scieee Science in your language
[en] (orig)
materials
Article
Nanoparticle Enhanced Antibody and DNA
Biosensors for Sensitive Detection of Salmonella
Sumeyra Savas 1, Aylin Ersoy 1, Yakup Gulmez 1, Selcuk Kilic 2, Belkis Levent 2and
Zeynep Altintas 3,*
1
National Research Institute of Electronics and Cryptology, The Scientific and Technological Research Council
of Turkey (TUBITAK), Kocaeli 41470, Turkey; [email protected].tr (S.S.);
2Turkey Public Health General Headquarter, Ankara 06100, Turkey; [email protected] (S.K.);
3Institute of Chemistry, Technical University of Berlin, Straße des 17. Juni 124, Berlin 10623, Germany
*Correspondence: [email protected]; Tel.: +49-30-314-23727
Received: 12 August 2018; Accepted: 22 August 2018; Published: 27 August 2018


Abstract:
Bacteria-related pathogenic diseases are one of the major health problems throughout
the world. Salmonella is a genus of rod-shaped Gram-negative enterobacteria of which more than
2600 serotypes have been identified. Infection with Salmonella can cause salmonellosis, a serious
bacterial toxi-infection syndrome associated with gastroenteritis, and paralyphoid and typhoid
fevers. Its rapid and sensitive detection is a key to the prevention of problems related to health.
This paper describes the development of antibody and DNA sensors for Salmonella detection using
a microfluidic-based electrochemical system. Commercial Salmonella typhimurium and Salmonella
typhimurium from human stool samples were investigated using standard and nanomaterial-amplified
antibody sensors. S. typhimurium could be detected down to 1 cfu mL
1
. The specificity of
immunoassay was tested by studying with non-specific bacteria including E. coli and S. aureus
that revealed only 2.01% and 2.66% binding when compared to the target bacterium. On the other
hand, the quantification of Salmonella DNA was investigated in a concentration range of 0.002–200
µ
M
using the developed DNA biosensor that demonstrated very high specificity and sensitivity with
a detection limit of 0.94 nM. Our custom-designed microfluidic sensor offers rapid, highly sensitive,
and specific diagnostic assay approaches for pathogen detection.
Keywords:
Salmonella spp.; pathogen detection; antibody biosensor; DNA biosensor; microfluidic-
based electrochemical sensor; nanoparticle enhanced bio-detection; infectious diseases
1. Introduction
Foodborne diseases lead to diverse health problems worldwide [
1
,
2
]. The World Health
Organization reported that Salmonella typhimurium and Salmonella enteritidis are the most common
causes of foodborne illnesses all over the world. According to the reports of the European Food Safety
Authority, human salmonellosis has resulted in three billion euros loss per year [
3
]. In some regions,
more than 90% of Salmonella strains isolated from humans until 1970 was S. typhimurium, but now
incidence of S. enteritidis is also gradually increasing, which has been the most frequently isolated
serotype in the last 10 years [
4
]. The symptoms of Salmonella infection include abdominal pain, fever,
nausea, vomiting, diarrhea, dehydration, weakness, and loss of appetite, and the symptoms normally
appear 12–72 h after ingestion of contaminated foods or beverages [5].
There are several methods used for the detection of Salmonella serotypes, such as cultivation
techniques [
6
], enzyme-linked immunosorbent assays (ELISAs) [
7
], polymerase chain reaction (PCR)
Materials 2018,11, 1541; doi:10.3390/ma11091541 www.mdpi.com/journal/materials
Materials 2018,11, 1541 2 of 17
methods [
8
10
], and biosensors [
11
]. The gold standard for detection of Salmonella serotypes are
still conventional methods that are sensitive and inexpensive. However, these techniques require
more than five days to obtain a result and often lack in providing good specificity and sensitivity.
Additionally, the cultivation techniques are generally time consuming and the limit of detection for the
analysis is insufficient. The use of biosensor technology is a strong alternative to the other techniques
by offering highly sensitive, rapid, and easy-to-use bio-detection principles [
12
]. Today, biosensors
are widely used for pathogen detection and are able to measure bacteria down to 1 cfu mL
1
. This is
particularly due to the significant impact of nanomaterials on the advancement of biosensors and
biosensing principles [
13
15
]. Furthermore, microbial biosensors often require sample volumes in the
microliter range and very short analysis time.
Various transducer systems based on surface plasmon resonance (SPR) [
16
], quartz crystal
microbalance (QCM) [
17
], and electrochemical sensing strategies [
18
] have been successfully employed
for bacteria detection. Offering very high sensitivity and good detection capacity electrochemical
sensors are among the widely used systems for Salmonella quantification [
14
,
19
,
20
]. Zhu et al.
developed a multichannel electrochemical immunosensor for Salmonella detection by combining the
rolling circle amplification with DNA-gold nanoparticles (AuNPs) probe [
20
]. Afonso et al. reported
a disposable immunosensor for electrochemical detection of Salmonella enterica subsp. Enterica serovar
Typhimurium LT2 using gold nanoparticles and magneto-immunoassay [
14
]. Sensitive amperometric
detection of Salmonella was also reported [
21
24
]. Even though great progress has been demonstrated
in the Salmonella detection, employing only one antibody in the biosensor design often results in
insufficient sensitivity, when the sensor could hardly discriminate between two LPS samples from two
different Gram-negative bacteria [25].
To overcome the selectivity problem, herein, we report antibody- and DNA-based biosensors
for Salmonella detection using a fully-automated custom-designed microfluidic sensing device
(MiSens) [
18
] that is composed of an electromechanical unit controlling the assay protocol via its
integrated software (MiCont
TM
). Normal and gold-nanoparticle amplified sandwich assays were
developed and used for the detection of commercial Salmonella samples and real samples from human
stool. DNA biosensor was developed by capturing the surface DNA probe on the neutravidin (NA)
immobilized sensor surface and then measuring the target Salmonella DNA based on the hybridization
reaction that occurs between the target DNA and the surface probe. As the measurement system relies
on the enzymatic reaction between horseradish peroxidase (HRP) and 3,3
0
,5,5
0
-tetramethylbenzidine
(TMB), the detector antibody and the DNA detection probe were both labeled with HRP. We have
demonstrated that the developed antibody and DNA biosensors are capable of measuring trace
amounts of Salmonella and Salmonella DNA, respectively.
2. Materials and Methods
2.1. Materials and Reagents
A monoclonal anti-Salmonella antibody was bought from BIO-RAD (Puchheim, Germany).
Peroxidase-labeled goat anti-Salmonella secondary antibody (BacTrace
®
Anti-Salmonella CSA-1 Antibody)
and Salmonella typhimurium were purchased from SeraCare Life Sciences (Gaithersburg, MD, USA).
Staphylococcus aureus and E. coli from human stool samples were obtained from the Public Health Agency
(Ankara, Turkey) for cross-reactivity studies. 11-Mercaptoundecanoic acid (MUDA), phosphate-buffered
saline tablets (PBS, 0.01 M phosphate buffer, 0.0027 M potassium chloride and 0.137 M sodium
chloride, pH 7.4), N-hydroxysuccinimide (NHS), analytical grade ethanol, horseradish peroxidase
(HRP), ethanolamine, and 3,3
0
,5,5
0
-tetramethylbenzidine (TMB) ready to use reagent with H
2
O
2
,
were purchased from Sigma Aldrich (Poole, UK). The gold nanoparticles in 15 nm (for DNA
assays) and 40 nm (for antibody assays) sizes were purchased from BBI International (Cardiff, UK).
Ultrapure water (18 M
cm
1
) produced by a Milli-Q water system was used for analyses (Millipore Corp.,
Tokyo, Japan). 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) and biotin were purchased
Materials 2018,11, 1541 3 of 17
from Thermo Fisher Scientific (Loughborough, UK). The oligonucleotide sequences (target sequence:
5
0
-ACCGACGGCGAGACCGACTTT-3
0
; surface probe: Biotin-5
0
-CTCACCAGGAGATTACAACATGG;
detection probe: Biotin-3
0
-AGTGGCTAAAAGTCGGTCTC; control surface probe: Biotin-5
0
-
CAATATTTGGCGTGAATGGGTCGGAAAACA) for DNA sensor development were obtained from
Sentromer DNA Technologies LLC (Istanbul, Turkey).
2.2. Isolation of Salmonella Typhimurium from Human Stool Samples
Human stool sample was inoculated onto Salmonella-Shigella and xylose lysine deoxycholate agar
mediums, and incubated at 37
C overnight. Bacterial culture was identified by using standard
biochemical tests (the use of glucose, citrate, and indole by bacteria, the production of gas and H
2
S
upon lactose fermentation of bacteria, the determination of the mobility and the ability to split urea).
The cultured colonies used glucose, citrate and indole confirmed the presence of Salmonella bacteria.
The isolate was serogrouped and serotyped using polyvalent and monovalent Salmonella antisera (Statens
Serum Institut, Copenhagen, Denmark) according to the Kauffmann-White scheme [
26
]. The colonies that
produced H
2
S were considered as a pure colony based on their morphology. After the confirmation and
serotyping, the strain was immediately frozen in tryptic soy broth with 16% glycerol at 80 C.
