scieee Science in your language
[en] (orig)
Physical influence of microbial
communities on the structure and
occlusion of particulate organic
matter in a sandy agricultural soil
vorgelegt von
Dipl.-Ing.
Frederick Büks
geb. in Berlin
an der Fakultät VI – Planen Bauen Umwelt
der Technischen Universität Berlin
zur Erlangung des akademischen Grades
Doktor der Naturwissenschaften
- Dr. rer. nat. -
genehmigte Dissertation
Promotionsausschuss:
Vorsitzende: Prof. Dr. Eva Paton
Gutachter: Prof. Dr. Martin Kaupenjohann
Gutachterin: Prof. Dr. Liliane Rueß
Gutachter: Prof. Dr. Ulrich Szewzyk
Tag der wissenschaftlichen Aussprache: 3. Mai 2018
Berlin 2018
“Selbst um auf einem Stein zu sitzen – drei Jahre.”
ZEN-WEISHEIT
Advertisement
Table of contents
List of figures .................................................................................................................... 8
List of tables ...................................................................................................................... 9
Abbreviations .................................................................................................................. 11
Acknowledgements ........................................................................................................ 13
Abstract ............................................................................................................................ 14
Zusammenfassung ......................................................................................................... 15
1 General introduction ....................................................................................................... 1
1.1 A short scientific history of aggregate structure and genesis ................................ 1
1.2 Soil aggregation ..................................................................................................... 5
1.2.1 Binding mechanisms within soil aggregates ...................................................................... 5
Physico-chemical interactions .................................................................................... 5
Biochemical interactions I: Bacterial extracellular polymeric substances (EPS) ......... 6
EPS and bacterial habitats ......................................................................................... 9
Aggregates scaffolded by filamentous microorganisms ............................................ 12
Biochemical interactions II: Fungal glomalin ............................................................. 13
1.2.2 Carbon occlusion within soil aggregates ......................................................................... 17
2 Measurement of aggregate stability and C occlusion .............................................. 21
2.1 The diversity of methods for aggregate stability measurement .......................... 21
2.2 Measuring aggregate stability by use of ultrasonication ..................................... 23
2.3 Measurement of C occlusion ............................................................................... 26
3 Aim of this work ............................................................................................................ 30
4 Enzymatic biofilm digestion in soil aggregates facilitates the release of particulate
organic matter by sonication .......................................................................................... 31
4.1 Abstract ................................................................................................................ 31
4.2 Introduction .......................................................................................................... 32
4.3 Materials and methods ........................................................................................ 36
4.3.1 Soil properties and microbial biomass ............................................................................. 36
4.3.2 Detachment scenarios ..................................................................................................... 37
4.3.3 Release of POM carbon .................................................................................................. 39
4.3.4 Release of bacterial DNA ................................................................................................ 40
4.3.5 Statistics .......................................................................................................................... 41
4.4 Results ................................................................................................................. 41
4.4.1 Release of POM carbon .................................................................................................. 41
4.4.2 Release of bacterial DNA ................................................................................................ 43
4.5 Discussion ........................................................................................................... 44
4.6 Conclusions ......................................................................................................... 48
4.7 Acknowledgements ............................................................................................. 49
I
5 POM occlusion within sandy soil macroaggregates is not affected by feeding and
motion of the nematode Acrobeloides buetschlii ........................................................ 51
5.1 Abstract ................................................................................................................ 51
5.2 Introduction .......................................................................................................... 52
5.3 Materials and methods ........................................................................................ 54
5.3.1 Soil sample ...................................................................................................................... 54
5.3.2 Basal respiration .............................................................................................................. 54
5.3.3 Preparation of the inoculum ............................................................................................ 55
5.3.4 Nematode population development ................................................................................. 55
5.3.5 Measurement of POC release ......................................................................................... 56
5.3.6 Phospholipid fatty acid (PLFA) extraction and analysis ................................................... 56
5.3.7 Mercury intrusion ............................................................................................................. 58
5.3.8 Statistics .......................................................................................................................... 59
5.4 Results ................................................................................................................. 59
5.4.1 Soil respiration ................................................................................................................. 59
5.4.2 Population development .................................................................................................. 60
5.4.3 POC release .................................................................................................................... 61
5.4.4 PLFA analysis .................................................................................................................. 62
5.4.5 Mercury intrusion ............................................................................................................. 64
5.5 Discussion ........................................................................................................... 64
5.6 Conclusions ......................................................................................................... 68
5.7 Acknowledgements ............................................................................................. 68
6 Two different microbial communities did not cause differences in occlusion of
particulate organic matter in a sandy agricultural soil ................................................ 69
6.1 Abstract ................................................................................................................ 69
6.2 Introduction .......................................................................................................... 70
6.3 Materials and methods ........................................................................................ 73
6.3.1 Preparation of soil and soil extracts ................................................................................. 73
6.3.2 Incubation and sampling ................................................................................................. 74
6.3.3 DNA extraction and qPCR ............................................................................................... 75
6.3.4 Disaggregation of soil aggregates and quantification of POC ......................................... 77
6.3.5 Statistical analyses .......................................................................................................... 77
6.4 Results ................................................................................................................. 78
6.4.1 Microbial population analysis .......................................................................................... 78
6.4.2 POC release .................................................................................................................... 81
6.5 Discussion ........................................................................................................... 82
6.6 Conclusions ......................................................................................................... 85
6.7 Acknowledgements ............................................................................................. 85
7 Synthesis and conclusions .......................................................................................... 87
7.1 Single experiments .............................................................................................. 87
7.2 Statistical restrictions ........................................................................................... 89
7.3 General conclusion .............................................................................................. 90
7.4 Transferability to other soils ................................................................................. 92
7.5 Future research ................................................................................................... 92
References ....................................................................................................................... 95
II
Advertisement
List of figures
Fig. 1: Idealized binding pattern of hierarchical and non-hierarchical soil aggregates ....... 4
Fig. 2: Extracellular polysaccharides, DNA, proteins and lipids within soils ....................... 8
Fig. 3: A model of soil aggregate structure on different scales ......................................... 16
Fig. 4: Proposed model of inner soil aggregate structure including EPS ......................... 33
Fig. 5: Relative POC release after enzyme treatments ..................................................... 42
Fig. 6: Relative bacterial DNA release from soil aggregates after enzyme treatments .... 43
Fig. 7: Soil respiration of samples with 0, 50, 70 and 80% water holding capacity .......... 60
Fig. 8: Population development of nematodes .................................................................. 61
Fig. 9: Relative POC release of samples with A. buetschlii and controls ......................... 62
Fig. 10: Amount of group specific PLFAs in soil aggregate samples ................................ 63
Fig. 11: Cumulative pore space diagram of macro-aggregate samples ........................... 64
Fig. 12: pF-bioreactor with its components ....................................................................... 74
Fig. 13: DNA conc. of phylogenetic classes and domains in SPsoil and SPair .................... 80
Fig. 14: Relative POC release of the variants SPsoil, SPair, SPcontrol ................................... 82
III
List of tables
Table 1: Collection of frequently used and/or promising methods for aggregate stability
measurement ........................................................................................................23
Table 2: Concentrations and molar masses of biofilm stabilizing macromolecules in
different environments ..........................................................................................35
Table 3: Variables, that are used for the calculation of enzyme units needed for biofilm
target decomposition ............................................................................................38
Table 4: Specific scenario parameters of the enzyme treatments .....................................39
Table 5: List of group specific PLFAs used in the present study .......................................58
Table 6: Target classes and domains, appropriate primer pairs, annealing temperatures
(AT) and standard organisms for qPCR ...............................................................76
Table 7: Applied primer sequences for class- and domain-specific qPCR ........................76
Table 8: Measured eubacterial class DNA of SPair and SPsoil variant in relation (%) to total
eubacterial DNA ....................................................................................................81
IV
Advertisement
Abbreviations
Abbreviation Full term
Å Ångström (0.1 nm)
AMF Arbuscular mycorrhizal fungi
ANOVA One way analysis of variance
ARW Artificial rainwater
C Carbon
COM Colloidal organic matter
CPOM Co-precipitated organic matter
DNA Deoxyribonucleic acid
DOM Dissolved organic matter
eDNA Extracellular DNA
EEG Easily extractable glomalin
EPS Extracellular polymeric substances
Eub Eubacteria(l)
FID Flame ionization detector
fwd Forward (Primer)
GRSF Glomalin related soil fraction
fLF Free light fraction
GC/MS Gas chromatography/mass spectroscopy
GRSP Glomalin related soil protein
HF Heavy fraction
IREEG Immonoreactive easily extractable glomalin
LF light fraction
MOM Mineral-associated organic matter
MWD Mean weight diameter
N Nitrogen
oLF Occluded light fraction
OC Organic carbon
OM Organic matter
PCR Polymerase chain reaction
PDA Potato dextrose agar
PLFA Phospholipid-derived fatty acids
POC Particulate organic carbon
POM Particulate organic matter
qPCR Quantitative real-time PCR
R2A Reasoner's 2A growth medium
rev Reverse (Primer)
rpm Rounds per minute
SOC Soil organic carbon
SOM Soil organic matter
SPT Sodium polytungstate
Su3 Silty sand (Bodenkundliche Kartieranleitung, 2005)
TEM Transmission electron microscopy
U Enzyme unit (conversion of 1 µmol substrate per minute)
UDF Ultrasonication/density fractionation
UV Ultraviolet
WSA Water stable aggregates
V
Acknowledgements
I am deeply grateful to
our laboratory assistants Claudia Kuntz, Kotan Yildiz, Maike Mai, Monika Rohrbeck,
Ruth See, Sabine Dumke and Sabine Rautenberg
Prof. Martin Kaupenjohann, who supervised this work
Prof. Ulrich Szewcyk for the unbureaucratic possibility to use the laboratories of the
chair of environmental microbiology
the helpful staff of the chair of soil protection (TU Berlin)
Prof. Liliane Rueß for her knowledge about nematodes
Dr. Peter Lentzsch and M.Sc. Philip Rebensburg for their perseverance
M.Sc. Patrick Reger and B.Sc. Lara Schneider for their theses and our former
students Marcus Bork, Kathrein Fischer, Christine Hellerström, Katja Jung,
Annabelle Kallähne, Paula Nitsch, Susann-Elisabeth Schütze, Anne Timm and
Karolin Woitke for their help in soil sampling, preparation and pre-trials.
Tom Grassmann for his enthusiasm to explain me how to handle R
the Leibnitz-Gemeinschaft who financially supported this project (SAW Pact for
Research, SAW-2012-ATB-3)
and all the people, who have been patient with me talking again and again about
soil aggregates and bacterial slime between primary particles.
They all were responsive and kind to help me each time I had problems or need for
discussion.
VI
Advertisement
Abstract
Soil aggregate stability is an integral marker of soil fertility. Well aggregated soil contributes
to high rootability, a proper water and aeration regime, resistance against compaction and
erosion as well as storage capability of organic carbon. The aggregation of soil primary
particles and microaggregates is promoted not only by a large variety of physico-chemical
but also biological interactions, that are based on e.g. the excretion of bacterial
extracellular polymeric substance (EPS) or fungal glomalin, concretion of biomineralization
products or adsorption of hydrophobic cell debris on soil particle surfaces. Hence,
microbial growth, exudation and grazing of bacterial-feeding organisms on sessile
prokaryotes most living within a viscouse EPS matrix (biofilms) are assumed to play a
regulating role in the occlusion of POM within soil aggregates. In consequence, microbial
communities would have physical influence on organic matter cycling e.g. in agricultural
soils.
In the present doctoral thesis, a sandy agricultural soil was treated with EPS degrading
enzymes, the bacterial feeding nematode Acrobeloides buetschlii or two different non-
converging microbial communities. After these treatments, respective changes of POM
occlusive strength were measured.
Results show no or little influence of microbial communities living in pores above the lower
mesopore scale (~10 µm) on the POM occlusive strength, whereas the applied methods
were not suitable to affect organisms within smaller pores. If there is a markable stabilizing
effect of microbial processes, it is located within the finer mesopores as indicated by
current literature. The present work highlighted this indication from a new point of view.
Future research should focus on the role of EPS as an aggregation agent within small
mesopores.
VII
Zusammenfassung
Die Aggregatstabilität in Böden ist ein integrales Merkmal von Bodenfruchtbarkeit. Gut
aggregierter Boden unterstützt Durchwurzelbarkeit, Wasser- und Luftversorgung, die
Widerstandsfähigkeit gegen Verdichtung und Erosion sowie seine Fähigkeit organischen
Kohlenstoff zu speichern. Zur Aggregierung von Primärpartikeln und Mikroaggregaten trägt
eine große Vielfalt nicht nur physico-chemischer sondern auch biologischer
Wechselwirkungen bei, die z.B. auf die Ausscheidung bakterieller extrazellulärer polymerer
Substanzen (EPS) oder pilzlichen Glomalins, auf Biomineralisationsprodukte oder die
Adsorption hydrophober Zellfragmente an Bodenpartikel zurückgehen. Daher kann
angenommen werden, dass mikrobielles Wachstum, Exsudation und die Beweidung
sessiler Prokaryoten, von denen die meisten in einer viskosen EPS-Matrix leben (Biofilm),
einen regulierenden Einfluss auf die Stärke der POM-Okklusion in Bodenaggregaten
haben. Folgerichtig hätten mikrobielle Gemeinschaften einen physikalischen Einfluss auf
den Kohlenstoffkreislauf z.B. in Ackerböden.
In dieser Arbeit wurde sandiger Ackerboden mit EPS-verdauenden Enzymen, der auf
bakteriellen Biofilmen weidenden Nematodenart Acrobeoloides buetschlii sowie
verschiedenen nicht konvergierenden mikrobiellen Gemeinschaften behandelt. Nach der
Inkubation wurde die jeweilige Veränderung der POM-Okklusionsstärke gemessen.
Die Ergebnisse zeigen wenig bis keinen Einfluss der im oberen Mesoporenbereich
(< 10 µm) lebenden microbiellen Gemeinschaften auf die POM-Okklusionsstärke, während
die verwendeten Methoden nicht geeignet waren, Organismen in feineren Poren zu
erreichen. Sofern ein bedeutender stabilisierender Effekt durch mikrobielle Prozesse
existiert, ist dieser im unteren Mesoporenbereich verortet, wie in der aktuellen Literatur
angedeutet wird. Diese Arbeit hebt jenen Effekt aus einem neuen Blickwinkel hervor.
Zukünftige Arbeiten sollten ihren Fokus auf die Rolle von EPS als Aggregierungsmittel im
unteren Mesoporenbereich legen.
VIII
Related document tools
Prepare academic work with more confidence
Plag helps editors, students and researchers review originality signals. Identific can help confirm that document-related processes are easier to manage. Together, they help make academic review more transparent.
Soil microbial communities and POM occlusion
1 General introduction
1.1 A short scientific history of aggregate
structure and genesis
For nearly 90 years soil structural stability gained attention in research on soil properties.
Early works concerning “soil friability”, “soil consistency” and “soil aggregate stability” were
aimed at a more precise assessment of soil plowability for the enhancement of plant
production (Russell, 1928; Christensen, 1930). In the following decades, soil aggregate
stability attained increasing importance as positive condition for plant growth and
resistance against soil compaction e.g. by large agricultural machinery (Rosenberg, 1964).
In some of the first trials focusing on aggregates, the crushing strength of dry soil
aggregates was determined by Martinson et al. (1950), and Greacen (1960) provided
evidence for increasing plastic deformation in soil aggregates with increasing water
content leading to reduced aggregate stability.
In a cutting-edge work Edwards and Bremner (1967a) postulated, that large soil
aggregates (>250 µm) are composed of smaller aggregates, which again are formed by
mineral and organic primary particles and molecules. With the underlying experiment the
authors could show, that small mechanical stress leads to disaggregation of large soil
aggregates, whereas aggregates <250 µm have a higher structural resistance, which is,
however, reduced by the removal of polyvalent cations and oxidation of water-insoluble
organic substance. Edwards and Bremner (1967a) postulated, that microaggregates are
stabilized by clay-humus interaction and are bricks of less stable macroaggregates. This
hypothesis became the foundation of later works about aggregate stability and structure.
From another point of view, based on a “theory of statistical brittle fracture”, Braunack et al.
(1979) hypothesized a decreasing stability of soil aggregates with increasing volume. If
mechanical stress reaches a critical level, the structure of a soil volume element is no
longer able to deflect forces (e.g. by plastic deformation) and thereupon cracks in its
weakest flaws. As large aggregated soil volumes statistically contain more weak points,
their stability would be reduced compared to smaller volumes. The resulting proportional
1
Advertisement
Frederick Büks (doctoral thesis 2017)
correlation between aggregate volume and susceptibility to mechanical stress was found
for soils observed in the named study.
The observations support a model of Dexter (1988), that proposes larger aggregates to be
built of interlaced even smaller aggregates down onto the level of primary particles. In this
aggregate hierarchy model aggregates of a higher order do not only contain aggregates of
lower order but also interjacent voids (and flaws) so to speak smaller aggregates
exclude voids of the higher hierarchy level. This “porosity exclusion principle” was
supposed to lead to a lower stability of aggregates with high porosity (mostly large
aggregates) compared to such with low porosity.
Oades and Waters (1991) fortified the hypothesis of an aggregate hierarchy (Fig. 1) in face
of mechanical stress. They could show, that in one group of soil types successively
enhanced mechanical stress first leads to a fracturation of larger and than finer aggregates
(hierarchical behavior). Surprisingly, another group of soil types mainly stabilized by
inorganic components (Tisdall, 1996) shows an increasing fracturation of aggregates of
all size-classes with increasing mechanical stress pointing to an absence of aggregate
hierarchy. In addition, the authors could show differing structural and chemical composition
in differently sized aggregates: In hierarchical soils larger aggregates contain a higher
content of organic matter (OM) and a higher C:N ratio than small aggregates, whereas
non-hierarchical soils do not show any differences between aggregate sizes. Furthermore,
electron microscopic pictures of aggregates <200 µm in diameter show cores of plant
debris, whereas aggregates <90 µm contain increasingly degraded POM or voids instead.
Aggregates <20 µm miss nearly any POM and have a low C:N ratio.
These results motivate a classification into macro-aggregates (>250 µm), micro-
aggregates (<250 µm) and “small” microaggregates (<20 µm) (Tisdall, 1996): Smallest
sub-units <0.2 µm are composed of flocculated clay particles or associations of clay
particles, that are linked to humic substance by polyvalent cations. Those sub-units are
aggregated in association with silt particles, partly humified bacterial debris and bacterial
colonies, hyphal fragments and mineral incrustations. They contain nearly any POM but
molecular organic matter of bacterial origin. Such smaller aggregate structures can be
reasonably summarized to a class of “small” microaggregates <20 µm and are
characterized by a high stability in face of rainfall, tillage and ultrasonication. In contrast,
2
Soil microbial communities and POM occlusion
microaggregates of diameters between 20 and 250 µm build up another structural class.
They are composed of “small” microaggregates, that are linked and embedded by the
chemical components listed above. But in addition, occlusion of small POM, which has a
lower degree of decomposition than the molecular OM, increases the C:N ratio. These
larger microaggregates are not stable in face of ultrasound. Within these aggregates, the
grade of degradation of POM as well as water stability increase with decreasing aggregate
size. The excretion of macromolecular EPS by inhabiting bacteria is assumed to play a
role in whole microaggregate stabilization (Chenu and Stotzky, 2002).
In most agricultural soils, macroaggregates (>250 µm) consist of microaggregates.
Although physico-chemical interactions play a linking role at the contact points of
contained microaggregates, wrapping by fine roots, fungal hyphae and bacterial
pseudomycelia are supposed to be important for macroaggregate stabilization (Molope et
al., 1987; Six et al., 2004; Chenu and Cosentino, 2011). However, these aggregates are
more water-labile than microaggregates and highly prone to mechanical stress. In
contrast, non-hierarchical aggregates >250 µm react very differently: As Oades and
Waters (1991) found for Oxisols, the whole macroaggregates are stable in face of high
mechanical stress. This can be explained by both a dominance of mineral interactions
(Oades and Waters, 1991) and a statistical lack of porosity exclusion (Dexter, 1988).
Based on data of the chemical composition of hierarchical and non-hierarchical
aggregates (Oades and Waters, 1991), aggregate hierarchy gained a new level of
complexity: Like formally supposed by Edwards and Bremner (1967a) and Dexter (1988),
hierarchy in face of mechanical stress is attended by specific geometric and chemical
properties. In consequence, flaws are not randomly distributed within the aggregate but
theoretically predictable.
As, on the one hand, there is a shared understanding about aggregate structure, two
fundamentally different but not contradictory theories about aggregate genesis are under
consideration. In the first mechanistic model (Tisdall and Oades, 1982), aggregate
formation appears ascending from associations of clay particles, organic matter and
polyvalent cations, that build minor aggregates, interspersed with additional mineral
components and microbial exudates. These secundary particles aggregate to
microaggregates of 20 to 250 µm and finally form macroaggregates. In contrast to
3
Advertisement
Frederick Büks (doctoral thesis 2017)
microaggregates, which are mainly stabilized by physico-chemical interactions,
macroaggregates stick together by biological entanglement. In the second model (Jastrow,
1996), macroaggregates of mineral and organic primary particles form around an
particulate organic core. The following “consumption” of the macroaggregate, consisting of
microbial decomposition and desintegration of the core and the excretion of metabolic
products, lead to regions of stable physico-chemical bonds between organic and mineral
particles and to the formation of more stable microaggregates within the macroaggregate.
This mechanism was confirmed by Gale et al. (2000). Both the ascending and the
consuming aggregate formation most likely appear together in a dynamic soil system (Six
et al., 2000), as minor microaggregates could take part in macroaggregate formation
around organic cores and consumed macroaggregates dissociate to microaggregates
which in turn could assemble to macroaggregates by means of biotic enmeshment.
4
Soil microbial communities and POM occlusion
1.2 Soil aggregation
1.2.1 Binding mechanisms within soil aggregates
In conclusion of the previous chapter, most soils have an aggregate hierarchy regarding
destructive stress, which reflects the physico-chemical properties of the soil and hence soil
performance. Soil aggregates are composed of manifold components that influence these
physico-chemical properties. Silicates of the sand, silt and clay fraction, oxides and
hydroxides of Fe, Al and Mn, phosphates and in (semi)arid soils carbonates are the
major inorganic constituents (Bronick and Lal, 2005). Beside biological structures like
bacterial colonies, bacterial pseudomycelia, fungal hyphae and roots (Six et al., 2004), the
organic fraction within soil aggregates comprises molecular and precipitated organic
components like humins, cell exudates and decomposed products as well as particulate
organic matter including detritus and black carbon (Bronick and Lal, 2005; Brodowski et
al., 2006a; Lützow et al., 2006). The interaction of these components is supposed to play
different roles on soil aggregation depending on the hierarchical level. A current model of
aggregate geometry based on the following binding mechanisms is pictured in Fig. 3.
Physico-chemical interactions
As suggested by Edwards and Bremner (1967a), aggregation of primary particles is
mediated by organo-mineral interactions: Clay-humus complexes linked by polyvalent
cations are supposed to play a fundamental role in the formation of smallest aggregates
(<20 µm), since after oxidation of organic matter the removal of polyvalent cations leads to
a total dispersion of clay soils. However, there is a broad range of physico-chemical
mechanisms linking primary particles and molecules. Permanent and variable surface
charge of clay minerals, metal oxides and hydroxides as well as variable charge of POM
cause adsorption of charged organic and inorganic fractions. Multivalent cations with small
hydrate shells like Ca2+, Fe3+ and Al3+ increase the aggregate stability by coagulation of
clay mineral particles, whereas low charged small cations with a large shell take effect in
opposite direction. Furthermore, high charged cations mediate bindings between organic
molecules and clay, especially clay-humus complexation, or further negative charged
surfaces like those of metal oxides and hydroxides. Organo-metallic complexes of Fe3+
and Al3+ with DOM precipitate at low pH. Precipitates of slightly soluble minerals like Fe3+
5
Advertisement
Frederick Büks (doctoral thesis 2017)
and Al3+ hydroxides and Ca2+ phosphates cause cementation of primary particles and
microaggregates due to coating and increase the aggregates' shear resistance. Under
(semi-)arid conditions, readily soluble minerals like calcium or magnesium carbonates
show the same effect. (Bronick and Lal, 2005)
Although found to be an important agent of soil aggregation, humic substance is an
extensive and vague term including a broad range of organic matter coming from highly
different metabolic pathways. Among various SOM from decomposing processes,
macromolecular exudates of bacteria, archaea, fungi and plants play a major role in
aggregate stabilization (Traoré et al., 2000; Chenu and Cosentino, 2011). These exudates
and other biological binding agents are in focus of the following sections.
Biochemical interactions I: Bacterial extracellular polymeric substances (EPS)
Slipping on stones on a river bank, complaining about mucus of a severe cold, marveling
about colorful microbial mats in volcanic hot springs and being pleased about the efficacy
of biological waste water treatment we are faced to the wide abundance of bacterial
biofilms (Costerton et al., 1995). Bacteria represents approximately 1/3 of the biomass in
soil ecosystems (Foster, 1988). It is supposed, that most of these bacteria live on surfaces,
protected by a matrix of homemade extracellular polymeric substance (EPS), making
these so called biofilms an ubiquitous mode of procaryotic life (Davey and O'toole, 2000).
Using histochemical staining, Foster (1988) showed intra-aggregate bacteria in soil
protected within an EPS capsula. But also archaea, fungi and algae are able to produce
extracellular polymers (Lewin, 1956; Rillig, 2004; Fröls, 2013) and partly live in also
syntrophic communities with sessile bacteria (Riding, 2000; Wargo and Hogan, 2006;
Stams and Plugge, 2009).
Prokaryotic biofilms consist of up to 97% water (Zhang et al., 1998; Schmitt and Flemming,
1999; Pal and Paul, 2008). The dry mass is composed of 10 to 50% cell biomass and
50-90% EPS matrix components comprising polysaccarides, extracellular DNA (eDNA),
lipids, proteins, humic and low-molecular substances (Flemming and Wingender, 2010;
More et al., 2014). Especially polysaccharides and eDNA have a large influence on biofilm
viscosity and stability, but also proteins are known as stabilizing agent, while lipids show
hydrophobic interface effects (Flemming and Wingender, 2010).
6
Soil microbial communities and POM occlusion
Early works describe extracellular macromolecules with focus on capsule or slime
polysacchrides of bacteria (Stacey, 1947; Wilkinson, 1958). As investigated in recent
works, these extracellular polysaccharides comprise 40 to 95% of the EPS dry mass
(Flemming and Wingender, 2001), concentrations of about 169 to 401 µg g-1 dry soil with
high variations between soil types (Redmile-Gordon et al., 2014) and molecular masses
between 0.5x106 and 2x106 Da. They contribute to the viscosity of the moist extracellular
matrix by entanglement and mediate attachment of EPS and cells to surfaces. This effect
is enhanced by polyvalent cations (e.g. Ca2+), which link polysaccharide strands by
bilateral binding to hydroxy groups (-OH). (Flemming and Wingender, 2010)
Similar mechanisms underly the stabilizing effect of extracellular DNA (eDNA) on EPS
matrix viscosity (Flemming and Wingender, 2010; Das et al., 2013; Das et al., 2014).
Extracellular DNA appears both exudated and released from lysed cells, is not
distinguishable from genomic DNA (Das et al., 2013) and has typical contents of 1 to 10%
of the dry EPS matrix (More et al., 2014), molar masses of 7.75x104 to 2.32x107 Da
(DeFlaun et al., 1987) and highly variable concentrations between 0.03 and 200 µg g-1 dry
soil depending on soil type and extraction method (Frostegård et al., 1991; Niemeyer and
Gessler, 2002; Agnelli et al., 2004; Pietramellara et al., 2009).
Extracellular proteins comprise two well known functional classes regarding biofilm
viscosity and structure. (1) Structural proteins provide specific binding sites and build
linkages among macromolecules (e.g. polysaccharides and eDNA) and with surfaces
(Flemming and Wingender, 2010). (2) Extracellular enzymes, on the other hand, work as
agents against other microorganisms, as metabolic enzymes or as instrument for
restructuring the biofilm matrix e.g. when adverse chemical gradients or a lack of nutrients
appeared (Donlan, 2002; Stewart and Franklin, 2008; Flemming and Wingender, 2010). As
it is impossible to extract these functional classes selectively, molecular data e.g. the
average share of 60% on the EPS dry mass with extrema of 75% (Jahn et al., 1999; More
et al., 2014) and concentrations in different soils of 43 to 163 µg g-1 dry soil (Redmile-
Gordon et al., 2014) – are potentially more widespread than only for extracellular structural
proteins.
Extracellular lipids are mainly biosurfactants and contribute to the attachment and
adhesion of cells to surfaces (Flemming and Wingender, 2010). Actually, lipids are not
7
Advertisement
Frederick Büks (doctoral thesis 2017)
numbered among macromolecules, since their molecular mass spans 750 to 1500 Da
(Abröll et al., 2008). However, lipids are major constituents of EPS dry mass (10%) (More
et al., 2014), whereas concentration data in soils were not found in the actual literature.
In contrast to polyvalent cations, polysaccharides, eDNA, proteins and lipids, little is known
about the function of humic substances within biofilms (Flemming and Wingender, 2010).
Furthermore, the collected data of extracellular macromolecules are rare (Fig. 2), partly
from non-soil ecosystems, contradictory and highly dependent on the extraction method
(Redmile-Gordon et al., 2014). Therefore they only allow rough estimations about the
abundance of EPS components in soil ecosystems.
The viscose biofilm habitat provides a bunch of protective, genetical and community
services for its inhabitants. In addition to adhesion and cohesion on surfaces, which is in
focus of the present work, manifold other functions are achieved by EPS capsulae. The
supply of a dehydration barrier, storage for organic and inorganic nutrients and an
extended extracellular space for catabolic activity, protection against disinfectants,
8
Fig. 2: Extracellular polysaccharides, DNA, proteins and lipids in soils with spans of molar masses,
concentrations in soil and shares in dry EPS. Data are yet rare and have to be specified to soil type and
extraction method in future research. (CCL by-nc-sa, Frederick Büks 2017)
Soil microbial communities and POM occlusion
biocides, antibiotics, oxidation stress, UV radiation, grazing organisms and immune
system cells as well as the fostered inter-cell communication, syntrophy and horizontal
gene transfer are just outstanding examples (Flemming and Wingender, 2010).
Mathematical modeling and foregoing investigations showed the biofilm matrix to be an
viscoelastic fluid, that is able to withstand mechanical forces (Klapper et al., 2002). Strong
adhesion of biofilm-occluded bacteria on surfaces in face of mechanical stress was
demonstrated by Böckelmann et al. (2003). As the growing biofilm within the narrow pore
space is connected to surfaces of different particles, interconnection between soil particles
most likely fosters soil aggregation. The direct mechanical contribution of biofilms to
aggregate coherence was shown in laboratory trials with artificial (Czarnes et al., 2000)
and native EPS (Geoghegan and Brian, 1948). However, a general and direct influence of
EPS on soil aggregation and the underlying regulatory processes are controversial. For
example, Martens and Frankenberger Jr (1992) and Tang et al. (2011) found aggregate
stability influenced by bacterial growth, but without direct attribution to microbial
polysaccharide production. Furthermore, the rheological properties of EPS strongly
depend on its chemical composition, which in turn is a result of microbial composition and
environmental conditions (Marty et al., 1992; jar et al., 1998; Steinberger and Holden,
2005; Simoes et al., 2007; Ayala-Hernández et al., 2008; Celik et al., 2008). However, in
cases of direct aggregate stabilization due to EPS, fixation of small organic particles within
microaggregates is conceivable. Even coarse POM might be occluded within attached
microaggregates and primary particles, leading to the assumption, that effective influence
of EPS on aggregate formation also have influence on POM occlusion.
