Transcriptome sequencing and comparative transcriptome analysis of the scleroglucan producer Sclerotium rolfsii [original]

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Open Access

RESEARCH ARTICLE

BioMed Central

Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in

any medium, provided the original work is properly cited.

Research article

Transcriptome sequencing and comparative

transcriptome analysis of the scleroglucan

producer

Sclerotium rolfsii

Jochen Schmid*

1,2

, Dirk Müller-Hagen

2,6

, Thomas Bekel

, Laura Funk

, Ulf Stahl

, Volker Sieber

1,4

and Vera Meyer

2,5

Abstract

Background: The plant pathogenic basidiomycete Sclerotium rolfsii produces the industrially exploited

exopolysaccharide scleroglucan, a polymer that consists of (1 T 3)-β-linked glucose with a (1 T 6)-β-glycosyl branch on

every third unit. Although the physicochemical properties of scleroglucan are well understood, almost nothing is

known about the genetics of scleroglucan biosynthesis. Similarly, the biosynthetic pathway of oxalate, the main by-

product during scleroglucan production, has not been elucidated yet. In order to provide a basis for genetic and

metabolic engineering approaches, we studied scleroglucan and oxalate biosynthesis in S. rolfsii using different

transcriptomic approaches.

Results: Two S. rolfsii transcriptomes obtained from scleroglucan-producing and scleroglucan-nonproducing

conditions were pooled and sequenced using the 454 pyrosequencing technique yielding ~350,000 reads. These

could be assembled into 21,937 contigs and 171,833 singletons, for which 6,951 had significant matches in public

protein data bases. Sequence data were used to obtain first insights into the genomics of scleroglucan and oxalate

production and to predict putative proteins involved in the synthesis of both metabolites. Using comparative

transcriptomics, namely Agilent microarray hybridization and suppression subtractive hybridization, we identified ~800

unigenes which are differently expressed under scleroglucan-producing and non-producing conditions. From these,

candidate genes were identified which could represent potential leads for targeted modification of the S. rolfsii

metabolism for increased scleroglucan yields.

Conclusions: The results presented in this paper provide for the first time genomic and transcriptomic data about S.

rolfsii and demonstrate the power and usefulness of combined transcriptome sequencing and comparative microarray

analysis. The data obtained allowed us to predict the biosynthetic pathways of scleroglucan and oxalate synthesis and

to identify important genes putatively involved in determining scleroglucan yields. Moreover, our data establish the

first sequence database for S. rolfsii, which allows research into other biological processes of S. rolfsii, such as host-

pathogen interaction.

Background

The basidiomycete Sclerotium rolfsii is a soilborne plant

pathogenic fungus causing diseases in many agricultural

and horticultural plants [1-3]. However, it is also used in

biotechnology as a microbial platform for the production

of the exopolysaccharide (EPS) scleroglucan. This poly-

saccharide is a water-soluble homopolymer composed of

a (1 T 3)-β-linked glucopyranose backbone with single (1

T 6)-β-linked glucopyranosyl branches on every third

subunit [4] and traded under the commercial names

Tinocare® GL and Actigum®. Scleroglucan shows remark-

able rheological properties rendering the substance as a

multipurpose compound for many industrial applica-

tions, ranging from oil recovery over food industry to

cosmetics and medical applications [5-7]. Surprisingly,

only very little information is available on the biosynthe-

sis of scleroglucan formation by S. rolfsii [4,7,8] whereas

the physicochemical properties of scleroglucan are well

explored [7-11].

* Correspondence: j.schmid@tum.de

1 Chair of Chemistry of Biogenic Resources, Straubing Centre of Science,

echnische Universität München, Schulgasse 16, 94315 Straubing, Germany

Full list of author information is available at the end of the article

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 2 of 16

According to theoretical considerations put forward by

Sutherland [11,12], scleroglucan synthesis follows the

general scheme for polysaccharide production in micro-

bial systems in three major steps: substrate uptake, intra-

cellular formation and extrusion from the cell. Uptake of

glucose into the cell is mediated by glucose trans-

porter(s), followed by phosphorylation of glucose to glu-

cose-6-phosphate via a hexokinase reaction (EC: 2.7.1.1).

After interconversion of glucose-6-phosphate to glucose-

1-phosphate by phospho-glucomutase (EC: 2.7.5.1), a

UTP-glucose-1-phosphate uridylyltransferase (EC:

2.7.7.9) activates glucose-1-phosphate to UDP-glucose. A

(1 T 3)-β-glucan synthase (EC: 2.4.1.34) polymerizes the

backbone chain using UDP-glucose as monomeric pre-

cursor. The last step yielding to the (1 T 6)-β branching at

every third glucose molecule is supposed to be catalyzed

by trans-D-glucosidases [12]. 14C incorporation experi-

ments evidenced that the (1 T 3)-β chain of scleroglucan

is elongated toward the non-reducing terminus and that

(1 T 6)-β-linked glycosyl side residues are incorporated

simultaneously as the (1 T 3)-β-glucan backbone is elon-

gated [13,14].

Several empirical studies have been performed to iden-

tify optimum medium composition for EPS production

by S. rolfsii [15-21]. Interestingly, medium conditions

favoring scleroglucan production have been reported to

increase the amount of secreted oxalate as well [22,23].

The biosynthesis of scleroglucan has thus been proposed

to be closely linked to the synthesis of oxalate; a reducing

agent and strong acid involved in the infection process of

S. rolfsii [24,25]. During industrial scleroglucan produc-

tion, however, the formation of the by-product oxalate is

undesirable as it lowers the productivity of the process

and negatively interferes with downstream processing of

scleroglucan [7,18]. For some of its applications, e.g. in

cosmetics and food industry, a cost intensive removal of

oxalate is necessary.

Microbial oxalate is assumed to be synthesized in the

glyoxylate cycle (GLOX), which is the anaplerotic path-

way during growth on C2-carbon sources. Glyoxylate and

succinate are the products of the isocitrate lyase reaction,

and glyoxylate is either further oxidized to oxalate via the

glyoxylate oxidase or used as precursor for malate synthe-

sis. Although for basidiomycetes the cellular role of

oxalate is still not clarified, it has been reported to be

important for free radical formation, iron and calcium

chelation as well as pectin and cellulose hydrolysis [26-

29]. In phytopathogenic fungi, oxalate has been described

as a very important factor contributing to fungal viru-

lence. One role of oxalate is to lower the pH of the ambi-

ent environment, resulting in increased fungal

polygalacturonase activity necessary for plant cell wall

degradation [23,27,28]. Other roles include sequestration

of calcium from cell walls, hydrolysis of plant pectin, sup-

pression of plant defense responses and induction of the

programmed cell death in plants [30-32].

Understanding the genetic basis for scleroglucan and

oxalate biosynthesis is a prerequisite for the design of

genetically engineered strains with improved scleroglu-

can yields. However, the genome of S. rolfsii has not been

sequenced yet and DNA sequences have been published

for only a few S. rolfsii genes. To overcome this obstacle,

we applied the massively parallel short-read 454 pyrose-

quencing technology to sequence the transcriptome of S.

rolfsii. From the assembled and annotated unigene

sequences, we predicted genes particularly involved in

EPS and oxalate metabolism. Additionally, we performed

a global suppression subtractive hybridization (SSH)

approach to isolate and identify genes up-regulated under

scleroglucan-producing conditions. We used the

sequence data obtained from the 454 sequencing and

from the SSH approaches to finally develop Agilent

microarray chips to perform comparative gene expres-

sion profiling for S. rolfsii grown in scleroglucan-produc-

ing and scleroglucan-nonproducing conditions and to

identify genes differentially expressed under both condi-

tions.

