Identification and Functional Characterization
of the Novel Mineralocorticoid Receptor
Target Gene Cnksr3
vorgelegt von
Diplom-Ingenieur
Tim Ziera
Von der Fakultät III - Prozesswissenschaften
der Technischen Universität Berlin
zur Erlangung des akademischen Grades
Doktor der Ingenieurwissenschaften
- Dr.-Ing. -
genehmigte Dissertation
Promotionsausschuss:
Vorsitzender: Prof. Dr. U. Stahl
Berichter: Prof. Dr. R. Lauster
Berichter: PD. Dr. K. Prelle
Berichter: Prof. Dr. L.-A. Garbe
Tag der wissenschaftlichen Aussprache: 23.10.2009
Berlin 2009
D83
Keywords
Aldosterone, Epithelial Na+ Channel, Chromatin Immunoprecipitation (ChIP), Microarray,
Reporter Gene Assay, Ussing Chamber, Site-Directed Mutagenesis
Abstract
Abstract
The mineralocorticoid receptor (MR) is a ligand-dependent transcription factor mainly
expressed in epithelial cells at the distal nephron and distal colon where it regulates salt and
water homeostasis. MR expression and function is also found in several non-epithelial tissues
particularly in the cardiovascular system. Dysregulation of aldosterone-MR signaling is
frequently involved in hypertension and cardiac failure.
While therapeutic benefits of MR antagonists in the above noted diseases are
undisputed, the molecular mechanisms of action remain to be fully elucidated. Activated by
aldosterone the MR elicits most of its physiological actions by altering gene expression of
target genes including genes that modulate the activity of the epithelial sodium channel
(ENaC) in the kidney. In the recent years a number of gene expression studies have been
carried out to identify primary MR target genes. The search for MR target genes is yet
hampered by the ubiquitously expressed glucocorticoid receptor (GR). Both MR and GR can
be activated by aldosterone and cortisol, albeit at different concentrations. Hence, the current
knowledge of MR target genes is likely to be mixed with actual GR target genes.
In order to identify MR target genes involved in aldosterone signaling cell culture
models were established that allow a clear separation of MR- versus GR-mediated effects on
gene regulation and transepithelial sodium transport as physiological readout. Microarray
gene expression profiling in human embryonic kidney cells (HEK293) stably expressing MR
led to the identification of 36 aldosterone regulated genes. Chromatin Immunoprecipitation
(ChIP) in combination with reporter gene assays confirmed that at least 12 out of these 36
candidate genes were directly regulated by MR. This approach led to the identification of the
novel MR target gene cnksr3. Expression analysis in different nephron segments,
microdissected from mice kidneys, confirmed that cnksr3 was highly expressed in the renal
cortical collecting duct (CCD), the prime target segment of aldosterone-regulated sodium
retention in the kidney. Mouse CCD-derived cells (M1) that either stably overexpressing or
silencing CNKSR3 were electrophysiologically analyzed and showed that CNKSR3
expression correlated with, and was required for, ENaC-mediated transepithelial sodium
transport. Moreover, CNKSR3 expression inhibited the RAS-RAF-MEK-ERK signaling
cascade, a pathway involved in the modulation of ENaC cell surface expression.
In conclusion, CNKSR3 a member of a family of scaffold proteins involved in RAS-
RAF-MEK-ERK pathway regulation is a direct MR target gene and is crucial for the
maintenance of transepithelial sodium transport in the kidney.
3
Zusammenfassung
Zusammenfassung
Der Mineralocorticoid-Rezeptor (MR) ist ein liganden-abhäniger Transkriptionsfaktor,
der vorwiegend in den Epithelzellen des distalen Nephrons und des distalen Kolons
exprimiert wird, wo er die Salz- und Wasserhomeostase reguliert. Die MR-Expression und
-Funktion ist ebenso in nicht-epithelialen Geweben zu finden, insbesondere dem Herz-
Kreislauf-System. Eine Dysregulation des Aldosteron-MR-Systems ist oftmals bei der
Entstehung von Bluthochdruck und bei kardialen Störungen beteiligt.
Der therapeutische Nutzten von MR-Antagonisten zur Behandlung oben genannter
Erkrankungen ist unumstritten, dennoch sind die molekularen Mechanismen dieser Prozesse
nur unvollständig verstanden. Der MR übt seine physiologische Funktion Aldosteron-
abhängig durch die Änderung der Expression von Target-Genen aus, unter anderem von
Genen, die die Aktivität des epithelialen Natriumkanals (ENaC) in der Niere regulieren. In der
Vergangenheit wurden verschiedene Genexpressions-Studien zur Identifizierung direkt MR-
regulierter Gene durchgeführt. Diese Suche nach MR-regulierten Genen ist jedoch durch den
ubiquitär exprimierten Glucocorticoid Rezeptor (GR) erschwert. Obwohl MR und GR durch
unterschiedliche Konzentrationen von Aldosteron und Cortisol aktiviert werden, ist die
Wahrscheinlichkeit hoch, dass unter den derzeitig als MR-reguliert bekannten Genen auch
solche sind, die tatsächlich über den GR reguliert sind.
Zur Identifizierung von direkt MR-regulierten Genen wurden neue Zellkulturmodelle
etabliert, die eine Trennung MR- bzw. GR- vermittelter Effekte auf Ebene der Genexpression
erlauben, sowie den transepithelialen Natriumtransport als physiologischen Parameter
messbar machen. Über eine Microarray-Genexpressionsanalyse in stabil MR-exprimierenden
humanen embryonalen Nierenzellen (HEK293) wurden 36 Aldosteron-regulierte Gene
identifiziert. Durch Kombination von Chromatin-Immunopräzipitation (ChIP) und
Reportergen-Assays wurde bestätigt, dass mindestens 12 der 36 identifizierten Gene direkt
über den MR reguliert sind. Dieser experimentelle Ansatz führte zur Identifizierung des noch
nicht als MR-reguliert beschriebenen Gens cnksr3. Die Expressionsanalyse in verschiedenen
Nephronsegmenten bestätigte, dass cnksr3 stark im kortikalen Sammelrohr [engl. Cortical
Collecting Duct (CCD)] in der Niere exprimiert wird, welches das Hauptsegment der
Aldosteron-regulierten Natriumrückresorption ist. Elektrophysiologische Messungen in Maus
CCD Zellen (M1), die entweder cnksr3 überexprimieren oder reprimieren, zeigten, dass der
ENaC-vermittelte transepitheliale Natriumtransport mit der cnksr3-Expression korrelierte
bzw. von dessen Expression abhängig war. Ferner blockierte die Expression von cnksr3 die
RAS-RAF-MEK-ERK Signalkaskade, ein Signalweg, der in die Regulation des
Membraneinbaus der ENaC-Ionenkanalproteine involviert ist.