EPS and bacterial habitats
Within the soil matrix bacteria appear in preferred habitats. As shown by Hissett and Gray
(1976), a majority of bacteria from sandy soils is located in or on POM with similar
abundances in further soils (Kerek et al., 2002). Kanazawa and Filip (1986) found, that
bacteria are highly abundant in coarse organic particles and the silt and clay fraction
<50 µm. In contrast, Chenu and Stotzky (2002) also reported dense bacterial growth and
attachment even on sand grains, which underpins the bacterial potential to colonize
surfaces of particles with various size and composition. However, Ranjard and Richaume
(2001) reviewed, that the majority of soil bacteria is located in the inner part of soil
9
Advertisement
Frederick Büks (doctoral thesis 2017)
aggregates, mainly in micropores <9 µm within microaggregates <100 µm in sandy soils
and within microaggregates <20 µm in clayey soils. Within these pores, single cells or
microcolonies normally do not fill the whole porespace to allow gas, water and nutrient
exchange (Foster, 1988). Probably as a result of mechanically induced reshaping of soil
structure, also micropores <1 µm were colonized by bacteria (Foster, 1988). Also Nunan et
al. (2003) analyzed porosity, bacterial population density and distribution in 30 to 40 µm
thin-cuts of cropped topsoil, fallowed topsoil and subsoil of a sandy agricultural soil. The
population density is reduced on the surface of inter-aggregate pores (>30 µm) and rises
towards the inner aggregate with increasing organic nutrient support. In addition to Foster
(1988), the authors found, that a decreasing nutrient support (cropped
topsoil > fallowed topsoil > subsoil) leads to a retreat of bacteria from the aggregate's core.
Higher population densities point to higher rates of growth due to increased nutrition, but
are very low, leading the author to assume a general lack of biofilms within sandy arable
soils. This interpretation could also be gathered from TEM pictures (Foster, 1988), but
strongly conflicts to established suppositions.
Beside surface properties of soil particles and taxonomic properties of the colonizers, the
spatial differentiation of bacterial densities is influenced by different factors as there are
accessibility of water, gradients of oxygen and nutrients as well as grazing pressure. Being
aquatic organisms, bacteria are restricted to saturated pores or water films on particle
surfaces (Chenu and Stotzky, 2002). Saturation is more likely given in smaller pores within
microaggregates than in draining mesopores. On the other hand, diffusion of nutrients and
metabolites is decreasing with pore size diameter, leading to low nutrient supply and
metabolite removal and hence decreased microbial growth rates within microaggregates
compared to larger mesopores (Chenu et al., 2001). Furthermore, within small pores
bacteria are protected against grazing. Predators such as large protozoa and grazers like
certain soil Nematodes are restricted to accessible pore space (Wallace, 1958), whereas
small predators such as amoebae, flagellates and small ciliates are able to enter the inner
pore space of soil aggregates (Vargas and Hattori, 1991). In consequence, bacterial-
feeding protozoa mediate a nutrient flow from the inner pore space to larger predators
(Bonkowski, 2004). In addition to spatial inaccessibility and EPS encapsulation, Hattori
(1970) showed strong adhesion of clay particles on E. coli in laboratory cultures. Thus,
10
Soil microbial communities and POM occlusion
bacterial cells and microcolonies can be surrounded by a coating of clay particles that
hinders predation and grazing (Chenu, 1995).
In consequence, soil bacteria basically show two different ways of interaction with
predators and grazers, which explain higher bacterial densities in microaggregates: (1) A
life in small pores around 10 µm within soil microaggregates, protected against drought
and feeding by spatial exclusion, clay-coating, EPS and taxonomic inedibility, but limited
by low diffusion of nutrients and metabolic products and therefore slowly growing in
established mature and stable biofilms. And (2) a life in larger pores, on surfaces of
aggregates and non-aggregated particles, with sufficient nutrient supply, able to dispose
metabolic waste, but highly susceptible to grazing, what results in high growth rates and
young biofilms (Chenu et al., 2001).
The composition of bacterial communities in different soil compartments is often analyzed
by use of ecotyping, performed with quantitative real-time PCR (qPCR). The taxonomic
level of class/phylum is assumed to be sufficient to depict changes of relevant ecological
processes and qualities in the soil, e.g. SOM cycling. (Von Mering et al., 2007; Fraser et
al., 2009; Philippot et al., 2010; Rousk et al., 2010)
Of known bacterial phyla, Gemmatimonadetes, Actinobacteria and Verrucomicrobia are
found to be mainly present in inner micro-aggregates (Kanazawa and Filip, 1986;
Drążkiewicz, 1994; Ranjard and Richaume, 2001; Mummey and Stahl, 2004; Mummey et
al., 2006). Other data show that Actinobacteria are also abundant or preferentially live in
outer parts of soil aggregates or on coarse organic particles (Kanazawa and Filip, 1986;
Drążkiewicz, 1994; Ranjard and Richaume, 2001; Mummey et al., 2006). Depending on
soil type, representatives of Firmicutes and Proteobacteria (e.g. α- and γ-Proteobacteria)
are suggested to prefer settling at the border between micro- and macroaggregates just
like Cyanobacteria or within the inner microaggregates (Ranjard and Richaume, 2001;
Mummey and Stahl, 2004; Mummey et al., 2006). Nitrifyers taken as a metabolic but not
a taxoniomic group are mainly found in the <20 µm fraction, but are hardly present in
macroaggregates (Lensi et al., 1995; Ranjard and Richaume, 2001), whereas Drążkiewicz
(1994) also found them to be abundant in macroaggregates. In contrast, Acidobacteria are
enriched within macroaggregates with decreasing abundance towards inner
microaggregates. This leads to the assumption, that they are loosely attached and play a
11
Advertisement
Frederick Büks (doctoral thesis 2017)
minor role in aggregate stabilization. Data on Bacteroidetes and Chloroflexi were too
sparse for evaluation (Mummey et al., 2006) and data on the distribution of other bacterial
phyla (Tenericutes, Chlorobi, Fusobacteria, Nitrospirae, Spirochaetes, Synergistetes,
Chrysiogenetes, Deferribacteres) as well as Archaea were not found. Furthermore, the
transfer of these single-moment results to the assessment of field trials has to be done
carefully, since the distribution of bacteria in soil is not static but changing with
environmental conditions (Fierer et al., 2003; Griffiths et al., 2003). However, due to a lack
of sufficient data about specific taxa and soil types, the relation of certain taxa to soil
aggregation processes and levels of the aggregate hierarchy is not sufficiently understood.
Aggregates scaffolded by filamentous microorganisms
On the macroaggregate scale, fine roots and hyphae grow into accessible pores and
thereby wrap microaggregates and primary particles. Both types of filaments produce a
coating of macromolecular exudates and cell wall components, e.g. polysaccharides, that
establish sticky links to the surfaces of adjacent particles. As a result, microaggregates
and primary particles are interconnected to macroaggregates by a sticky string bag of
roots and hyphae. The attachment of fine particles and precipitates cause an incrustation
of this bag. As physico-chemical links between microaggregates are weaker than such
within, this filamentous network significantly provides the formation of water-stable
macroaggregates and, in turn, disturbance of fungi and roots by tillage or chemical agents,
e.g. pesticides, lowers macroaggregate stability (Bossuyt et al., 2001).
As an additional mechanism, the growth-related pressure of hyphae and roots supports
aggregation of soil particles by relocation and compaction. Furthermore, especially
arbuscular mycorrhizal fungi (AMF) positively influence aggregation not only directly, but
also provides root growth due to fungi-plant symbioses (Miller and Jastrow, 1990). In
addition, fine roots and hyphae take up water and dry the adjacent soil, which enhance the
mechanical stability of soil aggregates. (Tisdall, 1996)
Compared to fungi, filamentous bacteria have 10-fold smaller hyphal diameters, but also
connect soil particles (Tiessen and Stewart, 1988). Actinobacteria are suggested to play a
role in microaggregate formation (Mummey et al., 2006). However, their influence on
aggregate stability and POM occlusion is unknown.
12
Soil microbial communities and POM occlusion
Biochemical interactions II: Fungal glomalin
In the last two decades, a macromolecular substance of fungal origin became a focus of
research on soil structure. This substance, Glomalin related soil protein (GRSP),
comprises a group of highly hydrophobic, strongly adhering and persistent glycoproteins
primarily produced by AMF (Wright et al., 1996; Rillig, 2004). Originally isolated as a target
of monoclonal antibodies for immunofluorescence detection of specific growing AMF
hyphae on roots (Wright et al., 1996), it shaped up as an only operationally defined group
of proteinaceous soil organic matter, that is coextracted with large excess of humic acids
(Schindler et al., 2007). A lack of knowledge about the relation of GRSP components and
functions recommends a broader denotation, e.g. glomalin related soil fraction (GRSF)
(Rillig, 2004).
The GRSF is suspected to play a role in soil aggregation. In an experimental study on a
variety of 37 soils across the United States and Scotland, Wright and Upadhyaya (1998)
demonstrated a correlation of glomalin concentration and stability of soil aggregates, that
saturates at >80% water stable aggregates (WSA). This relation was confirmed by other
surveys in different climate zones (Rillig et al., 2002; Bedini et al., 2009; Hontoria et al.,
2009; Spohn and Giani, 2010; Fokom et al., 2012; Wu et al., 2014). Furthermore, in a
comparison of different crop rotation systems, Wright et al. (1999), Wright and Anderson
(2000) and Fokom et al. (2012) found linear correlation between glomalin and aggregate
stability as well as a positive effect of non-tillage management on aggregate stability
compared to classical tillage. Wright et al. (2007) showed that the major part of GRSF in a
non-tillage agricultural ultisol is concentrated in the macro-aggregate fraction, whereas
treated soils contain most of their GRSF in the microaggregate and fine fraction. It was
also demonstrated that tillage decreases GRSF concentration in macro-, microaggregates
and fine material of agricultural ultisols compared with untreated soils (Wright et al., 2007).
This implies a correlation depending on agricultural practice. Deviating from that, in
samples of arid sandy/silty loam with stability mainly caused by high carbonate contents of
average 71%, positive correlation between glomalin and aggregate stability could not be
observed (Rillig et al., 2003).
These results imply that glomalin is preferentially accumulated in intact macro-aggregates
and AMF glomalin productivity is somehow related to aggregate stability. That could reveal
13
Advertisement
Frederick Büks (doctoral thesis 2017)
glomalin as a proxy but not necessarily as an agent of soil aggregation. Likewise
undisturbed fungal hyphae systems could produce more glomalin than those in tilled soils,
while merely stabilizing soil aggregates physically by entanglement and enmeshment
(Miller and Jastrow, 2000).
Results of Driver et al. (2005) showing >80% of GRSF (1.4 µg mg-1 mycelium) tightly
bound within the hyphal cell wall confirm glomalin as not being exudated, but rather being
integral part of AMF cell walls. Yet unexplored, its local function could encompass easing
of hyphal surface binding by increased hydrophobicity, decreased digestibility in face of
grazers or accumulation of cations (Gonzalez-Chavez et al., 2004; Driver et al., 2005).
Glomalin distribution in the soil matrix mainly appears by hyphal decay producing
fragments of approximately <5 µm (Wright and Upadhyaya, 1998). With given
concentrations of only 0.03 to 0.5 mg extraradical hyphae g-1 soil and hyphal average
turnover time of 5 to 7 days in pot experiments and laboratory cultures (Friese and Allen,
1991; Staddon et al., 2003; Zhu and Miller, 2003), GRSF concentrations of 1 to
21 mg g-1 soil amounting 3 to 10-fold the hot water extractable soil carbohydrates can only
be explained by high persistence and accumulation within the soil matrix (Wright et al.,
1996; Wright and Upadhyaya, 1998; Steinberg and Rillig, 2003; Zhu and Miller, 2003).
Although interactions of hydrophobic SOC with the soil matrix are expected to enhance
aggregate stability (Piccolo and Mbagwu, 1999), high aromatic and carboxyl as well as low
aliphatic group concentration measured by (Schindler et al., 2007) challenge the position
of glomalin as a hydrophobic substance. However, attached to hydrophobic chitin cell wall
fragments it could be immobilized and somehow act as hydrophobic aggregant.
Hydrophobe chitin-glomalin traces on particle surfaces could therefore support soil
aggregation by decreasing soil wettability and, in consequence, decrease decomposability
of organic surfaces, enhance aeration and cell attachment and provide sticking between
surfaces (Wright and Upadhyaya, 1998).
Previous results provide informations about the distribution of GRSF within soil
aggregates: The smaller proportion is located in AMF cell walls possibly playing a role in
hyphae-soil particle interaction (Driver et al., 2005). A distinctly higher concentration is
found in the soil matrix as a recalcitrant remain of hyphal turnover (Wright and Upadhyaya,
14
Soil microbial communities and POM occlusion
1998). Whether the latter is located around actual and former hyphal positions or evenly
distributed within the meso- and macropores of macro-aggregates is still unbeknown.
However, whereas GRSP is assumed to be hydrophobic and probably immobile, hyphal
wall fragments could be mobile or change their position relative to aggregate surfaces by
long-term reorganization of soil aggregates. In this case, an increasing equality of
distribution within the macro-aggregate can be assumed with increasing sequestration
time. After destructive soil treatment, GRSF is necessarily found in the micro-aggregate
fraction. Should the agglutinative effect of glomalin be proved, this pattern could elucidate
the high correlation of GRSF concentration and macroaggregate stability.
15
Advertisement
Frederick Büks (doctoral thesis 2017)
16
Soil microbial communities and POM occlusion
1.2.2 Carbon occlusion within soil aggregates
Nearly 1,500 Gt of organic carbon are stored in the first meter of global soils, which is
twice the atmospheric carbon stock (Lal, 2008a; Stockmann et al., 2013). Owing to this
enormous pool, the knowledge of decomposition and turnover rates of SOC is essential for
future predictions about the atmospheric CO2 content and SOC loss in consequence of
degradation due to land use or climate change.
The turnover rates of organic matter are strongly influenced by its stability in face of
chemical and biological decomposition (Schmidt et al., 2011). Although there are obvious
differences in the metabolization rate of different SOM under normalized conditions (e.g.
glucose versus lignin), fast decomposition of recalcitrant (Knežević et al., 2013) and
persistence of easily decomposable organic matter (Sollins et al., 1996) show that
degradability is not only an inherent factor of matter, but also depends on environmental
conditions like the metabolic capability of the grasping microbial populations (McGuire and
Treseder, 2010) or protection within the soil matrix (Six et al., 2002).
Soil aggregates contain approximately 90% of the total SOC, and up to 40% are located in
microaggregates (Lützow et al., 2007). Beside inherent recalcitrance of SOM, two
mechanisms are assumed to control the stabilization of SOM within the soil matrix: (1)
Molecular SOM is protected against microbial decomposition by the adsorption to charged
surfaces of silt and clay particles. (2) The occlusion within soil aggregates protects
particulate and molecular SOM against decomposition due to physical inaccessibility as
well as hindrance of nutrient and waste diffusion, which reduces microbial metabolic
activity. (Six et al., 2002)
The tremendous number of feedstocks and degradative pathways causes manifold soil
organic final and interstage products. However, physical pools of organic carbon - less
complex than chemical classifications comprise carbon from particulate organic matter
(POM), dissolved organic matter (DOM), mineral-organic associations (MOM) as well as
the minor researched fractions of co-precipitated organic matter (CPOM) and colloidal
organic matter (COM). These physical carbon pools represent different functions in the soil
ecosystem. Particulate organic matter mainly originates from above and belowground
plant debris and further fungal and animal fragments (Blume et al., 2015). It provides
17
Advertisement
Frederick Büks (doctoral thesis 2017)
surface for microbial colonization, nutrient source and structural function in soils (Bronick
and Lal, 2005). Molecular organic matter, which appears dissolved or adsorbed on
surfaces, is produced by bacteria, archaea, fungi and plants and enters the soil matrix via
exudation, cell break down, external input or extracellular enzymatic decomposition. It
appears to be an in part mobile microbial nutrient source (Marschner and Kalbitz, 2003),
but bound in mineral-organic complexes it shows reduced biodegradability and enhanced
contribution to soil microaggregation (Tisdall, 1996; Six et al., 2002; Edwards and
Bremner, 1967a). In addition, little is known about the appearance and behavior of
colloidal organic matter like bacterial cell wall debris, which is assumed to influence
hydrophobicity of soil mineral particles (Achtenhagen et al., 2015), and organic matter,
which is occluded within precipitated minerals (Eusterhues et al., 2008). These last two
classes are therefore excluded from further discussion in the present work.
Total SOM can be further subdivided into different C pools by means of its persistence,
which are linked to physical C pools (von Lützow et al., 2008): The active pool comprises
non-occluded residues, microbial biomass and other free SOM with turnover times
<10 years. The intermediate pool includes imperfectly decomposed POM from plant
residues and is protected by the occlusion within soil aggregates with turnover times of 10
to 100 years. Finally, the passive SOM pool mainly comprises decomposed molecular OM
strongly adsorbed to mineral surfaces and charred POM, which are thus protected for a
span extrapolated to >100 years.
The underlying model, that links persistence of different physical C pools and their status
within the soil matrix was supposed with varying accentuation by different authors and
includes different mechanisms of chemical longevity and protection (von Lützow et al.,
2008; Schrumpf et al., 2013; Lehmann and Kleber, 2015): Decomposition of plant and
animal residues result in a wide range of molecules with low to high molar masses as well
as POM, that have different decomposabilities depending on molecular structure and
surrounding microbial metabolisms, but no inherent, static recalcitrance. Stepwise
degradation towards smaller biopolymers, monomers and final mineralization with
reaction constants depending on the type of matter and biochemical steps to total
decomposition leads to a steady state equilibrium between more and less persistent
organic matter. The equilibrium is shifted towards longevity by the adsorption of both
18
Soil microbial communities and POM occlusion
particles and molecules of any size to mineral surfaces and occlusion within soil
aggregates. However, this protection is enhanced with decreasing particle and molecule
size, resulting in a high longevity of SOM in occluded mineral-organic associations.
Following Kalbitz et al. (2005), organo-mineral association is next to occlusion within soil
aggregates – the main protection mechanism against mineralization.
The persistence of organic matter from different functional pools is linked to specific
properties: High C:N ratios of 30.9±11.9 and 32.1±15.5 are related to free and occluded
particulate plant debris, respectively (Wagai et al., 2009; Cerli et al., 2012), whereas a low
C:N ratio of 13.5±4.6 found on the soil mineral matrix is more similar to C:N ratios around
9 related to microbial biomass (Cleveland and Liptzin, 2007; Wagai et al., 2009). In
consequence, a low C:N ratio indicates OM that is metabolized by fungi, bacteria or
archaea (OM of autotrophic prokaryotes excluded). Wagai et al. (2009) reviewed that the
C:N ratio of POM is positively related to the particle size and microbial activity as well as
negatively related to the grade of mineral coating, which underpins both an increased
degree of microbial decomposition of smaller particles and the protective function of
occlusion. High concentrations of carbohydrates represent both a very early state of
degradation of plant and animal debris as well as extensive storage of microbial
metabolites after OM decomposition (Poirier et al., 2005). This bipolarity can be solved by
analysis of polymerized monosaccharides: A decrease in the ratio of xylose (a mainly plant
derived sugar) to mannose (mainly microbial) indicates a microbial origin of OM (Oades,
1984). Likewise, increased aliphaticity points to increased degradation of SOM (Wagai et
al., 2009).
In conclusion, type and degree of SOM protection within soil aggregates are important
criteria for SOC storage and cycling. As particulate debris is the most important SOM feed,
the occlusion of POM as a first step of protection in an early stage of decomposition is an
important marker of turnover rates and C storage in soils.
19
Advertisement
Frederick ks (doctoral thesis 2017)
20
Soil microbial communities and POM occlusion
2 Measurement of aggregate stability
and C occlusion
2.1 The diversity of methods for aggregate
stability measurement
Earliest measurements of soil aggregation were largely performed using standardized dry-
and wet-sieving procedures (Yoder, 1936; Chepil and Bisal, 1943), which were frequently
adapted for the analysis of aggregate stability (Bissonnais, 1996; Wright and Upadhyaya,
1998; Seybold and Herrick, 2001). The underlying rationale of aggregate stability
measurement is to apply a distinct level of mechanical stress to a soil sample by shaking
in a sieve. The stress leads to disconnection of particles within the soil aggregate, that
depends on the strength of intra-aggregate binding forces. Weakly aggregated soils suffer
more reduction in secondary particle size, measured as mesh aperture, than stronger
aggregates. (Kemper and Rosenau, 1986)
Newer methods including water-dropping and ultrasonication share this principle of using
disaggregating forces (Farres and Cousen, 1985; Edwards and Bremner, 1967a).
However, both sieving and more recent methods require reference values to derive
aggregate stability from the post-treatment aggregation, e.g. the pre-treatment state, a
reference sample of a different or differently treated soil or the exact amount of applied
energy. Some frequently used and/or promising methods shall be shortly described in the
following (Table 1).
Dry-sieving in rotary sieves (Chepil and Bisal, 1943) and stacked sieves (Singh, 1952) is a
simple time- and material-saving method, which is used to date (Zhang, 1994; Rajaram
and Erbach, 1999). The human factor, which e.g. affects constant mechanical stress
generation, can be avoided by using machined sieving, but some important disadvantages
remain: The lab worker is not able to distinguish water-stable from water-labile aggregates,
which form during air-drying and increase the content of coarser aggregates (Beare and
Bruce, 1993). In addition, the analysis of fresh soil is restricted to lower water content to
avoid luting within the sieve. Furthermore, aggregate stability negatively correlates with
21
Advertisement
Frederick Büks (doctoral thesis 2017)
water content (Francis and Cruse, 1983; Beare and Bruce, 1993). Hence, compared to air-
dried aggregates fresh ones are reduced in their stability, and the reduced stability span
between stable and labile aggregates could therefore reduce the resolution of dispersion
measurement.
In contrast to dry-sieving, wet-sieving is conducted submerged. Although varying in mesh
size, number of sieves, amount of soil as well as movement axis, range and speed of
shaking (Kemper and Rosenau, 1986; Seybold and Herrick, 2001), all wet-sieving
procedures base on a scheme described by Yoder (1936). However, different re-wetting
methods affect the aggregate size distributions after wet-sieving (Beare and Bruce, 1993).
Some dry- and wet-sieving procedures are proposed by Kemper and Rosenau (1986),
Nimmo and Perkins (2002) and standardized in DIN/ISO (2002).
Alternatives to wet-sieving mainly used in early trials are the disaggregation by end-over-
end shaking (Oades and Waters, 1991) as well as the elutriation of soil aggregates within
a shaking tube and the further determination of aggregate sizes on the basis of
sedimentation layers and sedimentation time (Baver and Rhoades, 1932). Although this
method is simple, it provides dysfunctionality e.g. in face of fast-depositing particles
coarser than silt-size and is blind for differences in the bulk density of different aggregates.
However, it is functional for analyzing the disaggregation of microaggregates (Oades and
Waters, 1991).
Another class of methods comprises water-dropping on single soil aggregates in an
apparatus (Farres and Cousen, 1985) and artificial raining on soil beds (Barthes and
Roose, 2002) with measurement of the dispersive effects. Thereby, the quantification of
the applied energy was tried by integrating the kinetic energy of water drops with known
mass and height of fall (Marshall and Quirk, 1950).
The rupture-threshold approach, applied to single soil aggregates by Perfect and Kay
(1994), uses two parallel plates to provide a defined compression force to the interjacent
aggregate. This method allows to derive single aggregate stability from deformation up to
the point of rupture.
Strongly differing from methods involving mechanical stress is the estimation of aggregate
stability by means of a substance, which strongly correlates with aggregate stability in its
22
Soil microbial communities and POM occlusion
concentration. Wright and Upadhyaya (1998) found a correlation to aggregate stability
measured by mean weight diameter after wet-sieving for (freshly produced)
immonoreactive easily extractable glomalin (IREEG) and also easily extractable glomalin
(EEG) after autoclavation with 50 mM sodium citrate solution. Further experiments confirm
this relation (Wright et al., 1999; Wright and Anderson, 2000; Rillig et al., 2002; Wu et al.,
2014). Although this finding is not matured to a serviceable method, it has potential to be
used in qualitative comparison studies. However, it is most probably restricted to soils
getting their stability from organic compounds.
Table 1: Collection of frequently used and/or promising methods for aggregate stability measurement.
Method Restrictions Quantitative Exemplary reference
dry-sieving
(rotary sieves) no dist. between water-labile and -stabile
aggregates; restricted to lower water
content; susceptible to water content;
particles > silt size
no Chepil and Bisal (1943)
dry-sieving
(stacked sieves) no Singh (1952)
wet-sieving particles > silt size no Kemper and Rosenau (1986)
elutriation particles ≤ silt size no Baver and Rhoades (1932)
water-dropping applicable to single aggregates and
aggregates on surfaces yes Farres and Cousen (1985)
rupture-threshold
approach single or spatially separated aggregates yes Perfect and Kay (1994)
sonication needs calibration per each soil; needs
subsequent classification yes Edwards and Bremner (1967b)
glomalin only in soils with aggregate stability
dominated by organic agents no not yet applied
However, another currently preferred method for the mechanical disaggregation of soil
aggregates is the ultrasonication.
2.2 Measuring aggregate stability by use of
ultrasonication
Ultrasonication is a widely used method for the disaggregation of soil samples (Oades and
Waters, 1991; Lehtinen et al., 2014; Edwards and Bremner, 1967a). In the common
procedure (Kaiser and Berhe, 2014; Edwards and Bremner, 1967b), a pieco-electric
23
Advertisement
Frederick Büks (doctoral thesis 2017)
converter uses electric energy to generate axial vibration of a sonotrode, that is dipped into
a flask containing a submerged soil sample. The oscillating sonotrode emits shock-waves
within the aqueous medium. In front of the wave the medium is compressed, and the
increased pressure causes an increased gas solubility. Behind the wave the medium
relaxes below the normal pressure conditions leading to an explosive outgassing. This so
called cavitation effect produces lots of exploding micro-bubbles within the soil matrix
generating local pressure peaks of 200 to 500 atm accompanied by 4200 to 5000 K (Ince
et al., 2001), that provoke detachment of bondings within soil aggregates. Depending on
device type and settings, the vibration frequency can vary up to 10,000 kHz, but it is
recommended to use low frequencies around 20-100 kHz for soil aggregate dispersion
without influencing chemical composition of OM (Kaiser and Berhe, 2014).
In contrast to the methods mentioned above, ultrasonication allows semi-quantification of
aggregate stability without a reference sample, if the power output of the sonotrode (P) is
known. Its quantification take place by heating a known amount of water (mH20) in a Dewar
vessel with application of ultrasound for a certain time (t), represented by equation (1).
P=(mH20·cH20+CDewar)·ΔT
t+H
(1)
The increase in temperature (ΔT) is proportional to the heating time. As the Dewar vessel
is nearly thermally isolated (enthalpy flux H≈0) (North, 1976), has a heat capacity
CDewar<<(mH20·cH20) and the specific heat capacity of water is nearly constant between 298
and 318 K, equation (1) can be simplified to equation (2).
P=(mH20·cH20)·ΔT
t
(2)
However, in case of sonifying soils, this equation only describes the energy transmission to
the bulk of aqueous solution and soil, but not the ratio of heating the water, heating the soil
and stressing the soil by mechanical cavitation forces. This leads to an overestimation of
binding forces within the soil aggregates, when applied energy is claimed to work
24
Soil microbial communities and POM occlusion
completely cavitational. To reduce this overestimation, the specific dispersive power output
has to be distinguished from heating energy. If the same calibration is performed with an
additional amount of soil (ms) with a specific heat capacity (cs), the amount of dispersive
power (ms·L) is marked by a reduction in the heating rate of the solution and described by
equation (3).
P=(mH20·cH20+CDewar)·ΔT
t+ms·cs·ΔT
t+ms·L
t+H
(3)
As the specific heat capacity of the soil is also negligible (ms·cs <<mH20·cH20), the equation
can be simplified in accordance to equation (2) to
P=(mH20·cH20)·ΔT
t+ms·L
t
(4).
The ΔP between equations (2) and (4) relates to the effectively used cavitational energy.
Using this second calibration, a full-qualitative measurement of mechanical forces applied
to the soil matrix is possible (North, 1976). However, measurement of binding forces within
the soil aggregates remain semi-quantitative, as it is impossible to distinguish micro-
explosions treating particle links or surfaces.
Knowing the effective cavitational power, defined amounts of energy can be applied to soil
samples and the percentage of weight fraction smaller than a specific mean weight
diameter (MWD) can be plotted as a function of the applied energy, whereby steeper
gradients represent less stable soil aggregates (North, 1976). As cavitation bubbles have
diameters of maximum 100 µm (Crum, 1995) and expand in even the smallest soil pores,
ultrasonication is suitable for the disaggregation of both micro- and macroaggregates with
a broad span of stabilities. The resulting size-class distribution after treatment can be
determined e.g. by sieving and elutriation. In contrast to different wet-sieving methods,
using this method Graf-Rosenfellner (unpublished data) showed no significant differences
in disaggregation between different sonotrode types, which is known to be more effective
than a sonication bath (Edwards and Bremner, 1967a).
25
Advertisement
Frederick Büks (doctoral thesis 2017)
2.3 Measurement of C occlusion
Effective methods for the measurment of SOC functional pools comprise those of physical
fractionation by means of particle size or density as well as chemical extraction and
decomposition methods (Lützow et al., 2007). The present work focus on ultrasonication
with a subsequent density fractionation (UDF) to separate particulate non-occluded and
occluded as well as mineral-organic associated SOM.
The UDF is a frequently used method to analyze these soil carbon pools (Golchin et al.,
1994). For this purpose, soil samples are added to water or denser aqueous liquids to
perform floating of unbound organic matter, whereby centrifugation is used to accelerate
and improve the fractionation. Sodium polytungstate solution as a non-polluting, non-toxic
and reusable liquid facilitating a wide range of density cut-offs (1.0 to 3.1 g cm-³) is often
used for this separation (Six et al., 1999). The floating matter, that is separated without
mechanical destruction of aggregates, is operationally named free light fraction (fLF). The
sampling of fLF is followed by ultrasonication of the remaining soil leading to a
detachment, subsequent floating and separation of aggregate-occluded POM (oLF).
Repeating this procedure with constant or increasing energy leads to separation of organic
matter with increasing bonding strength to the mineral matrix. The OM remaining within the
sedimented after separation of all particulate organic matter is named the heavy fraction
(HF) and comprises mineral-associated organic matter. (Kaiser and Berhe, 2014)
The underlying method invented by Golchin et al. (1994) is used as a blue-print for diverse
surveys regarding e.g. organic carbon storage and SOM turnover (Baisden et al., 2002;
Crow et al., 2007), influence of land-use on carbon stocks (Tiessen and Stewart, 1983;
Meyer et al., 2012), carbon indicative or functional studies (Leifeld and Kögel-Knabner,
2005; Lützow et al., 2007) or further analyses of organo-mineral associations (Basile-
Doelsch et al., 2007). Those examinations often varied methodologically in the chosen
density cut-off, dispersion intensity, soil/liquid ratio, immersion depth of the sonotrode's tip
and other parameters and therefore lack comparability, as e.g. liquids of different densities
provide largely different fractionation of POM.
26
Soil microbial communities and POM occlusion
As UDF often plays a major role in studies about the ecological functionality of SOM
fractions, standardized parameters have to be chosen in a way, that operational fractions
match the functional C pools as accurate as possible:
In a first attempt to standardize this method for a wide range of soils, Cerli et al. (2012)
recommended a density cut-off of 1.6 g cm-³ even for the treatment of weakly aggregated
soils with low C content. SPT concentration <1.6 g cm-³ resulted in a decrease of OM in
the fLF, whereas concentrations >1.6 g cm-³ caused a sharp increase of the mineral
content. That characterizes ρ=1.6 g cm-³ as the cut-off avoiding both incomplete floating of
unbounded OM and contamination by OM from other functional pools, e.g. organic-mineral
associations.