Results and Discussion

Designing scleroglucan-producing and scleroglucan-

nonproducing media

A basic requirement for this work was the development

of two cultivation media for S. rolfsii, which should pro-

vide sufficient growth and a comparable biomass produc-

tion, however with significant differences in EPS

production. In order to identify such media composi-

tions, we used the synthetic EPS medium proposed by

Farina et al [15], and altered both the nature and concen-

tration of the carbon (glucose, fructose, sucrose; 25-220

mM) and nitrogen (NH4Cl, NaNO3, (NH4)2SO4; 17-280

mM) sources. S. rolfsii was cultivated in these media and

the formation of scleroglucan and oxalate was monitored

over time (data not shown). As shown in Figure 1A, scle-

roglucan production was high in medium containing 220

mM Glc and 35 mM NaNO3 (designated EPSmax13) and

lower in medium containing 220 mM Fru and 35 mM

NH4Cl (designated EPSmin17). At 30 h of cultivation, S.

rolfsii produced scleroglucan in EPSmax13 medium but

to a slightly lesser extent in EPSmin17 medium. Sufficient

amounts and significant differences in scleroglucan pro-

duction are detectable after 37 h of cultivation, whereas

biomass accumulation was comparable. We thus decided

to choose the 37 h time point for the comparative analy-

sis. Interestingly, cultures of S. rolfsii grown in EPSmax13

and EPSmin17 media displayed similar pH and oxalate

profiles, suggesting that oxalate production is rather cou-

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 3 of 16

pled to growth and biomass formation than to scleroglu-

can synthesis (Figure 1B).

454 pyrosequencing and data analysis

Total RNA extracted from 37 h old cultures of S. rolfsii

grown in EPSmin17 and EPSmax13 medium were pooled

in a 1:1 ratio to guarantee equal predominance of both

RNA populations and subsequently reversed transcribed

into cDNA. The mixed cDNA sample was sequenced by

454 Life Sciences™. The rationale behind combining both

mRNA populations was to increase transcriptome cover-

age. Triplicate sequencing runs resulted in 356,098 single

reads composed of 3.68 million bases (Table 1). Using the

454 Life Sciences™ Newbler software, these reads were

trimmed and assembled into 21,937 contiguous

sequences and 171,833 singletons (Table 1, Additional file

1) and are later on referred to as unigenes. A complete list

of all unigenes has been deposited at the NCBI Sequence

Read archive (SRA, http://www.ncbi.nlm.nih.gov/sra)

under accession number SRA012273.1.

All unigenes obtained were functionally analyzed via

the Sequence Analysis and Management System (SAMS).

This software platform was originally developed to sup-

port the computational analysis of shotgun genome

sequencing projects [33]. However, in addition to quality

assessments, SAMS is well suited for the annotation of

short sequence fragments and as an annotation pipeline

also includes standard bioinformatics tools such as

BLAST [34]. We thus used SAMS to analyze and func-

tionally annotate the S. rolfsii unigenes. The analysis

pipeline was set up with different BLAST tools and data-

bases: BLAST2× versus the NCBI NR protein database

(E-value cut-off of 10-5), BLAST2× versus the KOG pro-

tein database (E-value cut-off of 10-5), BLAST2n versus

the NCBI NT nucleotide database (E-value cut-off of 10-

5) and TBLASTx2 versus the NCBI NR/NT database, E-

value cut-off of 10-5). The EuKaryotic Orthologous

Groups database (KOG) is essentially the eukaryotic ver-

sion of the Clusters of Orthologous Groups database

(COG; http://www.ncbi.nlm.nih.gov/COG/).

A total of 6,951 sequences were assigned to one or

more KOG functional categories. The remaining

sequences were excluded by the chosen cut-off E value of

10-5. To evaluate the completeness of the transcriptomic

data collection, we searched the unigenes for the pres-

ence of genes predicted to function in four primary car-

bon metabolic pathways - glycolysis, pentose phosphate

pathway, TCA and glyconeogenesis. Annotated

sequences were found for every step of the four pathways

(data not shown), suggesting that the transcriptomic

library could represent a nearly complete sequence data-

base for the S. rolfsii transcriptome. The annotated uni-

gene functions cover a broad range of KOG categories

(Figure 2, Additional file 2), with the majority of genes

grouping into the metabolism category. Among the func-

tional KOG categories, we were particularly interested in

the categories 'Carbohydrate transport and metabolism

(G)' and 'Energy production and conversion (C)' as they

were supposed to contain unigenes which participate in

scleroglucan and oxalate metabolism. An overview of all

unigenes allocated into both categories is given in Addi-

tional file 3. From this list, unigenes were selected which

could potentially be involved in each of the five steps of

scleroglucan biosynthesis (Figure 3). Surprisingly, only

one potential candidate glycosyltransferase, presumed to

catalyze the last step in scleroglucan synthesis, was iden-

Table 1: Sequencing, assembly and data analysis.

Sequencing reads 356,098

Trimmed reads 343,410

Singletons 171,833

Average length singletons

(bases)

Contigs 21,937

Largest contig size (bases) 1,256

Average large contig size

(bases)

654

No. of bases in large contigs 286,124

No. of large contigs 437

No. of bases 3,681,160 bases

Figure 1 Growth of S. rolfsii and metabolite production in

EPSmax13 and EPSmin17 medium. S. rolfsii was cultivated in 50 ml

medium at 28°C up to 37 h. Cultures were harvested at the time points

indicated, and the dry weight biomass (BM), scleroglucan (SC), oxalate

and the medium pH determined. Mean values of a biological duplicate

experiment are shown.

4,5

BM EPSmax13 BM EPSmin17 SC EPSmax13 SC EPSmin17

2,5

3,5

ss [g/l]

0,5

1,5

Dry M

24 30 37

Time [h]

Ox EPSmax13

Ox EPSmin17

pH EPSmax13

pH EPSmin17

0,35

0,4

0,45

0,5

3,5

Ox EPSmax13

Ox EPSmin17

pH EPSmax13

pH EPSmin17

0,1

0,15

0,2

0,25

1,5

Oxalate [g

24 30 37

0,0

Time [h]

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 4 of 16

tified. Lacking more direct hits, we screened the com-

plete 171,833 singletons for the presence of a predicted

glycosyltransferase unigene and retrieved one additional

positive hit (D6LAZMP02HU01 M, 109 bases).