Zusammengefasst wurde gezeigt, dass cnksr3, ein Mitglied einer Familie von Gerüst-
Proteinen, die an der RAS-RAF-MEK-ERK Signaltransduktion beteiligt sind, ein direkt MR-
reguliertes Gen ist. CNKSR3 spielt eine zentrale Rolle bei der Aufrechterhaltung des
transepithelialen Natriumtransports in der Niere.
4
Table of contents
Abstract ...........................................................................................................................................3
Zusammenfassung...........................................................................................................................4
1. Introduction ................................................................................................................................7
1.1. The renin-angiotensin-aldosterone system..........................................................................7
1.2. The mineralocorticoid receptor...........................................................................................8
1.3. The role of MR in pathophysiology....................................................................................9
1.4. MR selectivity ................................................................................................................... 10
1.4.1. The pre-receptor level .................................................................................................11
1.4.2. The receptor level........................................................................................................11
1.4.3. The post-receptor level................................................................................................ 12
1.5. Molecular mechanisms of action....................................................................................... 13
1.5.1. Channels and transporters involved MR-regulated transepithelial sodium transport .14
1.5.2. Early MR-responsive genes modulating sodium retention .........................................15
1.6. Aim of study...................................................................................................................... 17
2. Materials and Methods .............................................................................................................19
2.1. Material .............................................................................................................................19
2.1.1. Plastic ware ................................................................................................................. 19
2.1.2. Chemicals.................................................................................................................... 19
2.1.3. Water ........................................................................................................................... 19
2.1.4. Buffers.........................................................................................................................19
2.1.5. Media...........................................................................................................................20
2.1.6. Size standards..............................................................................................................20
2.1.7. Oligonucleotides.......................................................................................................... 20
2.1.8. Vectors and plasmids .................................................................................................. 23
2.1.9. Antibodies ...................................................................................................................24
2.2. Methods.............................................................................................................................25
2.2.1. Molecular biology .......................................................................................................25
2.2.1.1. Restriction digest................................................................................................25
2.2.1.2. Fill-in of cohesive ends ......................................................................................25
2.2.1.3. Purification of DNA fragments..........................................................................25
2.2.1.4. Ligation of DNA fragments ............................................................................... 25
2.2.1.5. Transformation of E. coli and bacterial cultures................................................26
2.2.1.6. Preparation of plasmid and genomic DNA ........................................................26
2.2.1.7. Agarose gel electrophoreses............................................................................... 26
2.2.1.8. RNA preparation and cDNA synthesis .............................................................. 27
2.2.1.9. Polymerase chain reaction (PCR) ......................................................................27
2.2.1.10. Quantitative real time PCR analysis...................................................................27
2.2.1.11. Cloning of expression and reporter constructs...................................................28
2.2.1.12. Constructs for RNA interference........................................................................ 29
2.2.1.13. Western blot analysis ......................................................................................... 30
2.2.1.14. Chromatin immunoprecipitation ........................................................................ 30
2.2.1.15. Affymetrix microarray experiments...................................................................31
2.2.1.16. Determination of MR copy number ................................................................... 32
2.2.2. Cell biology.................................................................................................................32
2.2.2.1. Cell culture......................................................................................................... 32
2.2.2.2. Charcoal treatment of serum ..............................................................................33
2.2.2.3. Lentivirus production.........................................................................................33
2.2.2.4. Lentiviral transduction of mammalian cells....................................................... 33
2.2.2.5. Generation of expression cell lines .................................................................... 34
2.2.2.6. Luciferase reporter assays .................................................................................. 34
2.2.2.7. Electrophysiological measurements (Ussing chamber) ..................................... 35
5
Table of contents
2.2.2.8. Determination of EC50 and IC50 values.............................................................. 35
2.2.3. Microdissection of renal tubules ................................................................................. 36
2.2.4. Statistical analysis.......................................................................................................36
3. Results ......................................................................................................................................37
3.1. Identification of early aldosterone-regulated genes .......................................................... 37
3.1.1. Generation of HEK293 cells stably expressing the human MR.................................. 37
3.1.2. Characterization of HEK293-hMR+ cells....................................................................39
3.1.3. The genome-wide aldosterone gene regulation pattern............................................... 41
3.2. Identification of primary mineralocorticoid receptor target genes.................................... 45
3.2.1. Generation of HEK293 cells stably expressing a myc-tagged hMR for ChIP
analysis..................................................................................................................................45
3.2.2. Identification of functional MR binding sites ............................................................. 46
3.3. Cnksr3 is a direct MR target gene..................................................................................... 50
3.3.1. Characterization of MR binding sites within the cnksr3 -4 kb promoter fragment .... 50
3.3.2. The aldosterone-induced cnksr3 expression pattern ................................................... 52
3.4. Functional characterization of CNKSR3...........................................................................54
3.4.1. Cnksr3 is expressed in the mouse aldosterone-sensitive distal nephron.....................54
3.4.2. Generation and electrophysiological characterization of the MR stable M1 cell line 55
3.4.3. Generation of different M1-rMR+ derived cell lines...................................................57
3.4.4. Impact of CNKSR3 on the aldosterone-induced ENaC-controlled Na+ transport...... 59
3.4.5. CNKSR3 suppresses phospho-MEK1/2 level.............................................................60
4. Discussion.................................................................................................................................61
4.1. Early aldosterone target genes in HEK293 MR expressing cells...................................... 61
4.2. Direct MR target genes and their regulatory elements...................................................... 63
4.3. The role of CNKSR3 in the mechanism of transepithelial sodium transport.................... 65
4.4. Conclusion.........................................................................................................................68
5. References ................................................................................................................................69
6. Appendix ..................................................................................................................................78
6.1. Experimental flow-chart....................................................................................................78
6.2. Abbreviations ....................................................................................................................79
6.3. List of Figures and Tables................................................................................................. 81
6.4. Publications and Awards...................................................................................................82
6.5. Acknowledgements........................................................................................................... 83
6.6. Curriculum vitae................................................................................................................84
6
Introduction
1. Introduction
All creatures face the challenge to maintain a stable intracellular milieu by adapting
dynamically to ever-changing environmental conditions. This maintenance is referred to as
“homeostasis” and is achieved by regulatory circuits that require sensory mechanisms, set
points and feedback loops. Salt and water homeostasis is critical for the survival of terrestrial
organisms in a in that respect largely hostile environment. The salt and water homeostasis is
closely associated with the tight regulation of the components of extracellular liquid, a
corresponding volume of interstitial fluid and blood plasma. The main effectors are located in
epithelial tissues e.g. of the kidney and the colon where salt and water are either excreted or
reabsorbed under the control of a hormonal system, the renin-angiotensin-aldosterone system.