However, in contrast to a density cut-off, a general energetic dispersion cut-off (J ml-1) for
the total dispersion of soil aggregates could not be specified as it strongly depends on the
soil type. This cut-off is theoretically bounded below by insufficient release of oLF and
above by disruption and floating of organic-mineral associations from the HF. Kaiser and
Berhe (2014) reviewed 15 studies using ultrasonication of soil aggregates in terms of
energy level for total dispersion of soil aggregates and avoidance of primary particle
destruction. They found destruction of POM at applied energy levels >60 J ml-1, destruction
of sand-sized primary particles at >710 J ml-1 and of coarse silt-size particles at
>1500 J ml-1, whereas clay-sized primary particles gain damage at energy levels
>12.000 J ml-1. The over-application of ultrasound not only causes rupture of mineral and
organic matter, but also chemical transformation of OM due to very local heat and
pressure peaks (Ince et al., 2001). These peaks result in OH and H reactions leading to a
decrease in amount, molar mass and aliphaticity of OM. This mechanism mainly
influences more volatile OM, whereas a change in chemical composition of mineral-
associated organic matter was not found (Kaiser and Berhe, 2014).
Based on these findings it is recommended to prove every examined soil in pre-trials with
increasing dispersion energy for the point of depletion of oLF to distinguish between
occluded POM and mineral-associated OM. Only in best cases these do not overlap with
the disruption of parts of the soil matrix (Cerli et al., 2012). This results in a trade-off
between complete extraction of oLF-POM and the avoidance of an intermixture of
functional C pools by destruction and redistribution of soil primary particles. As a reaction
27
Advertisement
Frederick Büks (doctoral thesis 2017)
to this trade-off, e.g. Kaiser and Berhe (2014) recommended a treatment to reduce those
artefacts, that uses stepwise ultrasonication with a cumulated energy density of 1000 J ml-1
at <40°C and low frequency ultrasound (20 to 100 kHz).
Beside these standardization problems, UDF exhibit some fundamental problems
regarding the identity of operational and functional C pools and the representation of the
latter by binding patterns and decomposition state. In a comparative study of 36 soils with
different vegetation and site characteristics, Wagai et al. (2009) found an oLF C:N ratio
increased compared to the fLF, which contradicts to the theory of occlusion accompanied
by biotic degradation. This is explained e.g. by the distribution of recalcitrant POM like
biochar particles, spores and pollen to both the fLF and the oLF. As ultrasonication is also
used to detach bacterial cells from surfaces (Böckelmann et al., 2003), it is further
possible, that the C:N ratio of the oLF is an artefact, as it is increased by the removal of
bacterial biomass, whereas mineral-associated OM of the HF is not affected by this
method.
Furthermore, Wagai et al. (2009) suggest, that also the surface/volume ratio of the POM
determines the classification as fLF or oLF: Small POM with a mineral coating could have
a bulk density of >1.6 g cm-³ rather than larger particles with a coating of the same material
and exemplary thickness. Thus, a sharp separation of both the fresh POM and the
colonized plus degraded POM is not possible due to an intermixture between fLF and oLF.
Soil dispersion using UDF is also affected by SPT. As sodium acts as dispersive agent on
negatively charged surfaces, dispersion efficacy depends on soil mineral composition and
decrease comparability of different soil types.
Anyway, the use of 1.6 g cm-³ and an appropriate dispersion cut-off allows a rough
separation of functional carbon pools along the bulk light and heavy fraction and a less
precise separation of free and occluded light fractions. Making a complete C balance of
functional pools does not only require a predetermined dispersion cut-off, but also the
measurement of water/SPT solution-extractable DOM when extracting the fLF (Kaiser and
Berhe, 2014). Furthermore, a standardized pre-treatment has to be used, as e.g. drying
and further pre-treatment steps shift the OC content from oLF to fLF compared to field-
fresh soil aggregates (Kölbl et al., 2005).
28
Soil microbial communities and POM occlusion
In contrast, the analysis of POM occlusive strength of one soil type after different
treatments can be executed by use of an arbitrary dispersion cut-off. Differing POM
release as reaction on mechanical stress can be interpreted as a change in occlusive
strength, but the explanatory power about functional pools is thereby omitted. However,
Cerli et al. (2012) demonstrated that the release of occluded POM caused by cavitational
forces strongly depends on content, composition and binding patterns of POM as well as
soil mineralogy. In consequence, the comparison of POM occlusive strength is restricted to
very similar soils, if soil specific dispersion cut-offs for the total and exclusive oLF
detachment are not determined or determinable.
29
Advertisement
Frederick Büks (doctoral thesis 2017)
3 Aim of this work
As most of the SOM is located in soil aggregates, its physical protection has large
influence on decomposition, turnover rates and the soil carbon budget of landscapes. The
present work was conducted on a plowed sandy topsoil (Su3) from a cropland near Berge
(Brandenburg, Germany) and focus on POM occlusion, since this protective mechanism
represents initial stages of SOM decomposition. Due to their influence on soil structure,
microbial nutrition and metabolic diversity in soils, the grade and strength of POM
occlusion could be a proxy for soil properties like soil fertility and soil health. The
interaction of soil microorganisms and soil particles, which is an important factor of soil
aggregation, is assumed to have significant influence on the occlusion of POM within soil
aggregates. This overall aussumption is tested in the present thesis.
In a first experiment, the influence of bacterial EPS on the occlusive strength of POM
within soil aggregates was examined. I hypothesized that POM is fixed to the mineral
phase by EPS. This hypothesis was tested by a treatment of soil aggregates with
increasing concentrations of EPS degrading enzymes, that should result in an additional
release of POM after mechanical treatment.
The second experiment focus on the influence of grazing organisms on POM occlusion. I
hypothesized, that feeding on EPS by the bacterial-feeding nematode Acrobeloides
buetschlii would result in an additional release of occluded POM compared to a control
without nematodes, when grazed bacterial biofilms and EPS remains lose their cohering
function between soil particles.
In a third work, I investigated the influence of structurally different microbial populations on
the POM occlusion. Based on the assumtion, that different communities provide different
sets of biochemical and physical mechanisms for aggregate stabilization, we expected
differing POM occlusion in two variants with strongly unequal microbial populations.
The overall aim of this work is to elucidate different aspects of the contribution of
microorganisms to the POM occlusion within sandy agricultural soils (stabilization,
variability with changing populations and feeding influence).
30
Soil microbial communities and POM occlusion
4 Enzymatic biofilm digestion in soil
aggregates facilitates the release of
particulate organic matter by sonication
4.1 Abstract
The stability of soil aggregates against shearing and compressive forces as well as water
caused dispersion is an integral marker of soil quality. High stability results in less
compaction and erosion and has been linked to enhanced water retention, dynamic water
transport and aeration regimes, increased rooting depth and protection of soil organic
matter (SOM) against microbial degradation. In turn, particulate organic matter is
supposed to support soil aggregate stabilization. For decades the importance of biofilm
extracellular polymeric substances (EPS) regarding particulate organic matter (POM)
occlusion and aggregate stability has been canonical because of its distribution, geometric
structure and ability to link primary particles. However, experimental proof is still missing.
This lack is mainly due to methodological reasons. Thus, the objective of this work is to
develop a method of enzymatic biofilm detachment for studying the effects of EPS on
POM occlusion. The method combines an enzymatic pre-treatment with different activities
of α-glucosidase, β-galactosidase, DNAse and lipase with a subsequent sequential
ultrasonic treatment for disaggregation and density-fractioning of soils. Particulate organic
matter releases of treated samples were compared to an enzyme-free control. To test the
efficacy of biofilm detachment the ratio of bacterial DNA from suspended cells and the
remaining biofilm after enzymatic treatment were measured by quantitative real-time PCR.
Although the enzyme treatment was not sufficient for total biofilm removal, my results
indicate that EPS may attach particulate organic matter (POM) within soil aggregates. The
tendency to additional POM release with increased application of enzymes was attributed
to a slight loss in aggregate stability. This suggests that an effect of agricultural practices
on soil microbial populations could influence POM occlusion/aggregate stability and
thereby carbon cycle/soil quality.
31
Advertisement
Frederick Büks (doctoral thesis 2017)
4.2 Introduction
Soil organic matter (SOM) comprises 50% (~1,700 Gt, including peat) of the near-surface
terrestrial carbon budget, compared to ~813 Gt bound in the atmosphere (Lal, 2008b).
Beside carbon storage and its influence on the atmospheric CO2 balance, manifold
ecological soil functions are mediated by different SOM types like dissolved organic matter
(DOM), particulate organic matter (POM), molecular organic matter of organo-mineral
associations, colloidal organic matter and coprecipitated molecular organic matter (Kalbitz
et al., 2000; Weng et al., 2002; Pokrovsky et al., 2005; Eusterhues et al., 2008). For
example, POM is a structural component of soil aggregates, a nutrient source and
provides surfaces for microbial growth (Chenu and Stotzky, 2002; Bronick and Lal, 2005).
Parts of the POM are occluded within soil aggregates (Six et al., 2002). Physical isolation
protects POM against microbial degradation (Six et al., 2002; Lützow et al., 2006) and
maintains its ecological functions, while on the other hand this POM is thought to promote
soil aggregation (Bronick and Lal, 2005). Therefore, many benefits of soil POM are linked
to soil aggregate stability.
The stability of soil aggregates against shear and compression forces (Skidmore and
Powers, 1982) as well as disaggregation caused by water (Tisdall and Oades, 1982) is an
integral marker of soil quality (Bronick and Lal, 2005). Since aggregate stability implies
pore stability, it results in less soil compactibility (Baumgartl and Horn, 1991; Alaoui et al.,
2011) and a more dynamic water transport regime in the macropores that reduces erosion
caused by surface runoff (Barthes and Roose, 2002). Other benefits in comparison to
compacted soils are a higher aeration (Ball and Robertson, 1994) and lower penetration
resistance (Bennie and Burger, 1988) causing increased rootability and rooting depth
(Bengough and Mullins, 1990; Taylor and Brar, 1991). In addition, micropores within the
aggregates enhance water retention.
The occlusion of POM within soil aggregates depends on the properties of the aggregated
components. The mineral part of the solid soil matrix is composed of siliceous sand, silt
and clay particles, oxides and hydroxides of Fe, Al and Mn as well as diverse minor
minerals. Sticking together, pervaded and coated with multivalent cations and organic
constituents (like soluble metabolic products, humic substances, black carbon and other
POM) macro-aggregates (>250 µm) are formed by direct coagulation or built of micro-
32
Soil microbial communities and POM occlusion
aggregates (<250 µm). (Bronick and Lal, 2005; Brodowski et al., 2006b; Lützow et al.,
2006)
The structure-bearing primary particles, precipitates and adsorbed molecules cohere by
physico-chemical interactions between (i) permanent charge of mainly the clay mineral
fraction, (ii) multivalent cations with small hydrate shells such as Ca2+, Fe3+ and Al3+, (iii)
variable charges of various minerals and SOM and (IV) variable and permanent dipoles of
different soil components. Also carbonates, phosphates and other microbial precipitates
force up aggregation and occlusion of POM. (Jastrow and Miller, 1997; Bronick and Lal,
2005)
In addition, since a few decades biological structures like bacterial colonies, bacterial
pseudomycelia, algae, fungal hyphae and their exudates (e.g. glomalin), roots as well as
soil fauna are accepted as a major factor of soil aggregation (Tisdall, 1991; Oades, 1993;
Wright and Upadhyaya, 1998; Brown et al., 2000; Chenu and Stotzky, 2002; Rillig, 2004;
Bronick and Lal, 2005). Furthermore the role of extracellular polymeric substance (EPS) of
bacterial biofilms as an adhesive between soil particles is seen to be of importance
(Baldock, 2002; Ashman et al., 2009).
Physical and chemical properties of
soil mineral and organic matter allow
to hypothesize a simple spacial
model of the inner geometry of soil
aggregates, that includes biofilms as
links between primary particles
(Fig. 4). The biofilm itself is a viscous
microenvironment mainly built up of
90 to 97% water (Zhang et al., 1998;
Schmitt and Flemming, 1999; Pal
and Paul, 2008). The remaining dry
mass contains differing ratios of
polysaccharides, extracellular DNA
(eDNA), proteins and lipids besides
10 to 50% cell biomass (More et al.,
2014). In contrast to 'biofilm', EPS
33
Fig. 4: Proposed model of inner soil aggregate structure
including EPS: Sand and silt (both grey) and organic
particles (black) stick together by physico-chemical
interactions and are bridged by EPS (striped), which
additionally stabilizes the soil aggregate structure and
the pore space (white). (Büks and Kaupenjohann, 2016)
Advertisement
Frederick Büks (doctoral thesis 2017)
terms the extracellular polymeric matrix excluding cells. Extracellular polysaccharides
cause the EPS structural stability by means of entanglement and Ca2+ bridging between
molecules. So does eDNA (Das et al., 2014). Proteins function as enzymes and structural
links stabilizing the polysaccharide matrix, while lipids act as biosurfactants for bacterial
attachment on surfaces. (Flemming and Wingender, 2010)
The composition of EPS is highly variable depending on community composition and
environmental cues (Table 2): Redmile-Gordon et al. (2014) measured a natural habitat
extracellular polysaccharide concentration of 401 µg g-1 dry soil in grassland and
169 µg g-1 in fallows. Diverse single- and multi-species biofilms show a proportion of
polysaccharides on dry EPS of up to 95% (Pal and Paul, 2008; More et al., 2014).
Different single- and multi-species biofilms in laboratory cultures and natural soils have a
dry EPS eDNA content up to 10% (More et al., 2014). For forest soils values of 1.95 up to
41.1 µg g-1 dry soil are known (Niemeyer and Gessler, 2002; Agnelli et al., 2004).
Extracellular DNA concentration of other diverse soils ranges between 0.03 and 200 µg g-1
dry soil (Niemeyer and Gessler, 2002; Pietramellara et al., 2009), whereas concentrations
in soils explicitly used for agriculture are unknown. Extracellular matrix protein
concentration was measured at 163 µg g-1 dry soil in grassland and 43 µg g-1 dry soil in
fallow (Redmile-Gordon et al., 2014), but can contribute the largest fraction of EPS dry
mass, e.g. 60% (More et al., 2014), and even up to 75% in P. putida biofilms in laboratory
cultures (Jahn et al., 1999). The typical proportion of lipids in the EPS dry-mass of different
non-soil biofilms amounts up to 10% (More et al., 2014). Sparse molar mass data from
different environments comprise 0.5x106 to 2x106 Da for polysaccharides (Flemming and
Wingender, 2010), 7.75x104 to 2.32x107 Da for eDNA (DeFlaun et al., 1987) and 750 to
1,500 Da for lipids (Munk, 2008).
The extracellular matrix is not only exuded by soil bacteria and archaea, but also by fungi
and algae. It is engineered by grazing protozoa and small metazoa as well as microbial
extracellular enzymes. (Battin et al., 2007; Flemming and Wingender, 2010)
The activity of EPS degrading enzymes in natural soils spans up to two orders of
magnitude: The α-glucosidase and β-galactosidase activity of various soils ranges from
0.00011 U g-1 to 0.0011 U g-1 and from 0.00017 to 0.0094 U g-1, respectively (Eivazi and
Tabatabai, 1988; Acosta-Martinez and Tabatabai, 2000). The lipase activity in coarse
mineral soils shows values from 0.3 U g-1 in a sandy soil (Cooper and Morgan, 1981) to
34
Soil microbial communities and POM occlusion
Table 2: Concentrations and molar masses of biofilm stabilizing macromolecules (polysaccharides=PS,
eDNA, lipids and proteins) in different environments.
Conc. Proportion Molar mass Comment Reference
µg (g soil)-1 µg (100 µg EPS)-1 Da
PS
169 µg g-1 bare fallow Redmile-Gordon et al. (2014)
401 µg g-1 grassland Redmile-Gordon et al. (2014)
95% % of EPS dry-mass More et al. (2014)
40-95% % of EPS dry-mass Pal and Paul (2008)
2x106Chenu and Roberson (1996)
0.5-2x106Flemming and Wingender (2010)
eDNA
2.2-41.1 µg g-1 forest soil Agnelli et al. (2004)
0.08 µg g-1 Luvisol Niemeyer and Gessler (2002)
1.95 µg g-1 forest podzol Niemeyer and Gessler (2002)
0.03-200 µg g-1 unnamed soil Pietramellara et al. (2009)
10% % EPS dry-mass More et al. (2014)
7.75x104-2.32x107estuarine and oceanic
environments
DeFlaun et al. (1987)
Lipids
10% % of EPS dry-mass More et al. (2014)
750-1500 Abröll et al. (2008)
Proteins
43 µg g-1 bare fallow Redmile-Gordon et al. (2014)
163 µg g-1 grassland Redmile-Gordon et al. (2014)
< 75% % of Ps. Putida biofilm Jahn et al. (1999)
60% % EPS dry-mass More et al. (2014)
2.09 U g-1 in a Luvisol (Margesin et al., 2000) and up to 5 U g-1 in a Leptosol (Margesin et
al., 1999). Data for eDNAse activity in soils are not available.
Not much is known about the contribution of EPS to POM occlusion and aggregate
stability in relation to other aggregate stabilizing factors. That is mainly due to
methodological reasons: Though e.g. Tang et al. (2011) showed a significant contribution
of bacterial growth on aggregate stability, the observations could not definitely be
attributed to soil microbial exopolysaccharide production. Redmile-Gordon et al. (2014)
subsequently found that the techniques previously used to measure extracellular
polysaccharides in soil co-extracted large quantities of random’ soil organic matter which
confounded estimates of EPS production. Owing to the widespread interest in the role of
biofilms on soil fertility, the objectives of this work are (i) to design a selective method for
35
Advertisement
Frederick Büks (doctoral thesis 2017)
enzymatic biofilm detachment with minor impact on other types of aggregate bonds and (ii)
to apply the method to an agricultural soil to provide indications of the influence of biofilm
cohesion on POM fixation, which is expected to contribute to aggregate stability (Six et al.,
2004).
The method combines a modified enzymatic pre-treatment (Böckelmann et al., 2003) with
α-glucosidase, β-galactosidase, DNAse and lipase, a determination of the DNA ratio of
sessile to suspended cells after enzymatic treatment and an ultrasonication of soil
aggregates followed by density-fractioning and soil organic carbon (SOC) measurement
(Kaiser and Berhe, 2014). The ultrasonication/density-fractionation separates SOC into
three operational solid fractions: non-occluded free light fraction SOC (fLF-SOC),
aggregate-embedded occluded light fraction SOC (oLF-SOC) and colloidal as well as
(macro)molecular SOC, which is not detachable from mineral surfaces by the chosen
fractioning method and subsumed under heavy fraction (HF-SOC) (Kaiser and Berhe,
2014).
We hypothesize that a destabilization of the EPS matrix occurs during enzymatic
treatment. This should result in an increased cell detachment from aggregates. We also
expect an increased fLF-SOC release from destabilized aggregates compared to the
control and a shift of the oLF-SOC ratio from higher to lower binding strength (represented
by ultrasonic energy levels) that is interpretable as alteration of soil aggregate stability.
4.3 Materials and methods
4.3.1 Soil properties and microbial biomass
Well aggregated silty sand (Su3) of a plowed topsoil from a cropland near Berge
(Brandenburg/Germany) was air-dried and sieved to obtain a particle size of 0.63 to
2.0 mm containing mainly macro-aggregates. The aggregates have a pHCaCl2 of 6.9, Corg of
8.7 mg g-1 dry soil and a carbonate concentration of 0.2 mg g-1.
To estimate the soil microbial biomass, first 8 x 10 g of soil aggregates have been adjusted
to 70 %vol soil water content and incubated for 70 h at 20°C in the dark to attain basal
36
Soil microbial communities and POM occlusion
respiration. Then, based on DIN EN ISO 14240-2 half of the samples were fumigated with
ethanol-free chloroform in an evacuated desiccator for 24 h, whereas the other half
remained untreated. Afterwards chloroform was removed and both halves were extracted
with 40 ml of 0.5 M K2SO4 solution by 30 min of horizontal shaking and filtered through
0.7 µm glass fiber filters. The DOC concentrations of all filtrates were measured by a TOC
Analyzer (TOC-5050A, Shimadzu). 176±22 µg microbial carbon g-1 dry soil (Cmic) were
derived from the difference between DOC concentrations of fumigated and non-fumigated
samples multiplied by a conversion factor of 2.22 (Joergensen, 1996). Soil bacterial
biomass was derived from Cmic as 352±44 mg kg-1 assuming 0.5 as a ratio of Cmic to total
cell dry mass (Bratbak and Dundas, 1984).
4.3.2 Detachment scenarios
Four degradative enzymes were selected on the basis of soil pH and the temperature used
for definition of the catalytic unit (Tdef): a-glucosidase from S. cerevisiae (Sigma-Aldrich,
pHopt 6 to 6.5, Tdef=37°C, product number G0660) hydrolyzes terminal a-1,4-glycosidic
linkages in polysaccharides as b-galactosidase from E. coli (Sigma-Aldrich, pHopt 6 to 8,
Tdef=37°C, product number G5635) does with b-glycosidic bonds. Lipase from porcine
pancreas (Sigma-Aldrich, pHdef 7.7, Tdef=37°C, product number L0382) splits fatty acids
from lipids via hydrolysis, but do not digest phospholipids, which are part of bacterial
membranes. DNAse I from bovine pancreas (pHdef 5, Tdef=25°C, product number D5025)
breaks the phosphodiester linkages between nucleotides of DNA as an endonuclease.
Proteases were not used because of their promiscuity and therefore incalculable influence
on the other applied enzymes.
Literature shows a wide range of target concentrations related to these enzymes in
different soils. As we do not know target concentrations of our soil (due to a lack of
extraction methods), we considered the largest published values (Table 2) of EPS content
(ξEPS
max )
and enzyme target dry mass contents
(ξtarget
max )
from literature. Further, as bacterial
dry mass
(ξcell
min)
and target molar masses
(Mtarget
min )
vary as well, here we choose the
minimum percentage and the smallest mass, respectively. These values conduce to a
“worst-case” point of view with a maximum of enzyme targets. Any other boundary
37
Advertisement
Frederick Büks (doctoral thesis 2017)
conditions such as ion activity, diffusion rates or metabolization of enzymes by soil
organisms were disregarded.
Calculated by Eq. (1)
Unittarget=ccell
qξEPS
maxξtarget
max msample
ξcell
min
Mtarget
min t
(1)
with variables listed in Table 3 and Table 4, sufficient enzymes were provided to digest the
expected EPS concentration in five scenarios: In the E1 scenario ccell was given by the
results of fumigation-extraction. In the E2 scenario a bacterial dry mass of 500 g m-2 in the
upper 30 cm is considered, which is assumed to be the maximum for middle and northern
European soils (Brauns, 1968). Supposing a soil bulk density of 1.4 g cm-3, a ccell of
1190.5 µg g-1 dry soil is given. Although the soil bulk density of the soil aggregate samples
is ~1.15 g cm-3, we decided to use the soil bulk density of the original soil, which is in the
normal range of sandy silk soil (~1.40 g cm-3) (Chaudhari et al., 2013). This is due to the
fact that biofilm populations are mentioned to be mainly located in soil aggregates (Nunan
et al., 2003) and accords to the “worst-case”-approach. The E3 scenario uses a 100-fold
excess (q=100, Table 4) of the enzyme activities applied in the E2 scenario, whereas the
E4 scenario contained the 2,820-fold, which is slightly higher than activities used in
Böckelmann et al. (2003). Enzyme-free samples (E0) were used as a control.
Table 3: Variables, that are used for the calculation of enzyme units needed for biofilm target decomposition
and scenario parameters, [a] More et al., 2014; [b] Pal and Paul, 2008; [c] Flemming and Wingender, 2010;
[d] Abröll and Munk, 2008; [e] DeFlaun et al., 1987.
[µg g-1] bacterial dry mass per g dry soil
q
[-] enzyme concentration multiplier
ξEPS
max
[-] maximum ratio of EPS dry mass per total biofilm dry mass
(
ξEPS
max=0.9[a]
)
ξtarget
max
[-] maximum ratio of enzyme target per EPS dry mass
(
ξpolysaccharides
max =0.95[b]
,
ξlipids
max =0.1[a]
and
ξeDNA
max =0.1[a]
)
msample
[g] sample mass
ξcell
min
[-] minimum ratio of bacterial dry mass per total biofilm dry mass (
ξcell
min=0.1[a]
)
Mtarget
min
[µg µmol-1] minimum molar mass of enzyme target
(
Mpolysaccharides
min =0.5 x106[c]
,
Mpolysaccharides
min =700[d]
,
MeDNA
min =7.75 x104[e]
)
t
[min] incubation time
38
Soil microbial communities and POM occlusion
Table 4: Specific scenario parameters of the variants E0, E1, E2, E3 and E4.
E0 E1 E2 E3 E4
ccell
[µg g-1 dry soil] 352 352 1191 1191 1191
q
[-] 1 1 1 100 2,820
Ualphaglucosidase
max
[U g-1 dry soil] 0.00000 0.00010 0.00034 0.03393 0.95683
[µg g-1 dry soil] 0.00000 0.00080 0.00272 0.27144 7.65464
Ubetagalactosidase
max
[U g-1 dry soil] 0.00000 0.00010 0.00034 0.03393 0.95683
[µg g-1 dry soil] 0.00000 0.00020 0.00068 0.06786 1.91366
Ulipids
max
[U g-1 dry soil] 0.00000 0.00754 0.02551 2.55102 71.93876
[µg g-1 dry soil] 0.00000 0.00038 0.00126 0.12551 3.59694
UeDNA
max
[U g-1 dry soil] 0.00000 0.00007 0.00023 0.02304 0.64973
[µg g-1 dry soil] 0.00000 0.00004 0.00012 0.01152 0.32487
4.3.3 Release of POM carbon
Fifteen g of air-dried soil aggregates were incubated in 5 replicates per scenario with
3.4 ml of highly concentrated artificial rainwater (ARW: 0.2 mM NH4NO3, 0.3 mM
MgSO4x7H2O, 0.5 mM CaCl2 x 2H2O, 0.5 mM Na2SO4, 15 mM KCl, pH 5.7) for 3 days at
20°C in the dark to establish basal respiration and avoid slaking in the following
preparation steps. After incubation 2.5 ml of ARW containing enzymatic units according to
Table 4 were added to the samples. By means of a following incubation at 37°C, enzymes
were let to work near their catalytic optimum for 1 h, which is proven to be sufficient for
biofilm degradation (Böckelmann et al., 2003). After this enzymatic pretreatment, 67.2 ml
of 1.67 g cm-3 dense sodium polytungstate (SPT) solution were added resulting in a
density cut-off of 1.6 g cm-3, and samples were stored for 30 min to allow SPT diffusion into
the aggregates. Then samples were centrifuged for 26 min with 3,569 G. Sodium
polytungstate solution with floating fLF was filtered through an 1.5 µm pore size glass fibre
filter to capture LF particles. Afterwards following Golchin et al. (1994) aggregate samples
were consecutively disaggregated in four steps by application of each 50 J ml-1 of
ultrasonic energy (Branson© Sonifier 250) for 1 min 15 sec. The energy output was
determined by measuring the heating rate of water inside a dewar vessel (Schmidt et al.,
1999). Every treatment cycle consisted of ultrasonication, centrifugation for 26 min with
3,569 G and filtering of SPT solution through an 1.5 µm pore size glass fibre filter to
capture the LF. Afterwards the LFs and the remaining soil matrix ('sediment', consisting of
oLF bonded >150 J ml-1 and the HF) were frozen, lyophilized, ground and dried at 105°C.
39
Advertisement
Frederick Büks (doctoral thesis 2017)
Total amount of fraction carbon was determined using an Elementar Vario EL III CNS
Analyzer and the absence of carbonates was proved, respectively.
4.3.4 Release of bacterial DNA
The release of bacterial cells into the solution was estimated by use of DNA extraction
using a FastDNATM SPIN Kit for Soil and quantitative real-time PCR.
Therefore 45 µl of ARW were added directly to 0.1 g of air-dried aggregates. The samples
were sterilely incubated in duplicate at 20°C for 3 days in the dark in a closed FastPrep
Lysing Matrix E tube during run to basal respiration. Then 30 µl of ARW containing
enzymatic units according to Table 4 were distributed equally to the aggregates' surfaces.
The samples were incubated for 1 h at 37°C in a heating block, cooled down on ice to
decrease enzyme activity and washed three times in 1 ml of ARW not by shaking but
gently rotating along the tube's longitudinal axis to separate detached and planktonic cells
from the soil matrix. Supernatants of all three washing steps were removed carefully with a
pipette, pooled and centrifuged at 13.000 G for 15 min at 4°C. Then the supernatant was
discarded, the pallet resuspended in 200 µl ARW and transfered to another FastPrep
Lysing Matrix E tube. Both soil and washing ARW samples were extracted and purified at
4°C following the FastDNATM SPIN Kit for Soil manual. All DNA samples were stored at
-20°C for further use. A direct subsampling from the aggregate stability experiment was
rejected due to its destructive capability regarding aggregates. Temperature, substrate, pH
and water content of the DNA experiment were similar to the incubation of samples for the
measurement of aggregate stability. Further differences (e.g. soil volume) were
disregarded.
Amplification of 10-fold diluted DNA samples was performed using a C1000 Touch Thermal
Cycler (BioRad). According to the reference for SG qPCR Master Mix (Roboklon)
thermocycling comprised an initial denaturation at 95°C for 10 min as well as 55 cycles of
15 sec of denaturation at 95°C, 20 sec of annealing at 49°C and 30 sec of elongation at
72°C. The reaction mix contained 1 µl PCR-H2O, 12.5 µl SG qPCR MasterMix, each
0.75 µl of a 20 µmol l-1 solution of the universal bacterial primers 63f
(5'-CAGGCCTAACACATGCAAGTC-3') and 341r (5‘-CTGCTGCCTCCCGTAGG-3‘)
(Muyzer et al., 1993; Marchesi et al., 1998) and 10 µl template DNA. Escherichia coli 16s
40
Soil microbial communities and POM occlusion
DNA solution containing 10,000 copies µl-1 was used as qPCR standard in steps of tenfold
diluted concentration from 106 to 102 copies µl-1.
4.3.5 Statistics
For evaluation of the light fraction SOC (LF-SOC) release, mean values as well as
standard deviations were calculated. Parallels of each variant were positively tested to
provide normal distribution and evidence of variance homogeneity (Shapiro Wilk test,
Levene test, both p>0.05, data not shown). One way analysis of variance (ANOVA) was
applied followed by Tukey test to clarify significant (p<0.05) differences in LF-SOC release
between variants of each energy level. Results of bacterial DNA release were presented
as duplicates.
4.4 Results
4.4.1 Release of POM carbon
The relative LF carbon release from soil aggregate samples after different enzymatic
treatments is shown in Fig. 5. The proportionate C of each captured fraction is defined as
Cfrac CΣ-1, in which Cfrac is the release of LF-SOC per energy level or in case of the
sediment the organic carbon remaining in the soil matrix. CΣ is the total SOC of all
separated LFs and the sediment. Averaging all treatments, around 79% of CΣ remain in the
sediment, whereas the bulk of LF-SOC is released as weakly bound oLF (50 J ml-1) and
fLF. Only around 4.5% of CΣ is detached at 100 J ml-1 and 150 J ml-1.