With respect to oxalate metabolism, we could retrieve

matching unigenes for 9 out of 12 possible enzymatic

reactions (Figure 4 and Table 2). As three hits potentially

encode an oxaloacetate hydrolase (reaction 1 in Figure 4)

but none a glyoxylate oxidase (reaction 2 in Figure 4), it

can be suggested that the main route for oxalate synthesis

in S. rolfsii is via oxaloacetate. This would be in good

agreement with previous findings which demonstrated

that the most important pathway leading to oxalate for-

mation in asco- and basidiomycetes is catalyzed via an

oxaloacetate hydrolase and thus solely depends on oxalo-

acetate as precursor and not on glyoxylate [35-37]. On

the other hand, it has been reported for S. rolfsii that the

enzyme glycolate oxidase (reaction 12 in Figure 4) also

accepts glyoxylate as substrate and oxidizes it to oxalate

[20,38]. Four contigs show considerable homology to gly-

colate oxidases (Table 2), which thus could be candidate

genes for such an enzyme.

In terms of oxalate degradation, no hits were identified

for an oxalate oxidase (reaction 11 in Figure 4) and an

oxalate decarboxylase (reaction 7 in Figure 4), but several

unigenes matched a formate dehydrogenase (reaction 8 in

Figure 4). We propose two possible explanations for this

finding. Either the main pathway for oxalate degradation

is still the oxalate decarboxylase -- formate dehydroge-

nase route but the oxalate decarboxylase gene was

expressed on a very low level and therefore not found

among the mRNA population(s) used for sequencing. Or

S. rolfsii does not use the oxalate decarboxylase -- for-

mate dehydrogenase pathway for oxalate degradation and

the formate dehydrogenase enzyme rather has a function

in anaerobic respiration as shown for Fusarium oxyspo-

rum [39,40].

As the lack of detection for unigenes encoding for an

oxalate oxidase and oxalate decarboxylase could be due to

their low expression levels, we screened the genomic

DNA of S. rolfsii via PCR using primers designed from

respective fungal and plant gene sequences (see Meth-

ods). Basically, either one of both enzymes have been

reported to be present in basidiomycetes, e.g. an oxalate

oxidase is crucial for lignin degradation by the white rot

Figure 2 KOG categorization of S. rolfsii unigenes. Categories are abbreviated as follows: J, translation, ribosomal structure and biogenesis; K, tran-

scription; L, replication, recombination and repair; A, RNA processing and modification; B, chromatin structure and dynamics; D, cell cycle control, cell

division, chromosome partitioning; O, posttranslational modification, protein turnover, chaperones; N, cell motility; P, inorganic ion transport and me-

tabolism; T, signal transduction mechanisms; Z, Cytoskeleton; Y, Nuclear structure, M, cell wall/membrane/envelope biogenesis; V, defense mecha-

nisms; C, energy production and conversion; G, carbohydrate transport and metabolism; E, amino acid transport and metabolism; F, nucleotide

transport and metabolism; H, coenzyme transport and metabolism; I, lipid transport and metabolism; Q, secondary metabolites biosynthesis, transport

and catabolism; R, general function prediction only; S, function unknown.

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 5 of 16

fungus Ceriopsis subvermispora [41] and a oxalate decar-

boxylase is important for the brown rot fungus Flammu-

lina velutipes for the survival under low external pH

conditions [42]. All our PCR attempts to isolate a DNA

sequence encoding an oxalate degrading enzyme were

only successful for an oxalate oxidase but not for an

oxalate decarboxylase (data not shown). We were able to

isolate one DNA fragment (designated oxox), which

showed 32% similarity to the barley oxoX gene, suggest-

ing that the oxalate oxidase reaction is the likely oxalate

degradation route in S. rolfsii.

Comparative transcriptomics using suppression

subtractive hybridization

We used a suppression subtractive hybridization (SSH)

approach to isolate cDNA species which are only present

or enriched in S. rolfsii when grown in EPSmax13

medium compared to EPSmin17 medium. The advantage

of the SSH approach is that also low abundant mRNA

species can be isolated. The mRNA isolated from S. rolfsii

cultivated for 37 h in EPSmax13 medium was used as 'tes-

ter' and mRNA isolated from 37 h old S. rolfsii cultures

cultivated in EPSmin17 medium served as 'driver'. A total

of 400 transformants representing cDNAs induced under

scleroglucan-producing conditions were isolated. 180 of

these clones were randomly selected and screened by

reverse Northern hybridization for differential expression

(Figure 5 and data not shown). 49 of the 180 screened

cDNA clones showed considerable differences when

hybridized with total cDNAs from scleroglucan-produc-

ing and scleroglucan-nonproducing conditions, respec-

tively, confirming that these genes are up-regulated

during scleroglucan biosynthesis. The 49 differentially

expressed cDNAs were sequenced (Additional file 4),

analyzed via TBLASTx and assigned to their predicted

functional activity within different biochemical pathways

(Table 3). In addition, the BioEdit tool http://

www.mbio.ncsu.edu/BioEdit/bioedit.html was applied to

blast and align the SSH unigenes against the 21,937 con-

tigs identified via 454 sequencing (E-value cut-off of 10-5).

Figure 3 Candidate unigenes potentially involved in scleroglucan biosynthesis. Unigenes with predicted functions in one of these steps are in-

dicated with their contig code.

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 6 of 16

For the majority of the SSH unigenes, we could identify

homologous 454 unigenes (Table 3).

Interestingly, we isolated not only genes predicted to

function in scleroglucan and oxalate metabolism (e.g.

UTP-glucose-1-phosphate uridylyltransferase, two aspar-

tate aminotransferases, and two formate dehydrogenases)

but also genes known to play fundamental roles in pri-

mary metabolism. For example, pyruvate decarboxylase

(marker enzyme for oxygen limitation), isocitrate dehy-

drogenase (key enzyme of TCA), oxoglutarate dehydro-

genase (enzyme of TCA and key enzyme for ammonia

assimilation), acyl-CoA-dehydrogenase (first and rate-

limiting step of fatty acid oxidation) and glycogen phos-

phorylase (crucial for survival under low energy supply)

were among the predicted proteins.

Comparative transcriptomics using Agilent microarray

hybridization

Complementary to the SSH approach; we performed

gene expression profiling to identify genes up- and down-

regulated during scleroglucan-producing conditions. In

order to manufacture respective Agilent microarrays, ten

different 60 bp long probes were designed (Additional file

5) and in situ synthesized for all of the 454 and SSH uni-

genes (~22,000). The specificity of the probes was ana-

lyzed in a test hybridization run using pooled cDNA

populations from S. rolfsii cultivated for 37 h in

EPSmax13 and EPSmin17 medium (data not shown).

Based on the results, two probes per unigene were

selected for the design of Agilent Multiplex 44K Arrays

(Additional file 6). The arrays were hybridized with S.

rolfsii cDNA, obtained from 37 h cultivations in

EPSmax13 and EPSmin17 medium, respectively. Hybrid-

izations were performed in triplicate using mRNA iso-

lated from three independent cultures (biological

triplicate, Additional files 7, 8, 9, 10, 11, 12 and 13). After

normalization based on quantiles, hybridization cluster-

ing experiments were performed to control both experi-

mental conditions. Based on this quality check, we had to

exclude one of the triplicate samples from further analysis

(EPSmin17 experiment, Sample B) as it did not cluster

with the other two EPSmin17 samples (Additional file

14).

For the comparison of the EPSmax13 triplicate versus

the EPSmin17 duplicate arrays, we used an arbitrary cho-

sen fold change of 2 to define unigenes as differently

Figure 4 Biochemical pathways involved in microbial oxalate metabolism. A literature survey of microbial and especially fungal oxalate metab-

olism was conducted to obtain an inventory of all possible metabolic routes for oxalate synthesis and degradation. Unigenes with predicted functions

in one of these steps are indicated with their contig code in Table 2.