2.3. Fully-Automated Microfluidic-Based Electrochemical Sensor with a New Chip Design
A custom-designed fully-automated electrochemical sensor was used in this study to develop
antibody- and DNA-based biosensors for Salmonella detection. The sensor fabrication and its developmental
stages were fully described in our earlier studies [
18
,
27
,
28
]. Meanwhile, we have realized several drawbacks
dealing with device’s electronics and mechanics. One of the main problems was electromagnetic noise
in the signal. In order to decrease the noise level, two modifications were employed: (1) Increasing of
the distance between the microfluidic pumps and the potentiometer. The microfluidic pump spread
unwanted magnetic pulses by the pulse width modulation (PWM) mechanism; (2) Applying a coaxial
cable structure instead of unscreened cable structure between the biosensor and potentiostat circuit. Herein,
we designed and integrated a new chip (Figure 1) to improve the efficiency of the biosensing device and
the reproducibility of the assays. The electrodes were designed on the glass slide (10
×
20 mm) using a fine
metal mask, which was made of a laser-cut patterned stainless steel. Au was deposited on the wafer by
means of an electron beam evaporator (Ebeam system Nanovak NVEB-600, Nanovak, Ankara, Turkey).
Prior to the application of Au (200 nm), a 40 nm Ti layer was applied on to the wafer as an intermediary
adhesive layer to enhance the adhesion between the glass slide and the Au. Each array contains eight
working electrodes with a shared Au counter and quasi-reference electrodes. The experiments were
carried out using the MiCont
TM
software (TUB˙
ITAK-B˙
ILGEM, Kocaeli, Turkey) running on a wireless PC.
The assay protocols were generated, saved, and used when required.
Materials 2018, 11, x FOR PEER REVIEW 3 of 17
control surface probe: Biotin-5- CAATATTTGGCGTGAATGGGTCGGAAAACA) for DNA sensor
development were obtained from Sentromer DNA Technologies LLC (Istanbul, Turkey).
2.2. Isolation of Salmonella Typhimurium from Human Stool Samples
Human stool sample was inoculated onto Salmonella-Shigella and xylose lysine deoxycholate
agar mediums, and incubated at 37 °C overnight. Bacterial culture was identified by using standard
biochemical tests (the use of glucose, citrate, and indole by bacteria, the production of gas and H
2
S
upon lactose fermentation of bacteria, the determination of the mobility and the ability to split urea).
The cultured colonies used glucose, citrate and indole confirmed the presence of Salmonella bacteria.
The isolate was serogrouped and serotyped using polyvalent and monovalent Salmonella antisera
(Statens Serum Institut, Copenhagen, Denmark) according to the Kauffmann-White scheme [26]. The
colonies that produced H
2
S were considered as a pure colony based on their morphology. After the
confirmation and serotyping, the strain was immediately frozen in tryptic soy broth with 16%
glycerol at 80 °C.
2.3. Fully-Automated Microfluidic-Based Electrochemical Sensor with a New Chip Design
A custom-designed fully-automated electrochemical sensor was used in this study to develop
antibody- and DNA-based biosensors for Salmonella detection. The sensor fabrication and its
developmental stages were fully described in our earlier studies [18,27,28]. Meanwhile, we have
realized several drawbacks dealing with device’s electronics and mechanics. One of the main
problems was electromagnetic noise in the signal. In order to decrease the noise level, two
modifications were employed: (1) Increasing of the distance between the microfluidic pumps and the
potentiometer. The microfluidic pump spread unwanted magnetic pulses by the pulse width
modulation (PWM) mechanism. (2) Applying a coaxial cable structure instead of unscreened cable
structure between the biosensor and potentiostat circuit. Herein, we designed and integrated a new
chip (Figure 1) to improve the efficiency of the biosensing device and the reproducibility of the assays.
The electrodes were designed on the glass slide (10 × 20 mm) using a fine metal mask, which was
made of a laser-cut patterned stainless steel. Au was deposited on the wafer by means of an electron
beam evaporator (Ebeam system Nanovak NVEB-600, Nanovak, Ankara, Turkey). Prior to the
application of Au (200 nm), a 40 nm Ti layer was applied on to the wafer as an intermediary adhesive
layer to enhance the adhesion between the glass slide and the Au. Each array contains eight working
electrodes with a shared Au counter and quasi-reference electrodes. The experiments were carried
out using the MiCont
TM
software (TUBİTAK-BİLGEM, Kocaeli, Turkey) running on a wireless PC.
The assay protocols were generated, saved, and used when required.
Figure 1. Illustration of MiSens electrochemical sensor and its new chip design.
Figure 1. Illustration of MiSens electrochemical sensor and its new chip design.
Advertisement
Materials 2018,11, 1541 4 of 17
2.4. Sensor Chip Cleaning and SAM Deposition
Prior to forming a self-assembled monolayer (SAM) on the sensor chip, the electrode surfaces were
cleaned by employing nitrogen plasma [
29
,
30
]. A 2 mM concentration of MUDA was used to prepare
the thiol solution in absolute ethanol for SAM deposition [
18
]. The sensor chips were immersed in the
ethanolic solution for overnight followed by washing with ethanol and Milli-Q water, respectively.
Later on the sensor chips were dried thoroughly under a stream of nitrogen gas, vacuum-packed,
and stored at +4 C till use.
2.5. Selection of HRP Concentration for Bioassays
Different concentrations of HRP were initially measured using MiSens device (TUB˙
ITAK-B˙
ILGEM,
Kocaeli, Turkey) to determine the optimum HRP amount for bioassays. For this, six different
concentrations of HRP were mixed with same amount of TMB and injected to the MUDA coated
surfaces. These optimization experiments were repeated three times and the optimum HRP
concentration was chosen based on the average sensor signals.
2.6. Characterization of SAM Coated Sensor Chips Using AFM
The bare gold, the SAM coated and the antibody immobilized sensor chips were visualized
by employing a Naio (Nanosurf AG, Liestal, Switzerland) atomic force microscope (AFM).
Commercially available AFM probes (NCLR) from NanoWorld (NanoWorld AG, Liestal, Switzerland)
were used for AFM measurements. The AFM analyses for the SAM-deposited surface and the antibody
immobilization were carried out after having completed three cycles of buffer wash flow. The sensor
surfaces during the DNA assays were also visualized using AFM. Hence, the NA immobilization,
the capturing of DNA surface probe on the NA layer, and the target DNA binding were confirmed.
The chips were undocked from the MiSens sensor after three cycles of buffer flow, dried using a gentle
nitrogen stream, and then immediately placed in a glass Petri dish. All AFM measurements were
performed at room temperature using the intermittent air mode.
2.7. Development of the Antibody Biosensor
Two different antibody sensors were developed in this work by using a monoclonal primary
antibody and a secondary polyclonal antibody for Salmonella. The primary antibody was used as
a surface ligand to specifically capture Salmonella bacterium, whereas the polyclonal antibody was
utilized as a detector antibody to increase the sensor signal. Two different bio-detection assays
were established: a standard sandwich assay (Scheme 1) and a nanoparticle enhanced sensor assay
(Scheme 2). In the latter case the polyclonal antibodies were initially conjugated with gold nanoparticles
prior to the Salmonella detection assay.
Materials 2018, 11, x FOR PEER REVIEW 4 of 17
2.4. Sensor Chip Cleaning and SAM Deposition
Prior to forming a self-assembled monolayer (SAM) on the sensor chip, the electrode surfaces
were cleaned by employing nitrogen plasma [29,30]. A 2 mM concentration of MUDA was used to
prepare the thiol solution in absolute ethanol for SAM deposition [18]. The sensor chips were
immersed in the ethanolic solution for overnight followed by washing with ethanol and Milli-Q
water, respectively. Later on the sensor chips were dried thoroughly under a stream of nitrogen gas,
vacuum-packed, and stored at +4 °C till use.
2.5. Selection of HRP Concentration for Bioassays
Different concentrations of HRP were initially measured using MiSens device (TUBİTAK-
BİLGEM, Kocaeli, Turkey) to determine the optimum HRP amount for bioassays. For this, six
different concentrations of HRP were mixed with same amount of TMB and injected to the MUDA
coated surfaces. These optimization experiments were repeated three times and the optimum HRP
concentration was chosen based on the average sensor signals.
2.6. Characterization of SAM Coated Sensor Chips Using AFM
The bare gold, the SAM coated and the antibody immobilized sensor chips were visualized by
employing a Naio (Nanosurf AG, Liestal, Switzerland) atomic force microscope (AFM).
Commercially available AFM probes (NCLR) from NanoWorld (NanoWorld AG, Liestal,
Switzerland) were used for AFM measurements. The AFM analyses for the SAM-deposited surface
and the antibody immobilization were carried out after having completed three cycles of buffer wash
flow. The sensor surfaces during the DNA assays were also visualized using AFM. Hence, the NA
immobilization, the capturing of DNA surface probe on the NA layer, and the target DNA binding
were confirmed. The chips were undocked from the MiSens sensor after three cycles of buffer flow,
dried using a gentle nitrogen stream, and then immediately placed in a glass Petri dish. All AFM
measurements were performed at room temperature using the intermittent air mode.
2.7. Development of the Antibody Biosensor
Two different antibody sensors were developed in this work by using a monoclonal primary
antibody and a secondary polyclonal antibody for Salmonella. The primary antibody was used as a
surface ligand to specifically capture Salmonella bacterium, whereas the polyclonal antibody was
utilized as a detector antibody to increase the sensor signal. Two different bio-detection assays were
established: a standard sandwich assay (Scheme 1) and a nanoparticle enhanced sensor assay
(Scheme 2). In the latter case the polyclonal antibodies were initially conjugated with gold
nanoparticles prior to the Salmonella detection assay.