None of the enzymatic treatments altered the quantity of fLF-SOC released in the absence
of sonication (0 J ml-1). In contrast, visible differences to the control were shown for E1
(decrease, p=0.34) and E4 (increase, p=0.42) at mild sonication (50 J ml-1), whereas E2
(p=1.00) and E3 (p=1.00) are very similar to the control. The difference between E1 and
E4 was statistically significant (p=0.01) as indicated by the Tukey test, and the addition of
the highest enzyme concentration (E4) caused the release of about 63% more oLF-SOC
than occurred with the addition of the lowest concentration (E1). Released LF-SOC at 100
and 150 J ml-1 is not different among treatments. Only the E2 scenario shows any
41
Advertisement
Frederick Büks (doctoral thesis 2017)
tendency of increased oLF-SOC release at 100 J ml-1 compared to the other treatments
(p=0.07 compared to E3).
The sediment represents the SOC remaining unextractable at ≤150 J ml-1 and accordingly
shows a trend to decrease with increasing enzyme activity. In relation to the control, nearly
the whole alteration in the oLF-SOC releases of E1 and E4 at 50 J ml-1 as well as E2 at
100 J ml-1 comes from the sediment fraction, but hardly from the other LFs. However,
opposite reallocation of SOC between fractions due to converse physico-chemical effects
can only be observed in sum. Therefore alterations must be considered as net C transfer
between stability fractions.
Cumulating LF-SOC releases of all energy levels, E1 shows a reduction by 16% compared
to the control (3.3% of CΣ), whereas E4 was increased by 10% (2.2% of CΣ). The strongest
enzymatic treatment (E4) caused the release of about 58% (0.49 mg/g dry soil) more
cumulated LF-SOC than occurred with scenario E1.
42
Fig. 5: Relative POC release after treatments (E0, E1, E2, E3,
E4) at different energy levels (0, 50, 100, 150 J ml-1, sediment),
illustrated by Tukey test characters (a, ab, b). Data are shown as
mean values and standard deviations (n=5). (Büks and
Kaupenjohann, 2016)
Soil microbial communities and POM occlusion
4.4.2 Release of bacterial DNA
The relative DNA release after enzymatic treatment, as pictured with the treatments E0, E1
and E4 in Fig. 6, is defined as the ratio of extracted DNA from suspended bacterial cells
(DNAsusp) to the sum of DNA extracted from suspended and sessile bacterial cells and the
remaining EPS (DNAΣ) multiplied by 100. While there was no difference in relative DNA
release in the wash of control and low enzyme additions, treatment E4 caused an increase
to more than double the DNA content of either E0 or E1, which amounts to 5.6% of total
DNA. This increase is caused by both an increase in released bacterial DNA from
suspended bacterial cells and a decrease in eDNA remaining on washed soil particles.
43
Fig. 6: Relative bacterial DNA release from
soil aggregates after treatments E0, E1, and
E4 defined as 100x ratio of bacterial DNA
from suspended cells (DNAsusp) to total
bacterial DNA from suspended cells, sessile
cells (DNAΣ) and the EPS remaining upon the
soil matrix. (Büks and Kaupenjohann, 2016)
Advertisement
Frederick Büks (doctoral thesis 2017)
4.5 Discussion
We found that increasing the quantity of enzymes applied to aggregates led to increased
release of LF-SOC when aggregates were sonicated. This detachment is explained by the
following mechanism: The enzyme mix flows into the unsaturated pore space. From there
α-glucosidase, β-galactosidase, DNAse and lipase diffuse into the biofilm matrix, where
structural components like polysaccharides, eDNA and lipids are digested as approved for
diverse enzymes and enzyme targets in ecological and medical studies (Böckelmann et
al., 2003; Walker et al., 2007). We propose a simple spatial model to explain the observed
findings: The biofilm bridges gaps between organic and mineral primary particles,
connects them in addition to other physico-chemical bondings and builds a restructured
pore system inside the aggregate (Fig. 4). As macromolecular biofilm components yield
EPS as a viscoelastic structure (Sutherland, 2001), their digestion causes a loss in EPS
viscosity and thereby should reduce forces involved in the occlusion of POM. The effect is
expected to grow with increasing enzyme activity until the whole EPS matrix is dispersed.
In the following, LF-SOC is interpreted as SOC from released POM, since the share of
both adsorbed DOM and colloids on captured dry mass is considered to be negligible after
SPT treatment. Furthermore, LF-SOC transferred from the sediment fraction to light
fractions due to enzymatic treatment is also interpreted as POM, as in contrast mineral
associated organic matter of the HF is not assumed to be extractable at the applied
energies (Cerli et al., 2012).
In accordance with the model, measured oLF-SOC releases indicate a trend for increased
POM release with increasing enzyme addition (Fig. 5). The E4 scenario shows that relative
oLF-SOC release increased by 63% (5% of CΣ) compared to E1 at 50 J ml-1, but its release
is similar to the mean of the other treatments at 0 J ml-1, 100 J ml-1 and 150 J ml-1.
Noticeable deviations of E1 and E4 from the control do not match the usual significance
criteria (p<0.05). However, the increase of the relative oLF-SOC release in the E4 scenario
compared to the control is predominantly related to an equally lower C content of the
sediment but no decrease in the 100 J ml-1 and 150 J ml-1 fractions. That points to a strong
(oLF >150 J ml-1) intra-aggregate fixation of POM due to enzyme targets, which is
weakened by enzymatic treatment.
44
Soil microbial communities and POM occlusion
The relation of LF-SOC release with enzymatic biofilm digestion is supported by the
comparison of bacterial DNA releases between the treatments (Fig. 6). This indicates that
applied enzymes are targeting biofilm components and release bacterial cells: The E4
scenario shows EPS digestion and additional cell release leading to a doubled relative
DNA release compared with the control and E1. However, considering that most of the soil
bacteria are expected to live in biofilms (Davey and O'toole, 2000), the total DNA release
of only 5.6% in the E4 scenario is too low for total biofilm digestion. Hence, biofilm
detachment caused by E4 is still likely to be incomplete and the increased oLF-SOC
release of E4 only results from a partial soil biofilm detachment. We conclude a slight
influence of enzymatic treatment on the occlusion of POM at enzyme concentrations
exceeding natural concentrations. This conforms to results of Böckelmann et al. (2003),
which indicate that a treatment with enzyme concentrations of near that of E4 is sufficient
to destabilize biofilms within 1 hour.
The incomplete biofilm detachment can be explained by the reduction of enzyme activity
due to interaction with the soil matrix. Based on our calculations enzyme concentrations of
mix E1 should have been sufficient for total biofilm digestion within time of application (1 h)
as far as there are no other factors reducing enzyme efficiency. As surveys of natural
soils show enzyme concentrations up to mix E3 (Cooper and Morgan, 1981; Eivazi and
Tabatabai, 1988; Margesin et al., 1999; Acosta-Martinez and Tabatabai, 2000; Margesin et
al., 2000), such factors might be reasonably assumed. After addition to the soil sample,
enzymes must enter the EPS matrix by diffusion. Therefore parts of the enzymes probably
do not reach the biofilm due to inhibited diffusion. Beside diffusion, sorption and
decomposition could play a major role in reducing enzyme efficiency. Whereas turn-over
rates of soil enzymes are not yet assessed, extended stabilization of active enzymes over
time on soil mineral and organic surfaces is reported (Burns et al., 2013). This mechanism
could explain immobilization of enzymes off the biofilm and high measured soil enzyme
concentrations from literature in face of still existing biofilms. After penetration of biofilms
(macro)molecules interfere with EPS components depending on molecular size, charge
and biofilm structure (Stewart, 1998; Lieleg and Ribbeck, 2011) which is strongly
influencing decay rates of enzymes. Due to these boundary conditions, quantification of
the relation of enzyme concentration and POM carbon release was not possible in this
work.
45
Advertisement
Frederick Büks (doctoral thesis 2017)
The trend for increased POM release with increasing enzyme addition was only broken by
the control treatment. Probably this could be explained by pre-incubation of soil
aggregates given 0.2 mM NH4NO3 and further addition of NH4NO3 with enzyme
application: Redmile-Gordon et al. (2015) proposed that low C/N ratios of substrates
available to soil microorganisms reduce cell specific EPS production rates, and may trigger
microbial consumption of EPS to acquire C for cell-growth, which could weaken the
biofilm. The observations leading to this proposed dynamic were also found by addition of
NH4NO3. In the present study, NH4NO3 was applied with all treatments including the control
(which also received no C from enzyme provision). The lowest C/N ratio in the control soils
may itself have sustained EPS consumption and repressed reconstruction of the EPS,
contributing to the higher than expected release of POM from the control soil with
sonication at 50 J ml-1 and the break in the trend for increasing POM release with
increasing enzyme addition.
Enzyme C in E1 to E4 could be used as microbial C source. The addition of C increases
the C/N ratio and has been shown to lead to soil aggregate stabilization (Watts et al.,
2005; Tang et al., 2011). Decay rates of enzymes in soil are unknown but needed for a
more accurate estimation of enzyme C as a fast energy and carbon source.
Under certain conditions POM carbon release is indicative for soil aggregate stability.
Generally, aggregate stability is characterized by determining the reduction in aggregate
size after application of mechanical force. The commonly used methods are dry and wet
sieving. However, the destruction of soil aggregates by ultrasonication has an advantage
over these methods, which is the quantification of the applied energy (North, 1976). It is
used for studying reduction of aggregate size (Imeson and Vis, 1984) as well as
detachment of occluded POM carbon (Golchin et al., 1994). Kaiser and Berhe (2014)
reviewed 15 studies using ultrasonication of soil aggregates in consideration of its
destructiveness to the soil mineral matrix and occluded POM. They found destruction of
POM at applied energy levels >60 J ml-1, destruction of sand-sized primary particles at
>710 J ml-1 and of smaller mineral particles at even higher energy levels. We used this
method of gentle POM detachment from soil aggregates to measure the oLF-SOC release
as a result of mechanical force and linked it to aggregate stability. Since Cerli et al. (2012)
have shown that the release of free and occluded light fractions strongly depends on soil
properties like mineralogy, POM content, composition and distribution, this method is
46
Soil microbial communities and POM occlusion
restricted to comparison of soils being similar in these properties. Having regard to this
restriction, the trend for increase of oLF-SOC release over increasing enzyme additions
demonstrates an alteration of soil aggregate stability.
Although our results give a slight evidence for the influence of biofilms on aggregate
stability, they have to be recognized with restrictions to full quantifiability: (1) The enzyme
concentration hypothetically needed to disperse the whole soil sample EPS matrix
depends on diverse boundary conditions like the concentration of enzyme targets,
environmental conditions such as pH, temperature as well as ion activity and delay factors
such as low diffusion, kinetic influence or metabolization of enzymes by soil organisms. (2)
Underlying enzyme kinetics were measured by the producer using pure targets for unit
definition, while biofilm targets are much more diverse and soil matrix could interfere. (3)
Alternative enzyme targets might be reasonably assumed within the complex chemism of
the soil matrix. Released organic cytoplasm molecules of lysed cells can be excluded to be
an additional enzyme target due to their low concentration. On the other hand, enzyme
specificity to EPS targets in face of the organic soil matrix is unbeknown. (4) The decrease
of extracted POM mass due to biofilm erasement from surfaces is suggested to be low, but
could cause underestimation of POM release especially in scenario E4. In contrast, a
direct contribution of enzyme C to the POM carbon release can be refused. Even in case
of complete adsorption to the POM of only one fraction, the highest enzyme concentration
(E4) would result in additional 13.5 µg enzyme g-1 dry soil being <0.4% of the smallest
extracted POM fraction (Table 4). (5) Regarding DNA release measurement as well, data
are semi-quantitative, since quantification of the detachment effect is limited by a potential
adherence of detached cells to soil particles after washing (Absolom et al., 1983; Li and
Logan, 2004). Thus, cell release could be underestimated as biofilm detachment
increases.
Many of these uncertainties are owed to the high complexity of the soil system. Enzymes
were applied in concentrations four orders of magnitude higher than calculated from actual
Cmic and even 1 to 2 orders of magnitude higher than values from literature. Incomplete
biofilm removal indicated by the release of maximum 5.5% DNA from the soil matrix may
suggest that the pooled influence of the disregarded boundary conditions on enzymatic
detachment efficiency is large.
47
Advertisement
Frederick Büks (doctoral thesis 2017)
However, these results give a first though still vague insight in fundamental processes
underlying POM occlusion. A slight release of occluded POM coupled with increased
bacterial DNA release after treatment with high enzyme concentrations underpin the
assumption that biofilm is involved in POM occlusion being a stabilizing agent of soil
aggregates as proposed in a review by Or et al. (2007). The apparent increase of POM
carbon release caused by the digestion of EPS components suggests biofilm relevance in
soil ecosystems e.g. in terms of soil-aggregate related functions like soil water and C
dynamics, mechanical stability as well as rootability. However, the statistical power of this
introductory work is low and a more quantitative analysis of the relation of enzymatic EPS
detachment and POM release would require deeper knowledge of enzyme dynamics in
soil, more replicate samples, additional enzyme concentrations and probably inclusion of
soils from different land use. However, this was beyond the scope of the present study.
4.6 Conclusions
Extracellular polymeric substance (EPS) was shown to be a promising candidate factor of
aggregate stability. Our experimental results suggest that EPS contributes to occlusion
and attachment of particulate organic matter (POM) in sandy soil aggregates. The
application of a highly concentrated mix of α-glucosidase, β-galactosidase, DNAse and
lipase is related to a slight detachment of POM from a stable to a more fragile binding
structure, but not to an increase in POM release without physical disruption of aggregates
by sonication. The pattern of measured light fraction soil organic carbon (LF-SOC) release
and additional bacterial DNA release points to an intra-aggregate fixation of POM by
enzyme targets. A loss of EPS integrity could therefore cause a detachment of soil organic
matter, not only in the laboratory but also in tilled soils. Our results further suggest that a
change of the biofilm composition probably due to a shift in microbial population structure
may alter soil aggregate stability. On macro-scale this could affect soil compactibility,
erodibility, water transport, retention and aeration regime, rooting depth and the occlusion
of soil organic carbon. This, in conclusion, invites to behold soil EPS dynamics as a factor
of sustainable land use.
48
Soil microbial communities and POM occlusion
4.7 Acknowledgements
This project was financially supported by the Leibnitz-Gemeinschaft (SAW Pact for
Research, SAW-2012-ATB-3). We also are grateful to Prof. Dr. Ulrich Szewzyk and the
helpful staff of the Chair of Environmental Microbiology (Department of Environmental
Technology, TU Berlin) for the unbureaucratic possibility to use their laboratories. In
addition our thanks go out to Lara Schneider. Her bachelor thesis helped us to get an
overview in the early phase of this experiment. And thanx both to Dennis Prieß for initiating
a good idea during a very good Taiji training and to Tom Grassmann for his help to handle
R coding.
49
Advertisement
Frederick ks (doctoral thesis 2017)
50
Soil microbial communities and POM occlusion
5 POM occlusion within sandy soil
macroaggregates is not affected by
feeding and motion of the nematode
Acrobeloides buetschlii
5.1 Abstract
To protect in a harsh environment, bacteria gather in a viscose biofilm, which also forms a
food source for the soil fauna such as bacterial-feeding nematodes. In addition to its
protective and nutritive function, biofilm is supposed to provide the aggregation of soil
particles, which is attended by the occlusion of particulate organic matter (POM). In the
present work we hypothesized, that grazing of the nematode A. buetschlii on bacteria in a
sandy agricultural soil affects the occlusion of POM. Soil aggregate samples from a
cropland near Berge (Germany) were inoculated with on average 370 individuals g-1 of A.
buetschlii and incubated for 14 days. The population development was monitored and the
POM occlusion as well as the amount and pattern of phospholipid fatty acids (PLFAs) were
measured at day 0, 1 and 14. Although the population of A. buetschlii remained stable
across the experimental period, neither a changing microbial biomass and composition nor
a variation of POM release was observed compared to a nematode-free control. As about
41% of the mesopores within the aggregate sample did not provide enough space for
nematode migration, this suggests an inaccessibility of intra-aggregate biofilms and
therefore protection against faunal grazing. These spacially protected microaggregates
likely have a key role in POM occlusion.
51
Advertisement
Frederick Büks (doctoral thesis 2017)
5.2 Introduction
Biofilms represent a bacterial strategy to withstand ecological stressors, e.g. toxics and
antibiotics, radiation, drought and grazing pressure (Flemming and Wingender, 2010).
They consist of 90 to 97% water (Zhang et al., 1998; Schmitt and Flemming, 1999; Pal and
Paul, 2008), differing ratios of polysaccharides, extracellular DNA (eDNA), proteins and
lipids as well as microbial cells, which accounts for 10 to 50% of the biofilm dry mass
(More et al., 2014). The viscous biofilm matrix not only functions as protective clothing for
microorganisms living within, it is also a genetic cross-over hotspot and collective digestive
system, which plays a role in nutrient cycling and soil aggregation. (Baldock, 2002;
Ashman et al., 2009; Flemming and Wingender, 2010)
As soil bacteria are known to colonize particulate organic matter (POM), their biofilms are
suggested to play a role in POM occlusion due to soil aggregate formation (Jastrow and
Miller, 1997; Baldock, 2002; Chenu and Stotzky, 2002). Compared to unaggregated soils,
well aggregated soils show an increased water holding capacity in micropores, drainage,
aeration and rootability as well as less compactibility and erodability (Baumgartl and Horn,
1991; Taylor and Brar, 1991; Ball and Robertson, 1994; Barthes and Roose, 2002; Alaoui
et al., 2011). These are parameters that affect soil fertility. Consequently, influences of
agricultural praxis or natural soil processes on soil biofilms are important in sustainable
land use.
Grazing soil biota, e.g. protozoa and nematodes, are assumed to affect the bacterial
community and the soil nutrient cycling (Ingham et al., 1985; Bonkowski, 2004). Nematode
grazing maintains bacterial populations in a youthful state and thereby enhances
decomposition activity (Neher, 2010). It is therefore conceivable, that soil biofilm structure
is engineered by these organisms. As part of the microfauna, the phylum Nematoda is an
ecologically important branch containing >25,000 species (Zhang, 2013) in freshwater,
marine, endobiontic and soil habitats. Nematodes are ubiquitary abundant even in
stressed or disturbed soils (Neher, 2010) and show different feeding habits as there are
plant parasites, fungal feeders, predators, unicellular eukaryote feeders as well as
bacterial grazers (Yeates et al., 1993). Due to these diverse trophic interactions
nematodes hold a central position in both bottom-up and top-down controlled food webs
(Ferris, 2010; Yeates, 2010).
52
Soil microbial communities and POM occlusion
A well examined, cosmopolitic, robust and easily cultivable representative, Acrobeloides
buetschlii, is used in this study (Nicholas, 1962; Frey, 1971). This opportunistic species is
common in many soils and its ecology is well examined in studies of e.g. forest, subarctic
and agricultural soils (Ruess, 1995a; Korthals et al., 1996; Ruess et al., 2002; Kästner and
Germershausen, 2014). Female adults, predominant in soils, have a length between 300
and 500 µm and a diameter of 12.5 to 41.7 µm (Bongers, 1994). In pure culture A.
buetschlii showed its highest population growth rate at 26.6°C and a slightly reduced
growth rate at an incubation temperature of 20°C (Venette and Ferris, 1997). Its metabolic
rate is the highest at 35°C (8.5 ng CO2 µg-1 Nematode h-1) and has a second local optimum
(7 ng CO2 µg-1 Nematode h-1) at 20°C (Ferris et al., 1995). 20°C also lead to a generation
time of 13 to 14 days (Nicholas, 1962). As other nematodes are known to use chemotaxis
when foraging for food, A. buetschlii is also assumed to migrate this way (Zuckerman and
Jansson, 1984). The nematode develops well at a soil pH of 6 (Frey, 1971; Korthals et al.,
1996) and 60% field capacity in sandy soils (Ackermann et al., 2016). Nematodes swim in
water-filled pores and water films on particle surfaces (Juarez et al., 2010) and migrate
with 52 to 718 µm sec-1 as measured for various taxa (Gray and Lissmann, 1964; Wallace,
1968). A. buetschlii was shown to move randomly in the soil without bacteria present, and
cover distances of at least 6.6 cm within 8 days (Ackermann et al., 2016). With a bacterial
trigger A. buetschlii moves towards the resource, which may be located even at several
centimeter distance.
By feeding on soil bacteria, digesting and excreting easily available nutrients e.g. NH4+, A.
buetschlii functions as an interlink in soil elemental cycling and thereby strongly affects
bacterial growth (Freckman, 1988). Given that the bulk of soil bacteria is living in biofilms
(Davey and O'toole, 2000), it seems obvious, that bacterial feeders, whose feeding habit is
influenced by preference and food accessibility, influence this small-scale habitat (De
Mesel et al., 2004) and thus biofilm related POM occlusion within soil aggregates.
Furthermore, Ghanbari et al. (2012) showed a maximum level of mechanical force
generation for C. elegans of about 61.94 µN. As also A. buetschlii releases mechanical
forces to its surrounding, it possibly could manipulate soil structure, e.g. by displacing
primary particles within soil aggregates.
Based on this trophic and mechanical potential, we hypothesized that a dense population
of A. buetschlii given on a habitable, nematode-free soil would affect microbial community
53
Advertisement
Frederick Büks (doctoral thesis 2017)
and POM release. Expected changes in the occlusion of POM within soil aggregates are
attributed to a combined impact of both, mechanical displacement of soil particles and
biofilm grazing, and can be negative (destabilization) or positive (adaptive reaction of the
biofilm community). To prove our hypothesis, soil aggregates from an agricultural site near
Berge (Germany) were incubated for 14 days with A. buetschlii at densities similar to
common field populations of bacterial-feeding nematodes. The POM occlusion was
determined after 0, 1 and 14 days by ultrasonic treatment of soil aggregates, density-
fractioning and measurement of released particulate light fraction carbon (POC) following
Golchin et al. (1994) and compared to a nematode-free control. In addition, the microbial
biomass and community composition was determined by analysis of soil phospholipid fatty
acids (PLFAs) at each sampling date, and the nematode population was counted.
Separately, also the soil pore size distribution was measured by mercury intrusion to check
the accessibility of the intra-aggregate pore space for nematodes.
5.3 Materials and methods
5.3.1 Soil sample
Soil aggregates with a size of 630 to 2,000 µm were collected from an air-dried sandy
topsoil (Su3) (Sponagel et al., 2005) of an agricultural site near Berge (Brandenburg,
Germany). The resulting sample had a pHCaCl2 of 6.9, Corg=8.7 g kg-1, Cmin=200 mg kg-1 and
Cmic=352 mg kg-1.
5.3.2 Basal respiration
Following Nordgren (1988), 20 g of air-dried soil aggregates were incubated in 9-fold
replication at 20°C for 72 hours in a respiration device (CarbO2Bot, PRW Electronics) to
determine dry baseline CO2 emission. Afterwards the 9 replicates were divided into
triplicates and three different water contents were set (50, 70 and 80%vol field capacity;
addition of sterile tap water: 3.2 ml, 4.5 ml and 5.2 ml, respectively). Incubation was
conducted at 20°C for 95 hours to detect the water content of highest soil respiration and
the point of beginning basal respiration.
54
Soil microbial communities and POM occlusion
5.3.3 Preparation of the inoculum
Breeding of A. buetschlii was performed on colonies of the fungus Chaetomium globosum.
Sterile incubation of C. globosum took place on potato dextrose agar (39 g PDA, 1 l dest.
Water, sterilized at 121°C for 20 min) for 4 weeks. Afterwards, Petri dishes with C.
globosum were infected with A. buetschlii and sterilely incubated at 18°C in the dark until
dense population. A modified Baermann's funnel extraction (Ruess, 1995b) was applied for
3 days at 20°C to segregate living Nematodes from the agar plate and collect them in
45 ml flasks. Subsequently a washing procedure was applied to clean nematodes from
protozoa and bacteria: The Nematode suspension was centrifuged for 8 min at 700 rpm
and 8°C in a Thermo Scientific Heraeus Multifuge 3SR+ and the supernatant was
removed. The nematode pallet was resuspended in sterile tap water and washed again.
Then the received pallet was resuspended in 3 ml 0.01% HgCl2 solution, exposed for
3 min, subsequently washed another 2 times and resuspended in sterile tap water. The
Nematode concentration was determined by brightfield microscopic counting (100x
magnification) in 125 µl suspension. Afterwards the suspension was adjusted to 5,500
individuals ml-1 by addition of sterile tap water.
5.3.4 Nematode population development
18x15 g of dry soil aggregates were filled in 250 ml PE-bottles, adjusted to 70% field
capacity with sterile tap water (3.4 ml) and incubated for 4 days at 20°C in the dark to
reach basal respiration. Afterwards the evaporated water was refilled and half of the
samples were inoculated with 1 ml of A.buetschlii suspension containing
5,500 individuals ml-1 (Nem), which results in an density of 370 individuals g-1 dry soil
aggregates. The water volume added via nematodes thereby set soil aggregates on 90%
field capacity. The other half, used as control (Con), got 1 ml of sterile tap water instead.
Each 3 replicates per variant where incubated for 1, 6 and 14 days at 20°C in the dark.
Afterwards living Nematodes were extracted from the soil following Ruess (1995b) and
fixated with 4% formaldehyde solution. Collected Nematodes were counted using
brightfield microscopy with 100x magnification.
55
Advertisement
Frederick Büks (doctoral thesis 2017)
5.3.5 Measurement of POC release
25 soil aggregate samples à 15 g were moistened with sterile tap water to get 70% field
capacity (3.4 ml) and incubated at 20°C for 4 days in the dark. Afterwards, evaporated
water was refilled. Nematode samples were incubated in 5-fold replication for 1 day
(Nem1) and 14 days (Nem14) with addition of 1 ml of the above inoculum. Three further
controls without Nematodes (Con0, Con1 and Con14) were established comparably. After
incubation and refill to 90% field capacity, POC release was estimated by successive
ultrasonication, density fractioning and C/N-analysis (Kaiser and Berhe, 2014): In
consideration of the contained amount of water, 70.6 ml of 1.64 g cm-3 dense sodium
polytungstate solution (SPT) were added to the sample for the adjustment of 1.6 g cm-3.
Afterwards, the samples rested for 30 min to enable SPT distribution within the pore
space. Thereafter, the free light fraction (fLF) was captured using centrifugation at 3,569 G
for 26 min and filtering of supernatant trough a glass fibre filter with 1.5 µm pore size. For
the following ultrasonic treatment, energy output of the ultrasonication device (Branso
Sonifier 250) was derived from the heating rate of water inside a dewar vessel (North,
1976). The remaining soil was refilled to 75 ml 1.6 g cm-3 dense SPT, treated with 50 J ml-1
and again centrifuged and filtered to capture the weakly bond occluded light fraction
(oLF50). After further refill, soil samples were ultrasonicated twice with each additional
50 J ml-1 and again centrifuged and fractionated (oLF100 and oLF150). Light fractions (LF)
and the remaining sediment (heavy fraction HF plus strongly bond POM) were froze at
20°C, lyophilized, ground, dried at 105°C and analyzed for organic C concentration by use
of an Elementar Vario EL III CNS Analyzer. As the soil aggregates do not contain
carbonates (data not shown) and dissolved organic matter (DOM) was removed during
density fractionation, collected soil organic carbon (SOC) can be interpreted as POC.
5.3.6 Phospholipid fatty acid (PLFA) extraction and analysis
Similar to the measurement of POM release, 5 variants (Con0, Con1, Con14, Nem1 and
Nem14) with 5 replications were prepared. After incubation, samples were directly stored
at -20°C for later PLFA analysis.
Extraction of PLFAs from soil aggregates was performed following Frostegård et al.
(1993). Briefly, 2 to 3 g of soil substrate (wet weight) were extracted with Bligh/Dyer
56
Soil microbial communities and POM occlusion
solvent (chloroform:methanol:citrate buffer ratio of 1:2:0.8, ph 4). Lipids were fractionated
into neutral lipids, glycolipids and PLFAs on a silica column (HF BOND ELUT SI, Varian
Inc.) by elution with chloroform, acetone and methanol, respectively. PLFAs were
subjected to mild alkaline methanolysis, resulting in fatty acid methyl esters (FAMEs),
which were extracted with hexane-chloroform. Methylnonadecanoate (19:0) was used as
internal standard. FAMEs were dissolved in isooctane and stored at -20ºC until analysis.
PLFAs were analyzed by gas chromatography using an Agilent 7890 gas chromatograph
(GC) and flame ionization detector (FID) equipped with an HP Ultra 2 capillary column
(25 m x 0.2 mm i.d., film thickness 0.33 µm) and a computer associated software
(Sherlock Pattern Recognition Software, MIDI®). The system was operated in split mode
(1:40) with hydrogen as carrier gas. The oven temperature program started with 170°C
and increased by 28°C min-1 to 288°C, followed by 60°C min-1 to 310°C (hold time 1.3 min).
FAMEs were identified on the basis of their retention times in comparison to a standard
mixture. Correct identification, i.e. chain length and saturation, was verified by GC-mass
spectrometry (GC-MS). Representative samples were analysed with an Agilent Series
7890A GC connected to a Mass Selective Detector (Agilent 7000 Triplequadrupole)
equipped with HP5MS capillary column (30 m x 0.25 mm i.d., film thickness 0.25 µm),
operated in splitless mode with helium as carrier gas. Oven temperature program sated at
40°C and increased by 46°C min-1 to 200°C, followed by 5°C min-1 to 238°C, 120°C min-1
to 295°C and 2°C min-1 to 300°C, held for 2 min. A mass range of 40 to 400 m z-1 was
monitored in scan mode.
The microbial community was assigned using the PLFA 18:2ω6 for saprotrophic fungi, and
i15:0, a15:0, i16:0, i17:0, a17:0, cy17:0, 17:0 10-meth, cy19:0, 16:1ω7, 17:1ω8 and
18:1ω7 for bacteria according to Frostegård et al. (1993), Frostegård and Bååth (1996)
and Zelles (1999). The total amount of PLFAs represents a mean for microbial biomass
(Zelles, 1999). For more details see Table 5.
57
Advertisement
Frederick Büks (doctoral thesis 2017)
Table 5: List of group specific PLFAs used in the present study.
Target group PLFA References
Actinobacteria 10-meth16:0 Kroppenstedt (1985); Vestal and White (1989); Mirza et al. (1991)
10-meth-17:0
10-meth-18:0
gram(+) Eubacteria 14:0 iso O’Leary and Wilkinson (1988); Vestal and White (1989); Zelles
(1997); Zelles (1999)
15:0 anteiso
15:0 iso
16:0 iso
17:0 anteiso
17:0 iso
gram(-) Eubacteria 17:0 cyclo O’Leary and Wilkinson (1988); Zelles (1997); Zelles (1999)
19:0 cyclo
Eubacteria 15:1 ω9c iso Bowman (2015)
16:1 ω9c iso Bowman (2015)
16:1 ω5c Nichols et al. (1986); Zelles (1997)
16:1 ω7c Guckert et al. (1991); Zelles (1999)
16:1 ω9c Zelles (1997)
16:1 ω11c Zelles (1997)
17:1 ω7c anteiso Bowman (2015)
17:1 ω9c anteiso Bowman (2015)
17:1 ω8c Kaneda (1991); Bühring et al. (2014)
18:1 ω7c Zelles (1999)
Fungi 18:2 ω6c Federle (1986); Frostegård and Bååth (1996); Stahl and Klug
(1996); Zelles (1999)
Plants 22:0 Zelles (1999); Ruess et al. (2007)
24:0 Zelles (1999); Ruess et al. (2007)
Animals 20:3 ω6c Hutzell and Krusberg (1982); Ringelberg et al. (1997); Watts
(2009); Buyer et al. (2010)
20:4 ω6c Lechevalier and Lechevalier (1988); Stanley and Nelson (1993);
Chen et al. (2001)
Miscellaneous origin 14:0 Balasooriya et al. (2014); Lange et al. (2014)
15:0
16:0
17:0
18:0
20:0
23:0
18:1 ω5c Hutzell and Krusberg (1982); O’Leary and Wilkinson (1988);
Zelles (1997)
18:1 ω9c Vestal and White (1989); Zelles (1999); Bååth (2003); Ruess et al.