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 7 of 16

expressed (Students t-test; p < 0.05). Applying this filter,

expression of a total of 723 unigenes did significantly vary

between both conditions, whereby 356 unigenes were up-

and 367 down-regulated under EPSmax13 condition

when compared to the EPSmin17 condition. A compre-

hensive list of all differentially expressed unigenes is

depicted in the Additional file 15. As not all of the 723

unigenes displayed a KOG annotation, we manually re-

annotated this gene list using TBLASTx or BLASTN (E-

value cut-off of 10-5) and classified the predicted protein

functions according to the Functional Catalogue (Fun-

Cat) [43]. We could thereby assign putative FunCats to

267 unigenes, out of which 138 were up-regulated and

129 down-regulated in S. rolfsii when cultivated in

EPSmax13 medium (Additional file 15, Figure 6).

The functional categories with the largest number of

differently expressed unigenes are the categories 'Metab-

olism' and 'Transport' (Figure 6). Among these are four

unigenes which we had isolated via the SSH approach

(e.g. glycogen phosphorylase, UDP-glucose-4-epimerase,

formate dehydrogenase; Table 4). The high fold change

cut-off used for microarray analysis as well as the lower

sensitivity of microarrays compared to SSH probably lim-

ited the amount of overlapping hits. Nine unigenes pre-

dicted to encode polysaccharide-acting enzymes were up-

regulated when S. rolfsii was cultivated in EPSmax13

medium (Table 4), thus representing potential candidate

genes involved in scleroglucan elongation and branching.

Moreover, many up-regulated unigenes fall into the group

of ergosterol and sphingolipid metabolic proteins (Table

4). Finally, various unigenes assigned to transporters

Table 2: Unigenes with predicted enzyme function related to oxalate metabolism.

No.Enzyme Contig

1Oxaloacetate

hydrolase

contig05630 contig03818 contig14763

2 Glyoxylate oxidase No hit

3 Isocitrate lyase contig14763 contig15770 contig18874 contig18218 contig00175 contig08937

4 Malate synthase contig00888 contig05791

5 Pyruvate carboxylase contig00420 contig21272

6Aspartate

aminotransferase

contig02946 contig08150 contig16197 contig17262 contig19058 contig19059 contig20005

7Oxalate

decarboxylase

No hit

8Formate

dehydrogenase

contig00580 contig04723 contig04947 contig07858 contig11312 contig13166 contig15432

contig15438 contig16572 contig16914 contig17132 contig17885 contig18254 contig21037

9Malate

dehydrogenase

contig02004 contig07487e contig12545 contig16174 contig18066 contig19518 contig21582

10 Succinate

dehydrogenase

contig11748 contig12058 contig05741 contig07994 contig14088 contig04161 contig15005

contig20092 contig17475 contig19516 contig18382 contig20164 contig20896 contig19935

contig21237 contig16039 contig19560

11 Oxalate oxidase No hit

12 Glycolate oxidase contig15511 contig21032 contig08342 contig17818

T Summary of the S. rolfsii contigs giving at least one hit when analyzed with one of the four BLAST tools (E-value cut-off of 10-5) to the

enzymes catalyzing reactions 1-12 according to Figure 4.

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 8 of 16

(ions, amino acids, peptides, lipids) and oxidoreductases

(e.g. aryl-alcohol dehydrogenases) displayed altered

expression under EPSmax13 conditions (Additional file

15). These transcriptional changes could imply that scle-

roglucan synthesis might be coupled to the cellular ion

homeostasis machinery. Such a scenario would be in

agreement with the overall concept that microbial EPS

production is also an adaptive response towards environ-

mental salt and osmotic stress [44-47].

Conclusions

In this study, we used different strategies to reveal genes

involved in scleroglucan synthesis and oxalate metabo-

lism of Sclerotium rolfsii, a fungus that lacks a sequenced

genome. In sum, three independent transcriptomic

approaches were applied, which together uncovered can-

didate genes for each predicted step of scleroglucan syn-

thesis, oxalate synthesis and oxalate degradation. Many of

these genes were unraveled in both global comparative

transcriptomic analyses, making them as prime candi-

dates for further analyses.

The insights into the genetics and transcriptome of

scleroglucan synthesis obtained in this work are to our

knowledge the first gained for any EPS produced by a

basidiomycete. The sequence data covers a nearly com-

plete set of genes transcribed in S. rolfsii and provides an

important resource for studying the biology and patho-

genesis of S. rolfsii.

Methods

Cultivation conditions

S. rolfsii strain ATCC15205 was cultivated at 28°C in

shake flasks containing 50 ml EPS medium (C-source, N-

source, 2 g/l K2HPO4, 0.5 g/l KCl, 0.5 g/l MgSO4*7H2O,

Figure 5 Reverse Northern hybridization. A, Flowchart of the Reverse Northern analysis. B, cDNA clones enriched in EPSmax13 were spotted via

slot blot technique on two nylon membranes and then hybridized with total cDNAs derived either from EPSmax13 (upper panel) or EPSmin17 (lower

panel). C, as reference, the same membranes were hybridized with vector-DNA to normalize probe intensities. Differentially expressed genes are

marked by a red frame.

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 9 of 16

Table 3: Unigenes identified via SSH and Reverse Northern hybridization that display increased expression in EPSmax13

medium.