Scheme 1. Principle of antibody sensor development for Salmonella detection using the standard assay.
Scheme 1.
Principle of antibody sensor development for Salmonella detection using the standard assay.
Materials 2018,11, 1541 5 of 17
Materials 2018, 11, x FOR PEER REVIEW 5 of 17
The running buffer used for immobilization was degassed buffered saline (PBS, pH 7.4) and this
buffer continuously flowed over the Au sensor surfaces between the injections. The flow rate of the
buffer/reagents for the assay was 50 µL min
1
unless written otherwise. For the assays, the SAM
deposited sensor chip was initially inserted to the device and primed with the running buffer (PBS).
The sensor surface was activated with a mixture of EDC (0.4 M) and NHS (0.1 M) in a 1:1 volume
ratio by 4 min injection prior to the covalent immobilization of the primary antibody (50 µg mL
1
,
prepared in NaAc buffer, pH: 4.5) during the 4 min injection (50 µL min
1
, 200 µL). The antibody-free
areas of the sensing surface were then blocked using a 100 µg mL
1
BSA solution (50 µL min
1
, 200
µL) and 1 M of ethanolamine (pH: 8.5, 50 µL min
1
, 200 µL), respectively. Bio-detection capacity of
the sensor was tested in the investigation range of 15.41 × 10
7
cfu mL
1
using two different Salmonella
sample sources: commercially available S. typhimurium and real S. typhimurium samples from human
stool. The samples were prepared in a particular PBS buffer containing 200 µg mL
1
BSA, 0.5 M NaCl,
500 µg mL
1
dextran, and 0.5% Tween 20. Each sample was injected to the sensor surface (50 µL min
1
,
200 µL) followed by the injection of the HRP-labelled secondary antibody (50 µL min
1
, 200 µL).
Amperometric measurements were then carried out at 0.1 V using TMB reagent (4 min, 50 µL min
1
)
followed by buffer injection (4 min, 100 µL min
1
). The sensor surface regeneration was achieved with
the injection of 0.1 M HCl (1 min, 100 µL min
1
) twice for the sequential detection of different
Salmonella concentrations.
The gold nanoparticle-enhanced bioassays (Scheme 2) were performed using the same
procedure. In this case, the HRP-labelled secondary antibody was conjugated with AuNPs prior to
the experiments to amplify the sensor signal. The AuNP conjugation protocol was described in our
earlier studies [18] and used as is in this work. The secondary antibody-labelled AuNPs were stored
at +4 °C and warmed to room temperature before use. The concentration of nanoparticles was
calculated at 525 nm wavelength and the AuNP solution was diluted based on the dilution factor
calculated by considering the OD value. Commercially available S. typhimurium and real S.
typhimurium samples from human stool were detected in a concentration range from 1 to 5.41 × 10
7
cfu mL
1
using the amperometric sensor.
Scheme 2. Principle of the gold nanoparticles enhanced immunosensor for Salmonella detection.
Scheme 2. Principle of the gold nanoparticles enhanced immunosensor for Salmonella detection.
The running buffer used for immobilization was degassed buffered saline (PBS, pH 7.4) and this
buffer continuously flowed over the Au sensor surfaces between the injections. The flow rate of the
buffer/reagents for the assay was 50
µ
L min
1
unless written otherwise. For the assays, the SAM
deposited sensor chip was initially inserted to the device and primed with the running buffer (PBS).
The sensor surface was activated with a mixture of EDC (0.4 M) and NHS (0.1 M) in a 1:1 volume
ratio by 4 min injection prior to the covalent immobilization of the primary antibody (50
µ
g mL
1
,
prepared in NaAc buffer, pH: 4.5) during the 4 min injection (50
µ
L min
1
, 200
µ
L). The antibody-free
areas of the sensing surface were then blocked using a 100
µ
g mL
1
BSA solution (50
µ
L min
1
, 200
µ
L)
and 1 M of ethanolamine (pH: 8.5, 50
µ
L min
1
, 200
µ
L), respectively. Bio-detection capacity of the
sensor was tested in the investigation range of 1–5.41
×
10
7
cfu mL
1
using two different Salmonella
sample sources: commercially available S. typhimurium and real S. typhimurium samples from human
stool. The samples were prepared in a particular PBS buffer containing 200
µ
g mL
1
BSA, 0.5 M
NaCl, 500
µ
g mL
1
dextran, and 0.5% Tween 20. Each sample was injected to the sensor surface
(50
µ
L min
1
, 200
µ
L) followed by the injection of the HRP-labelled secondary antibody (50
µ
L min
1
,
200
µ
L). Amperometric measurements were then carried out at
0.1 V using TMB reagent (4 min,
50
µ
L min
1
) followed by buffer injection (4 min, 100
µ
L min
1
). The sensor surface regeneration was
achieved with the injection of 0.1 M HCl (1 min, 100
µ
L min
1
) twice for the sequential detection of
different Salmonella concentrations.
The gold nanoparticle-enhanced bioassays (Scheme 2) were performed using the same procedure.
In this case, the HRP-labelled secondary antibody was conjugated with AuNPs prior to the experiments
to amplify the sensor signal. The AuNP conjugation protocol was described in our earlier studies [
18
]
and used as is in this work. The secondary antibody-labelled AuNPs were stored at +4
C and
warmed to room temperature before use. The concentration of nanoparticles was calculated at
525 nm wavelength and the AuNP solution was diluted based on the dilution factor calculated by
considering the OD value. Commercially available S. typhimurium and real S. typhimurium samples
from human stool were detected in a concentration range from 1 to 5.41
×
10
7
cfu mL
1
using the
amperometric sensor.
Advertisement
Materials 2018,11, 1541 6 of 17
2.8. Development of the DNA Biosensor
2.8.1. Immobilization of Neutravidin and DNA Capture Probe on the Sensor Chip Surface
The SAM formation was initially performed on the sensor chip using 2 mM MUDA as described
in Section 2.4. The chip and the PMMA cassette were then assembled together using a double-sided
sticky tape and docked to the sensor device that was primed with degassed Dulbecco’s modified
phosphate-buffered saline (PBS, pH: 7.4). The same reagent was used as the running buffer during NA
immobilization and continuously flowed over the sensor surfaces between the injections. The flow rate
of the sensor was 50
µ
L min
1
during the DNA bioassays unless written otherwise. The SAM-coated
electrode surfaces of the sensor chip were activated using amine coupling chemistry [
29
,
31
]. For this,
a mixture of EDC (0.4 M)-NHS (0.1 M) at 1:1 volume ratio was injected to the surface during 4 min.
The NA prepared in PBS (50
µ
g mL
1
, 250
µ
L) was then immobilized to the sensor surface followed
by the injection of ethanolamine (1 M, 250
µ
L
1
pH: 8.5) for blocking of the NA-free areas on the
surface [
31
]. After immobilization of NA, the running buffer was changed to Tris buffer (20 mM
Tris-HCI, 150 mM NaCl, and 1 mM EDTA, pH: 7.0) and it was used during the capturing of the
biotinylated complementary surface probe and the detection of Salmonella DNA. The surface probe
was prepared in Tris buffer in the concentration of 10
µ
M and injected to the NA-immobilized surface
for 5 min, followed by a 1 min injection of 10 mM biotin to block the remaining active sites of the NA
surface. To obtain a control surface, a biotinylated non-specific surface probe was captured on the
NA layer and used for the target detection assays. The sensor signals obtained upon the binding of
Salmonella DNA on the non-specific surfaces were subtracted from the results obtained on the target
specific surfaces.
2.8.2. Preparation of HRP-NA-Labelled AuNPs
The HRP-NA labelled AuNPs were used for the sensitive detection of the target DNA. In this
assay, HRP is required to convert TMB
red
to TMB
ox
, and produce a measurement signal using the
amperometric sensor (Scheme 3). It was well defined that proteins can physically bind to the gold
surface via electrostatic interactions [
32
]. Herein, the same approach was used for modification of
AuNPs with HRP and NA. For this, a 1 mL solution of the gold nanoparticles (15 nm) was derivatised
with NA (1.5
µ
L, 1 mg mL
1
) and HRP (2.5
µ
L, 1 mg mL
1
) in an Eppendorf tube that was covered by
aluminum foil to prevent exposure to light. This solution was incubated for 45 min on a shaker at room
temperature prior to centrifugation for discarding excess reagents. The supernatant was removed,
and 30
µ
L of BSA (10 mg mL
1
) and 100
µ
L Tris buffer (20 mM) were added to the tube, respectively.
The modified AuNPs were stored at +4
C until use. The AuNP concentration was determined using
a spectrophotometer at a wavelength of 525 nm.