(2007)
5.3.7 Mercury intrusion
The measurement of the pore size distribution within the soil aggregate sample was
performed using mercury intrusion (Porosimeter 2000 WS, Carlo Erba Instruments). The
soil aggregate sample (0.51 g) was air-dried for 24 hours at 40°C and measured using a
maximum test pressure of 200 MPa and a pressure decrease of 3.6 MPa min-1 at 26.1°C
(find additional data in the supplements). Data are given for pore sizes between 0.005 and
58
Soil microbial communities and POM occlusion
50 µm representing the non-draining intra-aggregate pore space, which is filled with water
at field capacity (Blume et al., 2015).
5.3.8 Statistics
Data of Nematode density, POC release and PLFA composition analyzed with Shapiro and
Wilk's test as well as Levene's test are assumed to be normal distributed (Shapiro and
Wilk, 1965) and have homogeneity of variance (Lim and Loh, 1996), respectively. Basal
respiration was expressed as simple moving average with a span of 4 adjacent sampling
times. The characteristics of the triplicate with the largest ratio of CO2 emission to soil
water content was chosen for later incubation. A repeated measurement design (two-
factorial ANOVA, p≤0.05) was used to test for differences between Nematode and control
samples in both nematode density and PLFA composition (von Ende, 2001). Data of POM
release were analyzed using one-way analysis of variance (ANOVA, p≤0.05) followed by
Tukey's test (Christensen, 1996).
5.4 Results
5.4.1 Soil respiration
As dry soils showed nearly no CO2 emission, wetting resulted in a respiration maximum
around 6 µg CO2 g-1 h-1 after 17 hours and a basal respiration of about 2.7 µg CO2 g-1 h-1
after 60 hours in all samples. In the first 20 hours after wetting, samples of 50% water
holding capacity exhibit a lower basal respiration compared to samples of 70% and 80%,
which had quiet similar CO2 emissions. (Fig. 7)
On the basis of these data, a water holding capacity of 70% was chosen for pre-incubation
in all experiments, for it provides highest bacterial metabolic activity and sufficient air
capacity after application of Nematodes.
59
Advertisement
Frederick Büks (doctoral thesis 2017)
5.4.2 Population development
On average 367 nematodes g-1 dry soil were added to each inoculated sample. Nematode
counting after 1, 6 and 14 days points to a stable population with numbers between 187
and 239 nematodes g-1 soil (Fig. 8). In control soils few endogenous nematodes were
recorded with densities below 1 individual g-1 dry soil until day 6, which slightly increased
to 5 and 18 individuals g-1 dry soil at day 14 in two of the six replicate samples. Overall,
control samples comprised very few to no nematodes, whereas inoculated aggregate
samples function as habitat for a significantly higher and nearly stable nematode
population (p=0.0026) containing a large number of young nematodes at day 14 (not
counted).
60
Fig. 7: Soil respiration of dry samples (day -72 to 0) and samples with 50%, 70% and 80% (day 0 to 72)
water holding capacity. Data are presented as simple moving average. Peaks at -72 and 0 h are caused by
opening the device and have to be ignored.
-72 -60 -48 -36 -24 -12 0 12 24 36 48 60 72 84 96
0,00
2,00
4,00
6,00
8,00
10,00
12,00
14,00
16,00 50% water holding capacity
70% water holding capacity
80% water holding capacity
time [h]
respiration [µg CO g-¹ h-¹]
Soil microbial communities and POM occlusion
5.4.3 POC release
A comparison of the POC release defined as ratio of the organic carbon release per
energy level (Cfrac) to the sum of organic carbon of all light fractions and the sediment (CΣ)
shows a high similarity between the variants (Fig. 9): Tukey's test does not show
significant differences for 0, 50 and 100 J ml-1, neither between sampling dates of one
variant nor between variants for a fixed point in time. However, at day 14 the oLF150
release of the Nematode samples is reduced compared to day 1, amounting to 1.6% of CΣ
or 0.13 mg C g-1, respectively. The average relative POC release amounts to 5.9% in the
fLF, 9.4% in the oLF50, 2.8% in the oLF100 and 1.9% in the oLF150, whereas 80% of the POC
remain in the soil matrix. The absolute POC releases in mg POC g-1 dry soil show very
similar relations and significances (see supplements).
The cumulative POC release of both treatments shows a tendency (p=0.08 for Nem and
p=0.06 for Con) to decrease from day 0 (2.0 mg C g-1) to day 1 (1.8 C g-1) and further to
day 14 (1.6 C g-1) after stepwise application of 3x50 J ml-1.
61
Fig. 8: Population development of nematodes (individuals g-1 dry soil)
in 9 soil aggregate samples with () and 9 without (x) amendment of
Acrobeloides buetschlii after 1, 6 and 14 days of incubation at 20°C.
0 2 4 6 8 10 12 14
0
50
100
150
200
250
300
350
400
450
500
Con
Nem
incubation time [d]
abundance [individuals/g soil]
Advertisement
Frederick Büks (doctoral thesis 2017)
5.4.4 PLFA analysis
The total amount of PLFAs, as measure for microbial biomass, ranged from 28.0 to
42.5 nmol g-1 dry soil. No significant differences between samples colonized by A.
buetschlii and control samples were detected, and also no significant variation of microbial
biomass over time (Fig. 10). Both inoculated and control samples have total PLFA
concentrations of 17.4 to 28.3 nmol g-1 for Eubacteria, 6.0 to 9.0 nmol g-1 for gram positive
bacteria, 1.7 to 4.7 nmol g-1 for gram negative bacteria, 2.3 to 4.6 for Actinobacteria and
0.6 to 2.1 nmol g-1 for fungi, but do also not show different concentrations neither within the
phylogenetic groups nor regarding single PLFAs. The fungal population is surprisingly low.
From the 35 assessed individual PLFAs, only 20:4ω6c, a marker for soil animals,
significantly increases with the application of nematodes (p=0.05 at day 14).
62
Fig. 9: Relative POC release (mean values with standard deviations) of
samples with A. buetschlii and controls at different incubation times (0, 1 and
14 days) and applied ultrasonciation levels (0, 50, 100 and 150 J ml-1).
Significances are illustrated by Tukey test characters a, b and c.
0 50 100 150
0
0,02
0,04
0,06
0,08
0,1
0,12
0,14
control (day 0)
control (day 1)
nematodes (day 1)
control (day 14)
nematodes (day 14)
energy level [J/ml]
POC release [Cfrac/CΣ]
a a a a a
Soil microbial communities and POM occlusion
63
Fig. 10: Amount of group specific PLFAs in soil aggregate samples with () and without amendment of A.
buetschlii (x) at day 0, 1 and 14.
0 2 4 6 8 10 12 14
0
10
20
30
40
50
total eubacteria
t [d]
PLFA [nmol/g]
0 2 4 6 8 10 12 14
0
2
4
6
8
10
gram(-) eubacteria
t [d]
PLFA [nmol/g]
0 2 4 6 8 10 12 14
0
1
2
3
4
5
actinobacteria
t [d]
PLFA [nmol/g]
0 2 4 6 8 10 12 14
0
1
2
3
4
5
fungi
t [d]
PLFA [nmol/g]
0 2 4 6 8 10 12 14
0
10
20
30
40
50
total PLFA
control
nematode sample
t [d]
PLFA [nmol/g]
0 2 4 6 8 10 12 14
0
2
4
6
8
10
gram(+) eubacteria
t [d]
PLFA [nmol/g]
Advertisement
Frederick Büks (doctoral thesis 2017)
5.4.5 Mercury intrusion
The pore size distribution within the range of 0.005 to 50 µm is plotted in Fig. 11. At 90%
field capacity, pores <40 µm are filled with water. If the water content drops below 63%,
only pores of an equivalent diameter of 12.5 μm are completely filled with water, which
corresponds to the smallest known diameter of adult female A. buetschlii.
5.5 Discussion
The experimental setting featured environmental conditions that match the requirements of
soil-born grazing nematodes: Cultivation temperature and pH conform to literature and are
related to metabolic optima of A. buetschlii (Frey, 1971; Korthals et al., 1996; Venette and
Ferris, 1997). The measured nematode-free soil basal respiration of about
2.7 µg CO2 g-1 h-1 exceeds data reported from a regional-scale survey in Northeastern
Germany by the 2-fold (Wirth, 1999), with corresponding values in microbial carbon
(Cmic=352±44 mg kg-1 soil). Furthermore, the bacterial PLFA amount with an average
22.7 nmol g-1 dry soil aggregates during the experimental period conforms to literature
64
Fig. 11: Cumulative pore space diagram of macro-aggregates from a sandy
agricultural soil. The dotted line marks the body diameter of adult A. buetschlii.
0 5 10 15 20 25 30 35 40 45 50
0
10
20
30
40
50
60
70
80
90
100
mean pore diameter m]
pore space [%]
Soil microbial communities and POM occlusion
values (Bååth and Anderson, 2003). This implies a normal microbial activity and
abundance provided by the experimental soil substrate. As in addition sandy agricultural
soils in temperate regions are proved to be a habitat for A. buetschlii (Korthals et al.,
1996), an adequate bacterial food source can be reasonably assumed. This is supported
by the stable A. buetschlii population, which amounts ~1.4 times the Cephalobidae
density of a comparable agricultural soil (Scharroba et al., 2012). Nematode densities of
further soils from field and laboratory experiments show this density as above-avarage
(Yeates and Brid, 1994; Dmowska and Ilieva, 1995; Bouwman et al., 1996; Yeates et al.,
1999; Kästner and Germershausen, 2014). Additionally, the increased proportion of
juvenile nematodes occurring in the inoculated samples of day 14 (data not shown)
underpin the existence of a feasible environment to support nematode development and
accords to generation times found by Nicholas (1962). Furthermore, Ackermann et al.
(2016) reported a chemotactic perception of food sources by A. buetschlii within 6.6 cm.
This points to perceptibility of food sources at every point within the PET flask and a
potential migration of A. buetschlii within the whole soil sample. The soil moisture was
adjusted to high values that most probably provide connectivity between habitable pores.
Sufficient oxygen supply is expected, as anaerobic conditions appear as a shift in
abundance towards anaerobic bacterial taxa, e.g. represented by vaccenic type fatty acids
(e.g. ω7 type) (Zelles, 1999). Measured PLFAs do not show such a shift, pointing to
constant aerobic conditions during the whole incubation period.
However, no influence of the inoculum on POM occlusion and PLFA composition was
observed: The tendency of both variants to increase POM occlusion over time suggests a
rebuilding of aggregate structure after slaking induced by the initial wetting (Beare and
Bruce, 1993), but the occlusion of POM is not influenced by the application of nematodes.
This might be due to minor influence of nematode grazing on the abundance and
composition of the microbial community: The bacterial groups, represented by cumulated
amounts of specific PLFA markers, do not show any differences between nematode
samples and the control. This suggests no shift within major bacterial groups, e.g. gram
positive forms or acidobacteria. Also 34 of 35 individual PLFAs do not show significant
differences of amount and proportion between the variants. Only 20:4ω6c, a marker for
soil animals (Ruess and Chamberlain, 2010), is significantly enriched after nematode
application. This PLFA was most likely derived from the inoculated nematodes, yet
65
Advertisement
Frederick Büks (doctoral thesis 2017)
Protozoa developing in the soil may be an additional source. The PLFA 16:1ω5c showed a
tendency to decline in the presence of nematodes, suggesting nematode feeding on
bacteria. However, as 16:1ω5c is a general bacterial marker (Ngosong et al., 2012), no
specific group as nematode prey can be assigned. In sum, the limited shift between
aggregate soil with/without nematodes indicates only a small influence of grazing on the
soil microbial community.
Different reasons can be considered for the lack in hypothesized grazing effects:
1) The Nematodes do not feed upon the given microbial community. Although this is not
directly tested, refusing food seems implausible in the present study due to proper habitat
quality and observed nematode reproduction. Moreover, A. buetschlii is an opportunistic
bacterial feeder with a broad feeding range (Nicholas, 1962; Bird and Ryder, 1993; Venette
and Ferris, 1998).
2) Extracellular polymeric substance is known to be a hindrance against grazing. However,
whether this barrier is highly protective against certain grazers leading to preservation of
nearly the whole biofilm population or incompletely effective depends on various factors
such as biofilm architecture, toxicity or signaling and cannot be estimated in the present
study. (Höckelmann et al., 2004; Matz et al., 2004; Weitere et al., 2005)
3) Biofilms might be ineffectual for POM occlusion in sandy soils. The influence of biofilms
on aggregate formation is assumed to be weaker in sandy than in clayey soils, as mainly
silt, clay and small organic particles are bound by the biofilm extracellular matrix (EPS)
and protection of bacteria against grazers is enhanced by a fine pored, hardly accessible
habitat (Chenu, 1995; Chenu and Stotzky, 2002; Six et al., 2004). However, work on the
same sandy soil indicates a slight influence of EPS on the occlusion of POM (Büks and
Kaupenjohann, 2016).
4) Grazing Nematodes might be restricted to zones, whose bacterial population do not
contribute to the POM occlusion: At field capacity, soil pores <50 µm are water-saturated.
In the present study the soil water content reaches up to 90% field capacity, which allows
free swimming of Nematodes within the non-draining pore space <40 µm as well as gliding
even in thin water films within larger pores (Wallace, 1968). However, the motility of A.
buetschlii is restricted to pores larger than its body diameter, here 12.5 µm equal to ~37%
of the non-draining pore space of the present soil. Further ~22% of the non-draining pore
space have diameters <0.3 µm and are therefore not colonized by bacteria (Foster, 1988),
66
Soil microbial communities and POM occlusion
whereas all larger pore size classes, aggregate surfaces and the inter-aggregate space
are inhabited by bacterial communities. As a result, 41% of the non-draining pore space
comprise pores between 0.3 and 12.5 µm, that contain bacteria, which are spatially
protected against nematode grazing. This is in accordance with data of Ranjard and
Richaume (2001), who found that in sandy soils the majority of the bacterial population is
located in the inner part of soil aggregates, mainly in micropores <9 µm within aggregates
<100 µm, and also matches data of Winding et al. (1997). This undisturbed bacterial
community might be the agent for soil aggregation: Following a comprehensive review of
Tisdall (1996), the hierarchical structure of soil aggregates base upon “minor”
microaggregates (<20 µm), which are built of clay-humus-complexes associated with silt
particles, partly humified bacterial debris and exudates, mineral incrustations and even on
this level bacterial colonies. Larger microaggregates (<250 µm) consist of these elements
and further POM. Considering the function of bacterial macromolecular exudates on soil
aggregation (Chenu and Stotzky, 2002), spatially protected intra-aggregate bacteria could
play a role in POM occlusion, whereas grazed bacteria in large pores are subject to a
higher turnover rate and not able to establish a permanent structure for sticking primary
particles. Referring to the similar POM release in both treatment variants, also the
mechanical force generation of A. buetschlii does not suffice to overcome physico-
chemical bonds and to move/separate soil particles to reach new grazing sites within
microaggregates.
We propose to explain the missing effect of A. buetschlii on POM occlusion in the following
way. A. buetschlii most probably feed on EPS within the accessible pore space, but is not
able to reach bacteria in smaller mesopores. On its grazing sites, feeding is non-selective
and maintains a growing bacterial population resulting in an equilibrium and hence
constant PLFA amounts comparable to the control (Ingham et al., 1985). The bacterial
community of smaller mesopores, which is supposed to provide POM occlusion within soil
aggregates, remain protected against grazing. In consequence, A. buetschlii is not able to
influence the POM occlusion. However, deeper investigations are necessary to prove this
explanation. Long-term effects on soil structure, e.g. due to acclimatization of A. buetschlii
or mineral N exudation (Ferris et al., 1997), were excluded from this work. Further
experiments with different soils and nematode taxa as well as longer incubation time are
necessary.
67
Advertisement
Frederick Büks (doctoral thesis 2017)
5.6 Conclusions
We hypothesized a grazing influence of an excess population of A. buetschlii on soil PLFA
composition concomitant with a change of POM occlusion. This hypothesis has to be
refused, as a large, stable and fertile population of A. buetschlii only marginally affected
the soil PLFA composition and had no influence on POM occlusion in aggregates of a
sandy agricultural soil. This is explained by a majority of inadequate pore diameters
hindering A. buetschlii to access the finer pore space of microaggregates. However, the
bacterial communities in those microaggregates are assumed to contribute to aggregation
and POM occlusion.
5.7 Acknowledgements
This project was financially supported by the Leibnitz-Gemeinschaft (SAW Pact for
Research, SAW-2012-ATB-3). Our thanks go out to the Department of Building Materials
and Construction Chemistry (TU Berlin) for the possibility to use their Mercury Intrusion
Porosimeter and to it's helpful staff.
68
Soil microbial communities and POM occlusion
6 Two different microbial communities
did not cause differences in occlusion
of particulate organic matter in a sandy
agricultural soil
6.1 Abstract
Apart from physico-chemical interactions between soil components, microbial life is
assumed to be an important factor of soil structure forming processes. Bacterial exudates,
the entanglement by fungal hypae and bacterial pseudomycelia as well as fungal glomalin
are supposed to provide the occlusion of particulate organic matter (POM) through
aggregation of soil particles.
This work investigates the resilience of POM occlusion in face of different microbial
communities under controlled environmental conditions. We hypothesized that the formation
of different communities would cause different grades of POM occlusion. For this purpose
samples of a sterile sandy agricultural soil were incubated for 76 days in bioreactors.
Particles of pyrochar from pine wood were added as POM analogue. One variant was
inoculated with a native soil extract, whereas the control was infected by airborne microbes.
A second control soil remained non-incubated. During the incubation, soil samples were
taken for taxon-specific qPCR to determine the abundance of Eubacteria, Fungi, Archaea,
Acidobacteria, Actinobacteria, α-Proteobacteria and β-Proteobacteria. After the incubation
soil aggregates (100 to 2000 µm) were collected by sieving and disaggregated using
ultrasound to subject the released POM to an analysis of organic carbon (OC).
Our results show, that the eubacterial DNA of both incubated variants reached a similar
concentration after 51 days. However, the structural composition of the two communities
was completely different. The soil-born variant was dominated by Acidobacteria,
Actinobacteria and an additional fungal population, whereas the air-born variant mainly
contained β-Proteobacteria. Both variants showed a strong occlusion of POM into
aggregates during the incubation. Yet, despite the different population structure, there were
only marginal differences in the release of POM along with the successive destruction of soil
aggregates by ultrasonication. This leads to the tentative assumption that POM occlusion in
agricultural soils could be resilient in face of changing microbial communities.
69
Advertisement
Frederick Büks (doctoral thesis 2017)
6.2 Introduction
Microbial communities play an irreplaceable role in soil ecosystems. Due to their metabolic
diversity and abundance, especially bacteria and Fungi have considerable influence on
mineral and organic matter transformation (Torsvik and Øvreås, 2002; Gianfreda and Rao,
2004; Uroz et al., 2009; Madigan et al., 2015) and often represent the first element in
manifold faunal food webs. They also release a broad variety of molecules involved in
nutritional or functional cell-plant symbioses supporting plant growth and health (Pühler et
al., 2004; Van Der Heijden et al., 2008).
This work focus on a further ecological function of microbial communities: There is
evidence, that the soil microbial community takes part in soil aggregate formation, which is
supposed to be positively related to the occlusion of particulate organic matter (POM)
within soil aggregates. The grade of occlusion influences the carbon cycle, as occluded
POM is superior protected against microbial degradation compared to free POM and
mutually promotes development of stable macroaggregates. (Jastrow and Miller, 1997;
Bronick and Lal, 2005; Brodowski et al., 2006a; Lützow et al., 2006)
The physico-chemical mechanisms underlying aggregate formation comprise interactions
between permanent and variable charges of silicates, (hydr)oxides of Fe, Al and Mn,
phosphates, carbonates, DOM and POM, which are meditated by multivalent cations with
small hydrate shells (e.g. Ca2+, Fe3+ and Al3+), and also hydrophobic interactions (Bronick
and Lal, 2005). Fine roots form a physical stabilizing network in and around soil
macroaggregates and release cementing root exudates (Bronick and Lal, 2005). The
microbial influence is supposed to be achieved by the following mechanisms:
(1) Hyphal Fungi and possibly Actinobacteria as well as filamentous colonies of
Cyanobacteria wrap and pervade soil aggregates and increase their mechanical strength
(Chenu and Cosentino, 2011). Length, strength, surface adherence and geometry of the
mycelia determine the contribution to the bulk stability (Chenu and Cosentino, 2011).
When disturbed e.g. by tillage, mycelia were found to be less contributive to the formation
of water stable aggregates than intact ones (Beare et al., 1997). Whereas fungal hyphae
are assumed to mainly stabilize macroaggregates by formation of a sticky string bag
(Gupta and Germida, 1988; Miller and Jastrow, 2000), actinobacterial pseudomycelia were
70
Soil microbial communities and POM occlusion
found both within and around soil microaggregates (Kanazawa and Filip, 1986; Ranjard
and Richaume, 2001; Mummey and Stahl, 2004).
(2) Microbial exudates and debris adsorb to soil particles and alter their surface properties,
e.g. increase the hydrophobicity which decrease water-caused dispersion of soil
aggregates (Chenu and Cosentino, 2011; Achtenhagen et al., 2015).
(3) Microbial biomineralization could cement or block soil particles at their contact regions
(Bronick and Lal, 2005). However, little is known about the influence on POM occlusion.
(4) Arbuscular Mycorrhizal Fungi (AMF) are able to produce a proteinaceous substance
opperationally defined as Glomalin Related Soil Fraction (GRSF) or shortly glomalin
(Wright et al., 1996; Rillig, 2004). It appears in large quantities in various soils (Wright and
Upadhyaya, 1998), but is most probably not an exudate, since Driver et al. (2005) showed
that >80% of the soil glomalin are strongly bond within hyphal cell walls even after harsh
extraction. Soil aggregates rich in glomalin showed a high mechanical stability. However,
the frequently found correlation between soil aggregate stability and glomalin
concentration (Rillig et al., 2002; Bedini et al., 2009; Hontoria et al., 2009; Spohn and
Giani, 2010; Fokom et al., 2012; Wu et al., 2014) does not necessarily imply glomalin as
an agent of soil aggregation, as for example undisturbed AMF populations could produce a
lot of glomalin while in effect aggregate soil particles by wrapping. Therefore the influence
of glomalin concentration on POM occlusion is hypothetical.
(5) In contrast to Fungi, the bulk of bacteria is assumed to encapsulate within a viscose
matrix of extracellular polymeric substance (EPS) as a reaction to diverse ecological
stressors (Roberson and Firestone, 1992; Davey and O'toole, 2000; Mah and O'Toole,
2001; Weitere et al., 2005; Chang et al., 2007; Flemming and Wingender, 2010; Ozturk
and Aslim, 2010). This biofilm contains in average 90% water (Zhang et al., 1998; Schmitt
and Flemming, 1999; Pal and Paul, 2008). Only 10% to 50% of the remaining dry mass
are microbial biomass, whereas the bulk mainly consists of extracellular macromolecules
like polysaccharides, extracellular DNA, proteins, lipids and humic substance (Flemming
and Wingender, 2010; More et al., 2014). As a result of the ubiquity (Davey and O'toole,
2000), mechanical strength (viscosity) (Möhle et al., 2007; Flemming and Wingender,
2010), structure (Van Loosdrecht et al., 2002) and distribution across the soil aggregate
(Nunan et al., 2003), biofilms are supposed to be an important factor of soil aggregation
(Baldock, 2002). However, the viscosity of EPS is affected by its molecular composition
71
Advertisement
Frederick Büks (doctoral thesis 2017)
(Ayala-Hernández et al., 2008), which strongly depends on species and environmental
conditions: For example, different single-species biofilms cultivated under similar
conditions have a strongly differing EPS composition (Béjar et al., 1998; Steinberger and
Holden, 2005; Celik et al., 2008). But also similar single-species biofilms show differently
composed EPS under varying environmental conditions as demonstrated for
Pseudomonas aeruginosa (Marty et al., 1992; Ayala-Hernández et al., 2008). Little is
known about the capability of different bacterial taxa to produce EPS. For example,
Rhizibia species are considered to be strong EPS producers within the phylum of α-
Proteobacteria (Rinaudi and Giordano, 2010), and the genetic ability to produce large
amounts of high-molecular polysaccharides and proteins was found in different
Acidobacteria (Ward et al., 2009). However, these sparse data do not allow predictions
about the potential of specific microbial communities to take part in POM occlusion.
The five above specified mechanisms are all supposed to affect POM occlusion, and all of
them are obviously influenced by the composition of the soil microbial community. The aim
of this work is to test the resilience of POM occlusion in face of the development of two
fundamentally different microbial communities in a sandy agricultural soil. In this case
study, a gamma-sterilized sandy soil with pyrogenic biochar amendment from pine wood
was inoculated in two variants with microbial and sterile soil extract and incubated for 76
days in a bioreactor at field capacity. The second variant was routinely exposed to room air
during sampling to initiate the development of an air-born bacterial population. We chose
this inoculation, to receive two complex populations that have no potential to converge
their taxonomic abundances, as Delmont et al. (2014) recently found that the development
of microbial communities is controlled by physical-chemical properties of soils rather than
the initial population: E.g. a population taken from a forest soil was given on a sterile
grassland soil and there developed like the original grassland population. The biochar was
used as a POM analogue, but also represents an upcoming class of soil amendments
(Lehmann and Joseph, 2015). During incubation the DNA of Eubacteria, Fungi, Archaea,
Acidobacteria, Actinobacteria, α- and β-Proteobacteria in soil samples from both variants
was quantified using taxon-specific qPCR. After incubation, soil aggregates of a size
between 0.1 and 2 mm were separated by sieving. Following the method of Golchin et al.
(1994), aggregates were treated with ultrasound, and the release of intra-aggregate
particulate organic carbon (POC) was quantified by use of POM density fractionation and
72
Soil microbial communities and POM occlusion
carbon analysis. The amount of released POC depends on the destruction of soil
aggregates, which is a function of applied energy, and gives information about the binding
strength of POM within the aggregates.
We hypothesized that the establishment of different microbial communities will lead to a
different occlusion of POM. A lower occlusion strength is attended by an increased POC
release when applying a specific amount of mechanical stress to soil aggregates under
further similar conditions.
6.3 Materials and methods
6.3.1 Preparation of soil and soil extracts
Air-dried soil from a sandy A-horizon (Su3) of an agricultural experimental site in Berge
(Germany) was sieved to <2 mm particle size and mechanically disaggregated in a mortar
to create an macroaggregate-free soil sample with Corg=8.7 mg g-1 dry soil. The soil sample
was amended with 5%vol of pyrogenic biochar (pine wood, PYREG® GmbH,
Dörth/Germany) with a particle size <0.1 mm (71% <40 µm, see supplements) and
homogenized by end-over end shaking. Subsequently, the biochar-soil-mixture was
sterilized with 40.000 Gy using a Cobalt-60 γ-radiation source and an exposure time of
2 weeks following McNamara et al. (2003). The resulting soil had a pH of 7.1 in
0.01 M CaCl2 solution, a four times increased Corg concentration of 36.2 mg g-1 and a grain
gross density of 2.54 g cm-3.
In addition, 1200 g of untreated fresh soil were extracted with 1560 ml of 10-fold diluted
modified R2A broth (0.1 g l-1 NH4NO3, 0.05 g l-1 yeast extract, 0.05 g l-1 soy peptone,
0.05 g l-1 casamino acids, 0.05 g l-1 glucose, 0.05 g l-1 soluble starch, 0.03 g l-1 K2HPO4,
0.0024 g l-1 MgSO4, pH 7.2±0.2, autoclaved at 121°C for 20 min) (Atlas, 2010) by end-over
end shaking for 3 h. The extract was filtered twice through two layers of laboratory tissue
paper and afterwards split into two halves. One half was autoclaved at 120°C for 20 min,
whereas the other half remained untreated to provide an inoculum with a soil-born
microbial population.
73
Advertisement
Frederick Büks (doctoral thesis 2017)
6.3.2 Incubation and sampling
Under sterile conditions, two triplicates of each 300 g sterile soil
were filled into pF-bioreactors (Fig. 12) and packed to get a
bulk density of 1.36 g cm-3. When closed and connected to a
hydrostatic head, the reactors provide constant matrix potential,
similar evaporation rates and sterile air supply for soil microbial
containment experiments. In the present study, the headspace
was continually replaced with a flow rate of 0.4 l min-1 by room
air filtered with an 0.2 µm membrane filter. The hydrostatic head
was 120 cm (pF 2.08) and thus provided a soil water content of
about 35.0%vol and a soil air content of 11.5%vol. The water
content of 35%vol equates to 77 ml soil solution. For example,
giving 100 ml soil extract to the dry sample, hence 23 ml are
subsequently removed by the hydrostatic head when water
tension is adjusted. The adjustment of soil water content was
tested in pre-trials with addition of 100 ml of tap water to 300 g
of dry soil sample here the impounded water was rejected
within 15 min and the adjustment to 37%vol soil water content at
pF=2 took place within 4 days (data not shown). These
characteristics were also assumed for the main experiment.
The first triplicate (SPsoil) was inoculated with each 100 ml of
the non-autoclaved inoculum to reestablish the native microbial
population. The sterilized inoculate was given to the second
triplicate to start with an abiotic environment, that is susceptible
for infection by air-born microorganisms (SPair) when exposed
to unsterile air. Soil extract exceeding the adjusted soil water content was removed by the
hydrostatic head and discarded.
The soil columns were incubated for a total of 76 days. During the incubation, a stress
factor setting was established that includes warm-humid conditions from day 1 to 24, warm
and drying-out conditions between day 25 and 50 as well as cold-humid conditions from
day 51 to 76. This setting is supposed to promote EPS production and fungal growth
74
Fig. 12: pF-bioreactor
with its components A)
air supply composed of
diaphragm pump and
membrane filter, B) filter
column with soil sample
(dark grey) and filter
plate (dotted), C)
hydrostatic head (pale
grey) and D) liquid waste
container.
Soil microbial communities and POM occlusion
(Roberson and Firestone, 1992; Di Bonaventura et al., 2008; Borowik and Wyszkowska,
2016). Therefore, incubation took place at room temperature between 24.5°C and 32.5°C
until day 50 and at 8°C from day 51 to 76. Hanging water columns were disconnected at
day 24 and reconnected after addition of 100 ml of 10-fold diluted modified R2A broth at
day 50.
Soil sampling for DNA analysis was performed with sterile plastic pipes used as sampling
rings. About 500 mg composite sample compounded of soil from 3 evenly distributed
sampling points was taken from each column 18 and 29 h as well as 3, 5, 16, 49, 51 and
76 days after inoculation. The samples were filled in 2 ml reaction tubes and stored at
-20°C for later DNA extraction and quantification. During each sampling the bioreactors
with air-born cultures were exposed for 15 min to the unsterile room air to enforce
infection, whereas the soil-born variant was sampled in a cleanbench. After each
sampling, both variants were reconnected to sterile air supply.
After day 76, the soil was removed from the reactors and air-dried for 2 weeks in a laminar
flow hood. A pH of 6.8±0.3 was measured for all variants. Afterwards soil aggregates
between 0.1 and 2.0 mm in diameter were used for analysis of POM occlusion. In addition,
a non-incubated third triplicate (SPcontrol) was analyzed in the same way.