1.1. The renin-angiotensin-aldosterone system
The renin-angiotensin-aldosterone system (RAAS) is a hormonal system which plays an
important role in the regulation of salt and water homeostasis and blood pressure. Specialized
cells in the renal cortex detect decreases in sodium (Na+) concentration (macula densa) and
blood pressure (juxtaglomerular cells) and stimulate the secretion of the enzyme renin by
juxtaglomerular cells. In the circulating blood renin cleaves liver-derived inactive
angiotensinogen and thus converts it into angiotensin I. Angiotensin I is then converted to
angiotensin II by angiotensin-converting enzyme (ACE), which is located at the luminal side
of the pulmonary and renal endothelium. Angiotensin II is a potent vasoconstrictor of renal
arterioles and further stimulates the secretion of aldosterone (1). Also an increase of
extracellular potassium is a potent stimulator of aldosterone biosynthesis (2). The steroid
hormone aldosterone is synthesized by the outer section (zona glomerulosa) of the adrenal
cortex in the adrenal gland. Increased circulating level of aldosterone results in sodium
reabsorption and water retention particularly in the kidney. Aldosterone exerts its actions
through the mineralocorticoid receptor (MR), a ligand-dependent transcription factor
belonging to the nuclear receptor superfamily. The pivotal role of MR in the RAAS feedback
loop was clearly demonstrated by MR knockout mice, who died during the first two weeks of
life (3). Although these mice can be rescued by exogenous NaCl administration, they exhibit a
persistently activated RAAS and suffer from volume depletion (4).
7
Introduction
1.2. The mineralocorticoid receptor
The nuclear receptor superfamily is divided into several subfamilies. The
mineralocorticoid receptor (MR) belongs to the type I (steroid hormone) receptor subfamily
that includes the glucocorticoid receptor (GR), progestin receptor (PR), androgen receptor
(AR) and estrogen receptors (ER). Although these receptors are all ligand-activated
transcription factors with common structural features, divergence is achieved by their distinct
cognate ligands and molecular mechanisms of action, which regulate a wide variety of
physiological processes ranging from organ development to stress response and mood control
(5). MR, in particular, is required for the maintenance of electrolyte and water homeostasis
and blood pressure (6).
The NR3C2 gene encoding human MR (hMR) is localized on chromosome 4 in the
q31.1 region, spans 450 kb and is composed of ten exons. The first two exons, referred to as
1α and 1β, are untranslated but generate different mRNA isoforms, which differ in their
relative abundance in a tissue specific manner (7). The molecular function of these distinct
hMR mRNA transcripts remains to be determined but is assumed to be involved in the
regulation of transcript stability and/or translational efficacy. Exons 2 to 9 code for the
107 kDa hMR protein (8). The schematic representation of the NR3C2 gene coding for MR is
shown in Figure 1.1.
As all members of this receptor family MR contains four characteristic domains: an N-
terminal domain (NTD or A/B domain), followed by a central DNA-binding domain (DBD or
C domain), a hinge region (D domain), and a C-terminal E-domain containing the ligand-
binding domain (LBD). The NTD contains smaller regions responsible for hormone-
independent regulation of transcription, named activation function (AF) regions. These
regions are termed AF1a and AF1b to distinguish them from the AF2 region at the C-terminus
of the LBD. The DBD contains two zinc finger structures. One of which, termed the P box,
recognizes the hormone response elements (HRE) in the promoters of MR target genes and
mediates base-specific contacts within the major groove of the DNA. A second zinc finger
motif, the D box, is oriented alongside the axis of the DNA and facilitates receptor homo-
dimerization (5). The DBD further contains a nuclear export signal (NES) located between the
two zinc fingers (9). The hinge region, located between the DBD and the LBD, is flexible in
order to enable the receptor to twist and alter conformation. The C-terminal E domain
mediates the ligand-dependent activation of the receptor. It contains the LBD, a nuclear
localization signal (NLS), and a trans-activating function (AF-2). In the absence of ligand the
LBD is associated with a multi-protein complex of chaperones including Hsp90/ Hsp70 and
8
Introduction
immunophilins, which stabilize the receptor in an inactive but ligand-affine conformation.
Upon ligand binding the LBD adopts a more compact structure, resulting in a release of
associated chaperones and a translocation of the receptor into the nucleus. Once in the nucleus
MR modulates the expression of its target genes as described in further detail in section 1.5
below.
Fig. 1.1: Schematic representation of the NR3C2 gene (adapted from Pascual-Le Tallec, 2005)
A: The human NR3C2 gene encodes for two alternative mRNA isoforms and one mineralocorticoid
receptor (MR) protein. As a member of the steroid receptor superfamily MR harbours distinct
functional domains able to modulate transcription upon ligand activation. B: The DNA binding domain
(DBD) recognizes resonse elements of DNA by its two zinc finger structures. C: The predicted crystal
structure of the MR ligand binding domain (LBD) with aldosterone in the ligand binding pocket based
on crystal structure of the PR (10).
In summary MR is a ligand-operated transcription factor mainly located in the
cytoplasm of cells. Upon ligand binding, the receptor undergoes a conformational change and
translocates to the nucleus, where it binds as a homodimer to inverted repeat DNA half sites
in the promoter of target genes, activating or repressing their transcriptional activity.
