luence o Polyme A chi ec u e and Molecula Weigh o Poly(2-
(Dime hylamino)e hyl Me hac yla e) Polyca ions on T ans ec ion E iciency and Cell
Viabili y in Gene Deli e y ........................................................................................................ 40
2. Nano-Pa icula e Non-Vi al Agen o he E ec i e Deli e y o pDNA and siRNA o
Di e en ia ed Cells and P ima y Human T Lymphocy es ....................................................... 43
3. Double-Laye ed Micella In e polyelec oly e Complexes – How Many Shells o a
Co e? ......................................................................................................................................... 46
4. Micella In e polyelec oly e Complexes Wi h a Compa men alized Shell ........................ 48
5. Mul icompa men Micelles wi h Adjus able Poly(e hylene glycol) Shell o E icien
in Vi o Pho odynamic The apy ................................................................................................. 50
6. Indi idual Con ibu ions o Join Publica ions ..................................................................... 55
7. Re e ences ............................................................................................................................. 59
Zusammen assung
6
Ve zweigungsg ad bei e gleichba en Molekula gewich en ge unden. Polyka ionen
un e halb eines k i ischen Molekula gewich s on ca. 20 kDa zeig en keine ele an e
T ans ek ionse izienz unabhängig om N/P Ve häl nis. Die PDMAEMA-S e ne mi e wa
20 A men (Si-PDMAEMA), ausgehend on einem Silsesquioxan-Nanopa ikel als
Ini ia o molekül, zeig en eine übe agende T ans ek ionse izienz in CHO-K1 Zellen,
gekoppel mi eine ge ingen Zy o oxizi ä . Diese e besse en
T ans ek ionseigenscha en konn en auch in ande en Zelllinien bes ä ig we den, obwohl
diese als seh iel schwie ige zu ans izie en gel en. Da un e be anden sich un e
ande em kon luen e, nich - eilende C2C12 Zellen sowie ausdi e enzie e humane T-
Lymphozy en. Auße dem konn en die gu en T ans ek ionse gebnisse on Si-PDMAEMA
eben alls mi Mizellen aus einem amphiphilen Diblockcopolyme e eich we den. Die
Mizellen bes anden aus Polybu adien-block-PDMAEMA (PB-b-PDMAEMA), wobei die
Ke n-Schale-S uk u de Mizellen in Lösung de on s e n ö migen Polyme en ähnel .
Dies wi d als Hinweis au ein gene elles Design-P inzip gedeu e : PDMAEMA
S uk u en, die iele A me ausgehend on einem gemeinsamen zen alen Punk haben,
sind bei de nich - i alen Gen ans ek ion besonde s e ek i . Beide Polyme e (Si-
PDMAEMA und PB-b-PDMAEMA Mizellen) zeig en auße dem eine hohe E izienz bei
de RNA In e e enz-The apie, da siRNA eben alls e ek i in e schiedene Zelllinien
anspo ie we den konn e.
De zwei e Themenkomplex diese Disse a ion behandel die S uk u ionische
kompa imen ie e Mizellen, nachdem diese mi en gegengese z geladenen
Polyelek oly en komplexie wu den. Abschließend wu de die Fähigkei solche
S uk u en zum Wi ks o anspo in he apeu ischen Anwendungen un e such . Als
Basis ü diese Un e suchungen dien en kompa imen ie e Mizellen, die aus dem
amphiphilen und ampho e en T iblock e polyme Polybu adien-block-poly(1-me hyl-2-
inyl py idinium)-block-polyme hac ylsäu e (PB-b-P2VPq-b-PMAA; BVqMAA) du ch
Selbs assemblie ung in wäss igen Lösungen eine Ke n-Schale-Ko ona S uk u ausbilden.
De Ke n diese Mizellen bes eh aus PB, wäh end sich die diskon inuie liche Schale aus
einem IPEK aus P2VPq und PMAA zusammense z . Nach außen hin we den die Mizellen
du ch eine dich e Ko ona aus übe schüssigem, nich an de Komplexbildung mi P2VPq
be eilig em, PMAA s abilisie . Da die Ko ona Ke en bei aus eichend hohem pH We
nega i geladen sind, konn en sie ü die Komplexbildung mi di e sen Polyka ionen

Zusammen assung
7
sowie doppel hyd ophilen Diblockcopolyme en mi einem ka ionischen Block e wende
we den. So e n sich das ü die Komplexie ung e wende e Polyka ion on dem be ei s
o handenen P2VPq un e schied, wie zum Beispiel im Falle on qua e nisie em
PDMAEMA (PDMAEMAq), bilde e sich ein neues Kompa imen au dem
u sp ünglichen Ke n (PB und P2VPq/PMAA IPEK) de Mizellen aus. Dieses
Kompa imen bes and aus dem IPEK zwischen PMAA und zugegebenem Polyka ion und
ließ sich on de e s en Schale in elek onenmik oskopischen Au nahmen deu lich
un e scheiden. Es ha e die Fo m eine du chgängigen Schale, wenn die BVqMAA
Mizellen eine ku ze bis mi le e Ko ona-Länge ha en (345 – 550 MAA Einhei en p o
BVqMAA Ke e). Wu de ü die Komplexbildung ans elle eines Homopolyme s ein
amphiphiles Diblockcopolyme mi einem posi i en und einem wasse löslichen abe
ungeladenen Block e wende , so konn e eine kolloidale S abili ä de e zeug en
komplexen Mizellen übe den gesam en Mischbe eich zwischen Mizellen und
Polyka ionen e eich we den. Obe halb eine k i ischen Menge an zugegebenem Homo-
Polyka ion wa dagegen eine Agg ega ion und mak oskopische Phasensepa a ion de
Mizellen zu beobach en.
Bei BVqMAA Mizellen mi eine besonde s langen PMAA Ko ona (1350 Einhei en)
wu de eine un egelmäßige Ve eilung des neu gebilde en IPEK ans elle eine
du chgängigen Schale bei de Zugabe on Polyka ion-Homopolyme en um den Ke n
ge unden. Als U sache ü diese neuen S uk u en wi d eine G enz lächenminimie ung
zwischen u sp ünglichem Ke n und neu gebilde em Kompa imen e mu e . Die
Minimie ung wi d e möglich , da die besonde s lange Ko ona das neue Kompa imen
e ek i gegen eine Wechselwi kung mi dem wäss igen Medium abschi men kann und so
die Lösungs-S abili ä de gesam en Mizelle nich nega i beein luss wi d.
Abschließend wu den die Mizellen aus BVqMAA au ih e E izienz im T anspo on
hyd ophoben Wi ks o molekülen ü eine pho odynamische K ebs he apie (PDT) sowohl
in Zellkul u als auch in Mäusen mi Tumo modellen ge es e . Du ch die Komplexbildung
de Mizellen mi dem doppel hyd ophilen Diblockcopolyme Poly(L-lysin)-block-
poly(e hylenglykol) (PLL-b-PEG) konn e die Zusammense zung de Mizell-Ko ona on
einem PMAA kon inuie lich zu eine PEG-Ko ona e ände we den. De Ein luss de
Ko ona au die biologischen Eigenscha en de Mizellen in Abhängigkei ih e
Zusammense zung konn e so un e such we den. Bei einem hohen An eil an
zugegebenem PLL-b-PEG wu de eine s abile, neue Mizells uk u ge unden, wobei sich
Zusammen assung
8
das neu gebilde e IPEK-Kompa imen in Zylinde o m senk ech au dem Mizellke n
s ehend ausbilde . Bei Un e suchungen de du ch die Wi ks o - agenden Mizellen
e u sach en Zy o oxizi ä konn e ein deu liche Ein luss de Ko ona-Zusammense zung
ge unden we den. BVqMAA Mizellen ohne PLL-b-PEG zeig en die höchs e Zy o oxizi ä
gegenübe humanen Lungenk ebszellen (A549). Diese Zy o oxizi ä wu de mi
s eigendem An eil an PLL-b-PEG in de Mizellko ona s e ig ge inge , wobei de T end
gu mi de in die Zellen au genommenen Menge an Wi ks o ko elie e. Volls ändig
PEGylie e Mizellen zeig en die ge ings e Menge an zellulä au genommenem Wi ks o
und die ge ings e Zy o oxizi ä . In Mäusen wu de eine e länge e Blu zi kula ion im
Be eich meh e e S unden nach in a enöse Injek ion lediglich ü olls ändig
PEGylie e Mizellen beobach e , wäh end eilweise ode nich PEGylie e Mizellen
inne halb ku ze Zei nich meh im Blu k eislau nachweisba wa en. Auch eine
signi ikan e Akkumula ion in subku anen A549-Tumo en 24 h nach de Mizell-
Ve ab eichung wu de nu ü olls ändig PEGylie e Mizellen ge unden. Die Menge an
Wi ks o , welche du ch die Mizellen in den Tumo anspo ie wu de, wa aus eichend,
um nach einmalige Injek ion de Mizellen und eine einzigen Lase -Bes ahlung eine
e izien e Wachs umsun e d ückung des Tumo s übe einen Zei aum on 21 Tagen zu
e eichen. Somi konn e das Po en ial de BVqMAA Mizellen ü einen
Wi ks o anspo in i o und in i o e olg eich nachgewiesen we den.
Glossa y
9
Glossa y
AIBN - azobisisobu y o ni ile
ANOVA - analysis o a iance
ATRP - a om ans e adical polyme iza ion
BHT - bu yla ed hyd oxy oluene
b-PEI - b anched polye hyleneimine
BVqMAA - polybu adiene-block-poly(1-me hyl-2- inyl py idinium)-
block-poly(me hac ylic acid)
BVT - polybu adiene-block-poly( inyl py idine)-block-poly( e -
bu yl me hac yla e)
CD-spec oscopy - ci cula dich oism spec oscopy
cmc - c i ical micelle concen a ion
CPDB - 2-(2-cyanop opyl)di hio benzoa e
c yo-TEM - c yogenic ansmission elec on mic oscopy
CTA - chain ans e agen
DAMA - 2-((2-(dime hylamino)e hyl)me hylamino)e hyl
me hac yla e
DCM - dichlo ome hane
DCTB - ans-2-[3-(4- e -Bu ylphenyl)-2-me hyl-2-p openylidene]
malononi ile
DDS - d ug deli e y sys em
Dh - hyd odynamic diame e
D.I. - dispe si y index (ligh sca e ing)
DLS - dynamic ligh sca e ing
DMAc - dime hyl ace amide
DMAEMA - dime hyl aminoe hyl me hac yla e
DMF - dime hyl o mamide
DMSO - dime hyl sul oxide
Glossa y
10
DNA - desoxy ibonucleic acid
DP - deg ee o polyme iza ion
Dq - qua e nized PDMAEMA
EBIB - e hyl 2-b omoisobu y a e
EDC - N-(3-dime hylaminop opyl)-N′-e hylca bodiimide
hyd ochlo ide
eGFP - enhanced g een luo escen p o ein
ENB - Eli e Ne wo k o Ba a ia
EPR - enhanced pe mea ion and e en ion
FCS - e al cal se um
GPC - gel pe mea ion ch oma og aphy
HMTETA - 1,1,4,7,10,10-hexame hyl ie hylene e amine
IC50 - inhibi o y concen a ion o 50 % o cells
im-IPEC - in amicella in e polyelec oly e complex
IPEC - in e polyelec oly e complex
LCC50 - concen a ion o polyplex o 50 % o iable cells
LD50 - le hal dose o 50 % o cells
l-PEI - linea polye hylene imine
MAA - me hac ylic acid
MALDI-ToF-MS - ma ix assis ed lase deso p ion ioniza ion ime o ligh
mass spec ome y
MCM - mul icompa men micelle
MFI - mean luo escence in ensi y
Mic-PDMAEMA - micella PDMAEMA
Mn - numbe a e age molecula weigh
MTT - 3-(4,5-dime hyl hyazolyl-2)-2,5-diphenyl e azolium
b omide
Mw - weigh a e age molecula weigh
MWCO - molecula weigh cu o
Glossa y
11
Nagg. - agg ega ion numbe
NMR - nuclea magne ic esonance
N/P ( a io) - ni ogen o phospha e a io
P2VP - poly(2- inyl py idine)
P2VPq - poly(1-me hyl-2- inyl-py idinium)
PB - polybu adiene
PB-b-PDMAEMA - polybu adiene-block-poly(2-(dime hylamino)e hyl
me hac yla e)
PBS - phospha e bu e ed saline
PDAMA - poly(2-((2-(dime hylamino)e hyl)me hylamino)e hyl
me hac yla e)
PDAMAq - qua e nized PDAMA
PDI - polydispe si y index
PDLL-b-PEG - poly(D,L-lysine)-block-poly(e hylene glycol)
PDMAEMA - poly(2-(dime hylamino)e hyl me hac yla e)
PDMAEMAq - qua e nized PDMAEMA
pDNA - plasmid DNA
PDT - pho odynamic he apy
PEG - poly(e hylene glycol)
PEI - poly(e hylene imine)
PEO - poly(e hylene oxide)
PI - p opidium iodide
PLL-b-PEG - poly(L-lysine)-block-poly(e hylene glycol)
PMAA - poly(me hac ylic acid)
PMANa - poly(sodium me hac yla e)
PS - pho osensi ize
P BMA - poly( e bu yl me hac yla e)
RAFT - e e sible addi ion agmen a ion chain ans e
(polyme iza ion)

Glossa y
12
RES - e iculoendo helial sys em
Rh - hyd odynamic diame e
RNA - ibonucleic acid
ROS - eac i e oxygen species
SD - s anda d de ia ion
SEC - size exclusion ch oma og aphy
Si-PDMAEMA - PDMAEMA om silsesquioxane ini ia o
siRNA - small in e e ing ibonucleic acid
BMA - e -bu yl me hac yla e
TE - ans ec ion e iciency
TEM - ansmission elec on mic oscopy
THF - e ahyd o u ane
Chap e 1 – In oduc ion
13
Chap e 1 – In oduc ion
“Nanomedicine” is a ca chy name o ecen e o s in he medical ield o use ma e ials
o nanoscopic dimensions o he ea men o diagnosis o a ious diseases.1, 2 Al hough
he de ini ion is a he ague, he size o such sys ems is in be ween ha o small
molecule d ugs (up o se e al nanome e s) and mic on-sized objec s, esul ing in speci ic
bene icial p ope ies. Nanoma e ials a e compa able in size o p o eins, enzymes o
i uses and a e he e o e well sui ed o speci ically in e ac wi h biological sys ems on a
cellula o sub-cellula le el. Compa ed o small molecule d ugs a highe deg ee o
complexi y is inhe en o hose ma e ials, leading o a mul i- unc ionali y o he o e all
sys em. Fo example, in cance he apy many d ug deli e y sys ems (DDS) ha e been
de eloped om nanos uc u ed ma e ials, which show inc eased a ailabili y o he d ug
in he o ganism h ough a p olonged ci cula ion ime in he bloods eam, an enhanced
accumula ion in he a ge ed issue h ough a ge ing mechanisms as well as selec i e
elease o ac i a ion o he d ug a he desi ed si e. All hese p ope ies o nanoscopic
DDS can esul in a mo e e ec i e ea men o diagnosis as compa ed o con en ional
me hods. Depending on wha ype o a ma e ial is used o he medical applica ion hey
can be classi ied in o h ee di e en ca ego ies, namely ino ganic, o ganic o hyb id
ma e ials. Quan um do s a e well-known examples o ino ganic imaging agen s in
luo escence mic oscopy3 and i on oxide nanopa icles a e cu en ly in clinical ials o
magne ic esonance imaging4. Pu ely o ganic pla o ms can be ound in he
supe s uc u es o sel -assembled small molecules such as liposomes5 o in polyme ic
sys ems such as polyme micelles6 and polyme esicles (polyme somes).7 Consequen ly,
hyb ids a e a combina ion o bo h ypes o ma e ials in o a single DDS. In he ollowing,
polyme ic sys ems capable o deli e ing he apeu ically ac i e subs ances will be
desc ibed in mo e de ail.
1. Polyme -Aided D ug Deli e y
1.1. Polyme -D ug Conjuga es
A pionee ing idea o he use o polyme s in he apeu ic applica ions was in oduced by
Helmu Ringsdo in 1975, when he p oposed he concep o “polyme he apeu ics”.8 In
his app oach a polyme chain is used o co alen ly connec se e al unc ional molecules,
Chap e 1 – In oduc ion
14
such as a he apeu ic d ug and a a ge ing moie y, in o one mul i- unc ional
mac omolecule (Scheme 1-1).
The main ad an age o such a combina ion as p oposed by Ringsdo was in he la ge
a ailabili y o he d ug in he o ganism h ough an inc ease in blood ci cula ion ime due
o he highe molecula weigh and a be e solubiliza ion o poo ly wa e -soluble d ugs
by linking hem o hyd ophilic mac omolecules. The idea o a aching speci ic a ge ing
molecules o inc ease he localiza ion o he d ug a he desi ed si e was al eady included
in his app oach. Due o he ease o chemical modi ica ion o syn he ic polyme s, he
o iginal concep has been explo ed in much mo e de ail and was conside ably expanded
o include a wide a ie y o mac omolecula deli e y sys ems o he apeu ic
applica ions.9-12 The design o biocompa ible13 and deg adable polyme s14, 15 oge he
wi h he use o chemical linke s, which elease he coupled d ugs a app op ia e
condi ions ha e pushed he ield o wa d and se e al polyme -d ug conjuga e
o mula ions a e es ed in clinical ials o ha e al eady been app o ed o he apeu ic use
in humans.2, 16
Scheme 1-1. Ringsdo ´s model o a pha maceu ically ac i e polyme -d ug conjuga e. Rep in ed wi h
pe mission.8
1.2 Impo an Concep s in D ug Deli e y: S eal h E ec and EPR
A highly success ul syn he ic ma e ial aiding in he anspo a ion o d ugs inside li ing
o ganisms is poly(e hylene glycol) (PEG). Many DDS a e ul ima ely o mula ions
con aining PEG in some o m. I is an uncha ged, wa e -soluble polyme ha is
Chap e 1 – In oduc ion
15
ex ensi ely used in many kinds o consume p oduc s, such as shampoos, c èmes, gels,
e c. and is syn hesized by anionic polyme iza ion o e hylene oxide. The e o e, PEG is
also e e ed o as poly(e hylene oxide) (PEO) and bo h names a e used egula ly. Fo
he apeu ic applica ions PEG is an ideal polyme , because i is non- oxic, biocompa ible
and has p o ein epellen p ope ies. Compa ed o o he polyme s wi h simila p ope ies,
i.e. polyoxazolines,17 i has he ad an age o FDA (U.S. Food and D ug Adminis a ion)
app o al o many applica ions, consequen ly igge ing an ex ensi e use o PEG
polyme s in he apeu ic p oblems and esul ing in i s s a us as “gold s anda d”.18
O iginally, he e m o PEGyla ion e e ed o he conjuga ion o he apeu ically ac i e
molecules (small molecule d ugs, p o eins, pep ides, DNA, e c.) o PEG chains in o de o
inc ease he solubili y in wa e and o p o ec he espec i e molecule om deg ada ion,
e.g. by enzymes, o immunogenic ecogni ion.19 In he mean ime, howe e , he e m is
being b oadly applied o many kinds o PEG con aining s uc u es used in a medical
con ex , o example o ganic and ino ganic nanopa icles, su ace coa ings and polyme ic
micelles.20, 21 Many o he desi ed p ope ies ound o PEG-d ug conjuga es a e also
occu ing o PEGyla ed pa icles, whe e he PEG coa ing leads o inc eased ci cula ion
ime in he bloods eam and a educ ion o non-speci ic in e ac ions especially wi h
p o eins, which is summa ized in a so-called “shielding” o “s eal h e ec ” o PEG.
Depending on he designa ed applica ion, he molecula weigh and g a ing densi y
(mush oom o b ush con o ma ion22) o PEG chains ha e o be adjus ed.
Connec ed o he bene icial p ope ies con e ed by PEG on DDS, a passi e a ge ing
mechanism occu ing o solid umo s in cance he apy, known as he enhanced
pe mea ion and e en ion (EPR) e ec , has been la gely esponsible o he success o
nanoscopic DDS in ha ield.23 I was i s desc ibed by Maeda e al.24 in 1984 and is
based on he speci ic ascula s uc u e in solid umo s, cha ac e ized by a high ascula
pe meabili y oge he wi h an impai ed lympha ic d ainage as compa ed o no mal issue,
which allows DDS o a speci ic size ange o p e e en ially accumula e inside he umo
issue. In o de o make use o he EPR e ec , he nanoscopic ca ie sys em needs o
ha e a p olonged blood ci cula ion ime in he o de o se e al hou s, usually associa ed
wi h a size in be ween app oxima ely 10 – 500 nm and a dense shielding laye p e en ing
p o ein adso p ion.25 Molecules wi h a size below 10 nm a e apidly clea ed h ough he
kidney, while la ge pa icles up o 15 µm p ima ily accumula e in li e and spleen and
a e clea ed h ough he e iculoendo helial sys em (RES).26 Howe e , i bo h he su ace
Chap e 1 – In oduc ion
22
d ugs a once a e needed. Fo he syn he ic e o necessa y in c ea ing such sys ems o be
wo hwhile, he ull po en ial o a selec i e d ug elease o se e al d ugs independen o
each o he and in speci ic cellula loca ions mus be ealized in he u u e.