Materials 2018, 11, x FOR PEER REVIEW 6 of 17
2.8. Development of the DNA Biosensor
2.8.1. Immobilization of Neutravidin and DNA Capture Probe on the Sensor Chip Surface
The SAM formation was initially performed on the sensor chip using 2 mM MUDA as described
in Section 2.4. The chip and the PMMA cassette were then assembled together using a double-sided
sticky tape and docked to the sensor device that was primed with degassed Dulbecco’s modified
phosphate-buffered saline (PBS, pH: 7.4). The same reagent was used as the running buffer during
NA immobilization and continuously flowed over the sensor surfaces between the injections. The
flow rate of the sensor was 50 µL min
1
during the DNA bioassays unless written otherwise. The
SAM-coated electrode surfaces of the sensor chip were activated using amine coupling chemistry
[29,31]. For this, a mixture of EDC (0.4 M)-NHS (0.1 M) at 1:1 volume ratio was injected to the surface
during 4 min. The NA prepared in PBS (50 µg mL
1
, 250 µL) was then immobilized to the sensor
surface followed by the injection of ethanolamine (1 M, 250 µL
1
pH: 8.5) for blocking of the NA-free
areas on the surface [31]. After immobilization of NA, the running buffer was changed to Tris buffer
(20 mM Tris-HCI, 150 mM NaCl, and 1 mM EDTA, pH: 7.0) and it was used during the capturing of
the biotinylated complementary surface probe and the detection of Salmonella DNA. The surface
probe was prepared in Tris buffer in the concentration of 10 µM and injected to the NA-immobilized
surface for 5 min, followed by a 1 min injection of 10 mM biotin to block the remaining active sites of
the NA surface. To obtain a control surface, a biotinylated non-specific surface probe was captured
on the NA layer and used for the target detection assays. The sensor signals obtained upon the
binding of Salmonella DNA on the non-specific surfaces were subtracted from the results obtained on
the target specific surfaces.
2.8.2. Preparation of HRP-NA-Labelled AuNPs
The HRP-NA labelled AuNPs were used for the sensitive detection of the target DNA. In this
assay, HRP is required to convert TMB
red
to TMB
ox
, and produce a measurement signal using the
amperometric sensor (Scheme 3). It was well defined that proteins can physically bind to the gold
surface via electrostatic interactions [32]. Herein, the same approach was used for modification of
AuNPs with HRP and NA. For this, a 1 mL solution of the gold nanoparticles (15 nm) was derivatised
with NA (1.5 µL, 1 mg mL
1
) and HRP (2.5 µL, 1 mg mL
1
) in an Eppendorf tube that was covered by
aluminum foil to prevent exposure to light. This solution was incubated for 45 min on a shaker at
room temperature prior to centrifugation for discarding excess reagents. The supernatant was
removed, and 30 µL of BSA (10 mg mL
1
) and 100 µL Tris buffer (20 mM) were added to the tube,
respectively. The modified AuNPs were stored at +4 °C until use. The AuNP concentration was
determined using a spectrophotometer at a wavelength of 525 nm.
Scheme 3. Principle of the DNA assay using the microfluidic-based electrochemical biosensor.
Scheme 3. Principle of the DNA assay using the microfluidic-based electrochemical biosensor.
Materials 2018,11, 1541 7 of 17
2.8.3. DNA Detection Assay
Specific gene for Salmonella spp. was selected based on the literature [
33
]. For DNA assays,
the biotinylated surface probe was initially captured by the NA immobilized surface. The concentrations
of capture (10
µ
M) and detection (10
µ
M) probes were kept the same for all experiments. The biotin-free
Salmonella DNA was incubated with the biotinylated detection probe for 10 min at 55
C using a thermal
cycler. The hybridized DNA molecules were then injected to the sensor surface during 5 min (250
µ
L)
followed by the injection of the HRP-NA modified AuNPs for 4 min (200
µ
L). The modified AuNPs
bound to the sensor surface via interaction between the biotin label of the detection probe and the
NA label of the AuNPs. The electrochemical signal was obtained using a real-time electrochemical
profiling
TM
(REP
TM
, TUB˙
ITAK-B˙
ILGEM, Kocaeli, Turkey) assay at a fixed potential of
0.1 V and the
current was measured continuously. The current values were recorded during Tris buffer injection and
this signal was considered as a baseline. The subsequent injection of 200
µ
L TMB revealed a current
change and the subtraction between the current obtained during TMB and buffer was used as the sensor
signal (Figure 2).
Materials 2018, 11, x FOR PEER REVIEW 7 of 17
2.8.3. DNA Detection Assay
Specific gene for Salmonella spp. was selected based on the literature [33]. For DNA assays, the
biotinylated surface probe was initially captured by the NA immobilized surface. The concentrations
of capture (10 µM) and detection (10 µM) probes were kept the same for all experiments. The biotin-
free Salmonella DNA was incubated with the biotinylated detection probe for 10 min at 55 °C using a
thermal cycler. The hybridized DNA molecules were then injected to the sensor surface during 5 min
(250 µL) followed by the injection of the HRP-NA modified AuNPs for 4 min (200 µL). The modified
AuNPs bound to the sensor surface via interaction between the biotin label of the detection probe
and the NA label of the AuNPs. The electrochemical signal was obtained using a real-time
electrochemical profilingTM (REPTM, TUBİTAK-BİLGEM, Kocaeli, Turkey) assay at a fixed potential of
0.1 V and the current was measured continuously. The current values were recorded during Tris
buffer injection and this signal was considered as a baseline. The subsequent injection of 200 µL TMB
revealed a current change and the subtraction between the current obtained during TMB and buffer
was used as the sensor signal (Figure 2).
Figure 2. The current response of an individual electrode at 0.1 V potential is recorded
uninterruptedly during the consequent injections of buffer and TMB substrate to the HRP-bound
electrode to obtain a sensorgram. The flow rate of the device is 50 µL min1 during the injections.
3. Results and Discussion
3.1. Antibody Sensor for Salmonella Detection
Prior to developing the bioassays, we initially investigated the optimum HRP concentration for
use in electrochemical sensor. The sensor signal gradually increased from 1.5 ng mL1 to 12 ng mL1
of HRP, whereas it showed a clear decrease afterwards (Figure 3). Hence, 12 ng mL1 was selected as
the optimum concentration for HRP and used for the entire study.
-800
-700
-600
-500
-400
-300
-200
-100
0
0 50 100 150 200 250 300 350 400 450 500
Sensor signal (nA)
Tris buffer
Sensor Signal (nA)
Time (s)
TMB Tris buffer
Figure 2.
The current response of an individual electrode at
0.1 V potential is recorded
uninterruptedly during the consequent injections of buffer and TMB substrate to the HRP-bound
electrode to obtain a sensorgram. The flow rate of the device is 50 µL min1during the injections.
3. Results and Discussion
3.1. Antibody Sensor for Salmonella Detection
Prior to developing the bioassays, we initially investigated the optimum HRP concentration for
use in electrochemical sensor. The sensor signal gradually increased from 1.5 ng mL
1
to 12 ng mL
1
of HRP, whereas it showed a clear decrease afterwards (Figure 3). Hence, 12 ng mL
1
was selected as
the optimum concentration for HRP and used for the entire study.
Advertisement
Materials 2018,11, 1541 8 of 17
Materials 2018, 11, x FOR PEER REVIEW 8 of 17
1.53 6 121824
0
50
100
150
200
250
HRP-Signal Relationship
Sensor Signal (nA)
HRP Concentration (ng mL
-1
)
(A)
(B)
Figure 3. Overall results of HRP-TMB optimization assays in a concentration range of 1.5–24 ng mL1
(A) and real-time sensorgrams obtained with six different HRP concentrations (B).
3.1.1. Standard Sandwich Assay for the Analysis of Commercial and Real Samples
The initial investigations were carried out with commercially available Salmonella typhimurium
samples using a standard sandwich assay. The bare, the SAM-coated, and the antibody-immobilized
sensor surfaces were characterized by AFM (Figure 4). The 3D surface topology images in 1 × 1 µm
scanning area resulted in the heights of 11.5 nm, 12.3 nm, 22 nm for bare (Figure 4A), MUDA-coated
(Figure 4B), and antibody-immobilized (Figure 4C) surfaces, respectively. The gradual increase of the
surface height confirmed the successful preparation of the sensor chip for bacteria detection assays.
-350
-300
-250
-200
-150
-100
-50
0
50
0 50 100 150 200 250 300 350 400
Sensor Signal (nA)
Time (s)
a: 1.5 ng mL
-1
HRP
b: 3 ng mL
-1
HRP
c: 6 ng mL
-1
HRP
d: 24 ng mL
-1
HRP
e: 18 ng mL
-1
HRP
f: 12 ng mL
-1
HRP
Figure 3.
Overall results of HRP-TMB optimization assays in a concentration range of 1.5–24 ng mL
1
(A) and real-time sensorgrams obtained with six different HRP concentrations (B).
3.1.1. Standard Sandwich Assay for the Analysis of Commercial and Real Samples
The initial investigations were carried out with commercially available Salmonella typhimurium
samples using a standard sandwich assay. The bare, the SAM-coated, and the antibody-immobilized
sensor surfaces were characterized by AFM (Figure 4). The 3D surface topology images in 1
×
1
µ
m
scanning area resulted in the heights of 11.5 nm, 12.3 nm, 22 nm for bare (Figure 4A), MUDA-coated
(Figure 4B), and antibody-immobilized (Figure 4C) surfaces, respectively. The gradual increase of the
surface height confirmed the successful preparation of the sensor chip for bacteria detection assays.
Materials 2018,11, 1541 9 of 17
Figure 4.
AFM analysis of bare (
A
), MUDA-coated (
B
) and antibody-immobilized (
C
,
D
) sensor surfaces.
Salmonella detection was investigated in the concentration range of 1–5.41
×
10
7
cfu mL
1
,
which provided a limit of detection (LOD) of 2.7
×
10
1
cfu mL
1
for both commercial and real samples.
The average signal ratio in the entire concentration range between commercial and real sample analyses
was determined as 1.1. The overall results of Salmonella detection were subjected to the logarithmic
regression analysis that resulted in the correlation coefficients of 0.9671 and 0.9505 for commercial and
real samples, respectively (Figure 5).