1.3. The role of MR in pathophysiology
MR is expressed in polarized epithelial tissues, such as the distal part of the nephron, the
distal colon, and the salivary glands (7). These tissues are considered the classical aldosterone
target tissues, where MR regulates ion and water homeostasis (11, 12). As mentioned above,
the importance of MR is reflected by the phenotype of MR knockout mice, who develop
9
Introduction
symptoms of pseudohypoaldosteronism (PHA) in the first week of life and die in the second
week after birth from dehydration by renal sodium and water loss. These mice exhibit a
strongly impaired amiloride-sensitive, and thus ENaC-mediated, transepithelial sodium
transport in the kidney and colon (3).
In man there is only one MR mutation associated with a distinct phenotype described. A
missence mutation in the MR LBD (S810L) causes an autosomal dominant form of
hypertension exacerbated by pregnancy (13). Ligands, e.g. progesterone and cortisone that
normally do not activate wt MR become agonists for the MR S810L mutant, which causes a
constitutive MR activation (13, 14).
MR is also expressed in non-epithelial tissues which are clearly not primarily involved
in sodium transport e.g. the hippocampus, the heart, blood vessels, adipocytes and
macrophages (15-18). The role of MR in physiology and pathophysiology in non-classical
aldosterone target tissues has attracted considerable attention. The clinical relevance of MR in
the pathogenesis of cardiac dysfunction was demonstrated by two large clinical trials, the
Randomized Aldoactone Evaluation Study (RALES) and Eplerenone Post-Acute Myocardial
Infarction Heart Failure Efficacy and Survival Study (EPHESUS). Patients with heart failure
or post-acute myocardial infarction who received in addition to their usual treatment regimen
low doses of MR antagonists showed a 30% reduction in morbidity and mortality (19, 20).
Recent studies demonstrated that macrophage MR null mice were resistant against
mineralocorticoid-mediated cardiac fibrosis, despite normal macrophage recruitment (21).
Another example that MR plays a role in extra-renal physiology was demonstrated by mice
with a forebrain-specific MR knockout. These animals showed impaired spatial learning
linked to behavioral stereotype (22).
These studies clearly indicate that the MR is involved in many physiological processes
and that dysregulation of MR signaling is linked to intensively studied human diseases, such
as hypertension and cardiac failure.
1.4. MR selectivity
All cells expressing MR also express GR (11, 23, 24). MR and GR are closely related
members of the nuclear hormone receptor family. Both receptors exhibit a 15% homology for
the NTD, 94% for the DBD, and 57% for the LBD (25). This high homology is clearly
reflected in the overlapping DNA binding specificities and cross-reactivity with their cognate
ligands. Both receptors appear to recognize common DNA sequences (11, 12) and exhibit a
broad overlap of target genes. MR and GR have equivalent affinity for cortisol (26). In
10
Introduction
contrast, MR binds aldosterone with much higher affinity than GR does (27). However, GR
can also be activated at supraphysiological concentrations of aldosterone (28-30). Given the
circulating cortisol levels are at least 100-fold higher than those of aldosterone, occupancy of
MR by aldosterone should be precluded. This raises the question of mechanisms that confer to
mineralocorticoid specificity.
1.4.1. The pre-receptor level
At the pre-receptor level MR is protected against permanent glucocorticoid occupancy
by the enzyme 11β-hydroxysteroid dehydrogenase type 2 (11β-HSD2), which converts
cortisol into its MR-inactive 11-keto congener cortisone (16, 31) (Fig. 1.2). This metabolite
has negligible affinity for MR. The importance of 11β-HSD2 becomes clear by the syndrome
of apparent mineralocorticoid excess (AME) caused by a loss of function mutation in the 11β-
HSD2 gene. In the absence of 11β-HSD2 cortisol activates MR resulting in severe
hypertension mediated by increased ENaC activity (31-33). In the classical aldosterone target
organs such as kidney and colon 11β-HSD2 is co-expressed with MR (34). However, other
aldosterone-sensitive tissues such as heart or hippocampus lack 11β-HSD2 expression (35),
indicating that mineralocorticoid specificity is not exclusively ensured by 11β-HSD2.
Fig. 1.2: Inactivation of cortisol by
the 11β-HSD2
In epithelial tissues the enzyme 11β-
hydroxysteroid dehydrogenase type 2
(11β-HSD2) confers to aldosterone
specificity through converting cortisol
into its MR-inactive metabolite
cortisone.
1.4.2. The receptor level
At the receptor level two mechanisms are thought to contribute to mineralocorticoid
selectivity:
1) Ligand-dependent receptor conformation
11
Introduction
Even though the affinity of cortisol and aldosterone for MR is in the same order of
magnitude, cortisol dissociates more rapidly from MR than aldosterone does (36).
Additionally, in vitro transactivation assays revealed that MR is more sensitive to aldosterone
than to cortisol (25, 37). This indicates that the aldosterone-activated MR complexes are more
stable. This hypothesis has been reinforced by a study of Peter Fuller and colleagues,
demonstrating that intra-molecular contacts between the N and C-terminus of MR are stronger
in presence of aldosterone than of cortisol (38).
2) DNA-specific receptor conformation
Upon ligand binding MR binds to specific hormone response elements (HREs), typically
imperfect palindromic, hexameric half sites separated by 3 base pair (bp) spacers in the
promoters of target genes. It is widely accepted that MR and GR recognize common response
elements, but evidence is increasing that these elements comprise capabilities that confer to
the receptors activity. Recent studies from the Yamamoto laboratory reported that GREs
linked to target genes are highly conserved across species, but vary substantially around a
consensus (39). They further demonstrated that consensus sequences differing in a single bp,
differentially affect GR conformation and regulatory activity (40). Therefore it is likely that
common DNA consensus sequences differentially modulate MR vs. GR conformation and
thereby activity. It can be speculated, whether consensus sequences further tighten ligand-
dependent receptor conformation, important for specific co-regulator recruitment, and thus
target gene regulation. The recruitment of co-regulator proteins is considered as the post-
receptor level that confers to nuclear receptor-mediated transcriptional specificity.
1.4.3. The post-receptor level
Co-regulator molecules are recruited by steroid receptors to enhance or repress
transcription and are thus divided into co-activators and co-repressors respectively. To date
more than 285 co-regulator proteins have been described. Some of them appear to be general
modulators, pleiotropic in their action, and cellular expression, whereas others seem to be
receptor specific or limited in their tissue distribution (41). For a detailed review on this topic
see references (42, 43).