6.3.3 DNA extraction and qPCR
DNA was extracted from 370 mg dry soil equivalent by use of a NucleoSpin® Soil Kit
(MACHEREY-NAGEL GmbH & Co. KG, Düren/Germany) following the manual
instructions. DNA sample purity, represented by 260/230 nm and 260/280 nm extinction
ratios, was determined with a NanoDrop1000 spectrophotometer (NanoDrop Products,
Wilmington, DE, USA) and assessed as free of contamination (NanoDrop, 2008).
For quantification of different phylogenetic classes (Acidobacteria, Actinobacteria, α- and
β-Proteobacteria) and domains (Archaea, Eubacteria, Fungi), a quantitative real-time PCR
with specific primer pairs (Table 6) was performed using a QuantStudio™ 12K Flex Real-
Time PCR System (Life Technologies, Grand Island, NY/USA). The reaction mix per
sample contained 4 µl of 5x HOT FIREPol® EvaGreen® HRM Mix ROX (Solis Biodyne,
Tartu/Estonia), each 0.25 µl of the proper 10 pM fwd and rev primer solution (biomers.net,
Ulm, Germany; Table 7), 14.5 µl of PCR-H2O and 1 µl of template DNA solution.
75
Advertisement
Frederick Büks (doctoral thesis 2017)
Amplification of DNA templates was executed having an initial denaturation at 95°C for
15 min followed by 40 thermocycles consisting of a denaturation at 95°C for 15 sec,
annealing for 20 sec at primer-specific temperatures listed in Table 6 and elongation at
72°C for 30 sec. PCR was checked for consistency by melting curve analysis implemented
in the QuantStudio™ 12K Flex Real-Time PCR System. Extracted DNA from standard
organisms named in Table 6 was used as DNA standard for the relevant taxa, whereas
DNA of non-target organisms from soil samples in return functioned as negative control.
Sample-DNA dilution ranged between 1:1 and 1:100 in steps of 1:10.
Table 6: Target classes and domains, appropriate primer pairs, annealing temperatures (AT) and standard
organisms for qPCR. (AWI=Alfred Wegener Institute, Helmholtz Centre for Polar and Marine Research;
DSM=German Collection of Microorganisms and Cell Cultures; ZALF=Leibniz Center for Agricultural
Landscape Research)
Target organism Primer pair AT Standard organism (origin)
Archaea Ar109f / Ar915r 57°C Methanosarcina mazei (AWI)
Acidobacteria Acido31 / Eub518 50°C Acidobacterium capsulatum (DSM11244)
Actinobacteria Actino235 / Eub518 60°C Streptomyces avermitis (DSM46492)
α-Proteobacteria Eub338 / Alf685 60°C Agrobacterium tumefaciens pGV2260 (ZALF)
β-Proteobacteria Eub338 / Bet680 60°C Burkholderia phymatum (DSM17167)
Eubacteria Eub338 / Eub518 53°C Pseudomonas putida F1 (ZALF)
Fungi ITS1f / 5.8s 52°C Verticillium dahliae EP806 (ZALF)
Table 7: Applied primer sequences for class- and domain-specific qPCR.
Primer Primer sequence Reference
5.8s 5'–CGCTGCGTTCTTCATCG–3' Fierer et al. (2005)
Acido31 5'–GATCCTGGCTCAGAATC–3' Fierer et al. (2005)
Actino235 5'–CGCGGCCTATCAGCTTGTTG–3' Stach et al. (2003)
Alf685 5'–TCTACGRATTTCACCYCTAC–3' Lane (1991)
Ar109f 5'–ACKGCTCAGTAACACGT–3' Lueders and Friedrich (2003)
Ar915r 5'–GTGCTCCCCCGCCAATTCCT–3' Lueders and Friedrich (2003)
Bet680 5'–TCACTGCTACACGYG–3' Overmann et al. (1999)
Eub338 5'–ACTCCTACGGGAGGCAGCAG–3' Lane (1991)
Eub518 5'–ATTACCGCGGCTGCTGG–3' Muyzer et al. (1993)
ITS1f 5'–TCCGTAGGTGAACCTGCGG–3' Fierer et al. (2005)
76
Soil microbial communities and POM occlusion
6.3.4 Disaggregation of soil aggregates and quantification of POC
Successive destruction of soil aggregates by ultrasonication was used to release occluded
POM from its bonding sites (Kaiser and Berhe, 2014). Therefore, in a first step, 75 ml of
1.6 g cm-3 dense sodium polytungstate solution (SPT) were added to 15 g of air-dried
SPsoil, SPair and SPcontrol soil samples. After 30 min of SPT infiltration into the soil matrix and
centrifugation at 3,569 G for 26 min, the floating free light fraction (fLF) comprising non-
occluded POM was collected by filtering the SPT solution through an 1.5 μm pore size
glass fibre filter. In a following step, the remaining soil was filled up to 75 ml SPT solution
and ultrasonicated with 50 J ml-1 using a sonotrode (Branson© Sonifier 250) to destroy
weaker aggregate bonds and release occluded POM. After centrifugation, the floating
occluded light fraction (oLF50) was collected. For this purpose, the energy output of the
sonotrode was determined by measuring the heating rate of water inside a dewar vessel
(Schmidt et al., 1999). Then again the SPT solution was filled up to 75 ml and the sample
was treated with an additional energy of 450 J ml-1. After centrifugation, the floating
occluded light fraction (oLF500) and the “sediment”, which contains stronger bound POM as
well as molecular OM adsorbed to the mineral matrix, were separated and all separated
light fractions (LFs) and sediment samples were frozen at -20°C, lyophilized, ground and
analyzed for organic carbon concentration using an Elementar Vario EL III CNS Analyzer.
As dissolved organic matter (DOM) were leached by SPT solution during the first step of
density fractionation, extracted light fraction OC is interpreted as light fraction POC.
6.3.5 Statistical analyses
The statistical analysis of microbial populations and POC release comprised the
calculation of mean values, standard deviations and analysis of variance (p<0.05). After
application of the Shapiro-Wilk test (Shapiro and Wilk, 1965) and Levene test (Lim and
Loh, 1996) samples were assumed to be normally distributed and to have variance
homogeneity. Total bacterial populations were assumed to be similar in a sample, if the
absolute difference between the DNA mean values of both variants is smaller than the
averaged standard deviation. A repeated measurement design (two-factorial ANOVA) was
used to test for significant differences of class, domain and total DNA concentrations and
shares between SPsoil and SPair within the final period (von Ende, 2001). Particulate organic
77
Advertisement
Frederick Büks (doctoral thesis 2017)
matter releases of SPsoil, SPair and SPcontrol were analyzed using one way ANOVA followed
by Tukey's test (Christensen, 1996).
6.4 Results
6.4.1 Microbial population analysis
The DNA extracted from both incubated variants shows qualitative differences in the
composition of eubacterial populations and further quantitative differences in the fungal
population. It is expressed as ng DNA per mg dry soil (ng mg-1) and includes intra- and
extracellular DNA. (Fig. 13)
The sum of total measured DNA (DNAtot=DNAEUB+DNAFUNG+DNAARCH) in SPair averages
2 ng mg-1 until day 6, increases to 13.6 ng mg-1 at day 49 and decreases again to
6.8 ng mg-1 until day 76. In contrast, SPsoil quickly increases from 2.4 ng mg-1 at the
beginning to 19.6 ng mg-1 at day 6 and then decreases to 11.4 ng mg-1. Between day 51
and 76 (final period) both variants show a parallel development, but a significant difference
in DNA abundance (p=0.049), which is mainly due to fungal DNA. However, both variants
have similar total eubacterial populations (DNAEUB, amplified with Eub338/Eub518 primer
pair) within the final period with growth curves similar to DNAtot. From day 49 to day 76 the
population densities of both variants converge. Within the final period their difference fall
below the threshold for similarity.
Fungi (DNAFUNG) show nearly no growth in SPair and remain at DNA concentrations below
0.2 ng mg-1, whereas the fungal population of SPsoil grows from 1.11 ng mg-1 at day 0 to 5.6
at day 49 and then decreases to 4.7 ng mg-1. Fungal populations of SPsoil and SPair differ
significantly within the final periode (p=0.001). In contrast, the amount of archaeal DNA
(DNAARCH) remains <0,002 ng mg-1 in both variants and does not show a significant
difference.
Some eubacterial classes show significant differences between the variants. The amount
of acidobacterial DNA differs significantly within the final period (p=0.003). While SPair does
not exceed values of 0.3 ng mg-1, the DNA concentration in SPsoil increases from
78
Soil microbial communities and POM occlusion
0.4 ng mg-1 to values between 2.19 and 3.2 ng mg-1. Actinobacteria in SPair exhibit a nearly
constant DNA concentration <0.5 ng mg-1. In contrast, the SPsoil population quickly rises to
1.7 ng mg-1 at day 6 and then decreases to 1.0 ng mg-1 at day 76. Although SPsoil shows an
in tendency higher population then SPair, differences of both variants within the final period
are not significant (p=0.067). The concentration of α-proteobacterial DNA in SPsoil quickly
rises from 0.1 ng mg-1 to 1.0 within 6 days and then decreases continuously to 0.4 ng mg-1,
whereas SPair does not exceed 0.2 ng mg-1. Within the final period there are no significant
differences between the variants (p=0.237). Among the examined eubacterial classes, only
β-Proteobacteria show a significantly higher population in SPair than in SPsoil: Until day 16
the DNA concentration in SPair remains smaller than 0.1 ng mg-1, but increases to
5.9 ng mg-1 at the end. In contrast, SPsoil quickly increases to 2.8 ng mg-1 at day 6 and then
stabilizes at around 0.9 ng mg-1.
The DNA of eubacterial taxa as a percentage of the total eubacterial DNA (Table 8) shows
a dominance of Acidobacteria in SPsoil reaching shares of 32.7% (day 51) and 36.8% (day
76), whereas values in SPair stay below 0.9% (p=0.002). Actinobacteria show a 3-fold
higher percentage of around 14.6% in SPsoil compared to SPair within the final period
(p=0.057). In SPair and SPsoil, α-Proteobacteria show percentages of around 2.4% and
5.2%, respectively, and therefore do not represent a dominant class (p=0.27). In strong
contrast, β-Proteobacteria hold increasing percentages of 79.8% and 88.1% in SPair
compared to 8.8% and 12.3% in SPsoil (p=0.023). Cumulation shows that these classes
cover 88.9% to 96.6% in SPair, mainly dominated by β-Proteobacteria, and 60.9% to 69.1%
in SPsoil, that is dominated by Acidobacteria, Actinobacteria and also Fungi. In both variants
these classes hold an increasing percentage of the total DNA over time.
79
Advertisement
Frederick Büks (doctoral thesis 2017)
80
Fig. 13: DNA concentrations of phylogenetic classes and domains in soil with natural inoculate (SPsoil) and
air-born infection (SPair) (values in ng DNA per mg dry soil; * marks samples with p<0.05; n=3)
0 10 20 30 40 50 60 70 80
0
0,5
1
1,5
2α-proteobacterial DNA
t [d]
DNA [ng/mg dry soil]
0 10 20 30 40 50 60 70 80
0
0,5
1
1,5
2archaeal DNA
SPair
SPsoil
t [d]
DNA [ng/mg dry soil]
0 10 20 30 40 50 60 70 80
0
1
2
3
4
5acidobacterial DNA*
t [d]
DNA [ng/mg dry soil]
0 10 20 30 40 50 60 70 80
0
1
2
3
4
5actinobacterial DNA
t [d]
DNA [ng/mg dry soil]
0 10 20 30 40 50 60 70 80
0
2
4
6
8
10
12
14 fungal DNA*
t [d]
DNA [ng/mg dry soil]
0 10 20 30 40 50 60 70 80
0
2
4
6
8
10
12
14 β-proteobacterial DNA*
t [d]
DNA [ng/mg dry soil]
0 10 20 30 40 50 60 70 80
0
5
10
15
20
25 total DNA
t [d]
DNA [ng/mg dry soil]
0 10 20 30 40 50 60 70 80
0
5
10
15
20
25 eubacterial DNA
t [d]
DNA [ng/mg dry soil]
Soil microbial communities and POM occlusion
Table 8: Measured eubacterial class DNA of SPair and SPsoil in relation (%)
to the total eubacterial DNA at days 49, 51 and 76. Within the final period
(day 51 to 76) the total eubacterial population is assumed to be similar
between both variants. P-values are given for comparison of shares within
the final period. (n=3)
Eubacterial class SPair SPsoil
at day 51 76 51 76 p-value
Acidobacteria 0.79 0.86 32.69 36.77 0.002
Actinobacteria 5.97 5.51 14.94 14.23 0.057
α-Proteobacteria 2.37 2.51 4.55 5.85 0.270
β-Proteobacteria 79.75 88.10 8.83 12.27 0.023
sum 88.88 96.57 60.88 69.12
6.4.2 POC release
The relative light fraction POC release Crel is defined as the ratio of the POC release at the
respective energy level (Cfrac) to the cumulative POC release of all collected light fractions
plus the sediment (Ctot), expressed by Cre=Cfrac·Ctot-1.
SPsoil and SPair do not differ in their relative fLF release, which is around 4.6% of the Ctot. In
contrast, the fLF release of SPcontrol amounts to 44.7% (Fig. 14). SPsoil releases 2.4% of the
Ctot within the oLF50, whereas SPcontrol releases 10.3% (p=0.051). SPair lies in between
releasing 6.3% without a significant difference to both. At 500 J ml-1, all variants release
similar percentages of Ctot. The POC release of SPsoil and SPair is similar to the amount
released at 50 J ml-1, whereas SPcontrol is reduced to 1.3%. SPair shows a tendency to
exceed SPsoil and SPcontrol.
The carbon content of each sediment corresponds to the sum of the respective light
fraction POC release and amounts to 92.3% (29.9 mg g-1) in SPsoil, 83.9% (26.5 mg g-1) in
SPair and 43.8% (15.8 mg g-1) in SPcontrol. Thus, only SPcontrol shows a significantly reduced
carbon content remaining in the soil matrix. In consequence, the C-release from SPsoil and
SPair does not differ significantly in any fraction (although SPair shows a tendency to
release more POC than SPsoil in both occluded light fractions). In contrast, SPcontrol loses
nearly half of its Ctot in the fLF and additional 10% after application of 50 J ml-1.
81
Advertisement
Frederick Büks (doctoral thesis 2017)
6.5 Discussion
The total eubacterial DNA in SPsoil und SPair converge between day 6 and day 49 and
match the condition for similarity between day 51 and day 76 (the final period). Also the
observed eubacterial classes in both variants seem to be established until day 51 and
show a stable or slightly decreasing population development within the final period (Fig. 8).
This development lead to a cumulative percentage of Acidobacteria, Actinobacteria, α-
Proteobacteria and β-Proteobacteria on total eubacterial DNA, that increases from 88.9%
to 96.6% in SPair and from 60.9% to 69.1% in SPsoil. It can be seen that this bundle of
eubacterial classes holds the majority in both variants and becomes increasingly
dominant. For these three reasons, the effect of named eubacterial as well as fungal and
archaeal populations on POM occlusion is discussed based on the final period.
Although there is a similar total eubacterial DNA amount, the population structure is
strongly varying between the variants: Acidobacteria and β-Proteobacteria show a
significant and Actinobacteria an in tendency but not significant difference between
variants, whereas α-Proteobacteria, which have low abundances (<6%) in both variants,
did not develop differently. Beside Eubacteria, a fungal population developed in SPsoil,
82
Fig. 14: Relative POC release of the variants SPsoil, SPair, SPcontrol at different energy
levels (0, 50, 500 J ml-1). The highest carbon release is associated with the lowest
occlusive strength of POM at the respective energy level. (n=3)
fLF oLF(50) oLF(500)
0,00
10,00
20,00
30,00
40,00
50,00
60,00 SPsoil
SPair
SPcontrol
energy level [J/ml]
POC release [Cfrac/CΣ]
Soil microbial communities and POM occlusion
whose DNA spans 27.2% to 41.4% of the total measured population (DNAtot), whereas
only very small amounts of fungal DNA were found in SPair samples. Hence, ecosystems of
both variants were dominated by strongly different microbial classes: During the final
period Acidobacteria, Actinobacteria and Fungi together hold 61.9% to 71.3% of the total
measured DNA in SPsoil. In contrast, SPair is strongly dominated by β-Proteobacteria, which
provide 79.4% to 87.3% of the total measured DNA. We conclude, that both variants differ
in their community structure within the final period. Following our hypothesis, this implies a
different POM occlusion in SPsoil and SPair.
A strong occlusion of POM during incubation becomes apparent comparing the incubated
variants with SPcontrol: The carbon content in the fLFs of SPsoil and SPair decreased, while
increased in the sediment. However, contrary to our hypothesis SPsoil and SPair do not
show a significant (p<0.05) difference of POM occlusion in any fraction, although SPsoil has
a tendency to release less POC. Even considering a relation of microbial development and
POM occlusion in single parallels, no correlation of the growth of a specific taxon and POM
occlusion was observed (data not shown). The occlusion in both variants is extensive:
Total occluded POC amounts to ~30 mg g-1 dry soil in both variants and therefore exceed
occlusion in comparable soils by four-fold (Büks and Kaupenjohann, 2016). Our POM
mainly consists of pyrochar particles <20 µm. Since Kaiser and Berhe (2014) reviewed,
that microaggregates <63 µm are stable in face of ultrasonication levels >500 J ml-1, an
occlusion within very stable microaggregates of the sediment is expected. The main
biological agent for this occlusion is most likely bacterial EPS (Six et al., 2004). Thus, in
the present study POM occlusion exceeds that of a native soil, but is most probably not
affected by the community composition.
However, triplicates usually do not provide sufficient test power to avoid type 1 and 2
errors. Therefore the convention of p<0.05 only gives a weak statement. If instead
discussing the in tendency increased POM occlusion in SPsoil as a fact, fungal glomalin
and archaeal EPS can be refused as relevant mechanisms: As AMFs are obligatory
symbionts of plant roots (Bago and Bécard, 2002), remains of glomalin might exist in the
soil sample as a remain from the field, but neither are expected to differ between the
variants nor could be enriched by fungal growth. Also archaeal EPS (Fröls, 2013) could be
excluded, since Archaea hardly exist in both variants. Low-molecular weight exudates and
biomineralization could play a role in physico-chemical POM occlusion, but chemical
83
Advertisement
Frederick Büks (doctoral thesis 2017)
diversity and unknown effect levels do not allow an estimation of their influence in the
present study.
Fungi are highly abundant in SPsoil. Therefore, wrapping of macroaggregates by fungal
hyphae is expected to enhance POM occlusion. In contrast, Actinobacteria, which are
assumed to have the capability to form microaggregates, show only slight differences
between the variants and are therefore not supposed to contribute to the occlusion of
POM. (Aspiras et al., 1971; Gasperi-Mago and Troeh, 1979; Tisdall, 1991; Bossuyt et al.,
2001)
As the broad molecular diversity of EPS (Leigh and Coplin, 1992; Votselko et al., 1993;
Allison, 1998; Al-Halbouni et al., 2009; Flemming and Wingender, 2010; Ras et al., 2011)
develops in dependency of species and environmental factors and affects viscosity, it
seems self-evident that two different complex multi-species biofilms should show different
binding strength of POM within soil aggregates. However, even assuming no influence of
other microbial binding mechanisms, the bacterial community composition seems to be
less relevant in the present study. What are the explanations?
First, relicts of the original EPS could endured drying, mechanical dispersion, γ-sterilization
and recolonization along the whole soil treatment and form a background load, which
overlays the effect of the newly built EPS on POM occlusion. This explanation for similar
POM occlusion of SPsoil and SPair seems improbable due to γ-degradation and
metabolization (Kitamikado et al., 1990; Wasikiewicz et al., 2005), but cannot finally be
ruled out in this work. More likely, the different microbial development in both incubated
variants (1) causes only a little difference in EPS molecular composition, that is not
sufficient to affect POM occlusion in large extent, or (2) the span of possible molecular EPS
compositions has in general no significant influence on the mechanical characteristics of
EPS. Furthermore, (3) despite a broad acceptance of EPS as agents of soil aggregation, its
influence could be of minor importance under certain conditions (e.g. in sandy soils). (4)
Probably, but also not tested, similar POM occlusions in both variants can be caused by a
multi-species balancing mechanisms, in which a loss of coherence due to the dominance
of one group of taxa is compensated by another group.
Our results only give a first insight to the relation of microbial community composition and
POM occlusion. A more quantitative analysis would require more replicate samples,
manifold microbial communities and probably soils from different land use. This was
84
Soil microbial communities and POM occlusion
beyond the scope of the present study. Our findings show that soil-microbial ecosystems
with vastly different community structures can develop a nearly similar grade of POM
occlusion. This implies that soil ecosystems could be able to compensate the influence of
population shifts on POM occlusion.
6.6 Conclusions
Our incubation experiment demonstrated the possibility to breed stable soil aggregates in
the laboratory within 3 month. However, our hypothesis was not supported by the data.
After 76 days of incubation, two variants of the same sandy agricultural soil (Su3)
established a similar total eubacterial abundance, but different community structures one
strongly dominated by β-Proteobacteria, the other one by Acidobacteria, Actinobacteria
and Fungi. Structural differences between these microbial communities did not cause
significant differences in the occlusion of POM. This leads to the tentative assumption that
POM occlusion in agricultural soils could be resilient in face of changing microbial
communities. Nonetheless, a population shift can affect e.g. soil metabolic characteristics.
Therefore, the state of the soil microbial community should remain in focus of agricultural
practice.
6.7 Acknowledgements
This project was financially supported by the Leibnitz-Gemeinschaft (SAW Pact for
Research, SAW-2012-ATB-3). We are also grateful to our students Kathrein Fischer,
Christine Hellerström, Annabelle Kallähne, Paula Nitsch, Susann-Elisabeth Schütze, Anne
Timm and Karolin Woitke for pre-trials and soil preparation.
85
Advertisement
Frederick ks (doctoral thesis 2017)
86
Soil microbial communities and POM occlusion
7 Synthesis and conclusions
7.1 Single experiments
The present experiments show only little or even no significant effects of microbial binding
factors on the POM occlusion in a sandy agricultural soil.
Enzymatic treatment. The treatment of aggregate samples with a highly concentrated
enzymatic solution shows no significantly (p<0.05) enhanced POM release compared to
the control. But, there is a tendency for the reduction of POM occlusive strength. This
POM detachment is attributed to the enzymatic digestion of bacterial EPS. However, the
concomitant low additional release of DNA from intact bacterial cells confirms an
incomplete detachment and/or that the majority of cells within aggregates is not fixed by
EPS, but e.g. by occlusion. Following Ranjard and Richaume (2001), a majority of soil
bacteria is located in pores <9 µm in microaggregates <100 µm. Also Monrozier et al.
(1991) found 39 to 60% of the microbial biomass associated with microaggregates
<30 µm. This could explain the lack of POM release by the inaccessibility of bacterial EPS
for diffusing enzyme molecules: After pre-incubation, smaller mesopores are already filled
with soil solution, so that in contrast to macropores and larger mesopores enzymes do
not reach via convection, but only diffusively. In consequence, enzyme migration into small
mesopores is hindered, whereas larger pores are easily accessible for enzymes and
susceptible for instant enzymatic digestion of EPS components. By comparison, enzymatic
plus mechanical treatment led to accessibility of inner aggregate EPS and a significantly
higher cell release compared to pure mechanical and my enzymatic detachment
(Böckelmann et al., 2003).
In conclusion, the enzymatic treatment of extracellular polymers within the larger meso-
and macropore space has little effect on POM occlusion. This indicates little influence of
EPS on POM occlusive strength within the aggregate-hierarchical level of
macroaggregates and matches current assumtions (Chenu and Stotzky, 2002). The slight
additional POM release after application of the highest enzyme concentration mainly
originates from strongly bound POM (>150 J ml-1) of the sediment fraction and points to
the destabilization of stable macroaggregates (Kaiser and Berhe, 2014). However, the
87
Advertisement
Frederick Büks (doctoral thesis 2017)
effect on small mesopores could not be determinded due to little diffusive accessibility and
additionally depends on the amount of POM occluded in these aggregate regions.
Nematode grazing. The missing influence of a stable, fertile and grazing population of the
bacterial-feeding Nematode Acrobeloides buetschlii on the composition and abundance of
the bacterial community as well as on POM release conflicts with the initial hypothesis,
that grazing on bacterial biofilms and EPS would reduce the strength of POM bonds with
mineral particles. Like in the former experiment, this lack of effect might be caused by the
inaccessibility of the finer mesopore space. Restricted by its body diameter, A. buetschlii is
not able to enter small mesopores. In consequence, grazing is restricted to larger pores,
where the influence of bacterial biofilms and EPS on POM occlusive strength is assumed
to be insignificant (Chenu and Stotzky, 2002). As all samples showed a natural bacterial
population density derived from the PLFA concentrations, the results underpin the idea of
small mesopores as relevant retreat habitat for soil bacteria. However, the results give no
information if micropore-protected bacterial colonies are a relevant factor of aggregate
formation and POM occlusion within microaggregates. In addition, this experiment gives
no information about long-term influences of bacterial-feeding on POM occlusion, e.g. by
nematodal excretion and microbial population shifts.
Microbial communities. After incubation with two different microbial populations the
inoculated variants showed a significant increase of occluded biochar particles (POM
analogue), which is, however, not affected by the composition of the microbial community.
Tendencies of decreased POM release in the soil-born variant can be explained with the
high abundance of fungi, which are assumed to be an important biological factor of
macroaggregate formation. This, on the other hand, points to a negligible influence of the
bacterial community composition on POM occlusion in any pore size class, especially
within microaggregates, that are inaccessible for fungal hyphae (Chenu and Stotzky,
2002).
88
Soil microbial communities and POM occlusion
7.2 Statistical restrictions
Due to the little number of replicates within each variant, the analysis of these data suffer
from restrictions regarding the perceptibility of significance of the observed results:
Originally p-values were intended to support the estimation of statistical significance by
ranking given results on a scale of probability for the rejection of an actually true null
hypothesis (H0) (Fisher, 1925). Later p-values were conventionalized by means of
accepting p<0.05 and p<0.01 as sharp threshold values to distinguish between
insignificance, significance and strong significance, respectively (Biau et al., 2010). Beside
the obvious disutility of accepting data with for instance p=0.049 as statistically
insignificant and such of p=0.051 as significant, solely use of p-values hold insufficiencies
not only in the analysis of variants with little parallels. Nonsignificance never means a lack
of difference between variants (Goodman, 2008): For example, high variance between
parallels can result in p>0.05, although compared means are largely different and the
effect size is large (Zhu, 2016). Higher validity of statistical analyses can be reached by
use of further statistical markers. Whereas, on one hand, the p-value indicates the type-I
error, the probability of erroneously accepting the null hypothesis (also known as type-II
error) is given by the test power (1-β) (Biau et al., 2010). The test power increases with
decreasing variance within each variant as well as increasing |μAB| (the difference
between the means of the compared variants) and number of samples. Furthermore, even
in cases of few parallels, the effect size give information about the importance of the
difference between the compared variants in face of their amount and and give substantial
information about the relevance of found data even in case of p>0.05 (Cohen, 1988; Zhu,
2016).
In the present thesis, the released POM fractions of the enzymatic treatment and microbial
community experiments show a broad variance within samples of each variant.
Differences between the variants of these experiments are not significant (p>0.05), but
show a high effect size comparing E0 and E4 (d=0.98) as well as SPsoil and SPair (d=1.25)
at 50 J ml-1 applying Cohens d-test for single comparison (Cohen, 1988). The test power
for one way analysis of variance (ANOVA) was not calculated, but is most probably low
due to few parallels, high variance and small differences between the means of the
variants. In conclusion, the present results show tendencies with increased probability of
89
Advertisement
Frederick Büks (doctoral thesis 2017)
type-I errors. Hence, on the statistical level this work represents the standard problem of
environmental research: little money, little time, little parallels, little explanatory power by
applied statistics.
7.3 General conclusion
In soils there is no fundamental hindrance for bacteria or fungi to colonize any surface,
which is not in a pore smaller than the cell's size or fully covert by other particles.
Therefore, biofilms, EPS residues and further microbial binding factors are expected to
appear both in smaller mesopores and on particle surfaces within larger pores and could
therefore potentially be effective in both micro- and macroaggregates.
The distribution of bacterial biomass between these smaller and larger pore size ranges
most probably depends on factors such as soil texture, chemical and biological
composition, that affect the appearance of niches, predators and nutrient supply. Sandy
soils contain 30±10% of pores >10 µm (Blume et al., 2015), which allow free motion of
nematodes within the soil pore volume, whereas finer texture hinders nematode motion
and less likely provide a network of accessible pores for unhindered grazing (Wallace,
1968). The microbial biomass of a sandy soil is therefore prone to grazing and assumed to
be concentrated in small protective mesopores.
Soil respiration, PLFA concentrations and DNA amounts point to a microbial population
density, which is in the normal range of sandy soils. As biofilms and EPS residues of larger
pores are accessible and susceptible to enzymatic and trophic treatments, an influence on
POM occlusive strength should be measurable, if these substances have influence on
POM occlusion within the named pore size range. By reason that this is not the case, my
results can be interpreted in two ways:
(1) The enzymatic detachment, grazing and population changes in the upper mesopore
scale and beyond are of minor relevance for the strength of POM occlusion. The part of
the bacterial population, which is important for soil aggregation and POM occlusion, might
live in smaller mesopores <10 µm of microaggregates, where microbial binding factors
90
Soil microbial communities and POM occlusion
play a relevant role for aggregation, as assumed by different authors (Tisdall, 1994; Six et
al., 2004; Bronick and Lal, 2005).
(2) Within the probed sandy soil biofilms, EPS, bacterial exudates and residues have no
influence at all neither in smaller mesopores nor in the pore space above. This
interpretation conflicts with the established model but matches data of Foster (1988), who
did not find any biofilms within sandy soils.
However, the influence of microbial binding factors in smaller mesopores remained non-
proven in the present work due to methodological reasons and have to be part of future
research.
The third experiment furthermore shows the minor influence of microbial aggregation
factors resulting from different populations within the whole pore size range. This most
likely results from little differences in the rheological properties of EPSs with different
composition as well as other binding factors and do not affect POM occlusive strength.
Different soils varying in content, composition, distribution and physico-chemical
properties of their OM and mineral phase most likely do not release the same amount or
share of OM when treated with the same mechanical stress. Cerli et al. (2012) addressed
this problem in their comprehensive work about separation of operational OM fractions.
However, in the present study aggregate samples do not differ in their chemical
composition, while the applied treatments are used to selectively alter the influence of the
microbial community on physico-chemical binding properties. For that reason, the POM
occlusive strength is interpretable as proportional to aggregate stability when restricted to
soils with the same structural abilities. In consequence, enzymatic and trophic treatment of
biofilms/EPS as well as the two different microbial populations are assumed to have no
influence on aggregate stability.
The results of the present thesis underpin the future focus on microaggregates. Precise
differentiation of specific intra-microaggregate POM from other occluded POM and
mineral-associated OM is a challenging task, some authors estimated this fraction to
comprise 10 to 30% of the total POM in different soils (Besnard et al., 1996; O'Brien and
Jastrow, 2013) and up to 90% of the occluded POM in aggregates (Six et al., 2000). Given
this high proportion, to understand the contribution of microbial communities to the intra-
microaggregate occlusion of POM with all its ecological functions is an important task for
the research and practice on soil fertility in agriculture.