Materials 2018, 11, x FOR PEER REVIEW 9 of 17
A) B)
C) D)
Figure 4. AFM analysis of bare (A), MUDA-coated (B) and antibody-immobilized (C,D) sensor
surfaces.
Salmonella detection was investigated in the concentration range of 1–5.41 × 107 cfu mL1, which
provided a limit of detection (LOD) of 2.7 × 101 cfu mL1 for both commercial and real samples. The
average signal ratio in the entire concentration range between commercial and real sample analyses
was determined as 1.1. The overall results of Salmonella detection were subjected to the logarithmic
regression analysis that resulted in the correlation coefficients of 0.9671 and 0.9505 for commercial
and real samples, respectively (Figure 5).
Figure 5. Overall results of Salmonella detection in a concentration range of 27—5.41 × 107 using a
standard sandwich assay (n = 6).
y = 37.238ln(x) - 83.938
R² = 0.9505
y = 39.769ln(x) - 67.166
R² = 0.9671
0
100
200
300
400
500
600
1 100 10000 1000000 100000000
Sensor Signal (nA)
Bacteria concentration (cfu mL-1)
Real samples Commercial samples
Figure 5.
Overall results of Salmonella detection in a concentration range of 27–5.41
×
10
7
using
a standard sandwich assay (n = 6).
Advertisement
Materials 2018,11, 1541 10 of 17
3.1.2. Nanoparticle Enhanced Sandwich Assay for the Analysis of Commercial and Real Samples
The use of nanomaterials significantly enhanced the sensor signal and allows detecting trace
amounts of pathogens that has critical role in diagnostic [
11
]. To obtain a more sensitive diagnostic assay
for Salmonella detection we, therefore, used the AuNP-modified sandwich assay. The sensor signal
obtained with AuNP conjugated detector antibody is proportional to the amount of bacteria captured
on the surface by the primary antibody. The commercial and real Salmonella samples were investigated
in a concentration range of 1–5.41
×
10
7
cfu mL
1
(Figure 6A), which resulted in a 1 cfu mL
1
LOD
(Figure 6A,B). The logarithmic regression analysis of all results revealed a good reproducibility for
the assays with correlation coefficients of 0.9931 and 0.9902 for commercial and real sample analysis,
respectively (Figure 6C). The signal ratio between the two assays was calculated based on the detection
limit responses of two assays and it was found to be 1.098. In the entire investigation range, the average
signal ratio of commercial sample analysis to real sample analysis was found to be 1.03. Therefore,
for the first time in this study, we demonstrated that the sensor can reliably measure Salmonella samples
from different sources with a very high accuracy. Additionally, 50 times higher sensitivity was obtained
in this work when compared to our earlier work [
18
] and this is most likely due to the new chip design.
Materials 2018, 11, x FOR PEER REVIEW 10 of 17
3.1.2. Nanoparticle Enhanced Sandwich Assay for the Analysis of Commercial and Real Samples
The use of nanomaterials significantly enhanced the sensor signal and allows detecting trace
amounts of pathogens that has critical role in diagnostic [11]. To obtain a more sensitive diagnostic
assay for Salmonella detection we, therefore, used the AuNP-modified sandwich assay. The sensor
signal obtained with AuNP conjugated detector antibody is proportional to the amount of bacteria
captured on the surface by the primary antibody. The commercial and real Salmonella samples were
investigated in a concentration range of 1–5.41 × 107 cfu mL1 (Figure 6A), which resulted in a 1 cfu
mL1 LOD (Figure 6A,B). The logarithmic regression analysis of all results revealed a good
reproducibility for the assays with correlation coefficients of 0.9931 and 0.9902 for commercial and
real sample analysis, respectively (Figure 6C). The signal ratio between the two assays was calculated
based on the detection limit responses of two assays and it was found to be 1.098. In the entire
investigation range, the average signal ratio of commercial sample analysis to real sample analysis
was found to be 1.03. Therefore, for the first time in this study, we demonstrated that the sensor can
reliably measure Salmonella samples from different sources with a very high accuracy. Additionally,
50 times higher sensitivity was obtained in this work when compared to our earlier work [18] and
this is most likely due to the new chip design.
(A)
(B)
-4000
-3500
-3000
-2500
-2000
-1500
-1000
-500
0
500
1000
0 100 200 300 400 500 600
Sensor Signal (nA)
Time (s)
1 cfu mL
-1
5.41×10
7
cfu mL
-1
Increased S. typhimurium
concentration- CS
-4000
-3500
-3000
-2500
-2000
-1500
-1000
-500
0
500
1000
0 100 200 300 400 500 600
Sensor Signal (nA)
Time (s)
1 cfu mL
-1
5.41×10
7
cfu mL
-1
Increased S. typhimurium
concentration- RS
Figure 6. Cont.
Materials 2018,11, 1541 11 of 17
Materials 2018, 11, x FOR PEER REVIEW 11 of 17
(C)
Figure 6. Real-time sensorgrams of commercial (A) and real S. typhimurium (B) detection in a
concentration range of 1–5.41 × 107 cfu mL1. Overall results of the AuNP-enhanced sandwich assays
for the determination of commercial and real samples (n = 6) (C). CS: commercial sample, RS: real
sample.
Liebana et al. investigated Salmonella detection in milk using an electrochemical magneto-
immunosensor where the bacteria were captured and preconcentrated from milk samples by utilizing
magnetic beads via an immunological interaction [24]. A limit of detection of 7.5 × 103 cfu mL1 in
milk diluted 1/10 in lysogeny broth was achieved in 50 min without any pretreatment. Another
magneto-immunosensor for Salmonella quantification was reported using nano- and micro-sized
magnetic particles that allowed measuring S. enterica down to 5 × 104 and 1 × 104 cfu mL1, respectively
[15]. A disposable immunosensor, combining a permanent magnet under the screen-printed carbon
electrode and AuNPs as signal amplification agents, offers an alternative platform for sensitive
detection of Salmonella enterica subsp. enterica serovar Typhimurium LT2 (S) [14]. This sensor was
able to measure the target bacteria in a linear concentration range from 103 to 106 cfu mL1 with a
detection limit of 143 cfu mL1. The AuNP enhanced biosensor technique combined with magnetic
field application provided more sensitive detection platform than the conventional commercial
method carried out for comparison purposes. The total sensor assay time using the disposable
immunosensor was 1:30 h per sample [14]. Electrochemical sensing of Salmonella typhimurium in milk
samples was investigated using iron oxide/gold core/shell nanomagnetic probes and CdS biolabels
[21]. The screen-printed carbon electrodes were used as the sensor substrate and the measurements
were carried out by square-wave anodic stripping voltammetry through the use of CdS nanocrystals.
The bacterium was measured between 1 × 101 and 1 × 106 cfu mL1, and a LOD of 13 cfu mL1 was
recorded. The determination of Salmonella in milk samples using the biosensor required less than 1 h
[21]. On the other hand, the AuNP modified sandwich assay in our work could detect S. typhimurium
in a concentration range of 15.41 × 107 with LOD of 1 cfu mL1, which demonstrates much higher
sensitivity than all of the reported works. Additionally, the preparation of our antibody sensor
required 30 min and the detection of a sample was achieved in only 12 min. Furthermore, the same
sensor surface could be used multiple times in this work, avoiding the preparation of the antibody-
immobilized surface all the time. The reliability and accuracy of the sensor are also very high, which
could be demonstrated by studying with different sample sources.
y = 192.02ln(x) + 339.86
R² = 0.9902
y = 196.4ln(x) + 364.84
R² = 0.9931
0
500
1000
1500
2000
2500
3000
3500
4000
4500
1 100 10000 1000000 100000000
Sensor Signal (nA)
Bacteria Concentration (cfu mL-1)
S. typhimurium samples from human stool
Commercial S. typhimurium samples
Figure 6.
Real-time sensorgrams of commercial (
A
) and real S. typhimurium (
B
) detection in
a concentration range of 1–5.41
×
10
7
cfu mL
1
. Overall results of the AuNP-enhanced sandwich
assays for the determination of commercial and real samples (n = 6) (
C
). CS: commercial sample, RS:
real sample.
Liebana et al. investigated Salmonella detection in milk using an electrochemical magneto-
immunosensor where the bacteria were captured and preconcentrated from milk samples by utilizing
magnetic beads via an immunological interaction [
24
]. A limit of detection of 7.5
×
10
3
cfu mL
1
in milk
diluted 1/10 in lysogeny broth was achieved in 50 min without any pretreatment. Another magneto-
immunosensor for Salmonella quantification was reported using nano- and micro-sized magnetic particles
that allowed measuring S. enterica down to 5
×
10
4
and 1
×
10
4
cfu mL
1
, respectively [
15
]. A disposable
immunosensor, combining a permanent magnet under the screen-printed carbon electrode and AuNPs as
signal amplification agents, offers an alternative platform for sensitive detection of Salmonella enterica subsp.
enterica serovar Typhimurium LT2 (S) [
14
]. This sensor was able to measure the target bacteria in a linear
concentration range from 10
3
to 10
6
cfu mL
1
with a detection limit of 143 cfu mL
1
. The AuNP enhanced
biosensor technique combined with magnetic field application provided more sensitive detection platform
than the conventional commercial method carried out for comparison purposes. The total sensor assay
time using the disposable immunosensor was 1:30 h per sample [
14
]. Electrochemical sensing of Salmonella
typhimurium in milk samples was investigated using iron oxide/gold core/shell nanomagnetic probes
and CdS biolabels [
21
]. The screen-printed carbon electrodes were used as the sensor substrate and
the measurements were carried out by square-wave anodic stripping voltammetry through the use of
CdS nanocrystals. The bacterium was measured between 1
×
10
1
and 1
×
10
6
cfu mL
1
, and a LOD of
13 cfu mL
1
was recorded. The determination of Salmonella in milk samples using the biosensor required
less than 1 h [
21
]. On the other hand, the AuNP modified sandwich assay in our work could detect
S. typhimurium in a concentration range of 1–5.41
×
10
7
with LOD of 1 cfu mL
1
, which demonstrates
much higher sensitivity than all of the reported works. Additionally, the preparation of our antibody
sensor required 30 min and the detection of a sample was achieved in only 12 min. Furthermore,
the same sensor surface could be used multiple times in this work, avoiding the preparation of the
antibody-immobilized surface all the time. The reliability and accuracy of the sensor are also very high,
which could be demonstrated by studying with different sample sources.