About a dozen of co-regulators have been described that modulate MR activity. The MR
dependent co-regulator recruitment is schematically depicted in figure 1.3. Among the most
important co-activators were CBP/p300 (44), SRC-1 (45, 46), PGC-1α (46), TIF-1 and RIP-
140 (45) involved in chromatin remodeling and acetylation and the RNA helicase RHA (47).
12
Introduction
Co-repressors e.g. PIAS1 (48) and DAXX (49) have been demonstrated in vitro to bind MR
and to repress its transcriptional function. The first example for a MR selective co-activator is
the Pol II elongation factor ELL (eleven-nineteen lysine-rich leukemia). It was demonstrated
that the co-activating properties of ELL are restricted to MR, because it strongly represses
transactivation of GR and had no effect on PR and AR (50). A comprehensive study
comparing the interaction of a panel of cofactor binding peptides with LBD from MR, GR,
PR and AR demonstrated that the number of cofactors binding to MR was much less than for
GR and PR and not dissimilar from AR (51). This provides further support for MR and GR
functional diversity of action.
Fig. 1.3: Co-regulator recruitment by
MR
MR binds to hormone responsive
elements (HREs) in the promoter of
target genes and recruits a series of
co-activator or co-repressor complexes
that control initiation of transcription by
interaction with the preinitiation
complex (PIC); The PIC comprises
TBP and TAFs at the proximal
promoter (TATA-box) and is associated
with the RNA pol II.
Taken together, MR has equal affinity to aldosterone and cortisol, the natural ligand of
the GR, and the ubiquitously expressed GR is activated by supraphysiological concentrations
of aldosterone. To date several mechanisms have been identified that confer to MR
specificity. Nevertheless, this cross-reactivity makes it experimentally difficult to attribute
observed effects to either MR or GR. To investigate the mechanisms by which the
aldosterone-activated MR exerts its function requires experimental systems that largely
eliminate interference with GR.
1.5. Molecular mechanisms of action
Aldosterone-activated MR exerts its physiological action through modulation of gene
expression, which occurs after a lag period of 0.5-1 h. In contrast, there is increasing evidence
of rapid (within minutes after aldosterone exposure) so called non-genomic effects that
involve second messenger signaling pathways. To date it is not clear whether these rapid non-
genomic actions are mediated by MR or by a putative novel transmembrane receptor.
The best-known effect of aldosterone-activated MR is the increase of sodium
reabsorption across target epithelium in the aldosterone-sensitive distal nephron (ASDN) (52),
13
Introduction
which is the principle site for sodium retention in the body. This vectorial electrogenic
transport is mediated by the apically localized epithelial sodium channel (ENaC, SCNN1) and
catalyzed by the basolateral sodium potassium adenosinetriphosphatase Na-K-ATPase
(ATP1A1). The activity and surface expression of ENaC is hereby the rate limiting step and
consequently the prime target of the regulative impact of aldosterone-activated MR in the
kidney. In the recent years a number of gene products that are induced by aldosterone have
been identified, that have led to a much better understanding of the MR and its molecular
mechanism of action. The following chapter will focus on MR target genes that have been
shown to be crucial for the aldosterone-controlled transepithelial sodium transport.
MR functions as a ligand-dependent transcription factor (see section 1.2) by modulating
the transcription of target genes (41, 53). The mode by which MR alters the expression of its
target genes can be divided into an early and a late phase. Early responsive genes are
considered as direct MR target genes and respond to short time aldosterone exposure. These
genes code for regulatory factors that mediate acute effects through modulating channel
trafficking and possibly the open probability of already synthesized channels (54). As
aldosterone exposure continues late responsive genes are regulated. This regulation does not
exclude direct regulatory mechanisms but probably requires factors induced in the early
phase. Late responsive genes code, among others, for the transporters themselves. The long-
term regulation occurs probably via the number of functional channels expressed.
1.5.1. Channels and transporters involved MR-regulated transepithelial sodium transport
ENaC is composed of three distinct but similar subunits (α, β and γ) and located in the
apical membrane of epithelial cells. Each subunit consists of two transmembrane domains and
a large (50 kDa) extra-cellular region, whereas the amino and the carboxy-termini of all
subunits (~8-10 kDa) are cytosolic. The importance of all three ENaC subunits in the
mechanism of salt homeostasis has been demonstrated by different knockout mouse models.
Targeted disruption of α-ENaC (55), β-ENaC (56) and γ-ENaC (57) led to severe salt wasting
phenotypes in neonates, who died within 2 days after birth probably from hyperkaliemia. The
expression of all three ENaC subunits is stimulated by aldosterone in a tissue specific manner.
In the kidney the α-ENaC subunit is responsive to aldosterone (58), whereas in the colon only
β and γ-ENaC subunits are induced by aldosterone (59, 60). Interestingly, under normal
conditions in the kidney, when the rate of sodium transport is low, α-ENaC is transcribed to a
lesser extent than β- and γ-ENaC (61).
14
Introduction
The Na-K-ATPase is present in all cells to ensure basic cellular ion homeostasis but it
also contributes to specialized tissue functions (62). In epithelial cells involved in sodium
transport the expression of the Na-K-ATPase is restricted to the basolateral membrane where
it catalyses, dependently on ATP hydrolysis, the transport of 3 Na+ ions out of the cell in
exchange for 2 K+ ions into the cell (63). Its primary role is to maintain high intracellular K+
and low intracellular sodium concentrations. Thus the Na-K-ATPase becomes the driving
force for sodium reabsorption in epithelia which can develop high lumen-to-blood
concentration gradients. The Na-K-ATPase is composed of 2 subunits: a large catalytic α-
subunit (113 kDa), which transports the cations and hydrolyzes ATP, and a smaller β-subunit
(35 kDa), which has been proposed to be involved in the structural assembly of the enzyme
(64). mRNA level coding for the α- and β-Na-K-ATPase subunits were increased upon
aldosterone treatment in rat kidney epithelial cells (65) and HEK293 cells (66).
1.5.2. Early MR-responsive genes modulating sodium retention
The majority of rapid MR-responsive genes directly or indirectly modulate ENaC in its
surface expression or activity. ENaC is a protein complex with rapid turnover due to an
ubiquitinylation pathway that exerts a tonic inhibition on ENaC surface expression (54, 67).