Target ID Predicted function (TBLASTx) Length (bp)* Homologous 454 unigene

Carbohydrate metabolism

12 VII-3 Glucan phosphorylase 421 contig00741

contig15192

B5 UTP-glucose-1-phosphate

uridylyltransferase

429 contig14249

F4 UDP-glucose-4-epimerase 531 contig14591

contig16714

contig05705

contig19066

D1 Glucosamine-6-phosphate isomerase 441 contig18828

contig19082

E3 Beta-fructofuranosidase 419 contig14026

contig07977

C2 Glycogen phosphorylase 470 contig13256

7 VI-14 Glycogen phosphorylase 421 contig00741

contig15192

3 VI-7 Isocitrate dehydrogenase 546 contig15308

contig19633

9 VI-19 Oxoglutarate dehydrogenase 325 No hit

33 XI-28 Pyruvate decarboxylase 318 contig19196

contig19387

E4 Pyruvate decarboxylase 242 No hit

G2 Pyruvate decarboxylase 236 contig19196

contig19387

G8 Pyruvate decarboxylase 242 contig03793

contig15593

D2 Phosphopyruvate hydratase 183 No hit

B8 Trehalose phosphorylase 178 contig17258

contig19103

F3 Mannitol-1-phosphate dehydrogenase 357 contig21872

contig13513

contig19371

4 VI-8 Formate dehydrogenase 186 contig08513

27 V-36 Formate dehydrogenase 486 contig04947

contig11312

contig16572

contig17132

contig13166

Lipid metabolism

29 X-12 Acetyl-CoA hydrolase/transferase 911 contig16913

contig18900

contig13924

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 10 of 16

34 XI-34 Oleate 12-hydroxylase gene 337 contig00730

contig19568

21 VIII-38 Multifunctional beta-oxidation protein 589 contig15214

contig15066

contig12394

8 VI-18 Acyl-CoA-Dehydrogenase 877 contig11819

contig00728

contig07196

Transport

13 VII-5 Endoplasmic reticulum-derived transport 451 contig14573

contig13652

A3 Copper transporter 481 contig15666

contig14830

contig02543

contig18312

Amino acid metabolism

22 VIII-45 Acetylornithine aminotransferase 146 No hit

6 VI-12 Acetylornithine aminotransferase 140 No hit

21 VIII-38 Aminotransferase 589 contig15214

contig15066

contig12394

A2 Aspartate aminotransferase 476 No hit

B7 Aspartate aminotransferase 538 contig16197

contig17262

contig08150

Oxidative stress

D4 Manganese superoxide dismutase 229 contig14464

Others

D3 Superfamily of calcium sensors and

calcium signal modulators

351 contig18978

contig15800

contig15801

contig16990

18 VII-50 ATP synthase vacuolar proton pump 358 contig05644

contig12704

20 VIII-21 GAL4-like DNA-binding domain 340 contig04517

31 X-30 Plasma membrane H+ transporting

ATPase

348 contig14871

B4 Intradiol dioxygenase 570 No hit

Table 3: Unigenes identified via SSH and Reverse Northern hybridization that display increased expression in EPSmax13

medium. (Continued)

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 11 of 16

0.05 g/l FeSO4*7H2O, 1 g/l yeast extract, 0.7 g/l citric acid

7*H2O. pH 4.5) [15]. EPSmax13 contained 40 g/l glucose

and 3.0 g/l NaNO3 as C- and N-sources, whereas

EPSmin17 used 40 g/l fructose and 1.9 g/l NH4Cl, respec-

tively.

Analytical measurements

In order to determine S. rolfsii biomass from liquid cul-

tures, 40 g of each culture broth were sampled, preheated

to 56°C and subjected to enzymatic cell wall degradation

(1 mg Glucanex/g broth). After incubation for 30 min at

56°C, Glucanex was heat-inactivated (90°C, 20 min) and

the sample cooled down to room temperature. The initial

weight (40 g) was re-adjusted by adding water and 30 g of

this solution were centrifuged to harvest the biomass.

The dry weight was determined after the wet biomass

pellet was vacuum-dried over night (12 h, 60°C).

Hypothetical

A4 hypothetical protein UM02463.1 352 contig16014

14 VII-6 XP_001828655.1 CC1G_10527 345 No hit

24 IV-17 XP_001873967.1 470 No hit

28 X-11 XP_001875220.1 624 contig16711

contig08447

5 VI-11 XP_001873416.1 392 contig01594

contig20088

contig21715

contig15050

B2 XP_001830146.1 CC1G_09306 540 contig20176

contig17567

contig17591

contig21673

15 VII-9 Transcription factor 352 No hit

B6 No hit 590 contig02865

contig11989

contig00561

A8 No hit 193 No hit

A7 No hit 193 No hit

1 VI-4 No hit 207 contig14768

contig20467

contig09075

11 VII-2 No hit 241 contig15360

contig15302

G7 No hit 537 contig21711

contig12931

contig16495

C6 No hit 602 contig02865

contig11989

contig00561

F8 No hit 367 contig16532

contig19793

contig01157

* The DNA sequences of all SSH unigenes are given in Additional file 4.

Table 3: Unigenes identified via SSH and Reverse Northern hybridization that display increased expression in EPSmax13

medium. (Continued)

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 12 of 16

Scleroglucan levels were determined using isopropanol

precipitation. Two volumes of isopropanol were mixed

with one volume of culture broth and the resulting sclero-

glucan precipitate was filtered over a 74 μm mesh filter.

After evaporation of isopropanol, the precipitate was vac-

uum-dried for 2 h at 60°C and the dry weight of scleroglu-

can determined.

Oxalate levels in the culture supernatant were deter-

mined via HPLC (Knaur column H+) using 0.05 M H2SO4

as solvent and an UV detector (210 nm).

RNA isolation

Due to the high amounts of EPS produced, extraction of

intact total RNA from S. rolfsii cultures was only possible

by using a caesium chloride-based ultracentrifugation

method [48]. In brief, 1 g of S. rolfsii mycelium was har-

vested by filtration and frozen in liquid nitrogen. After

homogenization using a dismembrator (Braun Biotech),

the pulverized homogenate was resuspended in 5 ml

RNA extraction buffer (4 M guanidine isothiocyanate; 0.1

M Tris/HCl, pH 7.5; 1% β-Mercaptoethanol, 0.5% N-laur-

ylsarcosine). After centrifugation (5000 ×g, 10 min, RT),

the supernatant was subjected to ultracentrifugation

using 5 M caesium chloride (30,000 ×g, 19 h, RT). The

resulting RNA pellet was precipitated using 2 volumes of

ice-cold EtOH (96%) and 1/10 volumes of 8 M LiCl.

Suppression Subtractive Hybridization and Reverse

Northern analysis

Suppression subtractive hybridization was performed

using the PCR-SelectTM cDNA subtraction kit and fol-

lowed the manufacturer's instructions (Clontech). S. rolf-

sii mRNA extracted from EPSmax13 cultures was used as

tester (mRNA population containing specifically

expressed transcripts) and mRNA isolated from

EPSmin17 as driver (mRNA population that is used for

subtraction). The tester cDNAs enriched under

EPSmax13 conditions were ligated into pUC18 vector

(Fermentas) and transformed into Escherichia coli DH5α

(Gibco). Selected transformants were subjected to

Reverse Northern analysis. Plasmid DNAs isolated from

180 randomly picked clones were slot-blotted onto posi-

tively Hybond-N nylon membranes (Amersham) and

subjected to three independent hybridization runs using

P32-labelled cDNAs generated from EPSmax13 and

EPSmin17, respectively, as well as pUC18 plasmid DNA

as probes. cDNAs were generated using Superscript II

reverse transcriptase (Ambion). Hybridizations were per-

Figure 6 Functional categories of genes up- or down-regulated in S. rolfsii grown in EPSmax13 medium compared to growth in EPSmin17

medium. An annotated list of all responsive genes, including fold change, p value and classification, can be found in Additional file 15.

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 13 of 16

Table 4: Unigenes selected from the microarray analysis that display increased or reduced expression in EPSmax13

medium compared to EPSmin17 medium.