3.1.3. Cross-Reactivity Studies for Salmonella
To determine the specificity of the developed assays for the detection of Salmonella, the interaction
of non-specific bacteria with the Salmonella-specific antibody-immobilized surfaces was studied.
Related document tools
Review originality and document trust
Plag helps identify passages that may need closer source checking. Identific adds another layer when trust and verification matter. They are useful when quality and trust matter.
Materials 2018,11, 1541 12 of 17
S. typhimurium was used as the target bacterium, whereas S. aureus and E. coli were investigated
as the non-specific bacteria. Being a Salmonella serotype the binding of S. enteritidis on the antibody
immobilized surface was also tested. A fixed concentration (10
7
cfu mL
1
) of each bacterium was used
for cross-reactivity tests. The non-specific binding responses of S. aureus and E. coli were calculated as
2.66% and 2.01%, respectively, suggesting the high specificity of the bioassay for Salmonella (Figure 7).
The binding of S. enteritidis on the Salmonella antibody immobilized surface was determined as 14.35%.
Nevertheless, the specificity of antibody sensors for bacteria is often a problem, which motivated us to
develop a DNA biosensor in this work as an alternative method.
Materials 2018, 11, x FOR PEER REVIEW 12 of 17
3.1.3. Cross-Reactivity Studies for Salmonella
To determine the specificity of the developed assays for the detection of Salmonella, the
interaction of non-specific bacteria with the Salmonella-specific antibody-immobilized surfaces was
studied. S. typhimurium was used as the target bacterium, whereas S. aureus and E. coli were
investigated as the non-specific bacteria. Being a Salmonella serotype the binding of S. enteritidis on
the antibody immobilized surface was also tested. A fixed concentration (107 cfu mL1) of each
bacterium was used for cross-reactivity tests. The non-specific binding responses of S. aureus and E.
coli were calculated as 2.66% and 2.01%, respectively, suggesting the high specificity of the bioassay
for Salmonella (Figure 7). The binding of S. enteritidis on the Salmonella antibody immobilized surface
was determined as 14.35%. Nevertheless, the specificity of antibody sensors for bacteria is often a
problem, which motivated us to develop a DNA biosensor in this work as an alternative method.
Figure 7. Cross-reactivity tests for S. typhimurium specific antibody sensor assay (n = 3).
3.2. DNA Sensor for Salmonella Detection
For the first time, we investigated the potential of our custom-designed MiSens device for the
development of a DNA biosensor for pathogenic bacteria detection in this study. The detection of
target Salmonella DNA was studied in a concentration range of 0.002–200 µM using the DNA surface
probe that was initially captured by a neutravidin-immobilized layer on the sensor chip (Figure 8A).
The sensor could differentiate the lowest concentration of DNA (0.002) and negative control (Figure
8B) and showed a good reproducibility in a wide investigation range (Figure 8C). The LOD was
verified based on the linear portion of the saturation graph by calculating three times the standard
deviation of the blank response (0.4 × 3 = 1.2 nA) and extrapolating the sensor signal in the linear
calibration curve to convert the value to concentration [34]. The limit of detection was determined to
be 0.94 nM with a linear range from 2 nM to 20 nM, as shown in Figure 8D.
(A)
0
400
800
1200
1600
2000
2400
2800
3200
S. typhimurium S. aureus E. coli S. enteritidis
Sensor Signal (nA)
Binding of different bacteria on Salmonella
antibody immobilized sensor surfaces
-250
-200
-150
-100
-50
0
50
200 250 300 350 400 450 500 550 600
Sensor Signal (nA)
Time (s)
0.002 µM target DNA
200 µM target DNA
Figure 7. Cross-reactivity tests for S. typhimurium specific antibody sensor assay (n = 3).
3.2. DNA Sensor for Salmonella Detection
For the first time, we investigated the potential of our custom-designed MiSens device for the
development of a DNA biosensor for pathogenic bacteria detection in this study. The detection of
target Salmonella DNA was studied in a concentration range of 0.002–200
µ
M using the DNA surface
probe that was initially captured by a neutravidin-immobilized layer on the sensor chip (Figure 8A).
The sensor could differentiate the lowest concentration of DNA (0.002) and negative control (Figure 8B)
and showed a good reproducibility in a wide investigation range (Figure 8C). The LOD was verified
based on the linear portion of the saturation graph by calculating three times the standard deviation of
the blank response (0.4
×
3 = 1.2 nA) and extrapolating the sensor signal in the linear calibration curve
to convert the value to concentration [
34
]. The limit of detection was determined to be 0.94 nM with
a linear range from 2 to 20 nM, as shown in Figure 8D.
Materials 2018, 11, x FOR PEER REVIEW 12 of 17
3.1.3. Cross-Reactivity Studies for Salmonella
To determine the specificity of the developed assays for the detection of Salmonella, the
interaction of non-specific bacteria with the Salmonella-specific antibody-immobilized surfaces was
studied. S. typhimurium was used as the target bacterium, whereas S. aureus and E. coli were
investigated as the non-specific bacteria. Being a Salmonella serotype the binding of S. enteritidis on
the antibody immobilized surface was also tested. A fixed concentration (107 cfu mL1) of each
bacterium was used for cross-reactivity tests. The non-specific binding responses of S. aureus and E.
coli were calculated as 2.66% and 2.01%, respectively, suggesting the high specificity of the bioassay
for Salmonella (Figure 7). The binding of S. enteritidis on the Salmonella antibody immobilized surface
was determined as 14.35%. Nevertheless, the specificity of antibody sensors for bacteria is often a
problem, which motivated us to develop a DNA biosensor in this work as an alternative method.
Figure 7. Cross-reactivity tests for S. typhimurium specific antibody sensor assay (n = 3).
3.2. DNA Sensor for Salmonella Detection
For the first time, we investigated the potential of our custom-designed MiSens device for the
development of a DNA biosensor for pathogenic bacteria detection in this study. The detection of
target Salmonella DNA was studied in a concentration range of 0.002–200 µM using the DNA surface
probe that was initially captured by a neutravidin-immobilized layer on the sensor chip (Figure 8A).
The sensor could differentiate the lowest concentration of DNA (0.002) and negative control (Figure
8B) and showed a good reproducibility in a wide investigation range (Figure 8C). The LOD was
verified based on the linear portion of the saturation graph by calculating three times the standard
deviation of the blank response (0.4 × 3 = 1.2 nA) and extrapolating the sensor signal in the linear
calibration curve to convert the value to concentration [34]. The limit of detection was determined to
be 0.94 nM with a linear range from 2 nM to 20 nM, as shown in Figure 8D.
(A)
0
400
800
1200
1600
2000
2400
2800
3200
S. typhimurium S. aureus E. coli S. enteritidis
Sensor Signal (nA)
Binding of different bacteria on Salmonella
antibody immobilized sensor surfaces
-250
-200
-150
-100
-50
0
50
200 250 300 350 400 450 500 550 600
Sensor Signal (nA)
Time (s)
0.002 µM target DNA
200 µM target DNA
Figure 8. Cont.
Materials 2018,11, 1541 13 of 17
Materials 2018, 11, x FOR PEER REVIEW 13 of 17
(B)
0.002 0.003 0.005 0.01 0.015 0.02 0.2 2 20 200
0
50
100
150
200
250
Sensor Signal (nA)
Salmonella DNA Concentration (μM)
DNA detection assays
(C)
0 2 4 6 8 101214161820
0
10
20
30
40
50
60
Sensor Signal (nA)
DNA Concentration (nM)
y = 2696.8x - 1.3445
R² = 0.9795
(D)
Figure 8. Concentration-dependent real-time sensorgram of the DNA assay (A). Real-time
sensorgram showing signal difference between the lowest DNA concentration and negative control
(B). The detection of Salmonella DNA in a concentration range of 0.002–200 µM along with standard
deviations on the data (n = 6) (C). The linear calibration curve of DNA assays with a correlation
coefficient of 0.9795 (D).
Every step of the DNA assay was characterized by employing AFM. The 2D height images and
the 3D surface topography images were analyzed in the scanning area of 3 × 3 µm (Figure 9). A clear
difference in height was observed between MUDA-coated (12.3 nm) and the NA immobilized (21
nm) sensor surfaces, indicating the effective NA immobilization for the DNA surface probe capture.
When the surface probe was captured by the NA layer, a further increase in height (26 nm) was
-2.1
-1.6
-1.1
-0.6
-0.1
0.4
200 250 300 350 400 450 500 550 600
Sensor Signal (nA)
Times (s)
Negative control
0.002 µM DNA
Figure 8.