A central player in the group of proteins which influence the surface expression of
ENaC by interfering with this ubiquitinylation pathway is the serine/threonine kinase SGK1
(68-70), whose regulation by aldosterone has been shown in the ASDN and the distal colon.
In cell culture experiments it has been shown that activation of SGK1 is dependent on the
insulin-induced phosphatidylinositol 3-kinase (PI3K) signaling cascade. In contrast to
aldosterone-mediated signaling, which requires gene expression, insulin rapidly (within
minutes) stimulates PI3K activity through a multiple step transduction pathway (12). The
detailed mechanisms by which aldosterone induces PI3K activity remain to be elucidated. It is
assumed that this activation might be mediated by the aldosterone-induced K-RAS2 (71),
which has been shown to interact with PI3K (72). Thus SGK1 consolidates two extracellular
signals (aldosterone and insulin) to regulate sodium transport. Activated SGK1
phosphorylates the E3 ubiquitin ligase Nedd4-2 and thereby induces its interaction with
specific 14-3-3 protein isoforms (73-75). This impairs the interaction of Nedd4-2 and ENaC,
which causes channels to remain in the apical membrane that are otherwise targeted for
proteasome degradation (41).
15
Introduction
In addition to the ubiquitinylation route of regulating ENaC surface expression the RAS-
RAF-MEK-ERK pathway has emerged as an ENaC regulatory pathway. ERK seems to be
constitutively activated in collecting duct cells and has a potent inhibitory effect on ENaC
(reviewed in Bhalla et al. and references therein (54)). ERK appears to act via ENaC
phosphorylation, which stimulates interaction with Nedd4 ubiquitin ligases (76). However,
the expression of the core pathway proteins RAS, RAF, MEK and ERK seems not to be
regulated by aldosterone. On the other hand, several proteins which specifically regulate the
activity of that pathway have been reported to be aldosterone-regulated MR target genes
including K-RAS2 (71, 77), NDRG2 (78, 79), and GILZ1 (80, 81). Recent studies
demonstrated that GILZ1 stimulates ENaC-mediated sodium transport in Xenopus leavis
oocytes and kidney epithelial cells by inhibiting RAF (82). Further studies revealed that
GILZ1 directly interacts with the α- and β-ENaC subunits and is assembled with an ENaC
regulatory complex containing RAF-1 and Nedd4-2 (83). This supports the hypothesis that
aldosterone exerts its sodium stimulatory effect through triggering the formation of an
inhibitory complex that protects ENaC from tonic degradation by Nedd4-2.
Apart from ENaC the basolateral localized Na-K-ATPase might also be a target to fine-
tune sodium reabsorption. However, the only aldosterone-induced protein identified so far
that directly regulates the Na-K-ATPase activity is the corticoid hormone-induced factor
(CHIF) (84). CHIF is a member of the FXYD protein family, which is expressed in epithelia
of the nephron and the distal colon (85, 86), while its regulation by corticoids seems to be
restricted to the colon (85, 87).
A schematic overview how these early aldosterone-induced genes modulate ENaC-
mediated transepithelial sodium transport is shown in Figure 1.4. However, this picture is still
incomplete. There are several lines of evidence that there are yet unidentified genes involved
that also regulate ENaC activity or mediate crosstalk of already known regulatory processes.
16
Introduction
Fig. 1.4: Schematic depiction of aldosterone-regulated ENaC activity in an epithelial cell
Aldosterone-activated MR translocate into the nucleus and bind as homodimers to hormone
response elements (HREs) in the promoter of target genes, activating or repressing their
transcriptional activity. Aldosterone-induced proteins negatively regulate the activity of Nedd4-2,
which decreases ENaC cell surface expression. P, phosphate; ECV, extracellular volume; EGF,
epidermal growth factor; INS, insulin. See text for definitions of other abbreviations.
1.6. Aim of study
The mineralocorticoid receptor (MR) plays a pivotal role in salt and water homeostasis
and thus blood pressure. Dysregulation of MR signaling is involved in hypertension and
cardiac failure, two diseases with an enormous medical and economic burden for western
societies. Pharmacological blockade of MR can lower blood pressure and improve prognosis
in patients with severe heart failure, as convincingly demonstrated in clinical trials.
The detailed molecular mechanisms by which the MR exerts its effects are still not well
understood and lag far behind the knowledge of other steroid hormone receptors. That might
be in part due to the lack of appropriate in vitro models and the cross-reactivity with the
ubiquitously expressed glucocorticoid receptor (GR).
The present study aimed at the generation of appropriate in vitro models that allow a
clear separation of MR- versus GR-mediated effects in order to identify direct MR target
genes and to study their involvement in aldosterone-mediated physiological processes.
Gaining new insights into the molecular mechanisms of MR may provide the basis for the
17
Introduction
development of novel pharmaceuticals. Furthermore these studies should provide the basis for
novel in vitro test systems for the characterization of newly synthezised antimineralocorticoid
compounds. In the recent years it became increasingly evident that antimineralocorticoid
drugs, either given alone or on top of standard therapy, are beneficial in the treatment of
cardiovascular diseases. Also, the antimineralocorticoid activity of Drospirenone, a progestin
used in contraception and hormone therapy, has led to additional health benefits in women.
18
Material and Methods
2. Materials and Methods
2.1. Material
2.1.1. Plastic ware
All plastic ware required for cell culture maintenance was purchased from BD
(Heidelberg, Germany) or Corning® distributed by Sigma-Aldrich (Schnelldorf, Germany).
Cell culture dishes and multi-well plates were purchased from NUNCTM distributed by
Thermo Fisher Scientific (Langenselbold, Germany). Plasticware for molecular biology was
purchased from Biozym (Oldendorf, Germany) or Eppendorf AG (Hamburg, Germany).
2.1.2. Chemicals
If not stated otherwise, all chemicals were purchased from Sigma (Fulka) (Steinheim,
Germany) or Merck (Darmstadt, Germany) in p.a. (pro analysi) grade. Except for RU-
compounds (Sigma-Aldrich) hormones were synthesized in-house (Medicinal Chemistry
department of BSP).
2.1.3. Water
Water was purified utilizing the Milli-Q Gradient (Millipore, Schwalbach, Germany).
For PCR and restriction analysis nuclease-free ultra pure water (Ambion, Foster City, CA,
USA) was used.