91
Advertisement
Frederick Büks (doctoral thesis 2017)
7.4 Transferability to other soils
Silty sand (Su3) from the topsoil of the agricultural test site was used in all three
experiments. The samples showed a high sand and a low clay content (~72% and ~4%,
respectively), a low organic carbon content (~0.9%, with exception of the microbial
community experiment) and a low microbial carbon content of about 176 mg C kg-1 soil,
which is on the bottom of Cmic values for agricultural soils (Blume et al., 2015). Compared
to soils with larger silt, clay and OM content, the soil samples contain less than half of the
microbial population density (Anderson and Domsch, 1989; Anderson and Domsch, 2010),
hence with lower capability of EPS production. Microbial biomass correlates to the organic
matter and the clay content of soils (Schnürer et al., 1985; Anderson and Domsch, 1989)
and benefits from the amount of protective niches (Chenu et al., 2001), which is increased
in soils with finer texture. Therefore it could be argued, that microbial binding factors have
minor effect on aggregate stability and POM occlusion in soils, which are poor in clay and
OM. Assuming higher occlusive strength of POM in soil types with higher content of those
aggregation agents, future investigation on agricultural topsoils such as from Cambisols,
Luvisols or Chernozems might be proper to get more general insight into the function of
microbial communities in POM occlusion (Zech et al., 2014).
7.5 Future research
Aggregated soils with increased silt and clay content show a shift of the pore size
distribution towards smaller pores (Blume et al., 2015) leading to enhance the effect of
diffusion hindrance of macromolecules. In consequence, both the evaluation of the results
from the enzymatic experiment on the basis of statistically significant re-measurements
and the analyses of further soil types for micro- and macroaggregate occlusion of POM
require a preceding test procedure to optimize the application time of enzymes. The object
is to reach a preferably complete diffusion of enzymes into the whole pore space >0.3 µm
without significant reduction of POM mass by enzymatic digestion of organic surfaces.
92
Soil microbial communities and POM occlusion
Just like the diffusion behavior of macromolecules, the development of the microbial
community strongly depends on the soil type (Bossio et al., 1998; Buyer et al., 2002).
However, there is a lack of comprehensive studies both on the composition and
distribution of bacterial, archaeal and fungal phyla within aggregates of different soils.
Ecotyping on microbial phyla, their metabolic and physical properties (such as EPS
excretion, production of hydrophobic substances, entangling abilities and
biomineralization), their localization within the aggregate structure (inside
microaggregates, between microaggregates, on macroaggregate surfaces and outside of
aggregates) and knowledge about specific microbial community compositions at different
surfaces (POM, mineral surfaces, pyrochar, microplastic) could give insights in the
influence of microorganisms on the binding of soil particles, the aggregation processes
and the occlusion of POM.
In addition, grazing organisms might influence the potential of microbial phyla in accessible
pore space by depleting target populations and hold them in equilibrated permanent
growth. Results of the present work showed, that even small Nematodes like A. buetschlii
might be unable to influence bacterial populations within pores of 0.3 to 12.5 µm in
diameter. Following Griffiths et al. (1999), smaller protozoal grazers are able to reach
bacterial populations within microaggregates and could be used for further investigation on
the relation of biofilm/EPS grazing and aggregation of soil particles. Furthermore, selective
grazing of different protozoal taxa might give information about special roles of bacterial,
fungal and archaeal prays on the stabilization of aggregates.
At the instrumental level, the water content has large influence on aggregate stability and
in consequence on POM occlusive strength. Extensive analyses of various samples often
require storage of air-dried soil samples. To avoid slaking and further mechanical damage
by fast re-wetting, a device is needed to slowly increase the water content of soil
aggregates to a constant value (e.g. via filter plates) and directly perform
ultrasonication/density fractionation without destructive transfer to other tubes. This gentle
treatment is assumed to reduce variability of POM releases caused by undesired
mechanical disruption.
Future knowledge about the role of microorganisms in soil aggregate stabilization will
contribute to predictions about related soil fertility factors as a consequence of e.g. land-
use changes, application of biocides, climatic or seasonal changes. Future agriculturalists
93
Advertisement
Frederick Büks (doctoral thesis 2017)
might be enabled to optimize their food production allowing for microbial communities and
their effects on the soil-plant system.
94
Soil microbial communities and POM occlusion
References
Abröll, C., Kurth, T., Langer, T., Munk, K.and Nethe-Jaenchen, R.: Biochemie-Zellbiologie,
Georg Thieme Verlag, 2008.
Absolom, D. R., Lamberti, F. V., Policova, Z., Zingg, W., van Oss, C. J. and Neumann, A.:
Surface thermodynamics of bacterial adhesion, Appl. Environ. Microbiol., 46, 90--97,
1983.
Achtenhagen, J., Goebel, M.-O., Miltner, A., Woche, S. K. and Kästner, M.: Bacterial
impact on the wetting properties of soil minerals, Biogeochemistry, 122, 269--280, 2015.
Ackermann, M., Prill, P. and Ruess, L.: Disentangling nematode-bacteria interactions using
a modular soil model system and biochemical markers, Nematology, 18, 403--415, 2016.
Acosta-Martinez, V. and Tabatabai, M.: Enzyme activities in a limed agricultural soil,
Biology and Fertility of soils, 31, 85--91, 2000.
Agnelli, A., Ascher, J., Corti, G., Ceccherini, M. T., Nannipieri, P. and Pietramellara, G.:
Distribution of microbial communities in a forest soil profile investigated by microbial
biomass, soil respiration and DGGE of total and extracellular DNA, Soil Biology and
Biochemistry, 36, 859--868, 2004.
Alaoui, A., Lipiec, J. and Gerke, H.: A review of the changes in the soil pore system due to
soil deformation: A hydrodynamic perspective, Soil and Tillage Research, 115-116, 1--15,
2011.
Al-Halbouni, D., Dott, W. and Hollender, J.: Occurrence and composition of extracellular
lipids and polysaccharides in a full-scale membrane bioreactor, water research, 43, 97--
106, 2009.
Allison, D. G.: Exopolysaccharide production in bacterial biofilms, Biofilm Journal, 3, 1998.
Anderson, T.-H. and Domsch, K. H.: Ratios of microbial biomass carbon to total organic
carbon in arable soils, Soil biology and biochemistry, 21, 471--479, 1989.
Anderson, T.-H. and Domsch, K. H.: Soil microbial biomass: the eco-physiological
approach, Soil Biology and Biochemistry, 42, 2039--2043, 2010.
Ashman, M., Hallett, P., Brookes, P. and Allen, J.: Evaluating soil stabilisation by biological
processes using step-wise aggregate fractionation, Soil and Tillage Research, 102, 209--
215, 2009.
Aspiras, R., Allen, O., Harris, R. and Chesters, G.: Aggregate stabilization by filamentous
microorganisms., Soil Science, 112, 282--284, 1971.
95
Advertisement
Frederick Büks (doctoral thesis 2017)
Atlas, R. M.: Handbook of microbiological media, CRC press, 2010.
Ayala-Hernández, I., Hassan, A., Goff, H., de Orduña, R. M. and Corredig, M.: Production,
isolation and characterization of exopolysaccharides produced by Lactococcus lactis
subsp. cremoris JFR1 and their interaction with milk proteins: Effect of pH and media
composition, International dairy journal, 18, 1109--1118, 2008.
Bago, B. & Bécard, G. 2002. Bases of the obligate biotrophy of arbuscular mycorrhizal
fungi. In: Mycorrhizal Technology in Agriculture, 33--48, Springer
Baisden, W., Amundson, R., Cook, A. and Brenner, D.: Turnover and storage of C and N in
five density fractions from California annual grassland surface soils, Global
Biogeochemical Cycles, 16, 2002.
Baldock, J.: Interactions of organic materials and microorganisms with minerals in the
stabilization of soil structure, in: Interactions between Soil Particles and Microorganisms -
Impact on the Terrestrial Ecosystem, 84--129, John Wiley&Sons, Ltd: Chichester, West
Sussex, UK, 2002.
Ball, B. and Robertson, E.: Effects of uniaxial compaction on aeration and structure of
ploughed or direct drilled soils, Soil and Tillage research, 31, 135--148, 1994.
Barthes, B. and Roose, E.: Aggregate stability as an indicator of soil susceptibility to runoff
and erosion; validation at several levels, Catena, 47, 133--149, 2002.
Basile-Doelsch, I., Amundson, R., Stone, W., Borschneck, D., Bottero, J.-Y., Moustier, S.,
Masin, F. and Colin, F.: Mineral control of carbon pools in a volcanic soil horizon,
Geoderma, 137, 477--489, 2007.
Battin, T. J., Sloan, W. T., Kjelleberg, S., Daims, H., Head, I. M., Curtis, T. P. and Eberl, L.:
Microbial landscapes: new paths to biofilm research, Nat. Rev. Microbiol., 5, 76--81, 2007.
Baumgartl, T. and Horn, R.: Effect of aggregate stability on soil compaction, Soil and
Tillage Research, 19, 203--213, 1991.
Baver, L. and Rhoades, H.: Aggregate analysis as an aid in the study of soil structure
relationships, Journal of the American Society of Agronomy, 24, 920-930, 1932.
Beare, M., Hu, S., Coleman, D. and Hendrix, P.: Influences of mycelial fungi on soil
aggregation and organic matter storage in conventional and no-tillage soils, Applied Soil
Ecology, 5, 211--219, 1997.
Beare, M. H. and Bruce, R. R.: A comparison of methods for measuring water-stable
aggregates: implications for determining environmental effects on soil structure,
Geoderma, 56, 87--104, 1993.
96
Soil microbial communities and POM occlusion
Bedini, S., Pellegrino, E., Avio, L., Pellegrini, S., Bazzoffi, P., Argese, E. and Giovannetti,
M.: Changes in soil aggregation and glomalin-related soil protein content as affected by
the arbuscular mycorrhizal fungal species Glomus mosseae and Glomus intraradices, Soil
Biology and Biochemistry, 41, 1491--1496, 2009.
Béjar, V., Llamas, I., Calvo, C. and Quesada, E.: Characterization of exopolysaccharides
produced by 19 halophilic strains of the species Halomonas eurihalina, Journal of
biotechnology, 61, 135--141, 1998.
Bengough, A. and Mullins, C.: Mechanical impedance to root growth: a review of
experimental techniques and root growth responses, Journal of soil science, 41, 341--358,
1990.
Bennie, A. and Burger, R. d. T.: Penetration resistance of fine sandy apedal soils as
affected by relative bulk density, water content and texture, South African Journal of Plant
and Soil, 5, 5--10, 1988.
Besnard, E., Chenu, C., Balesdent, J., Puget, P. and Arrouays, D.: Fate of particulate
organic matter in soil aggregates during cultivation, European Journal of Soil Science, 47,
495--503, 1996.
Biau, D. J., Jolles, B. M. and Porcher, R.: P value and the theory of hypothesis testing: an
explanation for new researchers, Clinical Orthopaedics and Related
Researchtextregistered, 468, 885--892, 2010.
Bissonnais, Y. L.: Aggregate stability and assessment of soil crustability and erodibility: I.
Theory and methodology, European Journal of soil science, 47, 425--437, 1996.
Blume, H., Brümmer, G., Fleige, H., Horn, R., Kandeler, E., Kögel-Knabner, I.,
Kretzschmar, R., Stahr, K.and Wilke, B.: Scheffer/Schachtschabel Soil Science, Springer
Berlin Heidelberg, 2015.
Böckelmann, U., Szewzyk, U. and Grohmann, E.: A new enzymatic method for the
detachment of particle associated soil bacteria, J. Microbiol. Methods, 55, 201--211, 2003.
Bongers, T.: De Nematoden van Nederland Koninklejke Nedelandse Natuuhistorische
Vereniging, Stichting Uitgeverij van de Koninklijke Natuurhistorische Vereniging Utrecht,
1994.
Bonkowski, M.: Protozoa and plant growth: the microbial loop in soil revisited, New
Phytologist, 162, 617--631, 2004.
Borowik, A. and Wyszkowska, J.: Impact of temperature on the biological properties of soil,
International Agrophysics, 30, 1--8, 2016.
97
Advertisement
Frederick Büks (doctoral thesis 2017)
Bossio, D. A., Scow, K. M., Gunapala, N. and Graham, K.: Determinants of soil microbial
communities: effects of agricultural management, season, and soil type on phospholipid
fatty acid profiles, Microbial ecology, 36, 1--12, 1998.
Bossuyt, H., Denef, K., Six, J., Frey, S., Merckx, R. and Paustian, K.: Influence of microbial
populations and residue quality on aggregate stability, Applied Soil Ecology, 16, 195--208,
2001.
Bratbak, G. and Dundas, I.: Bacterial dry matter content and biomass estimations, Appl.
Environ. Microbiol., 48, 755--757, 1984.
Braunack, M., Hewitt, J. and Dexter, A.: Brittle fracture of soil aggregates and the
compaction of aggregate beds, Journal of Soil Science, 30, 653--667, 1979.
Brauns, A.: Praktische Bodenbiologie, G. Fischer Verlag: Stuttgart, Germany, 1--470,
1968.
Brodowski, S., John, B., Flessa, H. and Amelung, W.: Aggregate-occluded black carbon in
soil, European Journal of Soil Science, 57, 539--546, 2006.
Brodowski, S., John, B., Flessa, H. and Amelung, W.: Aggregate-occluded black carbon in
soil, European Journal of Soil Science, 57, 539--546, 2006.
Bronick, C. J. and Lal, R.: Soil structure and management: a review, Geoderma, 124, 3--
22, 2005.
Brown, G. G., Barois, I. and Lavelle, P.: Regulation of soil organic matter dynamics and
microbial activity in the drilosphere and the role of interactions with other edaphic
functional domains, European Journal of Soil Biology, 36, 177--198, 2000.
Büks, F. and Kaupenjohann, M.: Enzymatic biofilm digestion in soil aggregates facilitates
the release of particulate organic matter by sonication, SOIL Journal, 2, 499-509, 2016.
Burns, R. G., DeForest, J. L., Marxsen, J., Sinsabaugh, R. L., Stromberger, M. E.,
Wallenstein, M. D., Weintraub, M. N. and Zoppini, A.: Soil enzymes in a changing
environment: current knowledge and future directions, Soil Biology and Biochemistry, 58,
216--234, 2013.
Buyer, J. S., Roberts, D. P. and Russek-Cohen, E.: Soil and plant effects on microbial
community structure, Canadian Journal of Microbiology, 48, 955--964, 2002.
Celik, G. Y., Aslim, B. and Beyatli, Y.: Characterization and production of the
exopolysaccharide (EPS) from Pseudomonas aeruginosa G1 and Pseudomonas putida
G12 strains, Carbohydrate polymers, 73, 178--182, 2008.
98
Soil microbial communities and POM occlusion
Cerli, C., Celi, L., Kalbitz, K., Guggenberger, G. and Kaiser, K.: Separation of light and
heavy organic matter fractions in soil—Testing for proper density cut-off and dispersion
level, Geoderma, 170, 403--416, 2012.
Chang, W.-S., van de Mortel, M., Nielsen, L., de Guzman, G. N., Li, X. and Halverson, L.
J.: Alginate production by Pseudomonas putida creates a hydrated microenvironment and
contributes to biofilm architecture and stress tolerance under water-limiting conditions,
Journal of bacteriology, 189, 8290--8299, 2007.
Chaudhari, P. R., Ahire, D. V., Ahire, V. D., Chkravarty, M. and Maity, S.: Soil bulk density
as related to soil texture, organic matter content and available total nutrients of Coimbatore
soil, International Journal of Scientific and Research Publications, 3, 1--8, 2013.
Chenu, C. 1995. Extracellular polysaccharides: an interface between microorganisms and
soil constituents. In: Environmental Impact of Soil Component Interactions - Natural and
Anthropogenic Organics, 217--233, CRC Press, London
Chenu, C. and Cosentino, D.: Microbial regulation of soil structural dynamics, The
architecture and biology of soils: life in inner space, 37--70, 2011.
Chenu, C., Hassink, J. and Bloem, J.: Short-term changes in the spatial distribution of
microorganisms in soil aggregates as affected by glucose addition, Biology and Fertility of
Soils, 34, 349--356, 2001.
Chenu, C. and Roberson, E.: Diffusion of glucose in microbial extracellular polysaccharide
as affected by water potential, Soil Biology and Biochemistry, 28, 877--884, 1996.
Chenu, C. and Stotzky, G.: Interactions between microorganisms and soil particles: an
overview, in: Interactions between Soil Particles and Microorganisms: Impact on the
Terrestrial Ecosystem, 1--40, IUPAC Series on Analytical and Physical Chemistry of
Environmental Systems, 2002.
Chepil, W. and Bisal, F.: A Rotary Sieve Method for Determining the Size Distribution of
Soil Clods., Soil Science, 56, 95--100, 1943.
Christensen, O.: An Index of Friability of Soils., Soil Science, 29, 119--136, 1930.
Christensen, R. 1996. One-way ANOVA. In: Plane Answers to Complex Questions, 79--93,
Springer
Cleveland, C. C. and Liptzin, D.: C: N: P stoichiometry in soil: is there a “Redfield ratio” for
the microbial biomass?, Biogeochemistry, 85, 235--252, 2007.
Cohen, J.: Statistical power analysis for the behavioral sciences Lawrence Earlbaum
Associates, Hillsdale, NJ, 20--26, 1988.
99
Advertisement
Frederick Büks (doctoral thesis 2017)
Cooper, A. and Morgan, H.: Improved fluorometric method to assay for soil lipase activity,
Soil biology and biochemistry, 13, 307--311, 1981.
Costerton, J. W., Lewandowski, Z., Caldwell, D. E., Korber, D. R. and Lappin-Scott, H. M.:
Microbial biofilms, Annual Reviews in Microbiology, 49, 711--745, 1995.
Crow, S. E., Swanston, C. W., Lajtha, K., Brooks, J. R. and Keirstead, H.: Density
fractionation of forest soils: methodological questions and interpretation of incubation
results and turnover time in an ecosystem context, Biogeochemistry, 85, 69--90, 2007.
Crum, L. A.: Comments on the evolving field of sonochemistry by a cavitation physicist,
Ultrasonics Sonochemistry, 2, S147--S152, 1995.
Czarnes, S., Hallett, P., Bengough, A. and Young, I.: Root-and microbial-derived mucilages
affect soil structure and water transport, European Journal of Soil Science, 51, 435--443,
2000.
Das, T., Sehar, S., Koop, L., Wong, Y. K., Ahmed, S., Siddiqui, K. S. and Manefield, M.:
Influence of calcium in extracellular DNA mediated bacterial aggregation and biofilm
formation, PloS one, 9, 2014.
Das, T., Sehar, S. and Manefield, M.: The roles of extracellular DNA in the structural
integrity of extracellular polymeric substance and bacterial biofilm development,
Environmental microbiology reports, 5, 778--786, 2013.
Davey, M. E. and O'toole, G. A.: Microbial biofilms: from ecology to molecular genetics,
Microbiol. Mol. Biol. Rev., 64, 847--867, 2000.
De Mesel, I., Derycke, S., Moens, T., Van der Gucht, K., Vincx, M. and Swings, J.: Top-
down impact of bacterivorous nematodes on the bacterial community structure: a
microcosm study, Environmental Microbiology, 6, 733--744, 2004.
DeFlaun, M. F., Paul, J. H. and Jeffrey, W. H.: Distribution and molecular weight of
dissolved DNA in subtropical estuarine and oceanic environments, Marine Ecology-
Progress Series, 38, 65-73, 1987.
Delmont, T. O., Francioli, D., Jacquesson, S., Laoudi, S., Mathieu, A., Nesme, J.,
Ceccherini, M. T., Nannipieri, P., Simonet, P. and Vogel, T. M.: Microbial community
development and unseen diversity recovery in inoculated sterile soil, Biology and Fertility
of Soils, 50, 1069--1076, 2014.
Dexter, A.: Advances in characterization of soil structure, Soil and tillage research, 11,
199--238, 1988.
Di Bonaventura, G., Piccolomini, R., Paludi, D., D’orio, V., Vergara, A., Conter, M. and
Ianieri, A.: Influence of temperature on biofilm formation by Listeria monocytogenes on
100
Soil microbial communities and POM occlusion
various food-contact surfaces: relationship with motility and cell surface hydrophobicity,
Journal of applied microbiology, 104, 1552--1561, 2008.
DIN/ISO: 11277 Soil quality—determination of particle size distribution in mineral soil
material—method by sieving and sedimentation, DIN Deutsches Institut für Normung e.V.,
Beuth, 2002.
Donlan, R. M.: Biofilms: microbial life on surfaces, Emerg Infect Dis, 8, 2002.
Drążkiewicz, M.: Distribution of microorganisms in soil aggregates: effect of aggregate
size, Folia microbiologica, 39, 276--282, 1994.
Driver, J. D., Holben, W. E. and Rillig, M. C.: Characterization of glomalin as a hyphal wall
component of arbuscular mycorrhizal fungi, Soil Biology and Biochemistry, 37, 101--106,
2005.
Edwards, A. and Bremner, J.: Dispersion of Soil Particles by Sonic Vibration, Journal of
Soil Science, 18, 47--63, 1967b.
Edwards, A. P. and Bremner, J.: Microaggregates in Soils, Journal of Soil Science, 18, 64--
73, 1967a.
Eivazi, F. and Tabatabai, M.: Glucosidases and galactosidases in soils, Soil Biology and
Biochemistry, 20, 601--606, 1988.
von Ende, C. N.: Repeated-measures analysis, Design and analysis of ecological
experiments. Oxford University Press, Oxford, 134--157, 2001.
Eusterhues, K., Wagner, F. E., Häusler, W., Hanzlik, M., Knicker, H., Totsche, K. U., Kögel-
Knabner, I. and Schwertmann, U.: Characterization of ferrihydrite-soil organic matter
coprecipitates by X-ray diffraction and Mossbauer spectroscopy, Environmental science &
technology, 42, 7891--7897, 2008.
Farres, P. and Cousen, S.: An improved method of aggregate stability measurement, Earth
Surface Processes and Landforms, 10, 321--329, 1985.
Ferris, H.: Contribution of nematodes to the structure and function of the soil food web, J.
Nematol, 42, 63--67, 2010.
Ferris, H., Lau, S. and Venette, R.: Population energetics of bacterial-feeding nematodes:
respiration and metabolic rates based on CO2 production, Soil Biology and Biochemistry,
27, 319--330, 1995.
Fierer, N., Jackson, J. A., Vilgalys, R. and Jackson, R. B.: Assessment of soil microbial
community structure by use of taxon-specific quantitative PCR assays, Appl. Environ.
Microbiol., 71, 4117--4120, 2005.
101
Advertisement
Frederick Büks (doctoral thesis 2017)
Fierer, N., Schimel, J. and Holden, P.: Influence of drying-rewetting frequency on soil
bacterial community structure, Microbial ecology, 45, 63--71, 2003.
Fisher, R.: Statistical Methods For Research Workers, Cosmo Publications, 1925.
Flemming, H.-C. and Wingender, J.: Relevance of microbial extracellular polymeric
substances (EPSs)-Part I: Structural and ecological aspects, Water science and
technology, 43, 1--8, 2001.
Flemming, H.-C. and Wingender, J.: The biofilm matrix, Nat. Rev. Microbiol., 8, 623--633,
2010.
Fokom, R., Adamou, S., Teugwa, M., Boyogueno, A. B., Nana, W., Ngonkeu, M.,
Tchameni, N., Nwaga, D., Ndzomo, G. T. and Zollo, P. A.: Glomalin related soil protein,
carbon, nitrogen and soil aggregate stability as affected by land use variation in the humid
forest zone of south Cameroon, Soil and Tillage Research, 120, 69--75, 2012.
Foster, R.: Microenvironments of soil microorganisms, Biology and fertility of soils, 6, 189--
203, 1988.
Francis, P. and Cruse, R.: Soil water matric potential effects on aggregate stability, Soil
Science Society of America Journal, 47, 578--581, 1983.
Fraser, C., Alm, E. J., Polz, M. F., Spratt, B. G. and Hanage, W. P.: The bacterial species
challenge: making sense of genetic and ecological diversity, Science, 323, 741--746,
2009.
Freckman, D. W.: Bacterivorous nematodes and organic-matter decomposition,
Agriculture, Ecosystems & Environment, 24, 195--217, 1988.
Frey, F.: Über die Eignung von Acrobeloides buetschlii (Cephalobidae) für nematologische
Laboruntersuchungen, Nematologica, 17, 474--477, 1971.
Friese, C. F. and Allen, M. F.: The spread of VA mycorrhizal fungal hyphae in the soil:
inoculum types and external hyphal architecture, Mycologia, 409--418, 1991.
Fröls, S.: Archaeal biofilms: widespread and complex, Biochemical Society Transactions,
41, 393--398, 2013.
Frostegård, Å. and Bååth, E.: The use of phospholipid fatty acid analysis to estimate
bacterial and fungal biomass in soil, Biology and Fertility of Soils, 22, 59--65, 1996.
Frostegård, Å., Tunlid, A. and Bååth, E.: Microbial biomass measured as total lipid
phosphate in soils of different organic content, Journal of Microbiological Methods, 14,
151--163, 1991.
102
Soil microbial communities and POM occlusion
Frostegård, Å., Tunlid, A. and Bååth, E.: Phospholipid fatty acid composition, biomass, and
activity of microbial communities from two soil types experimentally exposed to different
heavy metals, Applied and Environmental Microbiology, 59, 3605--3617, 1993.
Gale, W., Cambardella, C. and Bailey, T.: Root-derived carbon and the formation and
stabilization of aggregates, Soil Science Society of America Journal, 64, 201--207, 2000.
Gasperi-Mago, R. R. and Troeh, F. R.: Microbial effects on soil erodibility, Soil Science
Society of America Journal, 43, 765--768, 1979.
Geoghegan, M. and Brian, R.: Aggregate formation in soil. 1. Influence of some bacterial
polysaccharides on the binding of soil particles, Biochemical Journal, 43, 5, 1948.
Ghanbari, A., Nock, V., Johari, S., Blaikie, R., Chen, X. and Wang, W.: A micropillar-based
on-chip system for continuous force measurement of C. elegans, Journal of
Micromechanics and Microengineering, 22, 095009, 2012.
Gianfreda, L. and Rao, M. A.: Potential of extra cellular enzymes in remediation of polluted
soils: a review, Enzyme and Microbial Technology, 35, 339--354, 2004.
Golchin, A., Oades, J., Skjemstad, J. and Clarke, P.: Study of free and occluded particulate
organic matter in soils by solid state 13C CP/MAS NMR spectroscopy and scanning
electron microscopy, Soil Research, 32, 285--309, 1994.
Gonzalez-Chavez, M., Carrillo-Gonzalez, R., Wright, S. and Nichols, K.: The role of
glomalin, a protein produced by arbuscular mycorrhizal fungi, in sequestering potentially
toxic elements, Environmental Pollution, 130, 317--323, 2004.
Goodman, S. 2008. A dirty dozen: twelve p-value misconceptions. In: Seminars in
hematology, 45. 135--140,
Graf-Rosenfellner, M. e. a.: Ringversuchsstudie zu Ultraschalldispergierung, unpublished
data.
Gray, J. and Lissmann, H. W.: The locomotion of nematodes, Journal of Experimental
Biology, 41, 135--154, 1964.
Greacen, E.: Water content and soil strength, Journal of Soil Science, 11, 313--333, 1960.
Griffiths, B. S., Bonkowski, M., Dobson, G. and Caul, S.: Changes in soil microbial
community structure in the presence of microbial-feeding nematodes and protozoa,
Pedobiologia, 43, 297--304, 1999.
Griffiths, R. I., Whiteley, A. S., O'Donnell, A. G. and Bailey, M. J.: Influence of depth and
sampling time on bacterial community structure in an upland grassland soil, FEMS
Microbiology Ecology, 43, 35--43, 2003.
103
Advertisement
Frederick Büks (doctoral thesis 2017)
Gupta, V. and Germida, J.: Distribution of microbial biomass and its activity in different soil
aggregate size classes as affected by cultivation, Soil Biology and Biochemistry, 20, 777--
786, 1988.
Hattori, T.: Adhesion between cells of E. coli and clay particles, The Journal of General and
Applied Microbiology, 16, 351--359, 1970.
Hissett, R. & Gray, T. 1976. Microsites and time changes in soil microbe ecology. In:
Symposium of the British Ecological Society,
Hontoria, C., Velásquez, R., Benito, M., Almorox, J. and Moliner, A.: Bradford-reactive soil
proteins and aggregate stability under abandoned versus tilled olive groves in a semi-arid
calcisol, Soil Biology and Biochemistry, 41, 1583--1585, 2009.
Imeson, A. and Vis, M.: Assessing soil aggregate stability by water-drop impact and
ultrasonic dispersion, Geoderma, 34, 185--200, 1984.
Ince, N., Tezcanli, G., Belen, R. and Apikyan, I. G.: Ultrasound as a catalyzer of aqueous
reaction systems: the state of the art and environmental applications, Applied Catalysis B:
Environmental, 29, 167--176, 2001.
Ingham, R. E., Trofymow, J., Ingham, E. R. and Coleman, D. C.: Interactions of bacteria,
fungi, and their nematode grazers: effects on nutrient cycling and plant growth, Ecological
monographs, 55, 119--140, 1985.
Jahn, A., Griebe, T. and Nielsen, P. H.: Composition of Pseudomonas putida biofilms:
accumulation of protein in the biofilm matrix, Biofouling, 14, 49--57, 1999.
Jastrow, J.: Soil aggregate formation and the accrual of particulate and mineral-associated
organic matter, Soil Biology and Biochemistry, 28, 665--676, 1996.
Jastrow, J. and Miller, R.: Soil aggregate stabilization and carbon sequestration: feedbacks
through organomineral associations, in: Soil processes and the carbon cycle, 207--223,
CRC Press Boca Raton, FL, 1997.
Joergensen, R. G.: The fumigation-extraction method to estimate soil microbial biomass:
calibration of the k EC value, Soil Biology and Biochemistry, 28, 25--31, 1996.
Juarez, G., Lu, K., Sznitman, J. and Arratia, P. E.: Motility of small nematodes in wet
granular media, EPL (Europhysics Letters), 92, 44002, 2010.
Kaiser, M. and Berhe, A. A.: How does sonication affect the mineral and organic
constituents of soil aggregates?—A review, J. Plant Nutr. Soil Sci., 177, 479--495, 2014.
Kalbitz, K., Schwesig, D., Rethemeyer, J. and Matzner, E.: Stabilization of dissolved
organic matter by sorption to the mineral soil, Soil Biology and Biochemistry, 37, 1319--
1331, 2005.
104
Soil microbial communities and POM occlusion
Kalbitz, K., Solinger, S., Park, J.-H., Michalzik, B. and Matzner, E.: Controls on the
dynamics of dissolved organic matter in soils: a review, Soil science, 165, 277--304, 2000.
Kanazawa, S. and Filip, Z.: Distribution of microorganisms, total biomass, and enzyme
activities in different particles of brown soil, Microbial Ecology, 12, 205--215, 1986.
Kästner, A. and Germershausen, K.: Struktur und Abundanzdynamik der Nematodenfauna
in einem Schwarzerde-Lößboden, Hercynia-Ökologie und Umwelt in Mitteleuropa, 26, 71--
93, 2014.
Kemper, W. and Rosenau, R.: Aggregate stability and size distribution, Methods of Soil
Analysis. Part 1. Physical and Mineralogical Methods - Agronomy Monograph no. 9 (2nd
Edition), 1986.
Kerek, M., Drijber, R. A., Powers, W. L., Shearman, R. C., Gaussoin, R. E. and Streich, A.
M.: Accumulation of microbial biomass within particulate organic matter of aging golf
greens, Agronomy Journal, 94, 455--461, 2002.
Kitamikado, M., Yamaguchi, K., Tseng, C.-H. and Okabe, B.: Method designed to detect
alginate-degrading bacteria, Applied and environmental microbiology, 56, 2939--2940,
1990.