Concentration-dependent real-time sensorgram of the DNA assay (
A
). Real-time sensorgram
showing signal difference between the lowest DNA concentration and negative control (
B
).
The detection of Salmonella DNA in a concentration range of 0.002–200
µ
M along with standard
deviations on the data (n =6) (
C
). The linear calibration curve of DNA assays with a correlation
coefficient of 0.9795 (D).
Every step of the DNA assay was characterized by employing AFM. The 2D height images
and the 3D surface topography images were analyzed in the scanning area of 3
×
3
µ
m (Figure 9).
Advertisement
Materials 2018,11, 1541 14 of 17
A clear difference in height was observed between MUDA-coated (12.3 nm) and the NA immobilized
(21 nm) sensor surfaces, indicating the effective NA immobilization for the DNA surface probe capture.
When the surface probe was captured by the NA layer, a further increase in height (26 nm) was
observed and the 3D surface topology image also displayed a rougher surface than that of the NA
immobilization. Upon binding of the target DNA on the surface, the height reached 31 nm and the
surface roughness significantly increased.
Materials 2018, 11, x FOR PEER REVIEW 14 of 17
observed and the 3D surface topology image also displayed a rougher surface than that of the NA
immobilization. Upon binding of the target DNA on the surface, the height reached 31 nm and the
surface roughness significantly increased.
Figure 9. AFM 2D height images (upper part) and 3D topography images (lower part) of neutravidin
immobilization (A,B), DNA surface probe capture (C,D), and target DNA binding at 2 µM
concentration (E,F).
DNA biosensors constitute strong alternatives to the antibody sensors for diagnosis of
pathogenic bacteria by quantifying the genetic material of a bacterium of interest. A disposable
electrochemical sensor developed for Salmonella detection based on a DNA hybridization reaction
using the thiolated DNA capture probes could quantify Salmonella DNA from 5 µM to 20 µM. The
hybridization event was detected using the ruthenium complex as electrochemical indicator. The
sensor demonstrated high selectivity towards Salmonella when compared to E. coli [35]. The DNA
sensor constructed in the current study detected Salmonella DNA down to 0.002 µM, which displays
enormously higher sensitivity than the disposable electrochemical sensor. However, it is worth
mentioning that we have not tested the sensor against other non-specific bacteria species in this work
as the main focus of the current study was to investigate the potential of our custom-designed sensor
for the construction of DNA assays for pathogenic bacteria detection. Instead, the specificity of the
DNA assays was checked using the control surface probe and no signal was observed upon the target
injection to the sensor.
Zhang et al. used the biotinylated single-stranded DNA capture probe, immobilized onto a
streptavidin-coated dextran sensor surface, to detect a specific sequence in the invA gene of
Salmonella by employing a label-free SPR biosensor (i.e., Biacore X, BIAcore AB). The target DNA
could be measured in the range of 51000 nM with a detection limit of 0.5 nM. This sensor was used
for the detection of single-stranded invA amplicons from three serovars of Salmonella, including
Typhimurium, Enterica, and Derby, and the responses to PCR products were related to different S.
typhimurium concentrations in the range of 10
2
10
10
cfu mL
1
. The hybridization reaction using the
SPR sensor required 15 min, whereas the electrochemical sensor in this work allowed the DNA
hybridization only in 5 min. The surface regeneration could be achieved in both studies for multiple
usage of the same chip using glycine-HCI (10 mM, pH: 3.0) [36] and HCI (100 mM, pH: 3),
respectively. The use of gold nanoparticles in the DNA sensor development offers superior
sensitivities that play a crucial role while working with interfering media, such as milk and blood.
The DNA sensors employing AuNP functionalized probes can quantify trace levels of Salmonella (for
Figure 9.
AFM 2D height images (upper part) and 3D topography images (lower part) of
neutravidin immobilization (
A
,
B
), DNA surface probe capture (
C
,
D
), and target DNA binding at
2µM concentration (E,F).
DNA biosensors constitute strong alternatives to the antibody sensors for diagnosis of pathogenic
bacteria by quantifying the genetic material of a bacterium of interest. A disposable electrochemical
sensor developed for Salmonella detection based on a DNA hybridization reaction using the thiolated
DNA capture probes could quantify Salmonella DNA from 5
µ
M to 20
µ
M. The hybridization event
was detected using the ruthenium complex as electrochemical indicator. The sensor demonstrated
high selectivity towards Salmonella when compared to E. coli [
35
]. The DNA sensor constructed in
the current study detected Salmonella DNA down to 0.002
µ
M, which displays enormously higher
sensitivity than the disposable electrochemical sensor. However, it is worth mentioning that we have
not tested the sensor against other non-specific bacteria species in this work as the main focus of the
current study was to investigate the potential of our custom-designed sensor for the construction of
DNA assays for pathogenic bacteria detection. Instead, the specificity of the DNA assays was checked
using the control surface probe and no signal was observed upon the target injection to the sensor.
Zhang et al. used the biotinylated single-stranded DNA capture probe, immobilized onto
a streptavidin-coated dextran sensor surface, to detect a specific sequence in the invA gene of Salmonella by
employing a label-free SPR biosensor (i.e., Biacore X
, BIAcore AB). The target DNA could be measured
in the range of 5-1000 nM with a detection limit of 0.5 nM. This sensor was used for the detection of
single-stranded invA amplicons from three serovars of Salmonella, including Typhimurium, Enterica,
and Derby, and the responses to PCR products were related to different S. typhimurium concentrations
in the range of 10
2
–10
10
cfu mL
1
. The hybridization reaction using the SPR sensor required 15 min,
whereas the electrochemical sensor in this work allowed the DNA hybridization only in 5 min. The surface
regeneration could be achieved in both studies for multiple usage of the same chip using glycine-HCI
Materials 2018,11, 1541 15 of 17
(10 mM, pH: 3.0) [
36
] and HCI (100 mM, pH: 3), respectively. The use of gold nanoparticles in the DNA
sensor development offers superior sensitivities that play a crucial role while working with interfering
media, such as milk and blood. The DNA sensors employing AuNP functionalized probes can quantify
trace levels of Salmonella (for e.g., 6 cfu mL
1
) in such complex sample media [
20
]. The AuNP-enhanced
DNA biosensor in this work shows great potential for Salmonella detection and our future direction will
be the further characterization of the developed sensor to be used in complex samples that may have
a significant impact in clinical diagnosis, environmental monitoring, and food safety.
4. Conclusions
In this work, antibody and DNA-based biosensors were developed using a fully-automated
custom-designed microfluidic device. Two different antibody biosensors were constructed using
standard and nanomaterial-enhanced assay approaches. The nanomaterial-enhanced immunosensor
(LOD: 1 cfu mL
1
) increased the limit of detection around 27-fold when compared to the standard
sandwich assay (LOD: 27 cfu mL
1
) for Salmonella determination from human stool samples. On the
other hand, the potential of the microfluidic sensor for the DNA analysis of pathogenic bacteria was
successfully demonstrated for the first time. The developed DNA biosensor could detect the Salmonella
DNA in a wide concentration range of 0.002–200
µ
M with a LOD of 0.94 nM. Both antibody and DNA
biosensors have shown high sensitivity and specificity for Salmonella samples. The sensor surface could
be regenerated multiple times in all assay types, which significantly reduces the cost of the system,
as well as the required analysis time by skipping the receptor immobilization step. The developed
sensors can be used for the diagnosis of infectious diseases caused by pathogenic bacteria.
Author Contributions:
S.S. performed the experiments. S.S. and Z.A. analyzed the data. A.E. and Y.G. contributed
to the sensor chip fabrication. B.L. and S.K. provided the microbiology facilities. Z.A. supervised the research,
directed the project, and prepared the manuscript.
Funding:
The authors would like to thank TUBITAK-B˙
ILGEM for supporting this work. Z.A. acknowledges
additionally the support of the European Union (10041380) and the Marie Curie Actions.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Liu, X.; Hu, Y.X.; Zheng, S.; Liu, Y.; He, Z.; Luo, F. Surface plasmon resonance immunosensor for fast, highly
sensitive, and in situ detection of the magnetic nanoparticles-enriched Salmonella enteritidis.Sens. Actuators
B Chem. 2016,230, 191–198. [CrossRef]
2.
Centers for Disease Control and Prevention. National Enteric Disease Surveillance: Salmonella Annual
Report; National Center for Emerging and Zoonotic Infectious Diseases, Division of Foodborne W,
and Environmental Diseases: Atlanta, GA, USA, 2012.
3. European Food Safety Authority (EFSA). EFSA Explains Zoonotic Diseases; EFSA: Parma, Italy, 2014.
4.
Ozdemir, K.; Acar, S. Plasmid profile and pulsed-field gel electrophoresis analysis of Salmonella enterica
isolates from humans in Turkey. PLoS ONE 2014,9, e95976. [CrossRef] [PubMed]
5.
Cinti, S.; Volpe, G.; Piermarini, S.; Delibato, E.; Palleschi, G. Electrochemical biosensors for rapid detection of
foodborne Salmonella: A Critical Overview. Sensors 2017,17, 1910. [CrossRef] [PubMed]
6.
Feder, I.; Nietfeld, J.C.; Galland, J.; Yeary, T.; Sargeant, J.M.; Oberst, R.; Tamplin, M.L. Comparison
of cultivation and PCR-hybridization for detection of Salmonella in porcine fecal and water samples.
J. Clin. Microbiol. 2001,39, 2477–2484. [CrossRef] [PubMed]
7.