2.1.4. Buffers
- DNA annealing buffer: 100 mM Tris-HCl, 1 M NaCl, 10 mM EDTA
- Chromatin sonication buffer: 10 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM EDTA,
0.5 mM EGTA, 0.1% Lauroylsarcosin, 0.1% Na-deoxycholate
- DNA loading buffer: 50% (w/v) Glycerin, 10 nM Tris, 10 mg/ml Orange G, pH = 7.5
- Lysis buffer for Western blot analysis: complete Lysis-M, EDTA free (Roche, Basel,
Swiss)
- RIPA buffer: 10 mM Tris-HCl pH 8.0, 1% Triton X-100, 1% Na-deoxycholate
19
Material and Methods
- Transfer buffer: NaHCO3 (10 mM), Na2CO3 (3 mM), SDS (0.05%), Methanol (20%)
- 20x MOPS SDS running buffer: NuPAGE (Invitrogen, La Jolla; CA, USA)
- 1x PBS: 137 mM NaCl, 2.7 M kcl, 8.2 mM Na2HPO4, 1.5 mM KH2PO4
- 50x TAE (tris acetate EDTA) buffer: 2 M Tris/HCl, 1 M acetic acid, 0.1 M EDTA
- 10x TBE buffer: 0.89 M Tris/HCl, 0.89 M boric acid, 20 mM EDTA
- 10x TBS buffer: 500 mM Tris.HCl, 1500 mM NaCl pH 7.4
- TBST: 1x TBS, Tween (0.05%)
2.1.5. Media
For bacterial culture the following media were used: LB medium: 1% (w/v) bacto
trypton, 0.5% (w/v) bacto yeast extract, 1% (w/v) NaCl; LB agar: LB medium with 1.5%
(w/v) bacto agar. Media for cell culture were purchased from Gibco® (Invitrogen). PBS for
cell culture and trypsin was purchased from PAA (Biochrom AG, Berlin, Germany).
2.1.6. Size standards
DNA size markers: TrackIt™ 1 kb Plus DNA Ladder, TrackIt™ 100 bp DNA Ladder
(Invitrogen). Protein size marker: Precision Plus Dual Color (Bio-Rad, Hercules, CA, USA)
2.1.7. Oligonucleotides
Oligonucleotides were designed using the computer software Vector NTI (Invitrogen),
SeqMan and PrimerSelect (DNASTAR, Madison, WI, USA) and purchased form Metabion,
(Munich, Germany).
Table 2.1: Oligonucleotides
Sequence 5' - 3' Primer Name used for
CTCCGCCCAGTTCCGCCCATTC SV40 For2 Genotyping
ACGCCGAGTTAACGCCATCAAAAA LacZeo Rev1 Genotyping
CCGCCCAGTTCCGCCCATTCTC SV40 For1 Genotyping
GGGCAGTTCGGTTTCAGGCAGGTCTT Hygro Rev3 Genotyping
CTCACGGGGATTTCCAAGTCTC CMV For1 Genotyping
TGGAATAGCACCGGAAACACAG hMR Rev1 Genotyping
CCTCCCCCGTGCCTTCCTTGACC BGH For1 Genotyping
AACCATCGGCGCAGCTATTTACCC Hygro Rev2 Genotyping
ATGCCTGCTGATGGGAACTGGAT CNKSR3 human For qPCR
CCGCTCGGTCGTGGGTCTG CNKSR3 human Rev qPCR
ATGTGAGTGGGCCCAACGACCTAC SGK human For qPCR
GCTTCCTTGACGCTGGCTGTGAC SGK human Rev qPCR
20
Material and Methods
Sequence 5’ – 3’ Primer Name used for
GGGCCTAACCAGCCTTGGGAGTAT TSC22D3 human For qPCR
CCGTGGCCGCATTCAGAGG TSC22D3 human Rev qPCR
GAAGTTGGCCGCATGAAGA Cyclophilin human F1 qPCR
GCCTAAAGTTCTCGGCCGT Cyclophilin human R1 qPCR
CTGACCGAGCGTGGCTACA beta-Actin human F1 qPCR
GCCATCTCCTGCTCGAAGTC beta-Actin human R1 qPCR
GGATGCGGTGAGGGAGTGGTA SCNN1A human For qPCR
AAGCGGCAGGCGAAGATGAA SCNN1A human Rev qPCR
CTGGAAGGCCGCTGTGGTG FKBP5 human For qPCR
TGTTCTTCCCGCTGCATTTTCTC FKBP5 human Rev qPCR
GGCAACAGTTGAACACCAGGAAAATC PDK4 human For qPCR
AGGCGTTGGTGCAGTGGAGTATGTAT PDK4 human Rev qPCR
AGCGCAGCGACGGGTTGTT PHLDA1 human For qPCR
CAGCTGCTTGGGCGGGATAA PHLDA1 human Rev qPCR
AGCGCTCCCGGGACTACTCG ZBTB16 human For 3 qPCR
GTGGCCCTTCATGTGCTTCTGC ZBTB16 human Rev 3 qPCR
CAGCCGGCTCGGTGTCCTC MAFB human For qPCR
AGCGCCTCGGGGTTCATCTG MAFB human Rev qPCR
GGGGGACACCTGGAAGGATTACTG KLF9 human For qPCR
CACGGAGGGGGTCTGGATGG KLF9 human Rev qPCR
CGCGGTGGGCAAGACGAG RHOU human For qPCR
GCCGCCCATCCACAGACAC RHOU human Rev qPCR
CAAAATTCGGCGTGGACAGTTCT TRIB1 human For qPCR
AGTAGGATCTCGGGGGCAGTGA TRIB1 human Rev qPCR
ACGTGGACCGGCTGGAGGAG ARL4C human For qPCR