Chap e 1 – In oduc ion
23
2. Deli e y o Genes
“Gene he apy” summa izes a he apeu ic app oach o he ea men o inhe i able o
acqui ed diseases, whe e de ec i e o missing genes a e eplaced by an app op ia e
exogenous gene in oduced in o he cell.66, 67 Also he down- egula ion (silencing) o
o e ac i e genes by means o RNA in e e ence can o e p omising and p e iously
una ailable he apeu ic ools.68 A human gene he apy app oach is especially p omising
o ce ain ypes o diseases ha a e o he wise di icul o e en impossible o ea so a .
These include gene ic diseases like se e e combined immunode iciency, hemophilia o
cys ic ib osis, bu also acqui ed illnesses like cance o AIDS could po en ially be
add essed wi h gene he apy.66 One o he bigges challenges o gene he apy is he
e ec i e in oduc ion o o eign gene ic ma e ial in o he a ge cell, because se e al
hu dles exis ha p o ec agains jus such an e en . Consequen ly, signi ican e o s ha e
been made in c ea ing deli e y ehicles (“ ec o s”) o nucleic acids ha can e ec i ely
o e come he di e en cellula ba ie s and success ully deli e hei ca go o he a ge
(nucleus o cy osol). Ine i ably, he deli e y o genes o igh ing disease in pa ien s will
need deli e y ehicles capable o deli e ing hei ca go in a complex li ing o ganism and
no jus in cell cul u e. This en i onmen o e s special condi ions, which addi ionally
complica e he p ocess o gene deli e y be o e he ec o has e en eached he a ge cell
and encoun e s i s inhe en de ense mechanisms. I ollows ha he same challenges
discussed abo e o in i o d ug deli e y apply he e as well.
Howe e , he in en ional modi ica ion o cells, summa ized unde he i le o gene ic
enginee ing, by in oducing ecombinan DNA in i o is an impo an ield in i s own
igh . Many d ug molecules a e di icul o p oduce by ully syn he ic means because o
mul i-s ep p ocedu es equi ing p o ec i e g oups, s e eo-selec i e ca alysis and mul iple
pu i ica ion s eps. Cells can p oduce hese d ugs by enzyma ic means wi h absolu e
s e eo-selec i i y and in high quan i y when gene ically enginee ed o do so. Since he
cells a e cul i a ed in cell cul u e in a bio eac o , many o he es ic ions ha apply o an
in i o deli e y sys em a e absen o his applica ion. The e o e, e en ec o s which
migh no be sui able o a gene he apy app oach can s ill be e y e ec i e o he
deli e y o genes in i o whe e ma e s o deli e y e iciency and p oduc ion cos migh
be mo e impo an han blood ci cula ion imes o o gan dis ibu ion.
Chap e 1 – In oduc ion
24
All deli e y ehicles, ega dless o hei inal use, a e usually di ided in wo ca ego ies,
namely i al and non- i al ec o s. Some signi ican di e ences be ween he wo ypes
exis , leading o speci ic challenges ha need o be o e come be o e a widesp ead use can
ake place.
2.1 Vi al Vec o s
Vi uses a e hea ily used as deli e y ehicles o gene ic ma e ial, because hey e ol ed
speci ically o in oduce hei own genome in o he hos cell. As a esul , he deli e y
e iciency o i al ec o s is e y high and in many cases speci ic owa ds a ce ain cell
line. In addi ion, i uses can s ably inco po a e he anspo ed DNA sequence in o he
hos cell genome ensu ing con inued gene exp ession, which can be bene icial in he
ea men o ce ain diseases. Howe e , some d awbacks exis o i al ec o s. The mos
signi ican d awback is he possibili y o an immune esponse o he o ganism, posing a
signi ican isk o he pa ien . Also, a epea ed applica ion o i al ca ie s in he same
pa ien could esul in a loss o ans ec ion e iciency, due o ecogni ion o he i us by
he immune sys em. Fu he mo e, la ge-scale p oduc ion and chemical modi ica ion o
he i us capsid is challenging, he la e po en ially leading o a change in he sel -
assembly o he h ee dimensional i us s uc u e. Some es ic ions on he size o he
anspo ed DNA can also apply, due o he highly de ined s uc u e o he i us.
Ne e heless, mos clinical ials pe o med on gene he apy so a ha e used i al
ec o s.69, 70
2.2 Non-Vi al Vec o s
Al e na i e ans ec ion me hods, o en based on syn he ic molecules o a i icial
pa icles, ha e been de eloped in ecen yea s o o e come he abo e-men ioned
d awbacks o i al ec o s. Amongs hose a e elec opo a ion, he “gene gun” - me al
nanopa icles coa ed wi h DNA ha a e sho in o he cells - as well as ca ionic molecules
such as lipids and polyme s.71 All o hese me hods a e gene ally conside ed o be less
e ec i e and selec i e in deli e ing hei gene ic ca go as compa ed o hei i al
compe i o s and in mos cases only a ansien exp ession o genes can be achie ed, since
hey a e lacking mechanisms o pe manen ly in oduce he anspo ed DNA sequence
Chap e 1 – In oduc ion
25
in o he hos genome. Fo some non- i al sys ems, bu especially in polyme ic ec o s, a
signi ican cellula oxici y is obse ed in many cases. S ill, signi ican e o has been pu
in o imp o ing he pe o mance o non- i al ec o s, aided by he ease wi h which
chemical modi ica ions can be made on he sys ems.
2.3 Ba ie s o a Success ul Deli e y o Genes
The p ocess o a success ul deli e y o nucleic acids o he a ge si e in he cell wi h
special conside a ion o he ba ie s encoun e ed en ou e is exempla ily desc ibed in he
ollowing by example o a polyca ionic non- i al gene deli e y ec o .
On i s own, he up ake o ee DNA in cells is ine icien , because o he size and nega i e
cha ge o he DNA. Consequen ly, me hods ha make use o deli e y mechanisms
inhe en o he cell (liposomes and polyme s) a he han b u e o ce (gene gun and
elec opo a ion) i s need o compac he DNA o pa icles o smalle size and neu alize
he nega i e cha ge o he DNA phospha e g oups. Bo h p ocesses occu when
polyca ions o m polyion complexes wi h nucleic acids (Figu e 1-2, I). Such complexes
a e also e med as “polyplexes” o “in e -polyelec oly e complexes” (IPECs) and
addi ionally p o ec he DNA agains enzyma ic deg ada ion. The p ope ies o polyplexes
like size and cha ge a e mos ly in luenced by he choice o he polyca ion and do no
s ongly depend on he DNA used, bu e en i hese physicochemical pa ame e s o
polyplexes a e known, i is no possible o p edic hei ans ec ion beha io .70 When
mixing DNA and polyca ions o o m polyplexes, gene ally, an excess o polyca ion
(calcula ed as he a io o posi i e o nega i e cha ges o ni ogen o e phospho us, N/P)
is used and his leads o he o ma ion o polyplexes wi h an o e all posi i e cha ge.
These can now e icien ly bind o he nega i ely cha ged cell memb ane, signi ican ly
enhancing hei cellula up ake in i o (Figu e 1-2, II). Cellula up ake o he polyplexes
depends on a mul i ude o ac o s such as size, cha ge, su ace chemis y, he p esence o
a ge ing unc ions and possibly also mechanical p ope ies o he polyplexes. I
cons i u es one o he mos c i ical s eps in gene deli e y, al hough a high polyplex up ake
is by no means a gua an ee o a s ong ansgene exp ession. The up ake beha io is also
known o a y wi h cell ype, whe e di e en pa hways may be used, which complica es
ma e s u he .72 An up ake h ough an endosomal pa hway is he mos common
mechanism o polyplex en y in o cells.
Chap e 1 – In oduc ion
26
Figu e 1-2. Ba ie s o gene deli e y – Design equi emen s o gene deli e y sys ems include he abili y o
(I) package he apeu ic genes; (II) gain en y in o cells; (III) escape he endo-lysosomal pa hway; (IV)
e ec DNA/ ec o elease; (V) a ic h ough he cy oplasm and in o he nucleus; (VI) enable gene
exp ession; and (VII) emain biocompa ible. Rep in ed wi h pe mission.72
Once he polyplex is inside o an endosomal compa men in he cell, i needs o be
eleased in o he cy osol and u he a el o he nucleus in case o DNA deli e y
(Figu e 1-2, III), while o siRNA deli e y eaching he cy osol is o en su icien .
Du ing he anspo o endosomes o lysosomes ATP-media ed p o on pumps acidi y he
in e io o he endosome, inally leading o he ac i a ion o nucleases capable o
deg ading he DNA. Se e al polyme ic ec o s make use o his acidi ica ion o an
endosomal escape. This can be ei he h ough a con o e sially discussed73 p ocess called
“p o on sponge e ec ” (PSE)74, 75 whe e he high bu e ing capaci y o polyca ions like
poly(e hylene imine) (PEI) leads o a wa e in lux and inally bu s ing o he endosome.
O he polyme ic sys ems ha e used cell pene a ing pep ide sequences76 o syn he ic
unc ions77 mimicking hese pep ides o in e up ing he endosomal memb ane and
acili a ing a elease o he polyplex om he endosome. Also he co-deli e y o small
molecules assis ing in endosomal escape has been shown.
E en a e a polyplex has success ully en e ed he cy osol o he a ge cell, he e a e s ill
se e al ba ie s o o e come, be o e he DNA has eached i s designa ed des ina ion. The
mobili y o mac omolecules and pa icles, such as polyplexes, is s ongly hinde ed in he
cy osol, i.e., due o he cy oskele on and he high iscosi y o he cy osol o igina ing om
Chap e 1 – In oduc ion
27
he high p o ein con en . Vi al ec o s can ely on ac i e anspo mechanisms such as
mic o ubules, which a e gene ally no a ailable o polyme ic ec o s unless s ill enclosed
in he endosome. Ins ead polyme ic ec o s ha e o o m complexes o small size o
inc ease mobili y. Nucleic acid deg ada ion is a eoccu ing p oblem in he cy osol and a
p ema u e elease o he DNA om he complex is de imen al o ans ec ion e iciency
mainly o easons o apid DNA deg ada ion. Howe e , o he gene ic in o ma ion o
he DNA o be accessible i mus e en ually be eleased om he polyplex, o he wise
ansgene exp ession is hinde ed. Finding a sys em wi h a balanced binding s eng h
owa ds he DNA, whe e on he one hand s able complexes ha p o ec he DNA om
deg ada ion a e o med while s ill allowing o a elease a he co ec imepoin , is
c i ical.
The inal ba ie o DNA deli e y o euka yo ic cells is he nucleic memb ane and he
DNA has o c oss i in o de o induce a success ul exp ession o he desi ed gene (Figu e
1-2, V). Po e complexes can ac i ely anspo e en la ge molecules h ough he
memb ane and in o he nucleus, bu app op ia e a ge ing ligands ha e o be p esen ed in
o de o ac i a e hese po e complexes. Ano he possibili y is du ing cellula di ision,
whe e he nucleic memb ane b eaks down o a sho pe iod o ime. The lack o po e
complex ac i a ing pep ides is he eason why many polyme ic ec o s a e only e icien
in di iding cell lines, while ans ec ion pe o mance d ops se e ely in non-di iding cell
lines.
Many o he p ocesses in ol ed in he success ul deli e y o exogenous gene ic ma e ial
o a a ge cell a e no ully unde s ood ye . I is he e o e di icul o make any p edic ion
on he ans ec ion pe o mance o a new polyme ec o and in many cases ca e ul
mapping o he pa ame e space is necessa y o ind op imal ans ec ion condi ions.
Since pe o mance can a y s ongly wi h each di e en cell line and also depends on
ac o s like he p esence o absence o se um p o eins in i o, his p ocess has o be
epea ed o each ec o when applied o a new a ge .
As men ioned abo e, he deli e y o genes unde in i o condi ions cons i u es a
o midable challenge o mos ans ec ion sys ems, especially o non- i al ones.
Polyplex s abili y can be a p oblem unde physiological condi ions (inc eased sal
concen a ion, compe ing polyions, se um p o eins, e c.) and dissocia ion o he complex

Chap e 1 – In oduc ion
28
can lead o DNA deg ada ion, while an agg ega ion o polyplexes o he associa ion wi h
p o eins in he bloods eam can lead o as clea ance. Fo in a enous injec ion o
polyplexes he p oblem o su icien accumula ion a he a ge si e and a oidance o
ecogni ion, al eady discussed o an i-cance -d ug ca ying polyme micelles, a ises as
well. Some solu ions a e ound in he cha ge neu aliza ion and shielding o he
polyplexes, o example h ough PEGyla ion, al hough his gene ally esul s in lowe
up ake e iciency in he a ge cells. A di ec injec ion o he polyplexes o he a ge
issue can o e come he p oblems associa ed wi h insu icien accumula ion; howe e , i
does no au oma ically gua an ee a success ul gene ans ec ion.
2.4 Polyme ic Vec o s
Many di e en polyme s wi h posi i e cha ges ha e been es ed o hei po en ial in
ans ec ion. Mos o hese polyme s ha e amino g oups as he cha ge bea ing species and
some ypical ep esen a i es o polyme ic non- i al ca ie s a e depic ed in Figu e 1-3.
Polylysine was one o he i s polyme s o be used o he ans ec ion o cells and has
eached p e-clinical ials as a block copolyme wi h PEG.78, 79 PEI in bo h i s b anched
and linea a chi ec u es has shown ema kably high ans ec ion e iciency and is
conside ed as he “gold s anda d” o polyme ic gene deli e y.75 Many chemical
modi ica ions ha e been p oposed o u he inc ease he ans ec ion e iciency and
especially a add essing he p oblem o i s a he high cy o oxici y.80 Se e al
comme cially a ailable ans ec ion eagen s such as ExGen500 and je PEI use linea PEI
in hei o mula ions. Szoka e al. i s used poly(amido amine) dend ime s o nucleic
acid anspo and se e al di e en dend i ic molecules ha e been s udied in de ail
because o hei b anched a chi ec u e and highly de ined s uc u e.81, 82 Recen ly, some
epo s used phosphonium con aining polyme s as an al e na i e ma e ial, p o ing hei
p incipal capabili y o he deli e y o genes in i o, while exhibi ing a he low
cy o oxici y as compa ed o ammonium con aining polyme s.83-85
Chap e 1 – In oduc ion
29
Figu e 1-3. Polyme s uc u es o polyca ions egula ly used as non- i al ans ec ion agen s.
To be e unde s and he indi idual mechanisms ha go e n a success ul deli e y o
genes o he a ge cell, i is a necessi y o ha e well-de ined s a ing ma e ials. Almos all
syn he ic polyme s ha e a dis ibu ion o hei molecula weigh and he e o e ep esen a
mix u e o indi idual polyme chains o a ying leng h. Fu he mo e, ep oducibili y is
only gi en up o a ce ain poin , since bo h molecula weigh and molecula weigh
dis ibu ion can a y signi ican ly be ween indi idual ba ches. I he dis ibu ion o a
polyme sample is b oad, i becomes di icul o disce n be ween he indi idual
con ibu ions o he di e en chains making up he o e all mix u e. The e o e, polyme s
wi h a na ow molecula weigh dis ibu ion, a good con ol o e he molecula weigh
and high ep oducibili y be ween ba ches is o be p e e ed. Addi ionally, access o
di e en polyme a chi ec u es can be in e es ing, since ma e ial p ope ies can be
signi ican ly in luenced h ough he h ee-dimensional connec ion o he monome s in a
polyme . By using monome s ha can be polyme ized wi h con olled o li ing
polyme iza ion me hods, such di e en polyme a chi ec u es in combina ion wi h na ow
molecula weigh dis ibu ions ha e become a ailable.86, 87 Wi h he esul ing polyme s o
de ined molecula weigh and con ollable a chi ec u e, he aim is o es ablish s uc u e-
p ope y ela ionships o polyme ic ec o s and possibly e en de ine some guidelines o
he design o success ul polyme ic gene ca ie s.88
Poly(2-(dime hylamino)e hyl me hac yla e) (PDMAEMA) is a polyca ion ha can be
easily p epa ed by li ing polyme iza ion me hods like e e sible addi ion agmen a ion
chain ans e (RAFT) polyme iza ion,89 a om ans e adical polyme iza ion (ATRP),90
Chap e 1 – In oduc ion
30
as well as anionic polyme iza ion91 and has shown p omising pe o mance as a non- i al
gene ca ie .92 Simila o many o he polyme ic gene ans ec ion agen s an inc ease in
cy o oxici y ha is coupled wi h an inc ease in ans ec ion e iciency could be obse ed.
Se e al s udies on he in luence o he molecula weigh on ans ec ion e iciency and
oxici y ha e also been pe o med.93, 94 Much e o has been pu in o decoupling an
e ec i e ans ec ion om a signi ican cy o oxici y. A he e y leas a dec ease o he
oxici y o bea able le els, while main aining a high ans ec ion e iciency has been he
aim o se e al s udies. I is belie ed ha pa o he oxici y s ems om he non-
deg adable na u e o he PDMAEMA. Se e al g oups ha e he e o e p epa ed DMAEMA
con aining polyme s ha can be clea ed in o smalle building blocks unde physiological
condi ions, albei wi h ambiguous esul s on bo h ans ec ion e iciency and oxici y.95-98
A copolyme iza ion o PDMAEMA wi h o he monome s o conjuga ing PEG o
PDMAEMA could success ully educe he oxic e ec s o he polyme s in many cases.
Howe e , no in all cases did a educ ion o he oxici y also lead o an inc ease in
ans ec ion e iciency.99 The in luence o a chi ec u al changes o he PDAMEMA
s uc u e was also es ed o imp o ing gene deli e y e icacy. Non-linea polyme
a chi ec u es can be syn hesized o PDMAEMA o example by using mul i- unc ional
ini ia o molecules. Bo h s a -shaped100-102, b anched103, 104 and cylind ical b ush-like105
polyme s we e subsequen ly es ed o hei ans ec ion pe o mance and showed
supe io esul s as compa ed o hei linea coun e pa s. Geo giou e al. we e he i s o
use s a -shaped PDMAEMAs o gene ans ec ion. They p epa ed he polyme h ough
an “a m- i s ” me hod wi h a c osslinking monome in oduced in o he g oup ans e
polyme iza ion o DMAEMA.106-108 Se e al o he g oups ha e made use o such
b anched s uc u es in he mean ime. In summa y, PDMAEMA o e s many possibili ies
o elucida e he mechanisms o gene ans ec ion, due o i s chemical e sa ili y.
Despi e hese emendous imp o emen s in con olling he polyme a chi ec u e and
molecula weigh dis ibu ion, many open ques ions emain unanswe ed o he momen .
Con o e sial and e en con lic ing esul s a e epea edly epo ed in he li e a u e. In
many cases a compa ison be ween di e en s udies is di icul , because ans ec ion
p o ocols, cell lines, epo e genes and ma e ial cha ac e iza ion me hods a e chosen
based on p e e ence o a ailabili y by he espec i e g oups a he han by s anda dized
ules. This is a majo d awback ha needs o be add essed in he u u e in o de o be e
coo dina e he indi idual e o s o each g oup.
Chap e 1 – In oduc ion
31
As an ou look o nanomedicine, polyme ic ma e ials ha e a good chance o signi ican ly
con ibu ing o he ield in he u u e. Polyme s a e chemically e sa ile and can easily be
ailo ed o hei espec i e use by skilled syn he ic chemis s. Howe e , o be able o
co ec ly design he ma e ials, polyme chemis s and ma e ial scien is s in gene al need o
closely collabo a e wi h scien is s om o he disciplines like biology, biochemis y,
pha maceu ical and medical sciences, who ha e a deep unde s anding o he p ocesses
and ela ed challenges speci ic o li ing o ganisms. Only h ough a cle e design o
ma e ials ha akes in o accoun all he a ailable knowledge o he di e en disciplines
will a signi ican imp o emen become possible, a he han hoping o a “lucky sho ”
om a single discipline.
Chap e 1 – In oduc ion
38