Target ID Predicted function

(TBLASTx)

P value Log2Fold

Carbohydrate metabolism

contig13845 Glycogen debranching

enzyme

6.43E-03 1.136

contig17335 Glycogen debranching

enzyme

4.42E-02 1.174

contig18482 Glycogen debranching

enzyme

8.15E-03 1.074

contig19066 UDP-glucose-4-epimerase 3.25E-03 1.012

contig20926 GH16 beta-1,3-glucan

recognition protein

1.60E-02 1.542

contig01604 GH16 beta-1,3-glucan

recognition protein

1.37E-02 1.540

C2 Glycogen phosphorylase 4.65E-02 1.493

contig04502 Glycoside hydrolase family 31 2.78E-02 1.455

contig08391 Glycoside hydrolase family 31 1.30E-02 1.102

contig20411 Glycoside hydrolase family 63 1.75E-03 1.056

F3 Mannitol-1-phosphate

dehydrogenase

1.77E-03 1.305

contig07858 Formate dehydrogenase 1.97E-02 1.307

contig11312 Formate dehydrogenase 6.59E-04 2.341

contig13166 Formate dehydrogenase 1.15E-03 2.826

contig16572 Formate dehydrogenase 1.25E-03 2.611

contig16914 Formate dehydrogenase 6.76E-04 2.570

contig17132 Formate dehydrogenase 4.23E-02 2.360

contig21037 Formate dehydrogenase 1.59E-03 2.231

contig21586 Endocellulase 6.16E-03 -2.391

contig06887 Endocellulase 4.85E-02 -1.571

contig16192 Endocellulase 4.08E-03 -2.419

contig15791 Endocellulase 1.89E-02 -3.138

contig08327 Glucoamylase G2 1.39E-02 -1.069

contig04589 Glucoamylase G2 2.43E-03 -2.330

contig03614 Exo-beta-1,3-glucanase 7.25E-04 -2.473

contig10472 UDP-glucuronosyl/UDP-

glucosyl transferase

3.21E-02 -1.403

Lipid metabolism

contig04863 Squalene monooxygenase 4.27E-02 2.255

contig19483 Squalene monooxygenase 4.21E-02 2.007

contig18170 Squalene monooxygenase 4.40E-02 1.861

contig16238 Squalene monooxygenase 2.91E-02 1.546

contig16026 Sphingolipid hydroxylase 4.69E-03 1.858

contig01140 Sphingolipid hydroxylase 3.75E-02 1.741

contig08736 Sphingolipid hydroxylase 3.30E-02 1.625

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 14 of 16

formed using the Rapid-Hyb buffer system (Amersham)

and followed the manufacturer's instructions.

454 pyrosequencing

Mixed cDNA populations obtained from S. rolfsii were

sequenced in triplicate runs by 454 Life Sciences (Bran-

ford, USA). For this purpose, total RNA was isolated from

37 h old cultures of S. rolfsii grown in EPSmin17 and

EPSmax13 medium (see above). Both RNA populations

were pooled in a 1:1 ratio to guarantee equal occurrence

and putative constitutively expressed genes (glycerol

phosphate dehydrogenase, gpdS; glucoamylase G2, acces-

sion number D49448) were used for normalization.

cDNAs were synthesized using the Clontech's SMART

System protocol modified by AGOWA (Berlin, Ger-

many). The cDNA library was sequenced by the ultrafast

pyrosequencing method (454 Life Sciences).

PCR screening

Oxalate oxidase metabolizes oxalate directly to CO2 and

H2O2 (enzyme no. 11 in Figure 4) and is found mainly in

plants [49-51] but also in basidiomycetes [41]. Sequences

from barley (oxoX, CAA74595) and the fungus Ceriopsis

subvermispora (CAD91553) were used to identify regions

of high homology (data not shown), inside of which prim-

ers were designed (Bar 1, GGTACGAACACGTGGGC;

Bar2, CCGGCCTCCACCCGAAGAG) to amplify a

potential oxalate oxidase from S. rolfsii genomic DNA

(see below). Using this primer pair, a ~850 bp fragment

was isolated.

Oxalate decarboxylase degrades oxalate to formate and

CO2 (enzyme no. 7 in Figure 4). Oxalate decarboxylases

are present in the brown rot fungi Postia placenta [52]

and Flammulina velutipes [42]. A region within the F.

velutipes oxdc gene (AF200683), which is highly con-

served among oxalate decarboxylases, was used as a tem-

plate for the design of specific primers (Oxdc1,

ATTAAGGATCCATCCATCGCATTTCCGATG;

Oxdc2, AATACCDAYGTAGGAAATCATATCCG-

GCCG). For both PCR reactions, different annealing

temperatures and elongation times were tested (not

shown).

Genomic DNA extraction

S. rolfsii was cultivated in 100 ml EPSmin17 medium at

28°C, 250 rpm using magnetic stirrers. After 48 h of culti-

vation, mycelium was harvested by filtration through a

piece of gauze and washed twice with hot water (85°C) to

remove scleroglucan. The mycelium was frozen in liquid

nitrogen and genomic DNA extracted following a proto-

col described for Aspergillus nidulans [53].

Microarray analysis

Tailor-made microarrays (44K multiplex chip, Agilent)

were designed by imaGenes (Berlin, Germany) using an

in-house developed method for empirical selection of

best performing probes for each gene (Pre Selection

Strategy). Briefly, up to ten probes were designed for each

of the 454 and SSH unigenes as well as for the oxox gene

(60 bp long oligomers). The 244K Agilent test array was

hybridized with pooled Cy3-labeled cRNAs gained form

EPSmax13 and EPSmin17 cultures (see above) and (in

average) two of the best performing oligos were selected

for each unigene.

For comparative expression profiling, total RNA was

isolated from S. rolfsii, cultured for 37 h in EPSmax13 and

EPSmin17 media as described above. RNA quality con-

trol, synthesis of Cy3-labeled cRNA including cRNA

purification and cRNA quality control, microarray

hybridization, scanning and data extraction (Agilent's

feature extraction software) were performed by

imaGenes GmbH. The complete set of transcriptional

raw data is available as Additional files 8, 9, 10, 11, 12 and

13 and has additionally been archived at Gene Expression

Omnibus http://www.ncbi.nlm.nih.gov/geo under acces-

sion number GSE21040. Expression data were analyzed

by imaGenes GmbH using an in-house developed data

analysis pipeline. After quantile normalization, genes

were defined as differentially expressed if their expression

levels varied at least 2 fold in EPSmax13 samples com-

pared to EPSmin17 samples and if the difference was sta-

tistically significant (Student's t-test, P-value cut-off of

0.05).

contig19971 Sphingolipid hydroxylase 1.05E-02 1.610

contig03880 Sphingolipid hydroxylase 1.43E-02 1.291

contig11092 C-4 sterol methyl oxidase 2.49E-02 1.622

contig21591 C-4 sterol methyl oxidase 3.28E-02 1.524

contig03744 C-4 sterol methyl oxidase 4.50E-03 1.754

contig14837 C-5 sterol desaturase 7.16E-03 1.872

Table 4: Unigenes selected from the microarray analysis that display increased or reduced expression in EPSmax13

medium compared to EPSmin17 medium. (Continued)

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 15 of 16

Additional material

Authors' contributions

JS carried out the molecular genetic studies, sequence annotations and

microarray analyses and performed the oxalate analyses. LF and JS carried out

the SSH approach and extracted RNA and scleroglucan. TB participated in the

bioinformatics and functional analyses. JS, DM and US participated in the

design of the study. VM and VS conceived of, designed and coordinated the

study. JS and VM wrote the manuscript. All authors read and approved the final

manuscript.

Acknowledgements

The authors would like to thank Barbara Walewska, Boris Winter and Mirine

Choi for technical assistance and the German Federal Ministry of Research and

Education for financial support (BMBF grant 0313397).