Wang, W.B.; Liu, L.Q.; Song, S.S.; Tang, L.J.; Kuang, H.; Xu, C.L. A highly sensitive ELISA and
immunochromatographic strip for the detection of Salmonella typhimurium in milk samples. Sensors
2015
,15,
5281–5292. [CrossRef] [PubMed]
8.
Fitzgerald, C.; Sherwood, R.; Gheesling, L.L.; Brenner, F.W.; Fields, P.I. Molecular analysis of the rfb O
antigen gene cluster of Salmonella enterica serogroup O:6,14 and development of a serogroup-specific PCR
assay. Appl. Environ. Microbiol. 2003,69, 6099–6105. [CrossRef] [PubMed]
Advertisement
Materials 2018,11, 1541 16 of 17
9.
Zhang, Z.; Xiao, L.; Lou, Y.; Jin, M.; Liao, C.; Malakar, P.K.; Pan, Y.; Zhao, Y. Development of a multiplex
real-time PCR method for simultaneous detection of Vibrio parahaemolyticus,Listeria monocytogenes and
Salmonella spp. in raw shrimp. Food. Control 2015,51, 31–36. [CrossRef]
10.
Maurischat, S.; Baumann, B.; Martin, A.; Malorny, B. Rapid detection and specific differentiation of Salmonella
enterica subsp enterica Enteritidis, Typhimurium and its monophasic variant 4,[5], 12:i—By real-time multiplex
PCR. Int. J. Food Microbiol. 2015,193, 8–14. [CrossRef] [PubMed]
11.
Altintas, Z. Biosensors and Nanotechnology: Applications in Health Care Diagnostics; Wiley: Hoboken, NJ, USA,
2017; ISBN 978-1-119-06501-2.
12.
Sheikhzadeh, E.; Chamsaz, M.; Turner, A.P.F.; Jager, E.W.H.; Beni, V. Label-free impedimetric biosensor
for Salmonella Typhimurium detection based on poly pyrrole-co-3-carboxyl-pyrrole copolymer supported
aptamer. Biosens. Bioelectron. 2016,80, 194–200. [CrossRef] [PubMed]
13.
Malhotra, R.; Patel, V.; Chikkaveeraiah, B.V.; Munge, B.S.; Cheong, S.C.; Zain, R.B.; Abraham, M.T.;
Dey, D.K.; Gutkind, J.S.; Rusling, J.F. Ultrasensitive detection of cancer biomarkers in the clinic by use
of a nanostructured microfluidic array. Anal. Chem. 2012,84, 6249–6255. [CrossRef] [PubMed]
14.
Afonso, A.S.; Uliana, C.V.; Martucci, D.H.; Faria, R.C. Simple and rapid fabrication of disposable
carbon-based electrochemical cells using an electronic craft cutter for sensor and biosensor applications.
Talanta 2016,146, 381–387. [CrossRef] [PubMed]
15.
Sutarlie, L.; Ow, S.Y.; Su, X.D. Nanomaterials-based biosensors for detection of microorganisms and microbial
toxins. Biotechnol. J. 2017,12, 1–25. [CrossRef] [PubMed]
16.
Masdor, N.A.; Altintas, Z.; Tothill, I.E. Surface plasmon resonance immunosensor for the detection of
Campylobacter jejuni.Chemosensors 2017,5, 16. [CrossRef]
17.
Masdor, N.A.; Altintas, Z.; Tothill, I.E. Sensitive detection of Campylobacter jejuni using nanoparticles
enhanced QCM sensor. Biosens. Bioelectron. 2016,78, 328–336. [CrossRef] [PubMed]
18.
Altintas, Z.; Akgun, M.; Kokturk, G.; Uludag, Y. A fully automated microfluidic-based electrochemical
sensor for real-time bacteria detection. Biosens. Bioelectron. 2018,100, 541–548. [CrossRef] [PubMed]
19.
Melo, A.M.A.; Alexandre, D.L.; Furtado, R.F.; Borges, M.F.; Figueiredo, E.A.T.; Biswas, A.; Cheng, H.N.;
Alves, C.R. Electrochemical immunosensors for Salmonella detection in food. Appl. Microbiol. Biotechnol.
2016
,
100, 5301–5312. [CrossRef] [PubMed]
20.
Zhu, D.; Yan, Y.R.; Lei, P.H.; Shen, B.; Cheng, W.; Ju, H.X.; Ding, S.J. A novel electrochemical sensing strategy
for rapid and ultrasensitive detection of Salmonella by rolling circle amplification and DNA-AuNPs probe.
Anal. Chim. Acta 2014,846, 44–50. [CrossRef] [PubMed]
21.
Freitas, M.; Viswanathan, S.; Nouws, H.P.A.; Oliveira, M.; Delerue-Matos, C. Iron oxide/gold core/shell
nanomagnetic probes and CdS biolabels for amplified electrochemical immunosensing of Salmonella
typhimurium.Biosens. Bioelectron. 2014,51, 195–200. [CrossRef] [PubMed]
22.
Brandao, D.; Liebana, S.; Campoy, S.; Cortes, P.; Alegret, S.; Pividori, M.I. Electrochemical magneto-
immunosensing of Salmonella based on nano and micro-sized magnetic particles. In Proceedings of the
8th Ibero-American Congress on Sensors (IBERSENSOR 2012), Carolina, Puerto Rico, 16–19 October 2012;
pp. 1–7.
23.
Hu, C.M.; Dou, W.C.; Zhao, G.J. Enzyme immunosensor based on gold nanoparticles electroposition and
Streptavidin-biotin system for detection of S. pullorum &S. gallinarum.Electrochim. Acta 2014,117, 239–245.
24.
Liebana, S.; Lermo, A.; Campoy, S.; Cortes, M.P.; Alegret, S.; Pividori, M.I. Rapid detection of Salmonella
in milk by electrochemical magneto-immunosensing. Biosens. Bioelectron.
2009
,25, 510–513. [CrossRef]
[PubMed]
25.
Amini, K.; Ebralidze, I.I.; Chan, N.W.C.; Kraatz, H.-B. Characterization of TLR4/MD-2-modified Au sensor
surfaces towards the detection of molecular signatures of bacteria. Anal. Methods 2016,8, 7623–7631.
26.
Grimont, P.A.D.; Weill, F. Antigenic Formulae of the Salmonella Serovars, 9th ed.; WHO Collaborating Centre for
Reference and Research on Salmonella; Pasteur Institute: Paris, France, 2007.
27.
Uludag, Y.; Esen, E.; Kokturk, G.; Ozer, H.; Muhammad, T.; Olcer, Z.; Basegmez, H.I.O.; Simsek, S.; Barut, S.;
Gok, M.Y.; et al. Lab-on-a-chip based biosensor for the real-time detection of aflatoxin. Talanta
2016
,160,
381–388. [CrossRef] [PubMed]
28.
Ciftci, G.Y.; Senkuytu, E.; Incir, S.E.; Yuksel, F.; Olcer, Z.; Yildirim, T.; Kilic, A.; Uludag, Y. First paraben
substituted cyclotetraphosphazene compounds and DNA interaction analysis with a new automated
biosensor. Biosens. Bioelectron. 2016,80, 331–338. [CrossRef] [PubMed]
Materials 2018,11, 1541 17 of 17
29.
Altintas, Z.; Uludag, Y.; Gurbuz, Y.; Tothill, I.E. Surface plasmon resonance based immunosensor for the
detection of the cancer biomarker carcinoembryonic antigen. Talanta
2011
,86, 377–383. [CrossRef] [PubMed]
30.
Altintas, Z.; Uludag, Y.; Gurbuz, Y.; Tothill, I. Development of surface chemistry for surface plasmon
resonance based sensors for the detection of proteins and DNA molecules. Anal. Chim. Acta
2012
,712,
138–144. [CrossRef] [PubMed]
31.
Altintas, Z.; Tothill, I.E. DNA-based biosensor platforms for the detection of TP53 mutation. Sens. Actuators
B Chem. 2012,169, 188–194. [CrossRef]
32.
Pawula, M.; Altintas, Z.; Tothill, I.E. SPR detection of cardiac troponin T for acute myocardial infarction.
Talanta 2016,146, 823–830. [CrossRef] [PubMed]
33.
Kim, H.J.; Park, S.H.; Lee, T.H.; Nahm, B.H.; Chung, Y.H.; Seo, K.H.; Kim, H.Y. Identification of Salmonella
enterica serovar Typhimurium using specific PCR primers obtained by comparative genomics in Salmonella
serovars. J. Food Prot. 2006,69, 1653–1661. [CrossRef] [PubMed]
34.
Altintas, Z. Surface plasmon resonance based sensor for the detection of glycopeptide antibiotics in milk
using rationally designed nanoMIPs. Sci. Rep. 2018,8, 11222. [CrossRef] [PubMed]
35.
Garcia, T.; Revenga-Parraa, M.; Anorga, L.; Arana, S.; Pariente, F.; Lorenzo, E. Disposable DNA biosensor
based on thin-film gold electrodes for selective Salmonella detection. Sens. Actuators B Chem.
2012
,161,
1030–1037. [CrossRef]
36.
Zhang, D.C.; Yan, Y.R.; Li, Q.; Yu, T.X.; Cheng, W.; Wang, L.; Ju, H.X.; Ding, S.J. Label-free and high-sensitive
detection of Salmonella using a surface plasmon resonance DNA-based biosensor. J. Biotechnol.
2012
,160,
123–128. [CrossRef] [PubMed]
©
2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Advertisement