Klapper, I., Rupp, C., Cargo, R., Purvedorj, B. and Stoodley, P.: Viscoelastic fluid
description of bacterial biofilm material properties, Biotechnology and Bioengineering, 80,
289--296, 2002.
Knežević, A., Milovanović, I., Stajić, M., Lončar, N., Brčeski, I., Vukojević, J. and Ćilerdžić,
J.: Lignin degradation by selected fungal species, Bioresource technology, 138, 117--123,
2013.
Kölbl, A., Leifeld, J. and Kögel-Knabner, I.: A comparison of two methods for the isolation
of free and occluded particulate organic matter, Journal of Plant Nutrition and Soil Science,
168, 660--667, 2005.
Korthals, G. W., Bongers, T., Kammenga, J. E., Alexiev, A. D. and Lexmond, T. M.: Long-
term effects of copper and ph on the nematode community in an agroecosystem,
Environmental Toxicology and Chemistry, 15, 979--985, 1996.
Lal, R.: Black and buried carbons’ impacts on soil quality and ecosystem services, Soil and
Tillage Research, 99, 1--3, 2008.
Lal, R.: Sequestration of atmospheric CO2 in global carbon pools, Energy & Environmental
Science, 1, 86--100, 2008.
Lane, D.: 16S/23S rRNA sequencing, Nucleic acid techniques in bacterial systematics,
125--175, 1991.
105
Advertisement
Frederick Büks (doctoral thesis 2017)
Lehmann, J.and Joseph, S.: Biochar for environmental management: science, technology
and implementation, Routledge, 2015.
Lehmann, J. and Kleber, M.: The contentious nature of soil organic matter, Nature, 528,
60--68, 2015.
Lehtinen, T., Lair, G. J., Mentler, A., Gisladóttir, G., Ragnarsdóttir, K. V. and Blum, W. E.:
Soil aggregate stability in different soil orders quantified by low dispersive ultrasonic
energy levels, Soil Science Society of America Journal, 78, 713--723, 2014.
Leifeld, J. and Kögel-Knabner, I.: Soil organic matter fractions as early indicators for
carbon stock changes under different land-use?, Geoderma, 124, 143--155, 2005.
Leigh, J. A. and Coplin, D. L.: Exopolysaccharides in plant-bacterial interactions, Annual
Reviews in Microbiology, 46, 307--346, 1992.
Lensi, R., Clays-Josserand, A. and Monrozier, L. J.: Denitrifiers and denitrifying activity in
size fractions of a mollisol under permanent pasture and continuous cultivation, Soil
Biology and Biochemistry, 27, 61--69, 1995.
Lewin, R. A.: Extracellular polysaccharides of green algae, Canadian Journal of
Microbiology, 2, 665--672, 1956.
Li, B. and Logan, B. E.: Bacterial adhesion to glass and metal-oxide surfaces, Colloids and
Surfaces B: Biointerfaces, 36, 81--90, 2004.
Lieleg, O. and Ribbeck, K.: Biological hydrogels as selective diffusion barriers, Trends in
cell biology, 21, 543--551, 2011.
Lim, T.-S. and Loh, W.-Y.: A comparison of tests of equality of variances, Computational
Statistics & Data Analysis, 22, 287--301, 1996.
Lueders, T. and Friedrich, M. W.: Evaluation of PCR amplification bias by terminal
restriction fragment length polymorphism analysis of small-subunit rRNA and mcrA genes
by using defined template mixtures of methanogenic pure cultures and soil DNA extracts,
Applied and Environmental Microbiology, 69, 320--326, 2003.
von Lützow, M., Kögel-Knabner, I., Ludwig, B., Matzner, E., Flessa, H., Ekschmitt, K.,
Guggenberger, G., Marschner, B. and Kalbitz, K.: Stabilization mechanisms of organic
matter in four temperate soils: development and application of a conceptual model, Journal
of Plant Nutrition and Soil Science, 171, 111--124, 2008.
Lützow, M. v., Kögel-Knabner, I., Ekschmitt, K., Flessa, H., Guggenberger, G., Matzner, E.
and Marschner, B.: SOM fractionation methods: relevance to functional pools and to
stabilization mechanisms, Soil Biology and Biochemistry, 39, 2183--2207, 2007.
106
Soil microbial communities and POM occlusion
Lützow, M. v., Kögel-Knabner, I., Ekschmitt, K., Matzner, E., Guggenberger, G., Marschner,
B. and Flessa, H.: Stabilization of organic matter in temperate soils: mechanisms and their
relevance under different soil conditions--a review, European Journal of Soil Science, 57,
426--445, 2006.
Madigan, M., Martinko, J., Bender, K., Buckley, D.and Stahl, D.: Brock Biology of
Microorganisms, Global Edition: UEL, Pearson Education Limited, 2015.
Mah, T.-F. C. and O'Toole, G. A.: Mechanisms of biofilm resistance to antimicrobial agents,
Trends in microbiology, 9, 34--39, 2001.
Marchesi, J. R., Sato, T., Weightman, A. J., Martin, T. A., Fry, J. C., Hiom, S. J. and Wade,
W. G.: Design and evaluation of useful bacterium-specific PCR primers that amplify genes
coding for bacterial 16S rRNA, Appl. Environ. Microbiol., 64, 795--799, 1998.
Margesin, R., Zimmerbauer, A. and Schinner, F.: Soil lipase activity--a useful indicator of oil
biodegradation, Biotechnology Techniques, 13, 859--863, 1999.
Margesin, R., Zimmerbauer, A. and Schinner, F.: Monitoring of bioremediation by soil
biological activities, Chemosphere, 40, 339--346, 2000.
Marschner, B. and Kalbitz, K.: Controls of bioavailability and biodegradability of dissolved
organic matter in soils, Geoderma, 113, 211--235, 2003.
Marshall, T. and Quirk, J.: Stability of structural aggregates of dry soil, Crop and Pasture
Science, 1, 266--275, 1950.
Martens, D. and Frankenberger Jr, W.: Decomposition of bacterial polymers in soil and
their influence on soil structure, Biology and fertility of soils, 13, 65--73, 1992.
Martinson, D. C., Olmstead, L. and others: Crushing strength of aggregated soil materials.,
Proceedings. Soil Science Society of America, 1949, 14, 34--38, 1950.
Marty, N., Dournes, J.-L., Chabanon, G. and Montrozier, H.: Influence of nutrient media on
the chemical composition of the exopolysaccharide from mucoid and non-mucoid
Pseudomonas aeruginosa, FEMS microbiology letters, 98, 35--44, 1992.
McGuire, K. L. and Treseder, K. K.: Microbial communities and their relevance for
ecosystem models: decomposition as a case study, Soil Biology and Biochemistry, 42,
529--535, 2010.
McNamara, N., Black, H., Beresford, N. and Parekh, N.: Effects of acute gamma irradiation
on chemical, physical and biological properties of soils, Applied Soil Ecology, 24, 117--132,
2003.
107
Advertisement
Frederick Büks (doctoral thesis 2017)
Meyer, S., Leifeld, J., Bahn, M. and Fuhrer, J.: Land-use change in subalpine grassland
soils: Effect on particulate organic carbon fractions and aggregation, Journal of Plant
Nutrition and Soil Science, 175, 401--409, 2012.
Miller, R. and Jastrow, J.: Hierarchy of root and mycorrhizal fungal interactions with soil
aggregation, Soil Biology and Biochemistry, 22, 579--584, 1990.
Miller, R. & Jastrow, J. 2000. Mycorrhizal fungi influence soil structure. In: Arbuscular
mycorrhizas: physiology and function, 3--18, Springer
Möhle, R. B., Langemann, T., Haesner, M., Augustin, W., Scholl, S., Neu, T. R., Hempel, D.
C. and Horn, H.: Structure and shear strength of microbial biofilms as determined with
confocal laser scanning microscopy and fluid dynamic gauging using a novel rotating disc
biofilm reactor, Biotechnology and bioengineering, 98, 747--755, 2007.
Molope, M., Grieve, I. and Page, E.: Contributions by fungi and bacteria to aggregate
stability of cultivated soils, Journal of Soil Science, 38, 71--77, 1987.
Monrozier, L. J., Ladd, J., Fitzpatrick, R. W., Foster, R. and Rapauch, M.: Components and
microbial biomass content of size fractions in soils of contrasting aggregation, Geoderma,
50, 37--62, 1991.
More, T., Yadav, J., Yan, S., Tyagi, R. and Surampalli, R.: Extracellular polymeric
substances of bacteria and their potential environmental applications, Journal of
environmental management, 144, 1--25, 2014.
Mummey, D., Holben, W., Six, J. and Stahl, P.: Spatial stratification of soil bacterial
populations in aggregates of diverse soils, Microbial Ecology, 51, 404--411, 2006.
Mummey, D. and Stahl, P.: Analysis of soil whole-and inner-microaggregate bacterial
communities, Microbial Ecology, 48, 41--50, 2004.
Munk, K.: Biochemie-Zellbiologie, Georg Thieme Verlag, Stuttgart, Germany, 1--576,
2008.
Muyzer, G., De Waal, E. C. and Uitterlinden, A. G.: Profiling of complex microbial
populations by denaturing gradient gel electrophoresis analysis of polymerase chain
reaction-amplified genes coding for 16S rRNA, Appl. Environ. Microbiol., 59, 695--700,
1993.
NanoDrop: NanoDrop 1000 Spectrophotometer V3. 7 Users Manual, Thermo Fisher
Scientific, 1--105, 2008.
Neher, D. A.: Ecology of plant and free-living nematodes in natural and agricultural soil,
Phytopathology, 48, 2010.
108
Soil microbial communities and POM occlusion
Nicholas, W.: A study of a species of Acrobeloides (Cephalobidae) in laboratory culture.,
Nemstologica, 8, 99--109, 1962.
Niemeyer, J. and Gessler, F.: Determination of free DNA in soils, J. Plant Nutr. Soil Sci.,
165, 121--124, 2002.
Nimmo, J. R. and Perkins, K. S.: 2.6 Aggregate Stability and Size Distribution, Methods of
soil analysis: Part, 4, 317--328, 2002.
Nordgren, A.: Apparatus for the continuous, long-term monitoring of soil respiration rate in
large numbers of samples, Soil Biology and Biochemistry, 20, 955--957, 1988.
North, P.: Towards an absolute measurement of soil structural stability using ultrasound,
Journal of Soil Science, 27, 451--459, 1976.
Nunan, N., Wu, K., Young, I. M., Crawford, J. W. and Ritz, K.: Spatial distribution of
bacterial communities and their relationships with the micro-architecture of soil, FEMS
Microbiology Ecology, 44, 203--215, 2003.
O'Brien, S. L. and Jastrow, J. D.: Physical and chemical protection in hierarchical soil
aggregates regulates soil carbon and nitrogen recovery in restored perennial grasslands,
Soil Biology and Biochemistry, 61, 1--13, 2013.
Oades, J.: The role of biology in the formation, stabilization and degradation of soil
structure, Geoderma, 56, 377--400, 1993.
Oades, J. and Waters, A.: Aggregate hierarchy in soils, Soil Research, 29, 815--828,
1991.
Oades, J. M. 1984. Soil organic matter and structural stability: mechanisms and
implications for management. In: Biological Processes and Soil Fertility, Tinsley, J. &
Darbyshire, J. (eds.) 319--337, Springer
Or, D., Smets, B. F., Wraith, J., Dechesne, A. and Friedman, S.: Physical constraints
affecting bacterial habitats and activity in unsaturated porous media--a review, Advances in
Water Resources, 30, 1505--1527, 2007.
Overmann, J., Coolen, M. J. and Tuschak, C.: Specific detection of different phylogenetic
groups of chemocline bacteria based on PCR and denaturing gradient gel electrophoresis
of 16S rRNA gene fragments, Arch. Microbiol., 172, 83--94, 1999.
Ozturk, S. and Aslim, B.: Modification of exopolysaccharide composition and production by
three cyanobacterial isolates under salt stress, Environmental Science and Pollution
Research, 17, 595--602, 2010.
Pal, A. and Paul, A.: Microbial extracellular polymeric substances: central elements in
heavy metal bioremediation, Indian Journal of Microbiology, 48, 49--64, 2008.
109
Advertisement
Frederick Büks (doctoral thesis 2017)
Perfect, E. and Kay, B.: Statistical characterization of dry aggregate strength using rupture
energy, Soil science society of America Journal, 58, 1804--1809, 1994.
Philippot, L., Andersson, S. G., Battin, T. J., Prosser, J. I., Schimel, J. P., Whitman, W. B.
and Hallin, S.: The ecological coherence of high bacterial taxonomic ranks, Nat. Rev.
Microbiol., 8, 523--529, 2010.
Piccolo, A. and Mbagwu, J. S.: Role of hydrophobic components of soil organic matter in
soil aggregate stability, Soil Science Society of America Journal, 63, 1801--1810, 1999.
Pietramellara, G., Ascher, J., Borgogni, F., Ceccherini, M., Guerri, G. and Nannipieri, P.:
Extracellular DNA in soil and sediment: fate and ecological relevance, Biology and Fertility
of Soils, 45, 219--235, 2009.
Poirier, N., Sohi, S. P., Gaunt, J. L., Mahieu, N., Randall, E. W., Powlson, D. S. and
Evershed, R. P.: The chemical composition of measurable soil organic matter pools,
Organic Geochemistry, 36, 1174--1189, 2005.
Pokrovsky, O. S., Dupré, B. and Schott, J.: Fe--Al--organic colloids control of trace
elements in peat soil solutions: results of ultrafiltration and dialysis, Aquatic Geochemistry,
11, 241--278, 2005.
Pühler, A., Arlat, M., Becker, A., Göttfert, M., Morrissey, J. P. and O’Gara, F.: What can
bacterial genome research teach us about bacteria--plant interactions?, Current opinion in
plant biology, 7, 137--147, 2004.
Rajaram, G. and Erbach, D.: Effect of wetting and drying on soil physical properties,
Journal of Terramechanics, 36, 39--49, 1999.
Ranjard, L. and Richaume, A.: Quantitative and qualitative microscale distribution of
bacteria in soil, Research in microbiology, 152, 707--716, 2001.
Ras, M., Lefebvre, D., Derlon, N., Paul, E. and Girbal-Neuhauser, E.: Extracellular
polymeric substances diversity of biofilms grown under contrasted environmental
conditions, Water research, 45, 1529--1538, 2011.
Redmile-Gordon, M., Brookes, P., Evershed, R., Goulding, K. and Hirsch, P.: Measuring
the soil-microbial interface: Extraction of extracellular polymeric substances (EPS) from
soil biofilms, Soil Biology and Biochemistry, 72, 163--171, 2014.
Redmile-Gordon, M., Evershed, R., Hirsch, P., White, R. and Goulding, K.: Soil organic
matter and the extracellular microbial matrix show contrasting responses to C and N
availability, Soil Biology and Biochemistry, 88, 257--267, 2015.
Riding, R.: Microbial carbonates: the geological record of calcified bacterial--algal mats
and biofilms, Sedimentology, 47, 179--214, 2000.
110
Soil microbial communities and POM occlusion
Rillig, M. C.: Arbuscular mycorrhizae, glomalin, and soil aggregation, Canadian Journal of
Soil Science, 84, 355--363, 2004.
Rillig, M. C., Maestre, F. T. and Lamit, L. J.: Microsite differences in fungal hyphal length,
glomalin, and soil aggregate stability in semiarid Mediterranean steppes, Soil Biology and
Biochemistry, 35, 1257--1260, 2003.
Rillig, M. C., Wright, S. F. and Eviner, V. T.: The role of arbuscular mycorrhizal fungi and
glomalin in soil aggregation: comparing effects of five plant species, Plant and Soil, 238,
325--333, 2002.
Rinaudi, L. V. and Giordano, W.: An integrated view of biofilm formation in rhizobia, FEMS
microbiology letters, 304, 1--11, 2010.
Roberson, E. B. and Firestone, M. K.: Relationship between desiccation and
exopolysaccharide production in a soil Pseudomonas sp, Applied and Environmental
Microbiology, 58, 1284--1291, 1992.
Rosenberg, N. J.: Response of plants to the physical effects of soil compaction, Advances
in Agronomy, 16, 181--196, 1964.
Rousk, J., Bååth, E., Brookes, P. C., Lauber, C. L., Lozupone, C., Caporaso, J. G., Knight,
R. and Fierer, N.: Soil bacterial and fungal communities across a pH gradient in an arable
soil, The ISME journal, 4, 1340--1351, 2010.
Ruess, L.: Nematode fauna in spruce forest soils: a qualitative/quantitative comparison,
Nematologica, 41, 106--124, 1995.
Ruess, L.: Studies on the nematode fauna of an acid forest soil: spatial distribution and
extraction, Nematologica, 41, 229--239, 1995.
Ruess, L., Schmidt, I. K., Michelsen, A. and Jonasson, S.: Responses of nematode
species composition to factorial addition of carbon, fertiliser, bactericide and fungicide at
two sub-arctic sites, Nematology, 4, 527--539, 2002.
Russell, J.: Report of the subcommittee on soil structure and consistency, Soil Science
Society of America Journal, 9, 10--22, 1928.
Schindler, F. V., Mercer, E. J. and Rice, J. A.: Chemical characteristics of glomalin-related
soil protein (GRSP) extracted from soils of varying organic matter content, Soil Biology and
Biochemistry, 39, 320--329, 2007.
Schmidt, M., Rumpel, C. and Kögel-Knabner: Evaluation of an ultrasonic dispersion
procedure to isolate primary organomineral complexes from soils, European Journal of
Soil Science, 50, 87--94, 1999.
111
Advertisement
Frederick Büks (doctoral thesis 2017)
Schmidt, M. W., Torn, M. S., Abiven, S., Dittmar, T., Guggenberger, G., Janssens, I. A.,
Kleber, M., Kögel-Knabner, I., Lehmann, J., Manning, D. A. and others: Persistence of soil
organic matter as an ecosystem property, Nature, 478, 49--56, 2011.
Schmitt, J. and Flemming, H.-C.: Water binding in biofilms, Water science and technology,
39, 77--82, 1999.
Schnürer, J., Clarholm, M. and Rosswall, T.: Microbial biomass and activity in an
agricultural soil with different organic matter contents, Soil Biology and Biochemistry, 17,
611--618, 1985.
Schrumpf, M., Kaiser, K., Guggenberger, G., Persson, T., Kögel-Knabner, I. and Schulze,
E.-D.: Storage and stability of organic carbon in soils as related to depth, occlusion within
aggregates, and attachment to minerals, Biogeosciences, 10, 1675--1691, 2013.
Seybold, C. and Herrick, J.: Aggregate stability kit for soil quality assessments, Catena, 44,
37--45, 2001.
Shapiro, S. S. and Wilk, M. B.: An analysis of variance test for normality (complete
samples), Biometrika, 52, 591--611, 1965.
Simoes, M., Cleto, S., Pereira, M. O. and Vieira, M.: Influence of biofilm composition on
the resistance to detachment, Water Science and Technology, 55, 473--480, 2007.
Singh, K.: Aggregate analysis of soils. I.—apparatus and method, Journal of the Science of
Food and Agriculture, 3, 205--209, 1952.
Six, J., Bossuyt, H., Degryze, S. and Denef, K.: A history of research on the link between
(micro) aggregates, soil biota, and soil organic matter dynamics, Soil and Tillage
Research, 79, 7--31, 2004.
Six, J., Conant, R., Paul, E. A. and Paustian, K.: Stabilization mechanisms of soil organic
matter: implications for C-saturation of soils, Plant Soil, 241, 155--176, 2002.
Six, J., Elliott, E. and Paustian, K.: Soil macroaggregate turnover and microaggregate
formation: a mechanism for C sequestration under no-tillage agriculture, Soil Biology and
Biochemistry, 32, 2099--2103, 2000.
Six, J., Schultz, P., Jastrow, J. and Merckx, R.: Recycling of sodium polytungstate used in
soil organic matter studies, Soil Biology and Biochemistry, 31, 1193--1196, 1999.
Skidmore, E. and Powers, D.: Dry soil-aggregate stability: energy-based index, Soil Sci.
Soc. Am. J., 46, 1274--1279, 1982.
Sollins, P., Homann, P. and Caldwell, B. A.: Stabilization and destabilization of soil organic
matter: mechanisms and controls, Geoderma, 74, 65--105, 1996.
112
Soil microbial communities and POM occlusion
Spohn, M. and Giani, L.: Water-stable aggregates, glomalin-related soil protein, and
carbohydrates in a chronosequence of sandy hydromorphic soils, Soil Biology and
Biochemistry, 42, 1505--1511, 2010.
Sponagel, H., Grottenthaler, W., Hartmann, K.-J., Hartwich, R., Janetzko, P., Joisten, H.,
Kühn, D., Sabel, K.-J.and Traidl, R.: Bodenkundliche Kartieranleitung [KA 5],
Schweizerbart, 2005.
Stacey, M.: Macromolecules synthesised by micro-organisms, Journal of the Chemical
Society (Resumed), 853--864, 1947.
Stach, J. E., Maldonado, L. A., Ward, A. C., Goodfellow, M. and Bull, A. T.: New primers for
the class Actinobacteria: application to marine and terrestrial environments, Environ.
Microbiol., 5, 828--841, 2003.
Staddon, P. L., Ramsey, C. B., Ostle, N., Ineson, P. and Fitter, A. H.: Rapid turnover of
hyphae of mycorrhizal fungi determined by AMS microanalysis of 14C, Science, 300,
1138--1140, 2003.
Stams, A. J. and Plugge, C. M.: Electron transfer in syntrophic communities of anaerobic
bacteria and archaea, Nature Reviews Microbiology, 7, 568--577, 2009.
Steinberg, P. D. and Rillig, M. C.: Differential decomposition of arbuscular mycorrhizal
fungal hyphae and glomalin, Soil Biology and Biochemistry, 35, 191--194, 2003.
Steinberger, R. and Holden, P.: Extracellular DNA in single-and multiple-species
unsaturated biofilms, Applied and environmental microbiology, 71, 5404--5410, 2005.
Stewart, P. S.: A review of experimental measurements of effective diffusive permeabilities
and effective diffusion coefficients in biofilms, Biotechnol. Bioeng., 59, 261--272, 1998.
Stewart, P. S. and Franklin, M. J.: Physiological heterogeneity in biofilms, Nature Reviews
Microbiology, 6, 199--210, 2008.
Stockmann, U., Adams, M. A., Crawford, J. W., Field, D. J., Henakaarchchi, N., Jenkins,
M., Minasny, B., McBratney, A. B., de Courcelles, V. d. R., Singh, K. and others: The
knowns, known unknowns and unknowns of sequestration of soil organic carbon,
Agriculture, Ecosystems & Environment, 164, 80--99, 2013.
Sutherland, I. W.: Biofilm exopolysaccharides: a strong and sticky framework,
Microbiology, 147, 3--9, 2001.
Tang, J., Mo, Y., Zhang, J. and Zhang, R.: Influence of biological aggregating agents
associated with microbial population on soil aggregate stability, Applied Soil Ecology, 47,
153--159, 2011.
113
Advertisement
Frederick Büks (doctoral thesis 2017)
Taylor, H. and Brar, G.: Effect of soil compaction on root development, Soil and Tillage
Research, 19, 111--119, 1991.
Tiessen, H. and Stewart, J.: Particle-size fractions and their use in studies of soil organic
matter: II. Cultivation effects on organic matter composition in size fractions, Soil Science
Society of America Journal, 47, 509--514, 1983.
Tiessen, H. and Stewart, J.: Light and electron microscopy of stained microaggregates: the
role of organic matter and microbes in soil aggregation, Biogeochemistry, 5, 312--322,
1988.
Tisdall, J.: Fungal hyphae and structural stability of soil, Soil Research, 29, 729--743,
1991.
Tisdall, J.: Possible role of soil microorganisms in aggregation in soils, Plant and soil, 159,
115--121, 1994.
Tisdall, J.: Formation of soil aggregates and accumulation of soil organic matter, Structure
and organic matter storage in agricultural soils, 57--96, 1996.
Tisdall, J. and Oades, J.: Organic matter and water-stable aggregates in soils, Journal of
soil science, 33, 141--163, 1982.
Torsvik, V. and Øvreås, L.: Microbial diversity and function in soil: from genes to
ecosystems, Curr. Opin. Microbiol., 5, 240--245, 2002.
Traoré, O., Groleau-Renaud, V., Plantureux, S., Tubeileh, A. and Boeuf-Tremblay, V.:
Effect of root mucilage and modelled root exudates on soil structure, European Journal of
Soil Science, 51, 575--581, 2000.
Uroz, S., Calvaruso, C., Turpault, M.-P. and Frey-Klett, P.: Mineral weathering by bacteria:
ecology, actors and mechanisms, Trends in microbiology, 17, 378--387, 2009.
Van Der Heijden, M. G., Bardgett, R. D. and Van Straalen, N. M.: The unseen majority: soil
microbes as drivers of plant diversity and productivity in terrestrial ecosystems, Ecology
letters, 11, 296--310, 2008.
Van Loosdrecht, M., Heijnen, J., Eberl, H., Kreft, J. and Picioreanu, C.: Mathematical
modelling of biofilm structures, Antonie van Leeuwenhoek, 81, 245--256, 2002.
Vargas, R. and Hattori, T.: The distribution of protozoa within soil aggregates., The Journal
of General and Applied Microbiology, 37, 515--518, 1991.
Venette, R. and Ferris, H.: Thermal constraints to population growth of bacterial-feeding
nematodes, Soil Biology and Biochemistry, 29, 63--74, 1997.
114
Soil microbial communities and POM occlusion
Von Mering, C., Hugenholtz, P., Raes, J., Tringe, S., Doerks, T., Jensen, L., Ward, N. and
Bork, P.: Quantitative phylogenetic assessment of microbial communities in diverse
environments, Science, 315, 1126--1130, 2007.
Votselko, S., Pirog, T., Malashenko, Y. R. and Grinberg, T.: A method for determining the
mass-molecular composition of microbial exopolysaccharides, Journal of microbiological
methods, 18, 349--356, 1993.
Wagai, R., Mayer, L. M. and Kitayama, K.: Nature of the “occluded” low-density fraction in
soil organic matter studies: a critical review, Soil Science and Plant Nutrition, 55, 13--25,
2009.
Walker, S. L., Fourgialakis, M., Cerezo, B. and Livens, S.: Removal of Microbial Biofilms
from Dispense Equipment: The Effect of Enzymatic Pre-digestion and Detergent
Treatment, Journal of the Institute of Brewing, 113, 61--66, 2007.
Wallace, H.: Movement of eelworms, Annals of applied Biology, 46, 86--94, 1958.
Wallace, H.: The dynamics of nematode movement, Annual Review of Phytopathology, 6,
91--114, 1968.
Ward, N. L., Challacombe, J. F., Janssen, P. H., Henrissat, B., Coutinho, P. M., Wu, M.,
Xie, G., Haft, D. H., Sait, M., Badger, J. and others: Three genomes from the phylum
Acidobacteria provide insight into the lifestyles of these microorganisms in soils, Applied
and environmental microbiology, 75, 2046--2056, 2009.
Wargo, M. J. and Hogan, D. A.: Fungal—bacterial interactions: a mixed bag of mingling
microbes, Current opinion in microbiology, 9, 359--364, 2006.
Wasikiewicz, J. M., Yoshii, F., Nagasawa, N., Wach, R. A. and Mitomo, H.: Degradation of
chitosan and sodium alginate by gamma radiation, sonochemical and ultraviolet methods,
Radiation Physics and Chemistry, 73, 287--295, 2005.
Watts, C. W., Whalley, W. R., Brookes, P. C., Devonshire, B. J. and Whitmore, A. P.:
Biological and physical processes that mediate micro-aggregation of clays, Soil Science,
170, 573--583, 2005.
Weitere, M., Bergfeld, T., Rice, S. A., Matz, C. and Kjelleberg, S.: Grazing resistance of
Pseudomonas aeruginosa biofilms depends on type of protective mechanism,
developmental stage and protozoan feeding mode, Environmental Microbiology, 7, 1593--
1601, 2005.
Weng, L., Temminghoff, E. J., Lofts, S., Tipping, E. and Van Riemsdijk, W. H.:
Complexation with dissolved organic matter and solubility control of heavy metals in a
sandy soil, Environmental Science & Technology, 36, 4804--4810, 2002.
115
Advertisement
Frederick Büks (doctoral thesis 2017)
Wilkinson, J.: The extracellular polysaccharides of bacteria, Bacteriological Reviews, 22,
46, 1958.
Wright, S. and Anderson, R.: Aggregate stability and glomalin in alternative crop rotations
for the central Great Plains, Biology and Fertility of Soils, 31, 249--253, 2000.
Wright, S., Franke-Snyder, M., Morton, J. and Upadhyaya, A.: Time-course study and
partial characterization of a protein on hyphae of arbuscular mycorrhizal fungi during active
colonization of roots, Plant and Soil, 181, 193--203, 1996.
Wright, S., Green, V. and Cavigelli, M.: Glomalin in aggregate size classes from three
different farming systems, Soil and Tillage Research, 94, 546--549, 2007.
Wright, S., Starr, J. and Paltineanu, I.: Changes in aggregate stability and concentration of
glomalin during tillage management transition, Soil Science Society of America Journal,
63, 1825--1829, 1999.
Wright, S. and Upadhyaya, A.: A survey of soils for aggregate stability and glomalin, a
glycoprotein produced by hyphae of arbuscular mycorrhizal fungi, Plant Soil, 198, 97--107,
1998.
Wu, Q.-S., Cao, M.-Q., Zou, Y.-N. and He, X.-h.: Direct and indirect effects of glomalin,
mycorrhizal hyphae, and roots on aggregate stability in rhizosphere of trifoliate orange,
Scientific reports, 4, 2014.
Yeates, G., Bongers, T., De Goede, R., Freckman, D. and Georgieva, S.: Feeding habits in
soil nematode families and genera—an outline for soil ecologists, Journal of nematology,
25, 315, 1993.
Yeates, G. W.: Nematodes in ecological webs, eLS, 2010.
Yoder, R. E.: A direct method of aggregate analysis of soils and a study of the physical
nature of erosion losses, Agronomy Journal, 28, 337--351, 1936.
Zech, W., Schad, P.and Hintermaier-Erhard, G.: Böden der Welt: ein Bildatlas, Springer-
Verlag, 2014.
Zelles, L.: Fatty acid patterns of phospholipids and lipopolysaccharides in the
characterisation of microbial communities in soil: a review, Biology and fertility of soils, 29,
111--129, 1999.
Zhang, H.: Organic matter incorporation affects mechanical properties of soil aggregates,
Soil and Tillage Research, 31, 263--275, 1994.
Zhang, X., Bishop, P. L. and Kupferle, M. J.: Measurement of polysaccharides and proteins
in biofilm extracellular polymers, Water science and technology, 37, 345--348, 1998.
116
Soil microbial communities and POM occlusion
Zhang, Z.-Q.: Animal biodiversity: An update of classification and diversity in 2013. In:
Zhang, Z.-Q.(Ed.) Animal Biodiversity: An Outline of Higher-level Classification and Survey
of Taxonomic Richness (Addenda 2013), Zootaxa, 3703, 5--11, 2013.
Zhu, W.: p< 0.05,< 0.01,< 0.001,< 0.0001,< 0.00001,< 0.000001, or< 0.0000001…,
Journal of Sport and Health Science, 5, 77--79, 2016.
Zhu, Y.-G. and Miller, R. M.: Carbon cycling by arbuscular mycorrhizal fungi in soil--plant
systems, Trends in plant science, 8, 407--409, 2003.
Zuckerman, B. M. and Jansson, H.: Nematode chemotaxis and possible mechanisms of
host/prey recognition, Annual review of phytopathology, 22, 95--113, 1984.
117
Advertisement