Author Details

1Chair of Chemistry of Biogenic Resources, Straubing Centre of Science,

Technische Universität München, Schulgasse 16, 94315 Straubing, Germany,

2Department of Microbiology and Genetics, Berlin University of Technology,

Gustav-Meyer-Allee 25, 13355 Berlin, Germany, 3Computational Genomics,

Center for Biotechnology (CeBiTec), Bielefeld University, D-33594 Bielefeld,

Germany, 4Degussa Food Ingredients GmbH, Lise Meitner Str. 34, 85354

Freising, Germany, 5Molecular Microbiology and Biotechnology, Institute of

Biology, Leiden University, 2333 BE Leiden, The Netherlands and 6PolyPhag

GmbH, Robert-Rössle-Str. 10, 13125 Berlin, Germany

References

1. Paintin RD: Notes on the parasitology of Sclerotium rolfsii. Mycologia

1928, 20(1):22-26.

2. Mordue JEM: Corticium rolfsii. CMI description of Pathogenic Fungi and

Bacteria no 410 1974, 41:.

3. Wydra K: Collection and determination of root and stem rot pathogens.

Annual Report IITA 1996, 68:.

4. Brigand G: Scleroglucan. In Industrial Gums 3rd edition. New York:

Academic Press; 1993:461-472.

5. Sandford PA: Exocellular, microbial polysaccharides. Adv Carbohydr

Chem Biochem 1979, 36:265-313.

6. EL Ouriaghli Y, Francois J, Sarazin D, Nguyen Truong D: Influence of

nonionic surfactant on aggregation state of scleroglucan in aqueous

solution. Carbohydr Polym 1992, 17(4):305-312.

7. Survase SA, Saudagar PS, Bajaj IB, Singhal RS: Scleroglucan: Fermentative

Production, Downstream Processing and Applications. Food Technol

Biotechnol 2007, 45(2):107-118.

8. Fariña JI, Viñarta SC, Cattaneo M, Figueroa LIC: Structural stability of

Sclerotium rolfsii ATCC 201126 β-glucan with fermentation time: a

chemical, infrared spectroscopic and enzymatic approach. J Appl

Microbiol 2009, 106(1):221-232.

9. Coviello T, Alhaique F, Parisi C, Matricardi P, Bocchinfuso G, Grassi M: A

new polysaccharidic gel matrix for drug delivery: preparation and

mechanical properties. J Control Release 2005, 102(3):643-656.

10. Coviello T, Grassi M, Palleschi A, Bocchinfuso G, Coluzzi G, Banishoeib F,

Alhaique F: A new scleroglucan/borax hydrogel: swelling and drug

release studies. Int J Pharm 2005, 289(1-2):97-107.

11. Giavasis I, Harvey LM, McNeil B: Scleroglucan. In Biopolymers:

Polysaccharides II Volume 6. Edited by: EJ S. Weinheim: Wiley-VCH;

2002:37-60.

12. Sutherland IW: Microbial polysaccharides-a comparison with

eukaryotic polymers. Sym Soc Exp Biol 1989, 43:389-402.

13. Schmid F, Stone BA, Brownlee RT, McDougall BM, Seviour RJ: Structure

and assembly of epiglucan, the extracellular (1-->3;1-->6)-beta-glucan

produced by the fungus Epicoccum nigrum strain F19. Carbohydr Res

2006, 341(3):365-373.

14. Batra KK, Nordin JH, Kirkwood S: Biosynthesis of the [beta]--glucan of

Sclerotium rolfsii sacc. Direction of chain propagation and the insertion

of the branch residues. Carbohyd Res 1969, 9(2):221-229.

15. Farina JI, Sineriz F, Molina , Perotti NI: High scleroglucan production by

Sclerotium rolfsii: Influence of medium composition. Biotechnol Lett

1998, 20(9):825-831.

16. Maxwell DP, Bateman DF: Influence of carbon source and pH on oxalate

accumulation in culture filtrates of S. rolfsii. Phytopathology 1965,

58:1351-1355.

17. Wang Y, McNeil B: Scleroglucan and oxalic acid formation by Sclerotium

glucanicum in sucrose supplemented fermentation. Biotechnol Lett

1994, 16:605-610.

18. Lee K: Characterization of scleroglucan fermentation by Sclerotium

rolfsii in terms of cell, scleroglucan and by-product, oxalic acid

concentrations, viscosity and molecular weight distribution. Irvine:

California; 1998.

19. Wang Y, McNeil B: Scleroglucan. Crit Rev Biotechnol 1996, 16(3):185-215.

20. Schilling BM, Henning A, Rau U: Repression of oxalic acid biosynthesis in

the unsterile scleroglucan production process with Sclerotium rolfsii

ATCC 15205. Bioprocess Eng 2000, 22:51-55.

21. Survase SA, Saudagar PS, Singhal RS: Enhanced production of

scleroglucan by Sclerotium rolfsii MTCC 2156 by use of metabolic

precursors. Bioresour Technol 2007, 98(2):410-415.

22. Survase SA, Saudagar PS, Singhal RS: Use of complex media for the

production of scleroglucan by Sclerotium rolfsii MTCC 2156. Bioresour

Technol 2007, 98(7):1509-1512.

23. Bateman DF, Beer SV: Simultaneous production and synergistic action

of oxalic acid and polygalacturonase during pathogenesis by

Sclerotium rolfsii. Phytopathology 1965, 55:204-211.

24. Dutton MV, Evans CS: Oxalate production by fungi: its role in

pathogenicity and ecology in the soil environment. Can J of Bot 1996,

42:881-895.

25. Goodell b, Jellison J, Liu J, Daniel G, Pasczynski A, Fekete F, Krishnamurthy

S, Jun L, Xu G: Low molecular weight chelators and phenolic

compounds isolated from wood decay fungi and their role in the

fungal biodegradation of wood. J Biotechnol 1995, 53:133-162.

26. Munir E, Yoon JJ, Tokimatsu T, Hattori T, Shimada M: A physiological role

for oxalic acid biosynthesis in the wood-rotting basidiomycete

Fomitopsis palustris. Proc Natl Acad Sci USA 2001, 98(20):11126-11130.

Additional file 1 454 summary. Summary of 454 sequencing and assem-

bly.

Additional file 2 SAMS results. Summary of annotation results using

SAMS.

Additional file 3 KOG categories. Unigenes grouped into the KOG cate-

gories 'Carbohydrate transport and metabolism (G)' and 'Energy produc-

tion and conversion (C)'.

Additional file 4 SSH results. Unigenes identified via SSH and Reverse

Northern hybridization.

Additional file 5 60 mers. Summary for all 60-mer probes designed for

microarray hybridization.

Additional file 6 selected 60 mers. 60-mer probes used for comparative

microarray hybridization.

Additional file 7 Sample Key. Sample key for comparative microarray

hybridization.

Additional file 8 251706710004_2. Raw data for experiment

EPSmax13_37 h, Sample A.

Additional file 9 251706710005_4. Raw data for experiment

EPSmax13_37 h, Sample B.

Additional file 10 251706710005_1. Raw data for experiment

EPSmax13_37 h, Sample C.

Additional file 11 251706710005_3. Raw data for experiment

EPSmin17_37 h, Sample A.

Additional file 12 251706710004_4. Raw data for experiment

EPSmin17_37 h, Sample B.

Additional file 13 251706710006_4. Raw data for experiment

EPSmin17_37 h, Sample C.

Additional file 14 Dendrogram. Dendrogram of the clustering hybridiza-

tion experiment based on mean expression values.