Chap e 2 – O e iew o e he Thesis
39
Chap e 2 - O e iew o e he Thesis
This hesis consis s o se en chap e s including i e publica ions, which a e p esen ed in
Chap e s 3 o 7.
S uc u al cha ac e iza ion o polyelec oly e nanos uc u es in aqueous solu ion and he
he apeu ic use a ising om hese ma e ials is he common opic uni ying he di e en
chap e s. Two di e en ypes o polyme ic ma e ials we e used in he wo k, which can be
di ided in o s a -shaped polyca ions on one side and mul icompa men micelles (MCMs)
om ionic iblock e polyme s on he o he .
In close collabo a ion wi h he g oup o P ocess Bio echnology a he Uni e si y o
Bay eu h, we explo ed he biological p ope ies o s a -shaped polyca ions o he
deli e y o gene ic ma e ial ( ans ec ion) in o euka yo ic cells. To be e unde s and he
ela ionship be ween chemical modi ica ions on he molecula le el and biological
p ope ies ele an o he ans ec ion p ocess, i.e., cy o oxici y and ans ec ion e iciency
(TE) we e he main c i e ia o in e es , I syn hesized a a ie y o di e en polyme
s uc u es ha we e subsequen ly es ed agains se e al ypes o cell lines. We ound
gene al design c i e ia o s a -shaped ec o s (Chap e 3 and 4) and could use hem o
c ea e ma e ials wi h signi ican ly enhanced ans ec ion p ope ies (Chap e 4) as
compa ed o p e iously used polyme s.
In he second pa o he hesis, om a s a ing ma e ial consis ing o MCMs om
iblock e polyme s which ha e a nega i ely cha ged co ona in aqueous solu ion, I
in es iga ed he possibili ies o al e he micella s uc u e owa ds highe complexi y
h ough he in e ac ion wi h opposi ely cha ged (block co-)polyme s. C ea ing new
compa men s o changing he su ace chemis y o he micelles by means o
in e polyelec oly e complex (IPEC) o ma ion was o pa icula in e es (Chap e 5 and
6). Some o hese new MCMs we e hen used o in es iga e he in luence o he co ona
chemis y on biological p ope ies, while simul aneously demons a ing good d ug
ca ying capaci y su icien o an i-cance he apy in i o and in i o (Chap e 7).
The mos impo an esul s om each o he di e en pa s a e discussed in he ollowing.
Chap e 2 – O e iew o e he Thesis
40
1. In luence o Polyme A chi ec u e and Molecula Weigh o Poly(2-
(Dime hylamino)e hyl Me hac yla e) Polyca ions on T ans ec ion
E iciency and Cell Viabili y in Gene Deli e y
Poly(2-(dime hylamino)e hyl me hac yla e) (PDMAEMA) is an ideal candida e o
in es iga ing s uc u e-p ope y ela ionships in non- i al gene deli e y, because well-
de ined polyme s wi h a ying mo phologies can be syn hesized by means o con olled
polyme iza ion me hods such as a om ans e adical polyme iza ion (ATRP).1 S a -
shaped polyca ions ha e only ecen ly been used in gene ans ec ion and he e was some
e idence o a supe io ans ec ion pe o mance o his speci ic polyme a chi ec u e
epo ed in he li e a u e.2, 3 We we e especially in e es ed how s uc u al pa ame e s,
such as he a m numbe and a m leng h o s a -shaped polyca ione, in luence hei
ans ec ion p ope ies. By using ATRP, I p epa ed a ma e ial lib a y consis ing o linea ,
3-a m-, and 5-a m-s a polyme s wi h di e en molecula weigh s o each ype o
polyme . The wo s a -shaped DMAEMA polyme s we e polyme ized in a “co e- i s ”
app oach using mul i unc ional ini ia o molecules on he basis o suga s (glucose and
saccha ose). The inal polyme lib a y con ained wel e polyme s in o al and co e ed a
molecula weigh ange om 16 o 158 kDa (see Table 2-1).
Chap e 2 – O e iew o e he Thesis
41
Table 2-1: Nomencla u e and molecula cha ac e iza ion o he linea , 3-a m and 5-a m DMAEMA
polyme s syn hesized wi h ATRP.
A chi ec u e
Name
N / Moleculea
Mn [kDa]b
PDIc
Linea
L110
108
17.1
1.12
L520
518
81.7
-
L880
881
138.7
1.73
L1000
1003
157.9
1.80
3-A m
S-395
95
15.9
1.26
S-3210
210
34.0
1.16
S-3300
296
47.5
1.12
S-3600
596
94.7
1.12
S-3710
710
112.6
1.13
5-A m
S-5580
575
91.9
1.09
S-5700
699
111.4
1.12
S-5920
919
146.0
1.10
acalcula ed om he NMR-molecula weigh ; bde e mined om NMR con e sion da a; cmeasu ed ia SEC
wi h DMAc as eluen and poly(me hyl me hac yla e) as s anda d.
The same polyme iza ion condi ions we e used o all h ee ypes o polyme
a chi ec u es and well-de ined s a -shaped PDMAEMAs wi h na ow molecula weigh
dis ibu ions we e ob ained. Then, polyplexes we e o med wi h plasmid DNA (pDNA) in
inc easing a ios o PDMAEMA-ni ogen/DNA-phospha e (N/P a io) o es hem o
hei cy o oxici y as well as TE in Chinese Hams e O a y (CHO-K1) cells. Fo ease o
da a analysis, he concen a ion dependen cy o oxici y da a o each polyme sample was
con e ed in o a single alue, de ined as he le hal complex concen a ion o 50 % o he
cells (LCC50) which could hen be plo ed agains he molecula weigh (Figu e 2-1a).
In e es ingly, a end was ound ha poin s owa ds a educed cy o oxici y (high LCC50
alue) wi h inc easing deg ee o b anching o compa able molecula weigh s, i.e., 5-a m
s a s a e less oxic han 3-a m s a s which in u n a e less oxic han linea polyme s.
Chap e 2 – O e iew o e he Thesis
42
Figu e 2-1: (A) Plo o he LCC50- alues o a ious PDMAEMAs agains he molecula weigh o he
polyme . LCC50- alues we e calcula ed om MTT expe imen s using CHO-K1 cells. The symbols
ep esen linea (squa es), 3-a m s a ( iangles) and 5-a m s a (s a s) PDMAEMA. (B) F ac ion o
ans ec ed cells plo ed agains he ela i e iabili y o he polyplexes om DMAEMA polyme s a N/P
a ios 2 (black), 5 (da k g ey), 10 (ligh g ey) and 20 (open symbols). The a e age numbe o monome s pe
polyca ion is gi en nex o each en y. Da a ep esen mean alue o h ee independen expe imen s. The
a ow ep esen s he gene al cou se o a polyca ion h ough he g aph wi h inc easing N/P a io ( om g ey
= low o black = high N/P a io).
Cellula oxici y can ha e a di ec in luence on he TE, as cell dea h dec eases he
p oduc ion o epo e genes. I is he e o e easonable o di ec ly connec he oxici y o a
Chap e 2 – O e iew o e he Thesis
43
gi en N/P a io wi h he co esponding TE. To ha e bo h o hese impo an pa ame e s
isualized in one g aph, we in oduced a plo o he TE agains ela i e iabili y o all
N/P a ios in he polyme lib a y as depic ed in Figu e 2-1b. This new ype o g aph
allows he eade o quickly iden i y he polyme ic ma e ial and N/P a io wi h ideal
ans ec ion p ope ies, i.e. he da a poin s ha appea in he uppe igh quad an numbe
2. Addi ionally, his ype o g aph nicely illus a es he e ec o inc easing he N/P a io
o a ce ain DMAEMA polyme , s a ing wi h low oxici y and TE, hen going h ough a
adeo egion be ween inc easing TE and oxici y, while inally he oxici y domina es
and esul s in a dec eased TE. This beha io is illus a ed by he a ow in Figu e 2-1b.
F om he da ase we could u he ind ha polyme s below a c i ical molecula weigh o
app oxima ely 20 kDa (co esponding o 130 monome uni s in case o PDMAEMA),
exhibi no signi ican ans ec ion, sugges ing ha polyme s wi h an in e media e
molecula weigh and a b anched a chi ec u e would be good candida es o gene
deli e y.
2. Nano-Pa icula e Non-Vi al Agen o he E ec i e Deli e y o pDNA
and siRNA o Di e en ia ed Cells and P ima y Human T Lymphocy es
Wi h he knowledge om he polyme lib a y con aining linea , 3- and 5-a m s a
DMAEMA polyme s desc ibed in Chap e 2.1, we hen es ed he ans ec ion p ope ies
o a s a -shaped PDMAEMA wi h 20 a ms (Si-PDMAEMA). This polyme had been
ob ained again by ATRP “co e- i s ” me hod using a mul i unc ional silsesquioxane
nanopa icle as he ini ia o (Scheme 2-1a).

Chap e 2 – O e iew o e he Thesis
44
Scheme 2-1. (A) Chemical s uc u e o s a -shaped Si-PDMAEMA syn hesized ia “co e- i s ” me hod by
ATRP; (B) S a -like PDMAEMA micelle sel -assembled om amphiphilic PB-b-PDMAEMA diblock
copolyme .
Despi e i s la ge molecula weigh (Mn = 730 kg/mol), we could achie e e y good
cellula iabili y coupled wi h ex emely high ans ec ion e iciencies in CHO-K1 cells
(74 % TE) wi h 93 % el. iabili y on a e age ha su passed he bes esul s om he
“gold s anda d” poly(e hylene imine) (PEI) (50 % TE wi h 94 % el. iabili y on
a e age). In a ious cell lines ha a e gene ally conside ed o be mo e di icul o
ans ec han CHO-K1 cells, he Si-PDMAEMA pe o med be e ela i e o PEI as is
exempla ily shown o C2C12 cells (Figu e 2-2). These cells s op di iding when he
cul u e pla e is densely popula ed (con luen ), which signi ican ly hinde s success ul
ans ec ion o mos polyme ic ec o s. Fu he mo e, he con luen C2C12 cells could
easily be di e en ia ed in o myo ubes h ough a change o he cul u e medium
composi ion. In all o he cases Si-PDMAEMA (Figu e 2-2, open symbols) ga e highe
TE o e e y single ans ec ion expe imen as compa ed o PEI (Figu e 2-2, closed
symbols).
Chap e 2 – O e iew o e he Thesis
45
Figu e 2-2. Analysis o he pe cen age o ans ec ed cells agains he ela i e iabili y a e ans ec ion in
C2C12 cells. T ans ec ion e iciencies in di iding (, ), non-di iding myoblas s (, ) and myo ubes
(, ) a e plo ed agains he iabili y. Black symbols: PEI, whi e symbols: Si-PDMAEMA. Da a shown
a e om indi idual ans ec ions.
The supe io ans ec ion pe o mance o Si-PDMAEMA is based on i s gene al
a chi ec u e, whe e a mul i ude o polyme ic a ms emana e om a common cen e , a he
han he speci ic polyme sample: When polyme ic micelles om an amphiphilic diblock
copolyme (polybu adiene-block-PDMAEMA; PB-b-PDMAEMA) comp ising a PB co e
and PDMAEMA co ona, which esemble a s a -shaped a chi ec u e (Scheme 2-1b), we e
used o gene deli e y, a compa able pe o mance o ha o Si-PDMAEMA was ound.
Bo h ypes o nanos uc u es could also ans ec human T lymphocy es wi h pDNA mo e
e icien ly as compa ed o he s anda d me hod o elec opo a ion o hese cell ypes.
Addi ionally, RNA in e e ence could also success ully be pe o med wi h bo h
polyme ic ec o s o s a -like a chi ec u e, eaching up o 40 % silencing e iciency o he
a ge ed gene in human T lymphocy es. The ema kable ans ec ion pe o mance o his
class o polyme s, combined wi h he la ge numbe o di e en cell lines i can be applied
o, especially o non-di iding o di e en ia ed cells, makes hese s a -like polyme s
highly in e es ing ma e ials o in i o gene deli e y.
Chap e 2 – O e iew o e he Thesis
46
3. Double-Laye ed Micella In e polyelec oly e Complexes – How
Many Shells o a Co e?
MCMs a e highly complex nanos uc u es wi h possible applica ions in empla ing, as
nano eac o s, o ca ying ca alys s and in biomedical d ug deli e y o imaging. By using
iblock e polyme s, i is possible o ob ain MCMs wi h wo chemically di e en
compa men s in he co e o he esul ing micelles. Howe e , inc easing he numbe o
dis inguishable compa men s o mo e han wo is gene ally e y di icul .
He e, we es ablished a new ou e o he o ma ion o dis inguishable and chemically
di e en compa men s in MCMs om ionic iblock e polyme s by using he nega i ely
cha ged co ona o hose micelles o IPEC o ma ion wi h opposi ely cha ged polyions.
The o iginal MCMs used in his wo k o med h ough sel -assembly o poly(bu adiene)-
block-poly(1-me hyl-2- inyl py idinium)-block-poly(me hac ylic acid) (BVqMAA) in
aqueous solu ion. The MAA co ona s abilizes he micelles and is easily accessible o
u he eac ions. Fi s , we used qua e nized PDMAEMA (PDMAEMAq), which e ains
i s posi i e cha ge e en a high pH alues (pH = 10) whe e PMAA is ully dep o ona ed.
Upon mixing he polyca ion solu ion wi h BVqMAA micelles, an IPEC was immedia ely
o med, which collapsed on o he co e o he micelles. This new IPEC compa men (2nd
IPEC) comp ising PDMAEMAq and PMAA could be dis inguished in c yogenic
ansmission elec on mic oscopy (c yo-TEM) measu emen s om he o iginal in a-
micella IPEC shell (Vq/MAA). Fu he mo e, a comple e second laye was o med
(Figu e 2-3, le side) leading o an onion- ype mo phology. Non-complexed MAA om
he o iginal micella co ona se ed o s abilize he micelles in solu ion below a c i ical
complexa ion a io. The 2nd IPEC laye was ound o 3 di e en block leng hs o he
MAA block in BVqMAA micelles, anging om 345 o 550 uni s. The leng h o he wo
DMAEMAq homopolyme s (157 and 820 uni s) used o complex o ma ion did no
signi ican ly a ec s uc u e o ma ion. I complexa ion a ios close o cha ge neu ali y
we e eached, a mac oscopic phase sepa a ion wi h p ecipi a ion o he MCMs was ound.
This mac oscopic p ecipi a ion a high complexa ion a io was a oided when ins ead o a
homopolyme he double hyd ophilic diblock copolyme o PEG-b-PDMAEMAq was
used o IPEC o ma ion (Figu e 2-3, igh side). The new laye ed compa men om
PDMAEMAq/MAA IPEC de eloped as be o e, bu he colloidal s abili y o he pa icles
Chap e 2 – O e iew o e he Thesis
47
was e ained e en a cha ge neu aliza ion, because he PEG segmen se ed as s abilizing
co ona chains.
Figu e 2-3: Schema ic pa hway o he o ma ion o double-laye ed IPECs om BVqMAA iblock
e polyme micelles and ei he PDMAEMAq homopolyme s (le ) o a PEG-b-PDMAEMAq diblock
copolyme ( igh ). Scale ba s in he inse s ep esen 40 nm.
Chap e 2 – O e iew o e he Thesis
54
d ug ca ying capaci y and he apeu ic e icacy o BVqMAA MCMs, while he
in e ac ions o he micelles in biological su oundings could be uned by con olling he
co ona composi ion.

Chap e 2 – O e iew o e he Thesis
55
6. Indi idual Con ibu ions o Join Publica ions
The esul s p esen ed wi hin his hesis we e ob ained in collabo a ion wi h o he pe sons
and we e p e iously published. In he ollowing he indi idual con ibu ions o each co-
au ho a e speci ied. The as e isk indica es he co esponding au ho (s) o he espec i e
publica ion.
Chap e 3
This wo k has been published in Biomac omolecules 12, pp. 4247-4255 (2011) unde he
i le:
“In luence o Polyme A chi ec u e and Molecula Weigh o Poly(2-
(dime hylamino)e hyl me hac yla e) Polyca ions on T ans ec ion E iciency and Cell
Viabili y in Gene Deli e y”
by Ch is ophe V. Syna schke, Anja Schallon, Valé ie Jé ôme, Ru h F ei ag*, and Axel
H. E. Mülle *
This wo k was conduc ed in collabo a ion wi h he chai o “P ocess Bio echnology” a
he Uni e si y o Bay eu h. I syn hesized all ma e ials, conduc ed hei physicochemical
cha ac e iza ion and w o e he manusc ip , excep ha :
A. Schallon was in ol ed in he planning o he expe imen s, pe o med all o he cell-
cul u e expe imen s and co ec ed he manusc ip .
V. Jé ôme, R. F ei ag and A.H.E. Mülle we e in ol ed in scien i ic discussions and
co ec ing he manusc ip .
Chap e 2 – O e iew o e he Thesis
56
Chap e 4
This wo k has been published in Biomac omolecules 13, pp. 3463−3474 (2012) unde he
i le:
“Nanopa icula e Non-Vi al Agen o he E ec i e Deli e y o pDNA and siRNA o
Di e en ia ed Cells and P ima y Human T Lymphocy es”
by Anja Schallon, Ch is ophe V. Syna schke, Valé ie Jé ôme, Axel H. E. Mülle , and
Ru h F ei ag*
This wo k was conduc ed in collabo a ion wi h he chai o “P ocess Bio echnology” a
he Uni e si y o Bay eu h. I syn hesized all ma e ials, conduc ed hei physico-chemical
cha ac e iza ion and w o e pa s o he manusc ip , excep ha : A. Schallon was in ol ed
in he planning o he expe imen s, pe o med o he cell-cul u e expe imen s and w o e
pa s o he manusc ip .
V. Jé ôme and R. F ei ag we e in ol ed in scien i ic discussions, planning o he cell-
cul u e expe imen s and w o e pa s o he manusc ip .
A.H.E. Mülle was in ol ed in scien i ic discussions and co ec ed he manusc ip .
Chap e 5
This wo k has been published in So Ma e 7, pp. 1714-1725 (2011) unde he i le:
“Double-Laye ed Micella In e polyelec oly e Complexes-How Many Shells o a
Co e?”
by Ch is ophe V. Syna schke, Felix H. Schache *, Melanie Fö sch, Ma kus D echsle
and Axel H. E. Mülle *
I conduc ed all o he expe imen s and w o e pa s o he manusc ip , excep ha :
F.H. Schache syn hesized he BVT iblock e polyme s, w o e pa s o he manusc ip
and was in ol ed in he planning o he expe imen s.
M. Fö sch and M. D echsle conduc ed all o he c yo-TEM measu emen s.
A.H.E. Mülle was in ol ed in scien i ic discussions and co ec ed he manusc ip .
Chap e 2 – O e iew o e he Thesis
57
Chap e 6
This wo k has been published in Mac omolecules 46, pp. 6466-6474 (2013) unde he
i le:
“Micella In e polyelec oly e Complexes Wi h a Compa men alized Shell”
by Ch is ophe V. Syna schke, Tina I. Löbling, Melanie Fö sch, And eas Hanisch, Felix
H. Schache *, and Axel H. E. Mülle *,
I syn hesized he BVT and BVqMAA polyme s, was in ol ed in he planning o he
expe imen s and w o e he manusc ip , excep ha :
T.I. Löbling pe o med all o he syn hesis, physico-chemical cha ac e iza ion and
co ec ed he manusc ip .
M. Fö sch conduc ed all o he c yo-TEM measu emen s.
A. Hanisch assis ed wi h BVT syn hesis and co ec ed he manusc ip .
F.H. Schache and A.H.E. Mülle we e in ol ed in scien i ic discussions and co ec ed
he manusc ip .
Chap e 2 – O e iew o e he Thesis
58
Chap e 7
This wo k has been published in ACS Nano (DOI: 10.1021/nn4028294) unde he i le:
“Mul icompa men Micelles wi h Adjus able Poly(e hylene glycol) Shell o
E icien in i o Pho odynamic The apy”
by Ch is ophe V. Syna schke, Takahi o Nomo o, Ho acio Cab al, Melanie Fö sch,
Kazuko Toh, Yu Ma sumo o, Kozo Miyazaki, And eas Hanisch, Felix H. Schache ,
Akihi o Kishimu a, Nobuhi o Nishiyama, Axel H. E. Mülle *, and Kazuno i Ka aoka*
This wo k was done in collabo a ion wi h he g oup o P o . Kazuno i Ka aoka a he
Uni e si y o Tokyo, Japan. I conduc ed all o he expe imen s and w o e he manusc ip ,
excep ha :
T. Nomo o was in ol ed in planning o he expe imen s, conduc ed some o luo escence
mic oscopy measu emen s and co ec ed he manusc ip .
H. Cab al conduc ed pa o he animal expe imen s, was in ol ed in he planning o
expe imen s and co ec ed he manusc ip .
M. Fö sch conduc ed all o he c yo-TEM measu emen s.
K. Toh and Y. Ma sumo o conduc ed luo escence mic oscopy measu emen s on animals.
K. Miyazaki assis ed wi h in i o PDT e icacy measu emen s and co ec ed he
manusc ip .
A. Hanisch assis ed wi h BVT syn hesis and co ec ed he manusc ip .
F.H. Schache , A. Kishimu a, N. Nishiyama, A.H.E. Mülle and K. Ka aoka we e
in ol ed in scien i ic discussions and co ec ed he manusc ip .
Chap e 2 – O e iew o e he Thesis
59
7. Re e ences
1. Ma yjaszewski, K., Mac omolecules 2012, 45, (10), 4015-4039.
2. Nakayama, Y.; Masuda, T.; Nagaishi, M.; Hayashi, M.; Ohi a, M.; Ha ada-Shiba,
M., Cu en D ug Deli e y 2005, 2, (1), 53-57.
3. Nemo o, Y.; Bo o ko , A.; Zhou, Y. M.; Takewa, Y.; Ta sumi, E.; Nakayama, Y.,
Bioconjuga e Chemis y 2009, 20, (12), 2293-2299.

Chap e 2 – O e iew o e he Thesis
60
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
61
Chap e 3
In luence o Polyme A chi ec u e and Molecula Weigh o
Poly(2-(Dime hylamino)e hyl Me hac yla e) Polyca ions on
T ans ec ion E iciency and Cell Viabili y in Gene Deli e y
The esul s o his chap e ha e been published in Biomac omolecules as:
“In luence o Polyme A chi ec u e and Molecula Weigh o Poly(2-
(Dime hylamino)e hyl Me hac yla e) Polyca ions on T ans ec ion E iciency and Cell
Viabili y in Gene Deli e y”
by Ch is ophe V. Syna schke, Anja Schallon, Valé ie Jé ôme, Ru h F ei ag, and Axel H.
E. Mülle
Rep in ed wi h pe mission om Biomac omolecules 2011, 12, 4247-4255. Copy igh
2011 Ame ican Chemical Socie y.
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
62
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
63
Abs ac
Non i al gene deli e y wi h he help o polyca ions has aised conside able in e es in
he scien i ic communi y o e he las decades. He ein, we p esen a sys ema ic s udy on
he in luence o he molecula weigh and a chi ec u e o poly(2-(dime hylamino)e hyl
me hac yla e) (PDMAEMA) on he ans ec ion e iciency and he cy o oxici y in CHO-
K1 cells. A lib a y o well de ined homopolyme s wi h a linea and s a -shaped opology
(3- and 5-a m s a s) was syn hesized ia a om ans e adical polyme iza ion (ATRP).
The molecula weigh s o he polyca ions anged om 16 o 158 kDa. We ound ha he
cy o oxici y a a gi en molecula weigh dec eased wi h inc easing numbe o a ms. Fo a
success ul ans ec ion a minimum molecula weigh was necessa y, since he polyme s
wi h a numbe -a e age molecula weigh , Mn, below 20 kDa showed negligible
ans ec ion e iciency a any o he es ed polyelec oly e complex composi ions. F om
he combined analysis o cy o oxici y and ans ec ion da a, we p opose ha polyme s
wi h a b anched a chi ec u e and an in e media e molecula weigh a e he mos
p omising candida es o e icien gene deli e y, since hey combine low cy o oxici y
wi h accep able ans ec ion esul s.
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
70
Complex Fo ma ion
pDNA/polyme polyplexes we e p epa ed a oom empe a u e using 3 µg pDNA and
a ied amoun s o he espec i e polyca ion s ock solu ion o achie e he indica ed
PDMAEMA-ni ogen/DNA-phospha e (N/P) a ios. Fo his pu pose, he pDNA was
dilu ed in a inal olume o 200 µL o 150 mM NaCl-solu ion. The equi ed polyme
solu ion was added in a single d op o he pDNA solu ion and he mix u e was
immedia ely o exed o 10 sec a ull speed, ollowed by incuba ion a oom
empe a u e o 30 min.
T ans ec ion o Mammalian Cells
Cells we e seeded in 2 mL g ow h medium a a densi y o 2 x 105 cells/well in 6-well
pla es 24 h p io o ans ec ion. One hou p io o ans ec ion, cells we e insed wi h
PBS and supplemen ed wi h 2 mL Op iMEM. The polyplex suspension (200 µL) was
added o he cells and he pla es we e cen i uged o 5 min a 200 g and placed o 4 h in
he incuba o . A e wa ds, he medium was emo ed, 2 mL o esh g ow h medium we e
added, and he cells we e u he incuba ed o 20 h. Cells we e ha es ed by
ypsiniza ion and esuspended in PBS. The ela i e exp ession o eGFP luo escence o
1 x 104 cells was quan i ied ia low cy ome y using a Cy omics FC 500 equipped wi h
he CXP Analysis esea ch so wa e (Beckman Coul e , K e eld, Ge many). The
pa ame e s o he de ice we e se , so ha he luo escence in ensi y alue o he con ol
cells (non- ea ed) was below 100. All cells showing a luo escence in ensi y abo e his
alue we e eco ded as ans ec ed.
MTT Assay (Cy o oxici y S udies)
The cy o oxici y o he polyplexes a a ious N/P- a ios was e alua ed in 96-well
mic o i e pla es by he MTT assay ollowing essen ially he ans ec ion p o ocol. The
CHO-K1 cells we e seeded in g ow h medium a a densi y o 2 x 104 cells/well 24 h p io
o he expe imen . One hou p io o he expe imen , he medium was disca ded and
se um- ee g ow h medium was added. Cells we e incuba ed wi h he indica ed polyplex
p epa a ion o 4 h, hen he medium was eplaced by se um-con aining medium
(analogously o he ans ec ion p o ocol abo e). A e 20h incuba ion, cells we e insed
wi h PBS and u he incuba ed in 200 µL MTT solu ion (0.5 mg/mL in PBS) o 2 h. The

Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
71
solu ion was aspi a ed, eplaced wi h 200 µL DMSO and mixed a 150 pm o 5 min o
dissol e he o mazan c ys als p oduced in he eac ion. Abso bance was hen measu ed
a 580 nm in a mic opla e eade (Genios P o, Tecan GmbH, C ailsheim, Ge many) wi h
un ea ed cells se ing as con ols. The le hal complex concen a ion (LCC50) was de ined
as polyme concen a ion o he complex a which 50 % o me abolic ac i i y could be
measu ed.
S a is ical Analysis
G oup da a a e epo ed as mean ± SD. Fo ans ec ion esul s, he S uden ’s - es was
used o de e mine whe he da a g oups di e ed signi ican ly om each o he . S a is ical
signi icance was de ined as ha ing P- alues < 0.05 o signi icance and P- alues < 0.01
o g ea signi icance. To de e mine he signi icance o mo e han wo g oups o da a,
ANOVA was used wi h a de ined P- alue < 0.05 o signi ican di e ences.
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
72
Resul s and Discussion
The aim o his wo k was o s udy he in luence o polyme a chi ec u e and molecula
weigh on bo h ans ec ion e iciency (TE) and cy o oxici y o DMAEMA-based
polyme s in gene deli e y expe imen s. Fo his pu pose, a lib a y o h ee di e en
polyme a chi ec u es, namely linea , 3-a m- and 5-a m s a s, was syn hesized by means
o ATRP. We chose his con olled adical polyme iza ion me hod, as i allows a p ecise
con ol o he molecula weigh o he esul ing polyme s, while ensu ing na ow
molecula weigh dis ibu ions. This is in con as o many o he s udies published in he
pe inen li e a u e, whe e he PDMAEMA used o he ans ec ion expe imen s is
equen ly p epa ed ia ee adical polyme iza ion. Such polyme s ypically ha e a b oad
molecula weigh dis ibu ion, especially in case o la ge molecules.18, 38 Wi h such
polydispe se samples i is almos impossible o disce n he in luence o he indi idual
species. Ins ead meaningless a e age alues a e de e mined. Any sys ema ic in es iga ion
o he in luence o molecula pa ame e s (a chi ec u e, molecula weigh , e c.) on he
gene deli e y abili y equi es ins ead polyme s wi h a minimal he e ogenei y in hese
pa ame e s. This becomes e en mo e impo an o a chi ec u es wi h a highe complexi y
such as s a s. Fu he mo e, when ATRP is used o p epa e he polyca ions, unc ional
end-g oups emain on he polyme chains, which can be used o subsequen
modi ica ions such as luo opho e labelling, as was demons a ed in an ea lie
publica ion.28
Polyme Syn hesis and Cha ac e iza ion
The polyme iza ion p ocess o he linea and s a -shaped samples is depic ed in
Scheme 3-1. We used a co e- i s app oach wi h unc ionalized suga s (glucose43 and
saccha ose44) as ini ia o s o he s a polyme s (Scheme 3-1B and C, espec i ely). Due
o s e ic hind ance, he ac ual a m numbe pe molecule is lowe han he numbe o
ini ia ion si es. In ou expe ience, he a e age a m-numbe o he glucose-based
polyme s is a ound h ee a ms pe molecule and we con i med his o he S-3300 sample
h ough alkaline clea age o he a ms, whe e an a e age numbe o a ms o 3.1 was
de e mined. PDMAEMA om he saccha ose-based ini ia o usually has sligh ly mo e
han i e a ms (5.4 – 5.6).22 A de ailed desc ip ion o he syn hesis o he ini ia o s and
syn he ic p ocedu e o he clea age o he a ms has been published p e iously.42, 45
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
73
Scheme 3-1: Syn hesis o he PDMAEMA samples wi h linea (A), 3-a m (B) and 5-a m (C) s a -shaped
a chi ec u e, om he espec i e ini ia o s ia ATRP. Due o s e ic hind ance no all ini ia ing si es o he
s a ini ia o s can o m polyme chains. The bo om line shows a schema ic ep esen a ion o he espec i e
polyme a chi ec u e.
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
74
Table 3-1: Nomencla u e and molecula cha ac e iza ion o he linea , 3-a m and 5-a m DMAEMA
polyme s syn hesized wi h ATRP. Molecula weigh a e ages we e calcula ed om NMR con e sion da a
and PDI was de e mined wi h SEC.
A chi ec u e
Name
N / Moleculea
Mn [kDa]b
PDIc
Linea
L110
108
17.1
1.12
L520
518
81.7
-
L880
881
138.7
1.73
L1000
1003
157.9
1.80
3-A m
S-395
95
15.9
1.26
S-3210
210
34.0
1.16
S-3300
296
47.5
1.12
S-3600
596
94.7
1.12
S-3710
710
112.6
1.13
5-A m
S-5580
575
91.9
1.09
S-5700
699
111.4
1.12
S-5920
919
146.0
1.10
acalcula ed om he NMR-molecula weigh ; bde e mined om NMR con e sion da a; cmeasu ed ia SEC
wi h DMAc as eluen and poly(me hyl me hac yla e) as s anda d.
As shown in Table 3-1, o each a chi ec u e we syn hesized a se ies o polyme s wi h
inc easing a e age molecula weigh s. The name o each sample is gi en as he polyme
a chi ec u e in capi al le e s, while he subsc ip s deno e he a e age numbe o
monome s pe molecule as de e mined om he NMR con e sion da a. SEC
measu emen s con i med con olled polyme iza ion condi ions, as polyme s show a a he
na ow molecula weigh dis ibu ion, a leas o he s a -shaped polyme s. One o he
linea polyme s (L520) could no be de ec ed in he SEC measu emen s, e en a high
polyme concen a ions (> 5 mg / mL). The eason o his emains obscu e. Addi ionally,
he polydispe si y indices (PDI) o he linea polyme s a e conside ably highe han hose
o he s a -shaped samples. This could be an indica ion o an uncon olled polyme iza ion
o he linea samples, caused o example h ough a complex o ma ion be ween he
g owing polyme chains and he coppe ca alys . Also, PDMAEMA is known o in e ac
wi h he column ma e ial du ing size exclusion ch oma og aphy, which has o be
supp essed h ough he addi ion o sal o he eluen . An in e ac ion o he sample wi h he
column ma e ial would also esul in a b oadening o he molecula weigh dis ibu ion
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
75
and should be mo e p onounced o he linea samples, because o hei less dense
s uc u e and inc eased hyd odynamic adius compa ed o he b anched s uc u es. Fo all
u he discussions, in pa icula he nomencla u e o he polyme s, he molecula weigh
de e mined ia NMR was used.
Cy o oxici y S udies by MTT Assay
The polyca ion lib a y was hen used o sys ema ically s udy he e ec o bo h
molecula weigh and polyme a chi ec u e on cy o oxici y and gene deli e y e iciency
in mammalian cells. All expe imen s we e pe o med using Chinese Hams e O a y
(CHO-K1) cells, as his cell line is well es ablished in ou g oup and also commonly used
o ecombinan p o ein p oduc ion in he biopha maceu ical indus y. The cy o oxici y o
he polyplexes om he indica ed polyme s a di e en N/P a ios was de e mined by
MTT assay. The esul s a e shown in Figu e 3-1, whe e he a e age o he h ee
expe imen s is gi en as he esidual cell iabili y ela i e o an un ea ed cell popula ion.

Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
76
Figu e 3-1: Rela i e iabili y o CHO-K1 cells incuba ed wi h polyplexes made o linea , 3-a m and 5-a m
PDMAEMA o a ying molecula weigh s a inc easing N/P a ios (1, 2, 5, 10, 20 and 50). Incuba ion
pe iod was 4 h wi h polyplexes in se um- ee media and 20 h in g ow h media a a cell seeding densi y o
2 x 104 cells/well. The esul s a e exp essed as a pe cen age o he con ol cell cul u e. Da a ep esen mean
± SD, n ≥ 3. The S uden s - es was used o de e mine he N/P a ios ha signi ican ly di e om 100 %
iabili y (*, P < 0.05; #, P < 0.01).
As shown in Figu e 3-1, all polyplexes became oxic a a su icien ly high
concen a ion o he polyca ion (N/P a io), as can be seen om he dec easing a e age
ela i e iabili y o he cells. A dec ease o iabili y wi h inc easing N/P a io can be seen
o all polyme s used o complex o ma ion excep he ones wi h he lowes molecula
weigh s, namely L110 and S-395, which show he lowes cy o oxici y (highes esidual cell
iabili y) a in e media e N/P a ios. Bo h low molecula weigh polyme s showed no
signi ican cy o oxici y (P < 0.01) in he S uden s - es . Only a N/P = 50 o L110 and a
N/P = 20 o S-395 a signi ican di e ence (P < 0.05) was obse ed in he S uden s - es
compa ed o 100 % iabili y, indica ing a sligh ly oxic beha io . Polyca ions in gene al
a e oxic o cells as hey in e ac wi h a ious impo an anionic species ound in
biological sys ems including he memb ane lipids, (poly)nucleo ides and many p o eins.39,
46, 47 As he N/P- a io inc eases, he ac ion o non-complexed polyca ions in he
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
77
p epa a ion and hence he cy o oxici y inc eases. The smalles polyca ions included in ou
in es iga ion on he o he hand show low gene al oxici ies and can be conside ed quasi
non- oxic in he in es iga ed ange.
In o de o simpli y he amoun o da a and allow a be e compa ison be ween he
indi idual polyme s as well as he di e en a chi ec u es, he LCC50 (50 % le hal
concen a ion o complexes a a ixed DNA concen a ion) alue was de e mined o each
polyplex solu ion. The LCC50 alue hen indica es he polyca ion concen a ion whe e he
iabili y compa ed o he con ol cells eached 50 %. The alue was ex apola ed om a
plo o he iabili y agains he polyme concen a ion (see Schallon e al.28 o de ails). In
Figu e 3-2 he LCC50 alues a e plo ed agains he molecula weigh o each polyme in
a double loga i hmic scale. A smalle LCC50- alue ep esen s a mo e oxic polyme , since
a lowe mola polyca ion concen a ion is necessa y o educe iable cell numbe s o 50
%. A s eady dec ease o he LCC50 alue wi h inc easing molecula weigh o he
polyca ions can be seen om Figu e 3-2.
Figu e 3-2: Plo o he LCC50- alues (50 % le hal complex concen a ion) o a ious PDMAEMAs agains
he molecula weigh o he polyme in a double loga i hmic scale. The symbols ep esen linea (squa e), 3-
a m s a ( iangle) and 5-a m s a (s a ) PDMAEMA. LCC50- alues we e calcula ed om MTT expe imen s
wi h CHO-K1 cells.
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
78
Mo e impo an ly, when he di e en a chi ec u es a e compa ed o a simila
molecula weigh , he 5-a m s a polyme s show he lowes oxici ies, ollowed by he 3-
a m s a s and inally he linea polyme s. Ou da a he e o e hin s owa ds a dec ease o
cy o oxici y o PDMAEMA wi h inc easing a m-numbe . In his con ex , a s udy by
Newland e al. is o in e es .48 The au ho s desc ibe a highly b anched PDMAEMA
p epa ed h ough he copolyme iza ion o DMAEMA wi h e hylene glycol
dime hac yla e. In hei expe imen s, hey obse ed a dec ease in he cy o oxici y o
i egula ly b anched PDMAEMA compa ed o linea PDMAEMA, which sugges s ha
polyca ion cy o oxici y may dec ease no only wi h inc easing a m-numbe as indica ed
by ou esul s, bu in gene al as a consequence o inc eased b anching. Simila ends
we e also desc ibed by Xu e al. o di e en ypes o b anched DMAEMA polyme s.25,
26, 37
The easons o he cy o oxici y o polyca ions in gene al and PDMAEMA in
pa icula , ha e been in es iga ed in se e al s udies. I was ound ha polyca ions ha e a
endency o in e ac wi h he cellula memb ane and memb ane p o eins.18, 46 A dec ease
in he memb ane po en ial was obse ed, which poin s owa ds he o ma ion o holes in
he cellula memb ane.49 Fu he mo e, an in e ac ion o he polyca ion wi h impo an
p o eins and RNA in he cy osol has been specula ed upon.11 The gene al concep ion is
ha polyme s ca ying mo e cha ges pe molecule, e.g. la ge polyca ions, a e mo e oxic,
because hey ha e a s onge endency o bind nega i ely cha ged pep ides and e en ually
p ecipi a e wi hin he cy osol.17, 18 In a ecen s udy wi h well-de ined linea PDMAEMA
om ATRP i was ound ha hese polyme s induce cy o oxici y h ough a coope a i e
e ec om bo h memb ane dis up ion and apop osis.39 Howe e , he speci ic mechanism
may also depend on he cell ype.47 As a consequence o his obse a ion, se e al g oups
ha e syn hesized deg adable polyca ions made om small building blocks, which indeed
showed a educed cy o oxici y compa ed o hei non-deg adable analogues.50-53
Howe e , such an explana ion canno be applied he e, since he polyme s used in his
s udy a e no biodeg adable. The educed cy o oxici y is he e o e e y likely a esul o
he unique s a -shaped a chi ec u e o hose molecules. A s a -shaped molecule has he
highes densi y in he co e, which dec eases wi h inc easing dis ance om he co e.54 The
in e ac ion o he a ious posi i ely cha ged ni ogen a oms in such a s a wi h a he
lexible polyanions such as pDNA should no be hampe ed signi ican ly. In ac li le
di e ences can be obse ed in he s abili y o polyplexes om he same ype o
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
79
polyca ion, ega dless o i s a chi ec u e.55 In case o a pu a i e in e ac ion wi h a globula
p o ein molecule o e en mo e impo an ly he phospholipids in he cellula memb ane,
howe e , we p opose ha no all ni ogens in a s a -shaped polyme can pa icipa e in he
in e ac ion, since hose om he inne pa o he s a would be s e ically excluded. Since
in e ac ion wi h he phospholipids and he concomi an o ma ion o holes in he
memb ane is an impo an media o o cellula cy o oxici y, b anched and in pa icula
s a -shaped and dend i ic polyme s should be less oxic han hei linea coun e pa s,
while ans ec ion e iciency would no necessa ily be a ec ed.
T ans ec ion S udies
In o de o in es iga e he s uc u e- unc ion- ela ionship in ega d o gene ans e
capabili y, he polyca ions we e hen e alua ed as ans ec ion agen s. We chose he eGFP
ansgene and low cy ome y o analysis, since he choice o a epo e gene assay
p o ed no o be c ucial o he expe imen al ou come, as ecen ly e iewed by an Gaal
e al.56 In o de o success ully anspo gene ic ma e ial in o he nucleus o euka yo ic
cells, se e al ba ie s ha e o be o e come.7 Fi s , he DNA has o be condensed by he
polyca ion in o small and posi i ely cha ged pa icles, so called polyplexes. These
polyplexes hen ha e o be anspo ed in o he cell h ough he cellula memb ane. The
commonly accep ed mechanism o he up ake o polyplexes by cells is ia endocy osis.19,
57 Al e na i ely, i was p oposed ha some polyca ions (e.g. dend ime s) ha e he abili y
o di ec ly pene a e he cellula memb ane, as could be shown in expe imen s on model
memb anes.58 In any case, a e c ossing he cellula memb ane he polyplex needs o
p o ec he gene ic ma e ial om deg ada ion. Fu he mo e, he polyplex has o be
anspo ed o he nucleus be o e he gene ic ma e ial c osses he nuclea memb ane.
When all o hese ba ie s ha e success ully been o e come, he gene ic in o ma ion
can be p ocessed leading o he exp ession o ansgenes. In ou case, he ansgene was
he enhanced g een luo escen p o ein (eGFP). Success ully ans ec ed cells appea
g een in his case and hus a e easily de ec ed by low cy ome y. F om hese da a, he
ans ec ion e iciency (TE) was calcula ed as pe cen age o g een luo escen cells wi hin
he o al cell popula ion analyzed, Figu e 3-3. N/P a ios abo e alues o 20 we e no
es ed, as he cy o oxici y o he polyca ions a N/P = 20 inc eases (see Figu e 3-1)
gene ally esul ing in a low TE.
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
86
signi ican ans ec ion. Addi ionally, a leas o he s a -shaped polyme s, an inc ease in
molecula weigh does no necessa ily esul in an imp o ed gene deli e y. Ou da a
sugges s, ha an ideal combina ion be ween low cy o oxici y and high ans ec ion should
be achie able wi h a b anched s uc u e displaying an in e media e molecula weigh . In
he u u e, i needs o be cla i ied, whe he s a -shaped polyme s wi h mo e han 5 a ms
can u he educe he cy o oxici y, which could lead o an inc ease in ans ec ion
e iciency. Also, o he s uc u es o e.g. i egula ly b anched polyme s should be es ed.
Acknowledgemen s
C. V. Syna schke g a e ully acknowledges unding by he s a e o Ba a ia h ough a
BayEFG schola ship and ongoing suppo by he Eli e Ne wo k o Ba a ia (ENB). The
au ho s would like o hank D. V. Pe gusho (Moscow), A. Kishimu a (Tokyo) and C. B.
Ts e ano (So ia) o help ul discussions. M. Böhm is acknowledged o pe o ming he
SEC measu emen s.

Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
87
Re e ences
1. de Smed , S. C.; Demees e , J.; Hennink, W. E Pha maceu ical Resea ch 2000,
17, 113-126.
2. He, C.-X.; Taba a, Y.; Gao, J.-Q. In e na ional Jou nal o Pha maceu icals 2010,
386, 232-242.
3. Jeong, J. H.; Kim, S. W.; Pa k, T. G. P og ess in Polyme Science 2007, 32, 1239-
1274.
4. T eco, D. A.; Selden, R. F. Molecula Medicine Today 1995, 1, 314-321.
5. Wong, S. Y.; Pele , J. M.; Pu nam, D. P og ess in Polyme Science 2007, 32, 799-
837.
6. Godbey, W. T.; Mikos, A. G. Jou nal o Con olled Release 2001, 72, 115-125.
7. Min ze , M. A.; Simanek, E. E. Chemical Re iews 2009, 109, 259-302.
8. Ve ma, I. M.; Somia, N. Na u e 1997, 389, 239-242.
9. Boussi , O.; Lezoualch, F.; Zan a, M. A.; Me gny, M. D.; Sche man, D.;
Demeneix, B.; Beh , J. P. P oceedings o he Na ional Acadamy o Science o he
Uni ed S a es o Ame ica 1995, 92, 7297-7301.
10. Godbey, W. T.; Wu, K. K.; Mikos, A. G. Jou nal o Con olled Release 1999, 60,
149-160.
11. Pa hami a , L.; La sen, A. K.; Hun e , A. C.; And esen, T. L.; Moghimi, S. M So
Ma e 2010, 6, 4001-4009.
12. on Ge sdo , K.; Sande s, N. N.; Vandenb oucke, R.; de Smed , S. C.; Wagne ,
E.; Og is, M. Molecula The apy 2006, 14, 745-753.
13. Deshpande, M. C.; Da ies, M. C.; Ga ne , M. C.; Williams, P. M.; A mi age, D.;
Bailey, L.; Vam akaki, M.; A mes, S. P.; S olnik, S. Jou nal o Con olled
Release 2004, 97, 143-156.
14. Dub uel, P.; Schach , E. Mac omolecula Bioscience 2006, 6, 789-810.
15. Funho , A. M.; an Nos um, C. F.; Lok, M. C.; K uij ze , J. A. W.; C ommelin,
D. J. A.; Hennink, W. E. Jou nal o Con olled Release 2005, 101, 233-246.
16. Lam, J. K. W.; A mes, S. P.; S olnik, S. Jou nal o D ug Ta ge ing 2011, 19, 56-
66.
17. an de We e ing, P.; Che ng, J. Y.; Talsma, H.; C ommelin, D. J. A.; Hennink, W.
E. Jou nal o Con olled Release 1998, 53, 145-153.
18. an de We e ing, P.; Che ng, J.-Y.; Talsma, H.; Hennink, W. E. Jou nal o
Con olled Release 1997, 49, 59-69.
19. an de Aa, M.; Hu h, U. S.; Ha ele, S. Y.; Schube , R.; Oos ing, R. S.;
Mas oba is a, E.; Hennink, W. E.; Peschka-Suss, R.; Koning, G. A.; C ommelin,
D. J. A. Pha maceu ical Resea ch 2007, 24, 1590-1598.
20. C eu z, S.; Teyssie, P.; Je ome, R. Mac omolecules 1997, 30, 6-9.
21. Rungsa d hong, U.; Deshpande, M.; Bailey, L.; Vam akaki, M.; A mes, S. P.;
Ga ne , M. C.; S olnik, S. Jou nal o Con olled Release 2001, 73, 359-380.
22. Plampe , F. A.; Schmalz, A.; Peno -Chang, E.; D echsle , M.; Jusu i, A.;
Ballau , M.; Mülle , A. H. E. Mac omolecules 2007, 40, 5689-5697.
23. Sahnoun, M.; Cha ey e, M.-T.; Ve on, L.; Delai , T.; D'Agos o, F. Jou nal o
Polyme Science, Pa A: Polyme Chemis y 2005, 43, 3551-3565.
24. Hea h, W. H.; Senyu , A. F.; Layman, J.; Long, T. E. Mac omolecula Chemis y
and Physics 2007, 208, 1243-1249.
25. Wang, Z. H.; Li, W. B.; Ma, J.; Tang, G. P.; Yang, W. T.; Xu, F. J.
Mac omolecules 2011, 44, 230-239.
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
88
26. Xu, F. J.; Ping, Y.; Ma, J.; Tang, G. P.; Yang, W. T.; Li, J.; Kang, E. T.; Neoh, K.
G. Bioconjuga e Chemis y 2009, 20, 1449-1458.
27. Xu, F. J.; Yang, W. T. P og ess in Polyme Science 2011, 36, 1099-1131.
28. Schallon, A.; Je ome, V.; Wal he , A.; Syna schke, C. V.; Mülle , A. H. E.;
F ei ag, R. Reac i e and Func ional Polyme s 2010, 70, 1-10.
29. Geo giou, T. K.; Phylac ou, L. A.; Pa ickios, C. S. Biomac omolecules 2006, 7,
3505-3512.
30. Geo giou, T. K.; Vam akaki, M.; Pa ickios, C. S.; Yamasaki, E. N.; Phylac ou, L.
A. Biomac omolecules 2004, 5, 2221-2229.
31. Geo giou, T. K.; Vam akaki, M.; Phylac ou, L. A.; Pa ickios, C. S.
Biomac omolecules 2005, 6, 2990-2997.
32. Pa i i, K. S.; Mas oyiannopoulos, N. P.; Phylac ou, L. A.; Pa ickios, C. S.
Biomac omolecules 2011, 12, 1468-1479.
33. Dai, F.; Sun, P.; Liu, Y.; Liu, W. Bioma e ials 2010, 31, 559-569.
34. Li, J. S.; Guo, Z. Z.; Xin, J. Y.; Zhao, G. L.; Xiao, H. N. Ca bohyd a e Polyme s
2010, 79, 277-283.
35. Loh, X. J.; Zhang, Z. X.; Mya, K. Y.; Wu, Y. L.; He, C. B.; Li, J. Jou nal o
Ma e ials Chemis y 2010, 20, 10634-10642.
36. Nemo o, Y.; Bo o ko , A.; Zhou, Y. M.; Takewa, Y.; Ta sumi, E.; Nakayama, Y.
Bioconjuga e Chemis y 2009, 20, 2293-2299.
37. Xu, F. J.; Zhang, Z. X.; Ping, Y.; Li, J.; Kang, E. T.; Neoh, K. G.
Biomac omolecules 2009, 10, 285-293.
38. Layman, J. M.; Rami ez, S. M.; G een, M. D.; Long, T. E. Biomac omolecules
2009, 10, 1244-1252.
39. Cai, J. G.; Yue, Y. A.; Rui, D.; Zhang, Y. F.; Liu, S. Y.; Wu, C. Mac omolecules
2011, 44, 2050-2057.
40. zg n, S. Akdemi , . asenpusch, G. Maucksch, C. Golas, M. M. Sande ,
B.; S a k, H.; Imke , R.; Lu z, J.-F.; Rudolph, C. Biomac omolecules 2009, 11,
39-50.
41. Venka a aman, S.; Ong, W. L.; Ong, Z. Y.; Loo, S. C. J.; Ee, P. L. R.; Yang, Y. Y.
Bioma e ials 2011, 32, 2369-2378.
42. Plampe , F. A.; Becke , H.; Lanzendo e , M.; Pa el, M.; Wi emann, A.; Ballau ,
M.; Mülle , A. H. E. Mac omolecula Chemis y and Physics 2005, 206, 1813-
1825.
43. Haddle on, D. M.; Edmonds, R.; Heming, A. M.; Kelly, E. J.; Kukulj, D. New
Jou nal o Chemis y 1999, 23, 477-479.
44. S enzel-Rosenbaum, M. H.; Da is, T. P.; Chen, V. K.; Fane, A. G.
Mac omolecules 2001, 34, 5433-5438.
45. Plampe , F. A.; Ruppel, M.; Schmalz, A.; Bo iso , O.; Ballau , M.; Mülle , A. H.
E. Mac omolecules 2007, 40, 8361-8366.
46. Fische , D.; Li, Y.; Ahlemeye , B.; K iegls ein, J.; Kissel, T. Bioma e ials 2003,
24, 1121-1131.
47. Rawlinson, L.-A. B.; O'B ien, P. J.; B ayden, D. J. Jou nal o Con olled Release
2010, 146, 84-92.
48. Newland, B.; Tai, H.; Zheng, Y.; Velasco, D.; Di Luca, A.; Howdle, S. M.;
Alexande , C.; Wang, W.; Pandi , A. Chemical Communica ions 2010, 46, 4698-
4700.
49. P e e e, L. E.; Mullen, D. G.; Banaszak Holl, M. M. Moleclua Pha maceu ics
2010, 7, 2370-2370.
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
89
50. Deng, R.; Yue, Y.; Jin, F.; Chen, Y. C.; Kung, H. F.; Lin, M. C. M.; Wu, C.
Jou nal o Con olled Release 2009, 140, 40-46.
51. Lu en, J.; an Nos um, C. F.; de Smed , S. C.; Hennink, W. E. Jou nal o
Con olled Release 2008, 126, 97-110.
52. Wen, Y. T.; Pan, S. R.; Luo, X.; Zhang, X.; Zhang, W.; Feng, M. Bioconjuga e
Chemis y 2009, 20, 322-332.
53. You, Y.-Z.; Manickam, D. S.; Zhou, Q.-H.; Oupický, D. Jou nal o Con olled
Release 2007, 122, 217-225.
54. Bo iso , O.; Zhulina, E.; Lee make s, F.; Ballau , M.; Mülle , A. Sel O ganized
Nanos uc u es o Amphiphilic Block Copolyme s I; Sp inge : Be lin/Heidelbe g,
2011; Vol. 241, pp 1-55.
55. Schallon, A.; Syna schke, C. V.; Pe gusho , D. V.; Je ome, V.; Mülle , A. H. E.;
F ei ag, R. Langmui 2011, 27, 12042-12051.
56. an Gaal, E. V. B.; an Eijk, R.; Oos ing, R. S.; Kok, R. J.; Hennink, W. E.;
C ommelin, D. J. A.; Mas oba is a, E. Jou nal o Con olled Release 2011, 154,
218-232.
57. Elouahabi, A.; Ruysschae , J.-M. Molecual The apeu ics 2005, 11, 336-347.
58. Ainalem, M. L.; Campbell, R. A.; Khalid, S.; Gillams, R. J.; Rennie, A. R.;
Nylande , T. Jou nal o Physical Chemis y B 2010, 114, 7229-7244.
59. Akinc, A.; Thomas, M.; Klibano , A. M.; Lange , R. Jou nal o Gene ic Medicine
2005, 7, 657-663.
60. Yang, S.; May, S. Jou nal o Chemical Physics 2008, 129, 185105.
61. Godbey, W. T.; Wu, K. K.; Mikos, A. G. Jou nal o Biomedical Ma e ials
Resea ch, Pa A 1999, 45, 268-275.
Chap e 3 – In luence o Polyme A chi ec u e and Molecula Weigh on TE and Cell Viabili y
90
Supplemen a y Ma e ial
Figu e 3-S1: Mean luo escence in ensi y (MFI) o he ans ec ion e iciency da a shown in Figu e 3-3.
S a is ical signi icance was es ed by ANOVA. Da a ep esen mean alues o i e independen expe imen s
 SD.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
91
Chap e 4
Nano-Pa icula e Non-Vi al Agen o he E ec i e Deli e y o
pDNA and siRNA o Di e en ia ed Cells and P ima y Human
T Lymphocy es
The esul s om his chap e ha e been published in Biomac omolecules as:
“Nano-Pa icula e Non-Vi al Agen o he E ec i e Deli e y o pDNA and siRNA o
Di e en ia ed Cells and P ima y Human T Lymphocy es”
by Anja Schallon, Ch is ophe V. Syna schke, Valé ie Jé ôme, Axel H. E. Mülle and
Ru h F ei ag*.
Rep in ed wi h pe mission om Biomac omolecules 2012, 13, 3463–3474. Copy igh
2012 Ame ican Chemical Socie y.

Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
92
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
93
Abs ac
Deli e y o polynucleo ides such as plasmid DNA (pDNA) and siRNA o non-di iding
and p ima y cells by non- i al ec o s p esen s a conside able challenge. In his
con ibu ion, we in oduce a no el ype o PDMAEMA-based s a -shaped nanopa icles
ha (i) a e e icien ans ec ion agen s in clinically ele an and di icul - o- ans ec
human cells (Ju ka T cells, p ima y T lymphocy es) and (ii) can e icien ly deli e
siRNA o human p ima y T lymphocy es esul ing o mo e han 40 % silencing o he
a ge ed gene. T ans ec ion e iciencies achie ed by he new ec o s in se um- ee
medium a e gene ally high and only sligh ly educed in he p esence o se um, while
cy o oxici y and cell memb ane dis up i e po en ial a physiological pH a e low.
The e o e, hese no el agen s a e expec ed o be p omising ca ie s o non- i al gene
ans e . Mo eo e , we p opose a gene al design p inciple o he cons uc ion o
polyca ionic nanopa icles capable o deli e ing nucleic acids o he abo e-men ioned
cells.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
94
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
95
In oduc ion
The in e es in designing ully syn he ic non- i al ec o s o gene deli e y has ne e
waned, 1 al hough in he pas he applica ion ange o such agen s was limi ed. Compa ed
o i al ec o s, 2, 3 ans ec ion e iciencies o non- i al ec o s in gene al a e low and
none o he known agen s can e icien ly ans ec non-di iding and/o di e en ia ed
cells. 4 Fo some inno a i e medical he apies, e.g. RNA in e e ence (siRNA), deli e y is
s ill conside ed a subs an ial bo leneck. 5, 6 Cu en ly used non- i al deli e y agen s a e
ypically based on ca ionic polyme s, polypep ides, o lipids, 7-10 wi h poly(e hylene
imine), PEI, being a majo playe in he ield o comme cial p oduc s.
The pe o mance o non- i al ans ec ion agen s is ypically discussed based on he
a ious s ages o he deli e y p ocess. The poo pe o mance o non- i al ec o s in
ans ec ing suspension o non-di iding cells has been linked o p oblems in ans ec ion
complex a achmen o he cellula memb ane leading o ine icien endocy osis 11 and o a
p esumed inabili y o ansg ess he in ac nuclea memb ane, 12 espec i ely.
In ecen yea s, we ha e ne e heless seen a numbe o s udies, which link size and
s uc u e o non- i al polyca ionic ans ec ion agen s o hei pe o mance. 12, 13
Inc easing size o he polyca ion o en co ela es wi h imp o ed ans ec ion e iciency,
bu also wi h an inc ease in cy o oxici y; he la e being p esumably due o a mo e
p onounced dis up i e in e ac ion wi h he cellula memb ane. 14, 15 Concomi an ly
e idence is building up ha non-linea polyme s uc u es a e mo e e icien ans ec ion
agen s han linea polyme s o he same size. 2, 16-19 In his con ex , poly(2-
(dime hylamino)e hyl me hac yla e) (PDMAEMA), i s desc ibed in he mid-90’s by
Che ng and co-wo ke s, 20 has become an impo an p obe molecule in ans ec ion
s udies, since PDMAEMA can be syn hesized by a numbe o con olled polyme iza ion
me hods (e.g., anionic polyme iza ion and a om ans e adical polyme iza ion (ATRP)).
Thus, a he homogeneous polyca ions o di e en opologies (e.g. linea , b anched)
become a ailable. In his con ex , sui able me hods o he co e- i s syn hesis o nano-
pa icula mul i-a med DMAEMA s a s using ATRP ha e ecen ly become a ailable, 21,
22 ex ending he basis o de ailed in es iga ion o s uc u e- unc ion ela ionships. In
addi ion, such s a shaped a chi ec u es can also be p oduced by using block copolyme s
which can sel -assemble o micelles s uc u es gi en sui able sol en s. 23 The esul ing
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
102
he cells, 2 mL o p e-wa med esh g ow h medium we e added, and he cells we e
u he incuba ed o 20 h.
Fo p ima y human T lymphocy es, ansgene deli e y was ca ied ou 3 o 5 days a e
PBMC p epa a ion and cul i a ion in QPBL medium. 5 x 105 cells we e placed in 1.5 mL
Op i-MEM medium pe well in 6-well pla es. 200 µL o he polyplex suspension p epa ed
as desc ibed abo e we e added and he pla e placed o 4 h in he incuba o . A e wa ds,
0.5 mL o he medium was emo ed aking ca e no o dis u b he cells, 2 mL o
p e-wa med esh QPBL medium we e added, and he cells we e u he incuba ed o
48 h. Elec opo a ion o T lymphocy es was pe o med as p e iously desc ibed. 42
B ie ly, 20 µg DNA we e pulsed wi h 5.0 x 106 cells in Op i-MEM a 250 V, 950 µF
(BioRad Gene Pulse X Cell). Immedia ely a e elec opo a ion, cells we e incuba ed o
10 min a 37°C ollowed by ans e in o p e-wa med esh QPBL medium (2 mL) in a
6-well pla e.
Fo analysis, adhe en cells we e ha es ed by ypsiniza ion and suspension cells by
cen i uga ion and esuspended in DPBS. Fo de e mina ion o he iabili y, dead cells
we e iden i ied ia coun e s aining wi h p opidium iodide (PI) o ypan blue. The ela i e
exp ession o EGFP luo escence o 1 x 104 cells was quan i ied ia low cy ome y.
Cells we e ini ially e alua ed by sca e p ope ies (FSC/SSC) in o de o selec a egion
ep esen ing single non-apop o ic cells (elimina ion o dead cells, deb is and cellula
agg ega ions). This ga ed egion (R0) was u he analyzed o luo escence (PI/EGFP).
Do plo s wi h log o he ed luo escence in ensi y (PI) on he x-axis and log o he g een
luo escence in ensi y (EGFP) on he y-axis we e used o es ima e he pe cen age o
EGFP-exp essing cells in he main non-apop o ic cell popula ion (ga e R0). Nega i e
con ols (N/P 0, non- ans ec ed cells o cells ans ec ed wi h an i ele an pDNA) we e
used o se he posi ion o quad an s sepa a ing GFP-posi i e li ing cells (uppe le ),
GFP-posi i e dead cells (uppe igh ), GFP-nega i e li ing cells (lowe le ) and GFP-
nega i e dead cells (lowe igh ). These quad an s we e applied o he analysis o
ans ec ed cells and pe cen age cell numbe / o al cell numbe in he ga ed egion we e
calcula ed o each quad an .

Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
103
Deli e y o siRNA
siRNAs we e: hCD4-siRNA (sense) 5’- GCAAUUGCUAGUGUUCGGAUUGACUGC -
3', (an i-sense), 5’ – GCAGUCAAUCCGAACACUAGCAAUUGC - 3’ EGFP-siRNA 50
(sense) 5'’ – AAGCUGACCCUGAAGUUCAUCUGCACC - 3', (an isense), 5’ –
GGUGCAGAUGAACUUCAGGGUCAGCUU - 3’ (all Eu o ins MWG pe on). The
siRNAs we e ob ained as duplex and solubilized in o 1x siMAX uni e sal bu e (6 mM
HEPES, 20 mM KCl, 200 µM MgCl2, pH 7.3; Eu o ins MWG Ope on). EGFP-siRNA
and hCD4-siRNA we e used as nega i e con ol in he expe imen s in ol ing CD4
knockdown in T lymphocy es and EGFP knockdown in CHO-EGFP-VEGFA cells,
espec i ely. Fo siRNA deli e y in o EGFP exp essing CHO cells (CHO-EGFP-VEGFA
cells 48), cells we e seeded a a densi y o 0.25 x 105 cells pe well in 24-well pla es 20 h
p io o deli e y. One hou p io o deli e y, cells we e insed wi h DPBS and
supplemen ed wi h 0.2 mL Op i-MEM medium. siRNA-polyplexes we e p epa ed by
dilu ing siRNAs s ock solu ion (10 µM) in a o al olume o 50 µL Op i-MEM o he
indica ed inal concen a ion and adding su icien amoun s o he polyca ion s ock
solu ion o each he desi ed N/P a io. The mix u e was immedia ely mixed by o exing
a ull speed ollowed by incuba ion a oom empe a u e o 15 min. The polyplex
suspension (50 µL) was added o he cells, he pla es we e cen i uged o 5 min a 200 g,
and placed o 4 h in he incuba o . A e wa ds, he supe na an was emo ed by
aspi a ion, 1 mL o esh g ow h medium was added, and he cells we e u he incuba ed
o 20 h (Si-PDMAEMA) and 30 h (Si-PDMAEMA and Mic-PDMAEMA). The ela i e
exp ession o EGFP luo escence o 1 x 104 cells was quan i ied. Fo de e mina ion o he
iabili y, dead cells we e iden i ied ia coun e s aining wi h p opidium iodide. Cells we e
ini ially e alua ed by sca e p ope ies (FSC/SSC) in o de o selec a egion ep esen ing
single non-apop o ic cells (elimina ion o dead cells, deb is and cellula agg ega ions).
This ga ed egion (R0) was u he analyzed o luo escence (PI/EGFP). To assess he
e iciency o he siRNA o knockdown he EGFP exp ession, he median luo escence
in ensi y (FI) alues we e compa ed.
Fo siRNA deli e y o T lymphocy es, cells we e washed wice wi h DPBS and pla ed in
250 µL Op i-MEM in 24-well pla es a 5 x 105 cells pe well o 1 h p io o ans ec ion.
Polyplexes we e p epa ed and added o he wells as desc ibed abo e. The pla es we e
cen i uged o 5 min a 200 g and placed o 4 h in he incuba o . A e wa ds, 700 µL o
p e-wa med esh QPBL medium we e added pe well and he cells we e u he
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
104
incuba ed o a leas 24 h wi hou emo ing he complexes o eplacing he medium un il
subsequen analysis by low cy ome y.
Analysis o CD4 Exp ession
Fo analysis o CD4 exp ession, cells we e ha es ed by cen i uga ion (5 min, 200 g,
4 °C) and esuspended in DPBS. T lymphocy es exp essing CD4 ecep o s we e
iden i ied by immuno luo escence ia s aining he cells wi h FITC-conjuga ed an i-CD4
o FITC-conjuga ed iso ype con ol an ibodies (acco ding o manu ac u e ’s ins uc ions)
on he day o siRNA deli e y and a leas 24 h a e deli e y. Dead cells we e iden i ied
ia coun e s aining wi h p opidium iodide. The ela i e exp ession o CD4 was quan i ied
ia low cy ome y.
Cells we e ini ially e alua ed by sca e p ope ies (FSC/SSC) in o de o selec a egion
ep esen ing single non-apop o ic cells and o elimina e deb is which always compose a
signi ican ac ion in an ac i a ed p ima y lymphocy e cell cul u e (ga e ”lympho”) and
by (SSC/PI) in o de o selec he li ing cells (PI-nega i e popula ion) (ga e ”li ing”). The
exp ession o he CD4 p o ein was assessed in his og am plo s (g een luo escence
in ensi y on he x-axis and cell numbe on he y-axis) ep esen ing he in ensi y o he
CD4-FITC luo escence (CD4low: luo escence in ensi y be ween 70 and 170; CD4high:
luo escence in ensi y > 170) in he li ing T lymphocy es (de ined as a sub-popula ion o
ga e “lympho” and ga e “li ing”).
Cy o oxici y / Vi ali y Assay (MTT)
The oxici y o he polyca ions was es ed (concen a ion ange 0.001 mg/mL o 5.0
mg/mL, 8 eplica e expe imen s each) acco ding o he ISO 10993-5 p o ocol by MTT
assay using L929 mu ine ib oblas s, cul u ed in MEM supplemen ed wi h 10 % FCS, as
es cells. The cells we e seeded a a densi y o 1 x 105 cells pe well 24 h p io o he
expe imen in 96-well pla es. The concen a ion o he MTT s ock solu ion was 1 mg/mL.
As 100 % iabili y con ol, un ea ed cells we e used. The abso bance was measu ed
using a pla e eade (Genios P o, Tecan, Ge many); wa eleng h 580 nm.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
105
Fo T lymphocy es, he MTT assay was pe o med as ollows. 5 x 105 human T
lymphocy es in 500 µL Op i-MEM medium we e ans e ed in o 1.5 mL Eppendo 
ubes. The polyme was added and he cells we e incuba ed o 4 h a 37°C in he
incuba o . Then, he Op i-MEM medium was eplaced by QPBL medium. All medium
exchange and washing s eps we e done by cen i uga ion (5 min, 200 g, 4°C). The cells
we e u he incuba ed o 20 h. Then cells we e insed wi h DPBS and u he incuba ed
in 200 µL MTT solu ion (1.0 mg/mL in RPMI 1640 wi hou phenol ed) o 2 h. The
ubes we e cen i uged o 5 min a 600 g, he MTT solu ion was disca ded and 200 µL
isop opanol we e added o he cell pelle . The ubes we e mixed a 150 pm o 5 min o
dissol e he o mazan c ys als p oduced in he eac ion. Abso bance was measu ed a 580
nm in he mic opla e eade wi h un ea ed cells se ing as con ols. Fo da a e alua ion,
O igin 6.1 (O iginLab Co po a ion, No hamp on, USA) so wa e was used, he x-scale
was plo ed loga i hmically and a nonlinea i was used o ob ain he LD50 alues.
Hemolysis Tes
The memb ane damaging p ope ies o he polyme s was quan i ied by analyzing he
elease o hemoglobin om human e y h ocy es, acco ding o Pa nham and We zig. 51
The e y h ocy es-con aining blood ac ion ob ained a e Ficoll g adien sepa a ion
was cen i uged a 700 g o 10 min. The ob ained pelle was washed h ee imes wi h
cold DPBS pH 7.4 by cen i uga ion a 700 g o 10 min and e-suspension in he same
bu e . Polyme solu ions we e p epa ed in DPBS bu e and 100 µL we e added o he
e y h ocy es (100 µL) o gi e inal concen a ions in he ange o 0.001 o 5.0 mg/mL and
incuba ed o 60 min unde cons an shaking a 37°C. A e cen i uga ion (700 g, 10
min), he supe na an was analyzed o eleased hemoglobin a 580 nm. The abso bance
was measu ed using a pla e eade (Genios P o, Tecan, Ge many). Fo compa ison,
collec ed e y h ocy es we e washed wi h DPBS and ei he lysed wi h 0.2 % T i on X-100
yielding he 100 % lysis con ol alue (A100) o esuspended in DPBS as e e ence (A0).
The analysis was epea ed wi h blood om a leas six independen dono s. The hemoly ic
ac i i y o he polyca ions was calcula ed as ollow:
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
106
% hemolysis = 100*(A – A0)/(A100 – A0)
wi h A: abso bance o he sample, A100: abso bance a 100 % hemolysis, A0: abso bance
a 0 % hemolysis.
S a is ical Analysis
G oup da a a e epo ed as mean  s.e.m. Fo ans ec ion esul s, he S uden ’s - es was
used o de e mine whe he da a g oups di e ed signi ican ly om each o he . S a is ical
signi icance was de ined as ha ing P < 0.05.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
107
Resul s and Discussion
Polyme Syn hesis and Cha ac e iza ion
As basis o he in es iga ion, a well-de ined 20-a med s a (Si-PDMAEMA) was
syn hesized ia ATRP o DMAEMA, om a silsesquioxane ini ia o co e (Scheme 4-1a)
based on a p ocedu e p e iously published by one o ou g oups. 21 P og ess o he
polyme iza ion was moni o ed by ollowing he monome consump ion ia 1H-NMR as
e idenced by he dec ease in he in eg al o he wo inyl p o ons a 6.21 ppm and 5.61
ppm. T ioxane was added as an in e nal s anda d o he mix u e, because i gi es a
cha ac e is ic signal a a chemical shi o 5.14 ppm and does no pa icipa e in he
eac ion. The polyme iza ion was quenched a 42 % monome s con e sion, which
co esponds o an a e age deg ee o polyme iza ion (DP, o numbe o DMAEMA uni s
pe molecule) o 4,570, o a numbe a e age molecula weigh Mn o 730 kDa assuming
ha he monome s we e homogenously dis ibu ed among all g owing pa icles. Due o
s e ic hind ance, no all pu a i e ini ia ion si es o he silsesquioxane ini ia o can be
expec ed o s a a polyme chain21 and he numbe o a ms pe s a is he e o e below he
heo e ically possible 58. In o de o de e mine he a e age numbe and leng h o he
a ms, hese we e clea ed o and hei molecula weigh dis ibu ion was de e mined by
gel pe mea ion ch oma og aphy (GPC). The numbe a e age Mn o he a ms was 23,500
Da, and he weigh a e age Mw was 33,500 Da, which co esponds o a polydispe si y
index (PDI) o 1.42 and a DP o 235 monome s pe a m. F om his, an a e age numbe o
19.5 a ms was calcula ed o he p oduced Si-PDMAEMA. The numbe o a ms is in
good ag eemen wi h he alues o 19 o 24 a ms ha ha e been de e mined o o he s a -
shaped polyme s p epa ed using he same ini ia o . 21 A z-a e age hyd odynamic adius,
<Rh>z, app., o 37.2 ± 3.5 nm was de e mined o he Si-PDMAEMA by dynamic ligh
sca e ing (DLS).
I is known ha b anched poly(e hylene imine) (b-PEI) shows a high bu e ing capaci y,
because o he la ge numbe o ni ogen a oms in i s chemical s uc u e. The so-called
“p o on sponge e ec ” is a esul o his bu e ing capaci y and i is said o esul in an
e ec i e escape o PEI-based-polyplexes om he endosome, explaining he high
ans ec ion e iciency o his polyme . 52, 53
We conduc ed po en iome ic i a ion expe imen s o he Si-PDMAEMA s a -shaped
polyme as well as o b-PEI. F om he i a ion expe imen s appa en pKa alues o pKa,

Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
108
app.(b-PEI) = 7.05 and pKa, app.(Si-PDMAEMA) = 6.73 we e de e mined. The i a ion was
pe o med a a mass concen a ion o 0.5 mg/mL in MilliQ wa e (co esponding o mola
ni ogen concen a ion o 11.6 mM and 3.13 mM o b-PEI and Si-PDMAEMA,
espec i ely) wi h 0.1M HCl solu ion. b-PEI had a la ge bu e ing egion anging om
pH 9.6 – 4.2 han Si-PDMAEMA, which showed a bu e ing e ec om pH 8.9 – 4.6.
The o e all amoun o bu e ed HCl was g ea e o b-PEI (2.61 mL) han o Si-
PDMAEMA (1.25 mL), which is explained by he highe mola ni ogen concen a ion o
b-PEI. In he bu e ing egion ele an o he endosomal en i onmen (pH 7.4 – 5) b-PEI
shows a sligh ly be e bu e ing capaci y by mass concen a ion han Si-PDMAEMA,
wi h 1.27 mL o bu e ed 0.1M HCl o b-PEI and 0.94 mL o Si-PDMAEMA.
Elemen al analysis o he polyca ions indica ed in e alia he p esence o 15.55 ppm Cu,
i.e. no all o he coppe ca alys had been emo ed om he inal p oduc du ing dialysis,
p obably due o s ong binding by he PDMAEMA a ms. Howe e , gi en he low
cy o oxici y o Si-PDMAEMA, see below, signi ican elease o coppe ions du ing
applica ion is unlikely.
To demons a e he gene al po en ial o mul i-a m s a -shaped polyca ionic nanopa icles
as polynucleo ide deli e y ehicles, a second s uc u e o simila design was p oduced ia
sel -assembly ( o ma ion o s a -like micelles) o an amphiphilic diblock copolyme . Fo
his pu pose, polybu adiene-block-poly(2-(dime hylamino)e hyl me hac yla e) (PB290-b-
PDMAEMA240) was syn hesized ia sequen ial li ing anionic polyme iza ion as
p e iously published. 44 The diblock copolyme had a numbe -a e age molecula weigh ,
Mn, o 53,500 Da and a e y na ow PDI o 1.07. A micella , s a -shaped gene deli e y
agen , Mic-PDMAEMA, was ob ained ia he sel -assembly o PB290-b-PDMAEMA240
in o micelles upon a change in sol en om THF, which solubilizes he en i e diblock
copolyme , o PBS, which only solubilizes he PDMAEMA block (Scheme 4-1b). An
<Rh>z, app. o 27 ± 3 nm was de e mined o he Mic-PDMAEMA by DLS. The
hyd odynamic adii o he wo deli e y agen s a e hus in he same ange.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
109
Scheme 4-1. Syn he ic p ocedu e o Si-PDMAEMA p epa a ion om mul i- unc ional ini ia o ia ATRP
(a) and sel -assembly o amphiphilic diblock copolyme PB290-b-PDMAEMA240 o Mic-PDMAEMA s a -
shaped micelles (b).
The i s s ep in polynucleo ides deli e y is he o ma ion o polyplexes be ween he
polyca ionic deli e y agen and he nega i ely cha ged polynucleo ide. Su ace cha ge o
polyplexes is an impo an ac o especially o unspeci ic up ake in o cells by adso p i e
endocy osis media ed by p o eoglycans. 54 We de e mined he ze a po en ial o he Si-
PDMAEMA and Mic-PDMAEMA polyplexes a a ious polyme N / DNA P- a ios
(Table 4-S1). The ze a po en ial o he polyplexes inc eased wi h inc easing N/P a io and
a N/P a ios equal o o la ge han 5 posi i e alues up o +10.5 mV we e ob ained.
pDNA Deli e y by Si-PDMAEMA
The Si-PDMAEMA was es ed by s anda dized ans ec ion p ocedu es, using EGFP as
epo e gene, in a panel o model cell lines including adhe en (CHO-K1, HEK-293, Wi-
38, A549) and suspension (Ju ka ) cells. In addi ion, C2C12 cells we e used as model o
non-di iding and di e en ia ed cells and human T lymphocy es we e used as example o
p ima y cells. b-PEI (25 kDa), i.e. he s anda d non- i al ans ec ion agen used in ou
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
110
g oup, se ed as con ol. While depending on N/P- a io and cell ype, ans ec ion
e iciencies we e consis en ly highe o Si-PDMAEMA han o b-PEI a sligh ly
educed cy o oxici ies (Table 4-1). This included he Ju ka cells, whe e he bes
ans ec ion e iciency was 46.1 % ± 3.7 o Si-PDMAEMA compa ed o 6.2 % ± 2.6 o
b-PEI (n  5). In o de o exclude a alse posi i e measu emen , we also pe o med
ans ec ion wi h a blank pDNA (“con ol plasmid”). The da a p esen ed in Table 4-1 and
Figu e 4-S2 clea ly demons a e ha he measu ed inc ease in luo escence in he Si-
PDMAEMA ans ec ed cells is due o EGFP exp ession and no o an inc eased
au o luo escence o he cells due o polyme accumula ion. Ju ka cells a e suspension
cells, which a e di icul o ans ec wi h non- i al ec o s because hey spa sely
in e nalize ca ionic complexes. 11 The low alues ob ained o b-PEI a e in acco dance
wi h he da a om he li e a u e 55, 56 and we e hus expec ed, while he much be e alue
ob ained o Si-PDMAEMA we e a i s indica ion o a undamen ally di e en
pe o mance o his ans ec ion agen .
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
111
Table 4-1. T ans ec ion e iciency and cell iabili y a e ans ec ion wi h polyplexes based on b-PEI and
Si-PDMAEMA.
Cell line
T ans ec ion e iciency (%)
Viabili y (%)
PEI
Si-PDMAEMA
PEI
Si-PDMAEMA
N/P 5
36.6 ± 12.0
59.8 ± 18.9
95.3 ± 3.7
93.7 ± 4.4
CHO-K1
N/P 10
49.1 ± 17.6
73.5 ± 8.0
94.4± 3.9
92.9 ± 3.0
N/P 20
40.9 ± 20.6
70.5 ± 6.3
87.3 ± 8.7
91.6 ± 3.2
N/P 5
n. d.
0.2 ± 0.2
n. d.
98.5 ± 0.7
Con ol plasmid a
N/P 10
n. d.
1.6 ± 1.1
n. d.
97.4 ± 2.8
N/P 20
n. d.
0.8 ± 0.1
n. d.
95.0 ± 1.9
N/P 5
23.5 ± 9.7
33.9 ± 15.0
83.9 ± 10.1
88.0 ± 6.8
HEK-293
N/P 10
36.1 ± 8.2
50.3 ± 15.1
82.7 ± 14.3
90.8 ± 5.9
N/P 20
32.8 ± 7.7
55.2 ± 15.2
79.1 ± 17.7
83.4 ± 9.6
N/P 5
20.3 ± 3.1
9.8 ± 3.5
71.0 ± 6.5
76.8 ± 7.3
Wi-38
N/P 10
19.2 ± 3.9
26.9 ± 5.5
66.6 ± 5.7
73.3 ± 6.4
N/P 20
2.1 ± 1.7
20.9 ± 6.4
39.4 ± 16.6
53.8 ± 7.9
N/P 5
21.7 ± 21.2
45.8 ± 28.0
93.2 ± 4.7
91.4 ± 4.0
A549
N/P 10
36.1 ± 14.2
48.6 ± 22.0
74.8 ± 7.9
86.0 ± 9.4
N/P 20
20.0 ± 7.7
43.0 ± 9.8
48.7 ± 16.1
70.1 ± 21.3
N/P 3
0.6 ± 0.4
24.1 ± 0.0
81. 4 ± 2.9
76.6 ± 4.8
Ju ka b, c
N/P 5
2.0 ± 1.4
33.3 ± 2.7
84.3 ± 4.2
54.4 ± 0.6
N/P 10
4.4 ± 3.1
46.1 ± 3.7
69.0 ± 19.3
44.2 ± 15.3
N/P 20
6.2 ± 2.6
28.6 ± 16.3
39.9 ± 22.0
53.6 ± 17.7
N/P 5
n. d.
0.4 ± 0.1
n. d.
71.8 ± 3.5
Con ol plasmid a
N/P 10
n. d.
0.3 ± 0.0
n. d.
60.6 ± 7.7
N/P 20
n. d.
0.4 ± 0.2
n. d.
53.1 ± 2.4
The cells we e ans ec ed wi h pEGFP-N1 (EGFP exp ession plasmid) and in he case o CHO-K1 and
Ju ka cells addi ional ans ec ions we e pe o med wi h a con ol plasmid (pIVEX2.3-UK, non-EGFP
exp ession plasmid) o exclude ha accumula ion o polyme me ely induces an inc ease o he cell
au o luo escence. DNA concen a ion: 15 µg/mL. The EGFP exp ession was measu ed 24 h a e
ans ec ion by low cy ome y and analyzed as desc ibed in he ma e ials and me hods sec ion. The
ans ec ion e iciency da a ep esen he pe cen age o li ing cells exp essing EGFP in he non-apop o ic
cell popula ion de ined by sca e p ope ies as de e mined by low cy ome y analysis. Fo de e mina ion o
he iabili y, dead cells we e iden i ied ia coun e s aining wi h p opidium iodide. a, b: Rep esen a i e low
cy ome y do plo s a e p o ided in he supplemen a y in o ma ion (Figu e 4-S1 and Figu e 4-S2). Da a
ep esen mean ± s.e.m., n ≥ 5, sa e o c: n ≥ 3. n. d.: no de e mined.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
118
Table 4-3. Rela i e elease o hemoglobin in pe cen (mean  s.e.m.) by human ed blood cells a e 60 min
incuba ion wi h di e en concen a ions o he ca ionic polyme s a 37°C (n = 6).
Polyme
0.001
mg/mL
0.005
mg/mL
0.01
mg/mL
0.05
mg/mL
0.1
mg/mL
0.5
mg/mL
1.0
mg/mL
5.0
mg/mL
b-PEI
0.1 ± 0.8
5.0 ± 1.9
5.4 ± 3.1
16.2 ±
5.0
26.2 ±
9.4
63.3 ±
12.9
75.2 ±
12.0
101.5 ±
8.4
Si-
PDMAEMA
1.4 ± 2.1
0.9 ± 1.9
0.9 ± 0.2
7.1 ± 1.9
13.2 ±
5.8
22.0 ±
1.5
23.4 ±
5.0
34.1 ±
7.2
siRNA-Media ed Knockdown o Gene Exp ession in Recombinan CHO Cells and T
Lymphocy es
RNA in e e ence (RNAi) ep esen s a p omising echnology o gene-speci ic
knockdown, e.g. in he con ex o de eloping new he apeu ic app oaches. 72 Howe e , a
c i ical ac o s ill limi ing he use o siRNA as he apeu ic is deli e ing siRNA o i s
in acellula a ge si e as ecen ly e iewed. 32, 73 Recombinan CHO cells cons i u i ely
exp essing EGFP 48 and human p ima y T lymphocy es we e used o e alua e he
po en ial o Si-PDMAEMA o deli e siRNA in o he cells and media e gene silencing.
P io o all silencing expe imen s, p elimina y es s we e pe o med in o de o es ima e
he mos sui able siRNA concen a ion and N/P a io o gene silencing. The e o e,
e e ing o published con ibu ions, 36, 74 25 and 50 nM siRNA we e es ed in pa allel o
a ious cha ge a ios (N/P 3 o 20). Op imized condi ions we e ound o be 25 o 50 nM
siRNA and a N/P a io o 10 ga e he bes esul s. A signi ican silencing e ec was no
de ec ed o incuba ion ime sho e han 30 h, p obably due o he high s abili y o he
a ge ed p o eins (EGFP 1/2 ≥ 24 h 75; CD4 1/2 = 20 h 76) (da a no shown). The esul s
p esen ed below we e ob ained unde op imized condi ions and e lec he maximal
knockdown achie ed so a . In he ecombinan CHO cells, knockdown a e incuba ion
wi h he complexes con aining 50 nM EGFP-siRNA was e alua ed by low cy ome y
analysis o he EGFP luo escence in compa ison o cells whe e deli e y o siRNA had
been a emp ed using b-PEI (Table 4-4). b-PEI/siRNA polyplexes achie ed a mos a 16
% educ ion o he EGFP exp ession. This low knockdown e iciency o PEI is in
ag eemen wi h da a published elsewhe e. 77, 78 Si-PDMAEMA igge ed a signi ican ly
highe knockdown (54.6 %). Fo bo h polyca ions, only a minimal e ec on cell iabili y,
which emained wi hin 85 % o he non- ans ec ed cells, was obse ed. Simila le els
we e obse ed in isola ed cases o PDMAEMA/siRNA polyplexes in lung cance cells.
79, 80

Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
119
Table 4-4. Gene silencing in ecombinan CHO cells cons i u i ely exp essing EGFP.
N/P a io
0
5
10
15
naked siRNA
5.3
-
-
-
b-PEI
-
0.0
16.0
n.d.
Si-PDMAEMA
-
1.7
54.6
51.0
EGFP exp ession was de e mined by low cy ome y 30h a e siRNA deli e y using ei he b-PEI o Si-
PDMAEMA. siRNA concen a ion: 50 nM a N/P 10. Da a ep esen pe cen age o knockdown o EGFP
exp ession compa ed o con ol cells. Viabili ies we e es ima ed by p opidium iodide s aining p io o low
cy ome y analysis. n.d.: no de e mined
T lymphocy es a e known o be pa icula ly esis an o siRNA up ake en o ced by
con en ional non- i al deli e y me hods excep ing Nucleo ec ion® 42 and an ibody
agmen -pep ide usion p o ein-based deli e y. 81 Based on he p omising esul s
ob ained in he ecombinan CHO cell line, we subsequen ly in es iga ed he po en ial o
Si-PDMAEMA o knockdown o CD4-exp ession in human T lymphocy es. In
p elimina y expe imen s, sc eening o op imized deli e y condi ions, we we e able o
show ha Si-PDMAEMA-based deli e y o hCD4-siRNA led o signi ican ly highe
silencing e ec han he one ob ained a e b-PEI-based deli e y (da a no shown). In
o de o con i m his obse a ion, siRNA deli e y/knockdown was epea ed wi h T
lymphocy es isola ed om ano he dono . In addi ion, linea PEI (l-PEI, 25 kDa) was
used ins ead o b-PEI. Cells mock-deli e ed wi h EGFP-siRNA se ed as con ol.
Knockdown a e 30 h incuba ion wi h he complexes was e alua ed by low cy ome y
analysis. Deli e y o he siRNA wi h l-PEI had no e ec on he le el o CD4 exp ession.
Si-PDMAEMA, on he o he hand, achie ed a 2.3- old dec ease o CD4high and a 2.3- old
inc ease o he CD4low popula ions, espec i ely (Table 4-5). Viabili y was again wi hin
85 % o he non- ans ec ed cells in all cases. This is, o ou knowledge, he i s ime ha
a PDMAEMA-based polyca ion we e used success ully o deli e siRNA in o human
p ima y T lymphocy es and leading o he speci ic knock-down o he a ge ed gene.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
120
Table 4-5. Analysis o CD4 exp ession 30 h a e human T lymphocy es we e ei he mock deli e ed
(EGFP-siRNA) o deli e ed wi h hCD4-siRNA (25 nM each).
hCD4-siRNA
EGFP-siRNA
CD4high
CD4low
CD4high
CD4low
l-PEI
77.5
22.5
79.9
20.1
Si-PDMAEMA
29.6
70.3
69
31
The siRNA was deli e ed complexed wi h l-PEI o Si-PDMAEMA (N/P a io 10). Da a ep esen he
pe cen age o CD4high and CD4low cells wi hin he iable CD4+ popula ion. The iabili y was es ima ed by
p opidium iodide s aining p io o low cy ome y analysis. Fo compa ison: cells submi ed o he same
medium changes as he ans ec ed ones, bu no ecei ing any siRNA displayed 66.7 % CD4high and 33.5 %
CD4low. Rep esen a i e low cy ome y do plo s and his og ams a e p o ided in he supplemen a y
in o ma ion (Figu e 4-S4).
Ve i ica ion o he Gene al Design P inciple o Imp o ed Non-Vi al T ans ec ion
Agen s
In o de o e i y ou ini ial hypo hesis ha many a ms emana ing om a common cen e
is a gene al design p inciple o he cons uc ion o e icien non- i al polynucleo ide
deli e y ehicles, s a -like polyme micelles (Mic-PDMAEMA) we e p oduced and hei
e iciency as po en ial ans ec ion eagen was explo ed unde s anda d condi ions in
Ju ka cells. The micelle co e-based s uc u e was as e icien as Si-PDMAEMA as
shown by he achie ed ans ec ion e iciency anging om 11 o 35 % ans ec ed cells
depending on he N/P a io, al hough ans ec ion a N/P a io o 20 led o high
cy o oxici y (Table 4-6).
Table 4-6. Summa y o he Ju ka cells ans ec ion wi h s a -like PDMAEMA-based micelles (Mic-
PDMAEMA) in se um- ee medium.
N/P a io
T ans ec ion e iciency (%)
Viabili y (%)
N/P 3
11.5 ± 1.4
88.1 ± 3.2
N/P 5
31.0 ± 3.0
76.2 ± 13.3
N/P 10
21.2 ± 0.0
79.4 ± 0.4
N/P 20
35.0 ± 17.4
32.4 ± 20.9
The cells we e ans ec ed wi h pEGFP-N1 (EGFP exp ession plasmid). DNA concen a ion: 15 µg/mL.
Polyme concen a ions we e adjus ed o he indica ed N/P a ios. The EGFP exp ession was measu ed 24 h
a e ans ec ion by low cy ome y. The ans ec ion e iciency da a ep esen he pe cen age o li ing
cells exp essing EGFP in he non-apop o ic cell popula ion de ined by sca e p ope ies as de e mined by
low cy ome y analysis. The iabili y was es ima ed by p opidium iodide s aining p io o low cy ome y
analysis. Da a ep esen mean ± s.e.m. (n ≥ 3) ep esen a i e low cy ome y do plo s a e p o ided in he
supplemen a y in o ma ion (Figu e 4-S5).
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
121
Recen ly, we ha e in addi ion published da a showing ha magne ic co e-shell
nanopa icles displaying simila a chi ec u e, can e icien ly deli e pDNA o CHO-K1
cells yielding mo e han 50 % ans ec ed cells. 82 Taken oge he , hese esul s sus ain
ou ini ial hypo hesis ha s a -shaped a chi ec u es wi h a la ge numbe o a ms
i adia ing om he co e a e e icien non- i al ec o s. Addi ional ine uning o he
composi ion o he co-polyme s o enhance endosomal elease could u he inc ease he
ans ec ion e iciency o he s a -like micelles as ecen ly demons a ed in one monocy e
cell line by Manganiello and co-wo ke s. 83
The abili y o Mic-PDMAEMA o deli e siRNA was es ed using he EGFP knockdown
in he ecombinan CHO cells s ably exp essing his p o ein as es sys em. He e also,
p elimina y sc eening o he op imum o siRNA concen a ion and N/P a io was
pe o med (da a no shown) and he esul s p esen ed below e lec da a ob ained unde
hese op imized condi ions. Knockdown a e 30 h incuba ion wi h he polyplexes (N/P
a io o 20) con aining ei he EGFP-siRNA o hCD4-siRNA (used as con ol) was
e alua ed by low cy ome y (Figu e 4-4).
Figu e 4-4. siRNA media ed silencing o he EGFP-exp ession in ecombinan CHO cells cons i u i ely
exp essing his p o ein de e mined a e deli e y wi h b-PEI o Mic-PDMAEMA; siRNA concen a ion:
25 nM, N/P a io: 20. CHO-EGFP-VEGF cells we e ei he mock deli e ed (hCD4siRNA, whi e ba s) o
deli e ed wi h EGFP-siRNA (black ba s). 30 h pos - ans ec ion, he cells we e coun e s ained wi h
p opidium iodide o iden i y dead cells and analyzed o EGFP exp ession by low cy ome y. Da a
ep esen pe cen age o knockdown o EGFP exp ession in iable cells compa ed o non- ea ed con ol
cells (mean ± s.e.m., n ≥ 3).
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
122
Whe eas b-PEI/siRNA polyplexes achie ed a mos a 20 % educ ion in he luo escence
geome ic mean, Mic-PDMAEMA deli e y esul ed in a 43.6 % knockdown and hus
pe o med almos in he same ange as Si-PDMAEMA (Table 4-4). As be o e, cell
iabili y was only minimally a ec ed (> 85 % in all cases).
Conclusions
The la ge polyca ionic nanopa icles in oduced he e display, o ou knowledge, a ne e
be o e obse ed capabili y o deli e nuclei acids o human p ima y T lymphocy es and o
non-di iding cells and hus, ha e conside able ad an ages o e con en ional polyca ions
o gene deli e y. In pa icula , he p oposed new ans ec ion eagen syn hesized om
an ino ganic co e (Si-PDMAEMA) displays high po en iali y o ans ec ion o p ima y,
non-di iding and di e en ia ed cells as well as a b oad compa ibili y wi h es ablished cell
lines. An addi ional cons uc , p oduced along he same design p inciple and con aining a
polybu adiene co e (Mic-PDMAEMA), also showed mo e e icien pDNA–deli e ies
han PEI o CHO and Ju ka cells. Fu he mo e, we es ablished a i s p oo o p inciple
ha Si-PDMAEMA and Mic-PDMAEMA can be used o gene silencing using small
in e e ing RNA (siRNA) in CHO cells and human p ima y T lymphocy es. In his
con ex , polyme s based on diblock copolyme s a e o pa icula in e es because hei
p oduc ion is easy and u he modi ica ion, e.g., including a a ge ing sequence, would
be possible. As a as we know, s a -like a chi ec u es epo ed be o e we e gene ally less
e icien han con en ional ans ec ion eagen s o gene deli e y in pa icula when
“ha d- o- ans ec ” cells we e conce ned. This wo k es ablishes ha he design p inciple
o many a ms emana ing om a common cen e esul s in e icien polynucleo ide
deli e y ehicles independen o he co e ma e ial and he e o e o e s ad anced
possibili ies o he de elopmen imp o ed gene ec o s in pa icula o p ima y cells.
Mo eo e , due o i s low dis up i e po en ial o cell memb anes (hemoly ic ac i i y) a
physiological pH and i s abili y o ans ec cells in he p esence o se um, Si-
PDMAEMA migh become an a ac i e sys em o u he in i o e alua ions.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
123
Acknowledgmen s
The au ho s would like o hank P o . Fö s e (Physical Chemis y I and Bay eu h Cen e
o Colloids and In e aces, Uni e si y o Bay eu h) o access o he Ze asize . C. V.
Syna schke acknowledges unding h ough a BayEFG schola ship and suppo om he
Eli e Ne wo k o Ba a ia. PB290-b-PDMAEMA240 block polyme s we e kindly supplied
by F. Schache (Mac omolecula Chemis y II, Uni e si y o Bay eu h, Ge many).
Alexand a Rinkenaue is acknowledged o pe o ming some o he siRNA deli e y
expe imen s.

Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
124
Re e ences
1. G igsby, C. L.; Leong, K. W. Jou nal o he Royal Socie y In e ace 2010, 7 Suppl
1, 67-82.
2. Min ze , M. A.; Simanek, E. E. Chemical Re iews 2009, 109, (2), 259-302.
3. Ve ma, I. M. Molecula Medicine 1994, 1, (1), 2-3.
4. an Gaal, E. V.; an Eijk, R.; Oos ing, R. S.; Kok, R. J.; Hennink, W. E.;
C ommelin, D. J.; Mas oba is a, E. Jou nal o Con olled Release 2011, 154, (3),
218-232.
5. Shegoka , R.; Al Shaal, L.; Mish a, P. R. Pha mazie 2011, 66, (5), 313-318.
6. Sli a, K.; Schnie le, B. S. Vi ology Jou nal 2010, 7, 248.
7. Donku u, M.; Badea, I.; We ig, S.; Ve all, R.; Elsabahy, M.; Fold a i, M.
Nanomedicine 2010, 5, (7), 1103-1127.
8. Elsabahy, M.; Naza ali, A.; Fold a i, M. Cu en D ug Deli e y 2011, 8, (3), 235-
244.
9. Lau e , S. D.; Res le, T. Cu en Pha maceu ical Design 2008, 14, (34), 3637-
3655.
10. Midoux, P.; Pichon, C.; Yaouanc, J. J.; Ja es, P. A. B i ish Jou nal o
Pha macology 2009, 157, (2), 166-178.
11. Laba -Moleu , F.; S e an, A. M.; B isson, C.; Pe on, H.; Feugeas, O.;
Fu s enbe ge , P.; Obe ling, F.; B ambilla, E.; Beh , J. P. Gene The apy 1996, 3,
(11), 1010-1017.
12. Pa hak, A.; Pa naik, S.; Gup a, K. C. Bio echnology Jou nal 2009, 4, (11), 1559-
1572.
13. Gao, X.; Kim, K. S.; Liu, D. AAPS Jou nal 2007, 9, (1), E92-104.
14. Fische , D.; Li, Y.; Ahlemeye , B.; K iegls ein, J.; Kissel, T. Bioma e ials 2003,
24, (7), 1121-1131.
15. Hun e , A. C. Ad . D ug Deli e y Re iews 2006, 58, (14), 1523-1531.
16. Al-Dosa i, M. S.; Gao, X. AAPS Jou nal 2009, 11, (4), 671-681.
17. Nakayama, Y. Accoun s o Chemical Resea ch 2012, 45, (7), 994-1004.
18. Schallon, A.; Jé ôme, V.; Wal he , A.; Syna schke, C. V.; Mülle , A. H. E.;
F ei ag, R. Reac i e and Func ional Polyme s 2010, 70, 1-10.
19. Syna schke, C. V.; Schallon, A.; Jé ôme, V.; F ei ag, R.; Mülle , A. H. E.
Biomac omolecules 2011, 12, 4247 - 4255.
20. Che ng, J.-Y.; an de We e ing, P.; Talsma, H.; C ommelin, D. J. A.; Hennink, W.
E. Pha maceu ical Resea ch 1996, 13, (7), 1038-1042.
21. Plampe , F. A.; Schmalz, A.; Peno -Chang, E.; D echsle , M.; Jusu i, A.;
Ballau , M.; Mülle , A. H. E. Mac omolecules 2007, 40, (16), 5689-5697.
22. Wang, J. S.; G esz a, D.; Ma yjaszewski, K. Abs ac Pape s, Join Con e ence –
Chemical Ins i u e o Canada and Ame ican Chemical Socie y 1995, 210, 227-
PMSE.
23. Ha ada, A.; Ka aoka, K. P og ess in Polyme Science 2006, 31, (11), 949-982.
24. Miya a, K.; Ch is ie, R. J.; Ka aoka, K. Reac i e and Func ional Polyme s 2011,
71, (3), 227-234.
25. Newland, B.; Tai, H.; Zheng, Y.; Velasco, D.; Di Luca, A.; Howdle, S. M.;
Alexande , C.; Wang, W.; Pandi , A. Chemical Communica ions 2010, 46, (26),
4698-4700.
26. Zhong, Z.; Song, Y.; Engbe sen, J. F.; Lok, M. C.; Hennink, W. E.; Feijen, J.
Jou nal o Con olled Release 2005, 109, (1-3), 317-329.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
125
27. Layman, J. M.; Rami ez, S. M.; G een, M. D.; Long, T. E. Biomac omolecules
2009, 10, (5), 1244-1252.
28. an de We e ing, P.; Che ng, J. Y.; Talsma, H.; C ommelin, D. J. A.; Hennink, W.
E. Jou nal o Con olled Release 1998, 53, (1-3), 145-153.
29. Geo giou, T. K.; Vam akaki, M.; Pa ickios, C. S.; Yamasaki, E. N.; Phylac ou, L.
A. Biomac omolecules 2004, 5, (6), 2221-2229.
30 Xu, F. J.; Zhang, Z. X.; Ping, Y.; Li, J.; Kang, E. T.; Neoh, K. G.
Biomac omolecules 2009, 10, (2), 285-293.
31. Aliabadi, . M. Land y, B. Sun, C. Tang, T. Uludağ, . Bioma e ials 2012, 33,
(8), 2546-2569.
32. Scholz, C.; Wagne , E. Jou nal o Con olled Release 2012, 161, (2), 554-565.
33. Zhang, S.; Zhao, Y.; Zhi, D.; Zhang, S. Bioo ganic Chemis y 2012, 40, (0), 10-
18.
34. Benoi , D. S.; Hen y, S. M.; Shubin, A. D.; Ho man, A. S.; S ay on, P. S.
Molecula Pha maceu ics 2010, 7, (2), 442-455.
35. Con e ine, A. J.; Benoi , D. S. W.; Du all, C. L.; Ho man, A. S.; S ay on, P. S.
Jou nal o Con olled Release 2009, 133, (3), 221-229.
36. Con e ine, A. J.; Diab, C.; P ie e, M.; Paschal, A.; Ho man, A. S.; Johnson, P.
H.; S ay on, P. S. Biomac omolecules 2010, 11, (11), 2904-2911.
37. Kong, W.-H.; Sung, D.-K.; Shim, Y.-H.; Bae, K. H.; Dubois, P.; Pa k, T. G.; Kim,
J.-H.; Seo, S.-W. Jou nal o Con olled Release 2009, 138, (2), 141-147.
38. Pa i i, K. S.; Pa ickios, C. S.; Geo giou, T. K.; Yamasaki, E. N.;
Mas oyiannopoulos, N. P.; Phylac ou, L. A. Eu opean Polyme Jou nal 2012, 48,
(8), 1422-1430.
39. Zhu, C.; Jung, S.; Luo, S.; Meng, F.; Zhu, X.; Pa k, T. G.; Zhong, Z. Bioma e ials
2010, 31, (8), 2408-2416.
40. Ga y, D. J.; Lee, H.; Sha ma, R.; Lee, J. S.; Kim, Y.; Cui, Z. Y.; Jia, D.; Bowman,
V. D.; Chipman, P. R.; Wan, L.; Zou, Y.; Mao, G.; Pa k, K.; He be , B. S.;
Konieczny, S. F.; Won, Y. Y. ACS Nano 2011, 5, (5), 3493-4505.
41. Lin, D.; Huang, Y.; Jiang, Q.; Zhang, W.; Yue, X.; Guo, S.; Xiao, P.; Du, Q.;
Xing, J.; Deng, L.; Liang, Z.; Dong, A. Bioma e ials 2011, 32, (33), 8730-8742.
42. Go ine , C.; Kepple , O. T. The FASEB Jou nal 2006, 20, (3), 500-502.
43. Webe , N. D.; Me kel, O. M.; Kissel, T.; Munoz-Fe nandez, M. A. Jou nal o
Con olled Release 2012, 157, (1), 55-63.
44. Schache , F.; Müllne , M.; Schmalz, H.; Mülle , A. H. E. Mac omolecula
Chemis y and Physics 2009, 210, (3-4), 256-262.
45. Mo i, H.; Mülle , A. H. E.; Klee, J. E. Jou nal o he Ame ican Chemical Socie y
2003, 125, (13), 3712-3713.
46. Mo i, H.; Wal he , A.; And e, X.; Lanzendo e , M. G.; Mülle , A. H. E.
Mac omolecules 2004, 37, (6), 2054-2066.
47. Mu huk ishnan, S.; Plampe , F.; Mo i, H.; Mülle , A. H. E. Mac omolecules 2005,
38, (26), 10631-10642.
48. F eima k, D.; Jé ôme, V.; F ei ag, R. Bio echnology Jou nal 2010, 5, (1), 24-31.
49. Chou, L.-F.; Chou, W.-G. Cell Biology In e na ional 1999, 23, (10), 663-670.
50. Kim, D.-H.; Behlke, M. A.; Rose, S. D.; Chang, M.-S.; Choi, S.; Rossi, J. J.
Na u e Bio echnology 2005, 23, (2), 222-226.
51. Pa nham, M. J.; We zig, H. Chemis y and Physics o Lipids 1993, 64, (1-3), 263-
274.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
126
52. Boussi , O.; Lezoualc'h, F.; Zan a, M. A.; Me gny, M. D.; Sche man, D.;
Demeneix, B.; Beh , J. P. P oceedings o he Na ional Academy o Science o he
Uni ed S a es o Ame ica 1995, 92, (16), 7297-7301.
53. Jeon, O.; Lim, H. W.; Lee, M.; Song, S. J.; Kim, B. S. Jou nal o D ug Ta ge ing
2007, 15, (3), 190-198.
54. Mislick, K. A.; Baldeschwiele , J. D. P oceedings o he Na ional Academy o
Science o he Uni ed S a es o Ame ica 1996, 93, (22), 12349-12354.
55. Guillem, V. M.; To mo, M.; Mo e , I.; Bene , I.; Ga cia-Conde, J.; C espo, A.;
Alino, S. F. Jou nal o Con olled Release 2002, 83, (1), 133-146.
56. Wang, D.-A.; Na ang, A. S.; Ko b, M.; Gabe , A. O.; Mille , D. D.; Kim, S. W.;
Maha o, R. I. Biomac omolecules 2002, 3, (6), 1197-1207.
57. A he on, G. T.; T a e s, H.; Deed, R.; No on, J. D. Cell G ow h and
Di e en ia ion1996, 7, (8), 1059-1066.
58. Eh ha d , C.; Schmolke, M.; Ma zke, A.; Knoblauch, A.; Will, C.; Wixle , V.;
Ludwig, S. Signal T ansduc ion 2006, 6, (3), 179-184.
59. Balci, B.; Dince , P. Bio echnology Jou nal 2009, 4, (7), 1042-1045.
60. Billie , L.; Gomez, J.-P.; Be chel, M.; Ja ès, P.-A.; Le Gall, T.; Mon ie , T.;
Be and, E.; Che adame, H.; Guégan, P.; Mé el, M.; Pi a d, B.; Ben egnu, T.;
Lehn, P.; Pichon, C.; Midoux, P. Bioma e ials 2012, 33, (10), 2980-2990.
61. Dodds, E.; Dunckley, M. G.; Naujoks, K.; Michaelis, U.; Dickson, G. Gene
The apy 1998, 5, (4), 542-551.
62. G osse, S.; Thé eno , G.; Monsigny, M.; Fajac, I. Jou nal o Gene Medicine 2006,
8, (7), 845-851.
63. Hamm, A.; K o , N.; B eibach, I.; Blind , R.; Bosse ho , A. K. Tissue
Enginee ing 2002, 8, (2), 235-245.
64. Guo, W.; Lee, R. J. Jou nal o Con olled Release 2001, 77, (1-2), 131-138.
65. Ki cheis, R.; Wigh man, L.; Wagne , E. Ad anced D ug Deli e y Re iews 2001,
53, (3), 341-358.
66. Laga, R.; Ca lisle, R.; Tangney, M.; Ulb ich, K.; Seymou , L. W. Jou nal o
Con olled Release 2012, 161, (2), 537-553.
67. Me dan, T.; Kopecek, J.; Kissel, T. Ad anced D ug Deli e y Re iews 2002, 54,
(5), 715-758.
68. Og is, M.; B unne , S.; Schulle , S.; Ki cheis, R.; Wagne , E. Gene The apy 1999,
6, (4), 595-605.
69. Üzgün, S.; Akdemi , O.; Hasenpusch, G.; Maucksch, C.; Golas, M. M.; Sande ,
B.; S a k, H.; Imke , R.; Lu z, J.-F.; Rudolph, C. Biomac omolecules 2010, 11,
(1), 39-50.
70. Ve baan, F. J.; Ousso en, C.; an Dam, I. M.; Takaku a, Y.; Hashida, M.;
C ommelin, D. J.; Hennink, W. E.; S o m, G. In e na ional Jou nal o
Pha maceu ics 2001, 214, (1-2), 99-101.
71. Dai, F.; Liu, W. Bioma e ials 2011, 32, (2), 628-638.
72. Cas ano o, D.; Rossi, J. J. Na u e 2009, 457, (7228), 426-433.
73. Takahashi, Y.; Nishikawa, M.; Takaku a, Y. Ad anced D ug Deli e y Re iews
2009, 61, (9), 760-766.
74. Cucca o, G.; Polynikis, A.; Siciliano, V.; G aziano, M.; di Be na do, M.; di
Be na do, D. BMC Sys ems Biology 2011, 5, (19), 1-12.
75. Maliyekkel, A.; Da is, B. M.; Roninson, I. B. Cell Cycle 2006, 5, (20), 2390-
2395.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
127
76. No ina, C. D.; Mu ay, M. F.; Dykxhoo n, D. M.; Be es o d, P. J.; Riess, J.; Lee,
S.-K.; Collman, R. G.; Liebe man, J.; Shanka , P.; Sha p, P. A. Na u e Medicine
2002, 8, (7), 681-686.
77. Hassani, Z.; Lemkine, G. F.; E bache , P.; Palmie , K.; Al ama, G.;
Gio annangeli, C.; Beh , J. P.; Demeneix, B. A. Jou nal o Gene Medicine 2005,
7, (2), 198-207.
78. Mao, S.; Ge me shaus, O.; Fische , D.; Linn, T.; Schnep , R.; Kissel, T.
Pha maceu ical Resea ch 2005, 22, (12), 2058-2068.
79. Va kouhi, A. K.; Lamme s, T.; Schi ele s, R. M.; an S eenbe gen, M. J.;
Hennink, W. E.; S o m, G. Eu opean Jou nal o Pha maceu ics Biopha maceu ics
2011, 77, (3), 450-457.
80. Va kouhi, A. K.; Moun ichas, G.; Schi ele s, R. M.; Lamme s, T.; S o m, G.;
Pispas, S.; Hennink, W. E. Eu opean Jou nal o Pha maceu ical Sciences 2012,
45, (4), 459-466.
81. Kuma , P.; Ban, H. S.; Kim, S. S.; Wu, H.; Pea son, T.; G eine , D. L.; Laoua ,
A.; Yao, J.; Ha idas, V.; Habi o, K.; Yang, Y. G.; Jeong, J. H.; Lee, K. Y.; Kim,
Y. H.; Kim, S. W.; Peipp, M.; Fey, G. H.; Manjuna h, N.; Shul z, L. D.; Lee, S.
K.; Shanka , P. Cell 2008, 134, (4), 577-586.
82. Majewski, A. P.; Schallon, A.; Jé ôme, V.; F ei ag, R.; Mülle , A. H. E.; Schmalz,
H. Biomac omolecules 2012, 13, (3), 857-866.
83. Manganiello, M. J.; Cheng, C.; Con e ine, A. J.; B ye s, J. D.; S ay on, P. S.
Bioma e ials 2012, 33, (7), 2301-2309.
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
134
Figu e 4-S4 Analysis o CD4 exp ession a e human T lymphocy es we e ei he mock deli e ed (EGFP-
siRNA) o deli e ed wi h hCD4-siRNA. P io o ans ec ion, Pe iphe al blood mononuclea cells (PBMCs)
we e cul i a ed o 2 – 3 days in QPBL medium o s imula e p oli e a ion o he T lymphocy es. On he day
o ans ec ion he cells a e ≥ 95 % CD3+ wi h blas mo phology. Fo ans ec ion, polyplexes we e o med
wi h ei he b-PEI o Si-PDMAEMA and 25 nM siRNA a a N/P a io o 10. 30 h pos - ans ec ion, he cells
we e s ained wi h CD4-FITC an ibody, coun e s ained wi h p opidium iodide o es ima ion o he dead
cells and hen analyzed o CD4 exp ession by low cy ome y. Cells we e ini ially e alua ed by sca e
p ope ies (FSC/SSC) in o de o selec a egion ep esen ing single non-apop o ic cells (ga e “lympho”)
and o sca e and luo escence (SSC/PI) in o de o selec he li ing cells (ga e “li ing”). Non- ea ed cells
(“con ol”), o he wise simila ly ea ed we e used o se he egions de ined as “CD4high” and “CD4low”. The
exp ession o he CD4 p o ein was assessed in his og am plo s (g een luo escence in ensi y on he x-axis
and cell numbe on he y-axis) ep esen ing he in ensi y o he CD4-FITC luo escence (CD4low:
luo escence in ensi y be ween 70 and 170; CD4high: luo escence in ensi y > 170) in he li ing T
lymphocy es (de ined as a sub-popula ion o ga e “lympho” and ga e “li ing”). The da a a e p esen ed as
his og ams o e lays (“con ol cells”: line and ill colo g ay “l-PEI”: black line “Si-PDMAEMA”: ed
line).

Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
135
Figu e 4-S5 G een luo escencen p o ein low cy ome y analysis a e ans ec ion o Ju ka cells wi h
Mic-PDMAEMA.Fo ans ec ion polyplexes we e o med wi h Mic-PDMAEMA and 15 µg/mL pEGFP-
N1 a N/P 5, 10, and 20. 24 h pos - ans ec ion, he cells we e analyzed o EGFP exp ession. Cells we e
ini ially e alua ed by sca e p ope ies (FSC/SSC) in o de o selec a egion ep esen ing single non-
apop o ic cells. This ga ed egion (R0) was u he analyzed o luo escence (PI/EGFP). Do plo s wi h log
o he ed luo escence in ensi y (PI) on he x-axis and log o he g een luo escence in ensi y (EGFP) on
he y-axis we e used o es ima e he pe cen age o EGFP-exp essing cells in he main non-apop o ic cell
popula ion (ga e R0). Nega i e con ols (con ol; non- ans ec ed cells) we e used o se he posi ion o
quad an s sepa a ing GFP-posi i e li ing cells (uppe le ), GFP-posi i e dead cells (uppe igh ), GFP-
nega i e li ing cells (lowe le ) and GFP-nega i e dead cells (lowe igh ). These quad an s we e applied
o he analysis o ans ec ed cells and pe cen age cell numbe / o al cell numbe in he ga ed egion we e
calcula ed o each quad an .
Chap e 4 – E ec i e Deli e y o Nucleic Acids o Di e en ia ed Cells and Human T Lymphocy es
136
Chap e 5 – Double-Laye ed Micella In e polyelec oly e Complexes – How Many Shells o a Co e?
137
Chap e 5
Double-Laye ed Micella In e polyelec oly e Complexes –
How Many Shells o a Co e?
The esul s om his chap e ha e been published in So Ma e as:
“Double-Laye ed Micella In e polyelec oly e Complexes – How Many Shells o a
Co e?”
by Ch is ophe V. Syna schke, Felix H. Schache ,* Melanie Fö sch, Ma kus D echsle ,
and Axel H. E. Mülle *
Chap e 5 – Double-Laye ed Micella In e polyelec oly e Complexes – How Many Shells o a Co e?
138
Chap e 5 – Double-Laye ed Micella In e polyelec oly e Complexes – How Many Shells o a Co e?
139
Abs ac
We epo on he o ma ion o double-laye ed micella in e polyelec oly e complexes
(IPECs) om ABC iblock e polyme p ecu so micelles and hyd ophilic homo- o
block copolyme s. Polybu adiene-block-poly(1-me hyl-2- inyl py idinium)-block-
poly(sodium me hac yla e) (PB-b-P2VPq-b-PMANa) block e polyme s o m micelles in
aqueous solu ion a high pH exhibi ing a PB co e, a P2VPq/PMANa in amicella IPEC
(im-IPEC) shell, and a PMANa co ona, which is nega i ely cha ged. Upon mixing wi h
ei he posi i ely cha ged, qua e nized poly(N,N-dime hylaminoe hyl me hac yla e)
(PDMAEMAq) homopolyme s o i s double-hyd ophilic block copolyme wi h
poly(e hylene oxide) (PEO-b-PDMAEMAq), a u he IPEC shell is o med, ende ing
co e-shell-shell-co ona agg ega es. The e ec s o he a io o posi i e o nega i e cha ges,
Z+/-, he composi ion o he block e polyme micelles, and he leng h o he added Dq
block we e in es iga ed. We show ha wi hin a ce ain Z+/- egime s able complex
micella IPECs ea u ing wo dis inguishable IPEC shells a e o med. The so- o med
complex pa icles we e analyzed by dynamic ligh sca e ing and c yogenic ansmission
elec on mic oscopy.

Chap e 5 – Double-Laye ed Micella In e polyelec oly e Complexes – How Many Shells o a Co e?
140
Chap e 5 – Double-Laye ed Micella In e polyelec oly e Complexes – How Many Shells o a Co e?
141
In oduc ion
Sel -assembly o block co- and e polyme s in solu ion has ecei ed conside able in e es
du ing he pas decade.1, 2 Typically, such p ocesses lead o he o ma ion o sphe ical
micelles,3, 4 cylind ical o od-like agg ega es,5-7 o esicles.8 Pa icula in e es is de o ed
o he con ol o size, size dis ibu ion, shape, o he numbe o ype o unc ional g oups
p esen on he su ace o such pa icles. This can be achie ed by con olling he kine ics
o he sel -assembly p ocess,9 h ough changing he polyme composi ion o
a chi ec u e,10 o ia he a ia ion o ex e nal pa ame e s like he employed sol en ,11, 12
pH,13 salini y,14 o empe a u e.15
Ano he possibili y o in luence sel -assembly p ocesses in solu ion is o employ block
copolyme s wi h cha ged compa men s, o polyelec oly e segmen s.16, 17 Such
polyelec oly es can be na u al (e.g., polynucleic acids) o syn he ic polyanions o -
ca ions and can be u he subdi ided in o weak (e.g., poly(me hac ylic acid), PMAA) o
s ong (e.g., poly(s y ene sul ona e)) species.18 Recen esea ch in e es in such ma e ials
has been p ima ily based on in insic p ope ies such as wa e solubili y, e y s ong in e -
and in a-chain in e ac ions, ionic conduc i i y, and su ace ac i i y.19
Mixing o wo di e en block copolyme s wi h polyelec oly e segmen s bea ing opposi e
cha ges in aqueous solu ion leads o elec os a ic co-assembly and he o ma ion o
in e polyelec oly e complexes (IPECs).20-22 The d i ing o ce is he en opy gain om
he elease o he coun e ions. Such IPECs a e hyd ophobic ye a e s ill able o pa icipa e
in dynamic polyion exchange eac ions in aqueous media.23, 24 I weak polyelec oly es
like PMAA a e used, he complex o ma ion is pH-dependen .25 In addi ion, he IPEC
o ma ion is e e sible: he addi ion o la ge amoun s o sal leads o a sc eening o he
cha ges and o a b eakup o he complexes.20, 26 I p e o med micelles wi h a cha ged
co ona a e mixed wi h opposi ely cha ged polyelec oly es, an elegan ou e owa ds
complex micella a chi ec u es is opened. This has been demons a ed o micelles
exhibi ing a so polyisobu ylene co e and a PMAA co ona25, 26 o o mo e complex co e-
compa men alized block e polyme micelles.27
Wi hin his con ibu ion we demons a e o he i s ime he o ma ion o wo dis inc ly
di e en adjacen IPEC shells wi hin he same complex micella agg ega e. As s a ing
ma e ial we employ mul icompa men micelles exhibi ing a so polybu adiene (PB)
co e, a discon inuous shell consis ing o an in amicella IPEC (im-IPEC) be ween
Chap e 5 – Double-Laye ed Micella In e polyelec oly e Complexes – How Many Shells o a Co e?
142
qua e nized poly(2- inylpy idine) (P2VPq) and poly(sodium me hac yla e) (PMANa),
and a co ona o excess PMANa, hus ende ing colloidal objec s wi h a nega i e su ace
cha ge. These micelles a e o med i ampholy ic block e polyme s, polybu adiene-block-
poly(1-me hyl-2- inyl py idinium)-block-poly(sodium me hac yla e) (PB-b-P2VPq-b-
PMANa), sel -assemble in aqueous solu ion a pH 10, condi ions whe e me hac ylic acid
is nega i ely cha ged.28 To his is added ano he solu ion con aining a posi i ely cha ged
polyelec oly e, being ei he qua e nized poly(N,N-dime hylaminoe hyl me hac yla e)
(PDMAEMAq) homopolyme s o di e en chain leng h o he co esponding double-
hyd ophilic block copolyme wi h poly(e hylene oxide) (PEO-b-PDMAEMAq). This hen
esul s in u he IPEC o ma ion be ween he PMANa co ona and PDMAEMAq and he
gene a ion o a second IPEC shell. The whole p ocess is shown in Scheme 5-1.
Scheme 5-1: Schema ic pa hway o he o ma ion o double-laye ed IPECs om PB-b-P2VPq-b-PMANa
block e polyme micelles and ei he PDMAEMAq homopolyme s (le ) o a PEO-b-PDMAEMAq diblock
copolyme ( igh ).
Chap e 5 – Double-Laye ed Micella In e polyelec oly e Complexes – How Many Shells o a Co e?
143
In case o PEO-b-PDMAEMAq, he PEO chains hen se e as he co ona o he gene a ed
co e-shell-shell-co ona pa icle and main ain a good solubili y in aqueous media. We
in es iga ed wo PDMAEMAq homopolyme s o di e en chain leng h, in sho : Dq162
and Dq820, and one double-hyd ophilic block copolyme , EO325Dq157, he subsc ip s
deno ing he deg ee o polyme iza ion o he co esponding block. As p ecu so micelles
h ee di e en block e polyme s, PB800-b-P2VPq190-b-PMANa345, PB800-b-P2VPq190-b-
PMANa465, and PB800-b-P2VPq190-b-PMANa550, we e used. In he ollowing sec ions a
sho e nomencla u e, BVqMANax, will be used o he p ecu so micelles, as he i s
wo blocks (B and Vq) ha e he same deg ee o polyme iza ion in all cases shown in his
manusc ip . The complexa ions we e pe o med a di e en Z+/- alues. We de ine Z+/- by
di iding he numbe o ca ionic Dq monome uni s added o he micella solu ion di ided
by he numbe o ee (non-complexed) anionic MANa uni s p esen , as shown in
equa ion (5-1).
/
Dq
MANa Vq
n
Znn

(5-1)
The s uc u e and he s abili y o he o med micella IPECs we e analyzed using dynamic
ligh sca e ing (DLS) and cy ogenic ansmission elec on mic oscopy (c yo-TEM).
Expe imen al
Syn hesis
Ma e ials. The sol en s o he p epa a ion o he micella solu ions we e pu chased in
p.a. g ade and used as deli e ed. Dime hyl sul a e (Me2SO4, >99 %, Ald ich) and
hyd ochlo ic acid (32 %) we e used as ecei ed. Bu e solu ions wi h pH 10
(H3BO3/KCl/NaOH) we e ob ained om Fluka and con ained abou 0.3 w . % sal . The
ini ia o o ATRP, e hylb omo isobu y a e (EBIB) was dis illed and s o ed unde
ni ogen. HMTETA was dis illed p io o use. Anisole (p.a. g ade, Fluka) and CuB (>99
%, Ald ich) we e used as ecei ed.
Acknowledgemen s
246
The MC2-Team dese es a e y BIG hanks. Wo king in he g oup has been a wonde ul
expe ience, and I ha e ne e me a g oup ha sha ed a simila spi i as we did in MC2.
Thanks o he e e yday help in he labo a o ies, o many a co ee, cake, bee and
Schnapps sha ed in he ki chen, he coun less ba beques and all he un we had on ou
ips o con e ences.
The echnicians kep he lab in good wo king condi ion. I wan o hank Melanie Fö sch
and Annika P a enbe ge o aking ca e o all my TEM samples and oge he wi h Dane
Blasse o o ming my “MALDI-Team”. Toge he we kep he old lady in good shape.
Ma ie a Böhm, I hank o always being he e o measu e he icky samples I p epa ed
o SEC. Fu he , Anne e K ökel ook ca e o much o he adminis a i e wo k occu ing
in he lab, and could always ell me whe e o ind he odd missing piece o equipmen ,
glasswa e o consumable. Thank you o ha .
I also hank he “good soul” o he MC2, Gaby Oli e , who somehow always managed o
ge hings done wi h he uni e si y adminis a ion e en on e y sho no ice. She wo ked
he mi acle ways o e-o ganize he g oup money and always ound a ollow-up con ac
om a ious sou ces o me.
Many people came and wen in MC2 du ing my ime he e. Thanks o he ema kable
a mosphe e you c ea ed (in no pa icula o de ): Ma kus Müllne , And eas Hanisch,
Thomas Ruhland, Alexande Majewski, And é G öschel, Tina Löbling, E a Be hausen,
And ea Wol , S ephan Weiß, Sand ine Tea, And é P a , Alexande Schmalz, Joachim
Schmelz, S e an Reinicke, Zhicheng Zheng, F ancesca Benne , Holge Schmalz, Ma kus
D echsle , Anja Goldmann, Jiayin Yuan, And eas Wal he , Jun Ling, Jie Kong, Weian
Zhang, Ma ina K ekho a, S e an Döhle , Shohei Ida, Tony G an ille, Hülya A slan, I an
Babin, Mei a Ben-Lulu and Tomohi o i ano. The “Russian Ma ia” consis ing o
Dmi y (Dima) Pe gusho , La issa Siegolae a, Alexande (Sasha) Yakimansky and Oleg
Bo iso , as well as he co esponding “Spanish Ma ia”: Ramón No oa-Ca ballal, Lou des
Pas o -Pé ez and Ainhoa Tolen ino Chi i e. My s uden s and “ iwi´s” also dese e a big
hank you o all he e o hey pu in o hei wo k: Annika Ecka d , Fabian Pooch, I ina
Webe and Tobias Rudolph.
I would also like o hank P o . Ru h F ei ag o he good collabo a ion I had wi h he
g oup and o he suppo , especially in he inal pa o my hesis.

Acknowledgemen s
247
F om con e ences, mee ings and collabo a ions I hank hose people who did in luence
my wo k, o discussed ideas. S e en Weidne , Jana Falkenhagen, Volke Saue land,
Ch is o Ts e ano , Da in Pochan, Ch is ophe Ba ne -Kowollik, Helmu Schlaad, Felix
Plampe , Vladimi Tsuk uk, Jü gen Senke , And eas Fe y, Takuzo Aida, Ma hias Ka g,
Ma kus Re sch, Helmu Ringsdo , Ami Fahmi, Ha ald Pasch, Ian Manne s and Eugenia
Kumache a.
Du ing my 6-mon hs esea ch s ay a he Uni e si y o Tokyo, I me many people who
made my ime he e an excep ional expe ience. Fi s among hose people is P o .
Kazuno i Ka aoka, whom I deeply espec and who has imp essed me as being a
esea che o a e quali y. Wi hin his g oup o connec ed wi h he Uni e si y o Tokyo I
wan o hank Ho acio Cab al, Takahi o Nomo o, S e anie Deshayes, Philippe Sain -C icq
Ri ie e, Tomeu (The Bas a d) Sobe a s, Ad ien Kaese , Xiao Ling, Kazuko Toh, Yu
Ma sumo o, Sayan Chuanoi, Yuuki Mochida, Mi su u Nai o, Akihi o Kishimu a,
Nobuhi o Nishiyama, R. James (Jim) Ch is ie and Yu aka Miu a.
I am u he g a e ul o inancial suppo I ecei ed om a ious sou ces du ing my
wo k, mos impo an ly om he S a e o Ba a ia, he Ge man Academic Exchange
Se ice, he Cen e o Medical Sys ems Inno a ion and he SFB 840.
Many iends ha e suppo ed me h oughou he PhD p ocess and I canno name you all.
Le i su ice o say you a e an impo an pa o my li e. Thank you Anja, o all he lo e
and suppo you ga e me du ing hose wonde ul 6 yea s ha we sha ed. I wish you he
bes o you u u e and hope o emain a small pa o ha .
Mos impo an ly, I wan o hank my amily. My mo he Elisabe h I hank o suppo ing
me uncondi ionally, always lis ening o my ad en u es, successes and in some a e cases
my us a ions. Bo h my sis e s Dagma and F anziska ha e been an inspi a ion o me
and ha e shown me choices I migh no ha e known wi hou hem.
Acknowledgemen s
248
249
“The e is a heo y which s a es ha i e e anyone disco e s
exac ly wha he Uni e se is o and why i is he e, i will
ins an ly disappea and be eplaced by some hing e en mo e
biza e and inexplicable.
The e is ano he heo y which s a es ha his has al eady
happened.”
― Douglas Adams, The Res au an a he End o he
Uni e se
250
251
E klä ung
Die o liegende A bei wu de on mi selbs ändig e ass und ich habe dabei keine
ande en als die on mi angegebenen Hil smi el ode Quellen e wende .
Fe ne habe ich nich e such , ande wei ig mi ode ohne E olg eine Disse a ion
einzu eichen ode mich eine Dok o p ü ung zu un e ziehen.
Bay eu h, den 15. Janua 2014
Ch is ophe Volke Syna schke