Additional file 15 Differentially expressed unigenes. Differentially

expressed unigenes in EPSmax13 compared to EPSmin17 medium.

Received: 23 December 2009 Accepted: 26 May 2010

Published: 26 May 2010

This article is available from: http://www.biomedcentral.com/1471-2164/11/329© 2010 Schmid et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.BMC Genomics 2010, 11:329

Schmid et al. BMC Genomics 2010, 11:329

http://www.biomedcentral.com/1471-2164/11/329

Page 16 of 16

27. Shimadaa M, Akamtsub Y, Tokimatsua T, Miia K, Hattoria T: Possible

biochemical roles of oxalic acid as a low molecular weight compound

involved in brown-rot and white-rot wood decays. J Biotechnol 2007,

53(2-3):103-113.

28. Green F, Clausen CA, Kuster TA, Highley TL: Induction of

polygalacturonase and the formation of oxalic acid by pectin in

brown-rot fungi. World J Microbiol Biotechnol 1995, 11(5):519-524.

29. Green IF, Tschernitz J, Kuster TA, Highley TL: Hydrolysis of bordered pits

during colonization of conifers by brown-rot decay. The International

Research Group on Wood Preservation, 26th Annual Meeting Helsingør,

Denmark 11-16 June 1995. Helsingør 1995.

30. Errakhi R, Meimoun P, Lehner A, Vidal G, Briand J, Corbineau F, Rona JP,

Bouteau F: Anion channel activity is necessary to induce ethylene

synthesis and programmed cell death in response to oxalic acid. J Exp

Bot 2008, 59(11):3121-3129.

31. Lehner A, Meimoun P, Errakhi R, Madiona K, Barakate M, Bouteau F: Toxic

and signalling effects of oxalic acid oxalic acid-natural born killer or

natural born protector? Plant Signal Behav 2008, 3(9):746-748.

32. Kim KS, Min JY, Dickman MB: Oxalic acid is an elicitor of plant

programmed cell death during Sclerotinia sclerotiorum disease

development. Mol Plant Microbe Interact 2008, 21(5):605-612.

33. Bekel T, Henckel K, Kuster H, Meyer F, Mittard Runte V, Neuweger H,

Paarmann D, Rupp O, Zakrzewski M, puhler A, Stoye J, Goesman A: The

sequence analysis and management system - SAMS-2.0: data

management and sequence analysis adapted to changing

requirements from traditional sanger sequencing to ultrafast

sequencing technologies. J Biotechnol 2009, 140(1-2):3-12.

34. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment

search tool. J Mol Biol 1990, 215(3):403-410.

35. Kubicek CP, Schrefferl-Kunar GE, Wöhrer W, Rohr W: Evidence for a

cytoplasmic pathway of oxalate biosynthesis in Aspergillus niger.

Environ Microbiol 1988, 54(3):633-637.

36. Han Y, Joosten HJ, Niu W, Zhao Z, Mariano PS, McCalman M, van Kan J,

Schaap PJ, Dunaway-Mariano D: Oxaloacetate hydrolase, the C-C bond

lyase of oxalate secreting fungi. J Biol Chem 2007, 282(13):9581-9590.

37. Rio M, de Oliveira B, de Tomazella D, Silva J, Pereira G: Production of

calcium oxalate crystals by the basidiomycete Moniliophthora

perniciosa, the causal agent of Witches' Broom disease of cacao. Curr

Microbiol 2008, 56(4):363-370.

38. Maxwell DP, Bateman DF: Oxalic acid biosynthesis by Sclerotium rolfsii.

Phytopathology 1968, 58:1635-1642.

39. Takaya N, Uchimura H, Lai Y, Shoun H: Transcriptional control of nitric

oxide reductase gene (CYP55) in the fungal denitrifier Fusarium

oxysporum. Biosci Biotechnol Biochem 2002, 66(5):1039-1045.

40. Uchimura H, Enjoji H, Seki T, Taguchi A, Takaya N, Shoun H: Nitrate

reductase-formate dehydrogenase couple involved in the fungal

denitrification by Fusarium oxysporum. J Biochem 2002, 131(4):579-586.

41. Escutia MR, Bowater L, Edwards A, Bottrill AR, Burrell MR, Polanco R, Vicuna

R, Bornemann S: Cloning and sequencing of two Ceriporiopsis

subvermispora bicupin oxalate oxidase allelic isoforms: implications for

the reaction specificity of oxalate oxidases and decarboxylases. Appl

Environ Microbiol 2005, 71(7):3608-3616.

42. Azam M, Kesarwani M, Chakraborty S, Natarajan K, Datta A: Cloning and

characterization of the 5'-flanking region of the oxalate decarboxylase

gene from Flammulina velutipes. Biochem J 2002, 367(Pt 1):67-75.

43. Ruepp A, Zollner A, Maier D, Albermann K, Hani J, Mokrejs M, Tetko I,

Guldener U, Mannhaupt G, Munsterkotter M, Mewes HW: The FunCat, a

functional annotation scheme for systematic classification of proteins

from whole genomes. Nucleic Acids Res 2004, 32(18):5539-5545.

44. Chen LZ, Li DH, Song LR, Hu CX, Wang GH, Liu YD: Effects of salt stress on

carbohydrate metabolism in desert soil alga Microcoleus vaginatus

Gom. J Integr Plant Biol 2006, 48(8):914-919.

45. Mikherjee SK, Samadarr KR: The correlation between salt tolerance and

extracellular polysaccharide production in Rhizobium. Microbes Environ

1997, 12(1):9-13.

46. Ozturk S, Aslim B: Modification of exopolysaccharide composition and

production by three cyanobacterial isolates under salt stress. Environ

Sci Pollut Res Int 2010, 7(3):595-602.

47. Nagarajan T, Vanderleyden J, Tripathi AK: Identification of salt stress

inducible genes that control cell envelope related functions in

Azospirillum brasilense Sp7. Mol Genet Genomics 2007, 278(1):43-51.

48. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ: Isolation of

biologically active ribonucleic acid from sources enriched in

ribonuclease. Biochemistry 1979, 18(24):5294-5299.

49. Lane BG: Oxalate oxidases and differentiating surface structure in

wheat: germins. Biochem J 2000, 349(Pt 1):309-321.

50. Lane BG, Dunwell JM, Ray JA, Schmitt MR, Cuming AC: Germin, a protein

marker of early plant development, is an oxalate oxidase. J Biol Chem

1993, 268(17):12239-12242.

51. Dumas B, Freyssinet G, Pallett KE: Tissue-specific expression of germin-

like oxalate oxidase during development and fungal infection of barley

seedlings. Plant Physiol 1995, 107(4):1091-1096.

52. Micales JA: Oxalate decarboxylase in the brown-rot wood decay fungus

Postia placenta. Mater Organismen 1995, 29(3):177-186.

53. Yelton MM, Hamer JE, Timberlake WE: Transformation of Aspergillus

nidulans by using a trpC plasmid. Proc Natl Acad Sci USA 1984,

81(5):1470-1474.

doi: 10.1186/1471-2164-11-329

Cite this article as: Schmid et al., Transcriptome sequencing and compara-

tive transcriptome analysis of the scleroglucan producer Sclerotium rolfsii

BMC Genomics 2010, 11:329