ATAGGTGGTGGCCGGGATAAGC ARL4C human Rev qPCR
CCGGCCGACTTTGGAGGTGT BCL6 human For qPCR
TGAGGGGGCAGCAGGTTTGAG BCL6 human Rev qPCR
CATCATCACGCTGGTGGTCCTCTT EFNB2 human For qPCR
CGCTGCGCTTGGGTGTGG EFNB2 human Rev qPCR
CCAACGGCGAGGATCACTTCAG ETV1 human For qPCR
CCAACGGCGAGGATCACTTCAG ETV1 human Rev qPCR
CCGGCGCTTCAGGCACTACA F3 human For qPCR
ACTTGATTGACGGGTTTGGGTTCC F3 human Rev qPCR
CCGGGCAAGGGCAACTACTG FOXG1 human For qPCR
GCGCGGTCCATGAAGGTGA FOXG1 human Rev qPCR
ATTCCGCCTAACCCCGTATGTGAC Per1 human For qPCR
TGTGCCGCGTAGTGAAAATCCTCT Per1 human Rev qPCR
ACCCACCAGCACTGCCTCCTAAA PI3KR1 human For qPCR
TCCCCAGTACCATTCAGCATCTTG PI3KR1 human Rev qPCR
CGTGGGGCAGCACAAAGGTCT RASGEF1B human For qPCR
GGGAAGGCGGTTGGCACAA RASGEF1B human Rev qPCR
TCGCCCAGGCTTCTTCTCCAG TBX3 human For qPCR
CCTCGGCGTCGCTCTCACC TBX3 human Rev qPCR
TCGCCTGTTGGCTGCCTTACTACAT CXCR4 human For qPCR
TAGGGCCTCGGTGATGGAAATCC CXCR4 human Rev qPCR
ACCCCGCACCTCCACTCCATC NFKB1A human For qPCR
GAAGGGCAGTCCGGCCATTACA NFKB1A human Rev qPCR
AGGTCAGTACTTGGGACTGTGTCAGG PKP2 human/ rat/ mouse For qPCR
CGTGGGTGATCCCAGTGTGAAA PKP2 human/ rat/ mouse Rev qPCR
CCCCATGCGAGCTCATCAAGGGAAAGAC CDC42EP3 human For qPCR
21
Material and Methods
Sequence 5’ – 3’ Primer Name used for
AGGGCCCAAGATCAAGCTGCAGGGAGAG CDC42EP3 human Rev qPCR
ACCCGCACCTCATTCCTACATCAAT NRP1 human For qPCR
TCGCCTTGCGTTTGCTGTCAT NRP1 human Rev qPCR
GAGTATGCGGCTGTTGGGATTCT MBLN1 ChIP For ChIP
CTATGACTTGTGCCTGTGCTGGTG MBLN1 ChIP Rev ChIP
TAACACCCAGGGTCATTCTGTCAAA MGC21644 ChIP For ChIP
TCCTTGCTGAATGAATGAATGAACTG MGC21644 ChIP rev ChIP
TCAGGTGGGACAGCGGGAGAG SGK1 ChIP For ChIP
GTAACAAGCGAAGGGAGGGGTAGC SGK1 ChIP Rev ChIP
CCGGGCTTGTAAGATGTGAGAATG SCNN1A ChIP For ChIP
TCCTTAGGAAGCTGCCGTGTGC SCNN1A ChIP Rev ChIP
TGTTGCTCACAGCGAGACAGAGTG CNKSR3 Prom. ChIP For ChIP
CGGGCCCCGCTTTCCTT CNKSR3 Prom. ChIP Rev ChIP
CTCGATAGGGGGTACAAAAAGT CNKSR3 ChIP For ChIP
ATAGATGAGGCAGTACCCACAAA CNKSR3 ChIP Rev ChIP
CAAGGCGCAAGTAATTCTAACACAGG CXCR4 ChIP For ChIP
TGGAGACAGAAGGATTTAGGGAAGGA CXCR4 ChIP Rev ChIP
AACGCACTGGAGTGTGGAAATCAA RHOB ChIP For ChIP
ATCCAGAGGGGAACAGAACATCCA RHOB ChIP Rev ChIP
TTGAGGGGCTGCCCAGATACATTTA PDK4 ChIP For ChIP
GATCACCGCAAAAGGTAAGGCAAACT PDK4 ChIP Rev ChIP
CCCGGCCAAGGGGTTAGGAA KLF9 ChIP For ChIP
CTGGGCTGGGGCTGGATTGAT KLF9 ChIP Rev ChIP
ATGCCGTTCTCAGCCATCTACTCTG PIK3R1 ChIP For ChIP
TTGATGGAGGAAATGTGAAA PIK3R1 ChIP Rev ChIP
TGGGTTCCACCACATATACAACAGTTTG GILZ ChIP For ChIP
TAAGAGGCCCCAGTACTTTTCCAATAGC GILZ ChIP Rev ChIP
ATGAAGGGGAACAAGCGTGAGG SCNN1A ChIP control For ChIP
GCCGTGGATGGTGGTGTTGTT SCNN1A ChIP control For ChIP
GCATCTCGAGCACCGGCATCGCTGTTCTGC pGL4.23 SGK1 rep500bp For XhoI Reporter
GCATAAGCTTAGGGGGCGGAAATAAAAGTCGTCT pGL4.23 SGK1 rep500bp Rev HindIII Reporter
ACATCTCGAGAACATTGGGTTCCACCACATA pGL4.23 GILZ rep626bp For XhoI Reporter
ACATAAGCTTCAGGGAATTCTGATACCAGTTA pGL4.23 GILZ rep626bp Rev HindIII Reporter
GCTATGAGCTCAGGCGGGAGAATCGCTGGAACCTG pGL4.10 CNKSR3 Prom. For SacI Reporter
GCTATCTCGAGCGCGCTCGGGTTGCAAAGTTTCA pGL4.10 CNKSR3 Prom. Rev XhoI Reporter
GCTATCTCGAGCTGCCTCACTTATTCAAATTCTTCTGAT pGL4.23 CNKSR3 4kb up For XhoI Reporter
GCTATGAGCTCTCACCGAGTCTGAAACTCTTGGTATTAT pGL4.23 CNKSR3 4kb up Rev SacI Reporter
GCATCTCGAGGACAACTGAAATGCGAAGTAGAGTA pGL4.23 PIK3R1 For XhoI Reporter
GCATAAGCTTTGATGGAGGAAATGTGAAATGTAAG pGL4.23 PIK3R1 Rev HindIII Reporter
GCTATGAGCTCGCTTGTGCCAGACATTTGAGGGTAGA pGL4.10 PDK4 For SacI Reporter
GCTATCTCGAGTGGGACGGGGCTCCGAGTC pGL4.10 PDK4 Rev XhoI Reporter
ACATCTCGAGGAGGAGAGGGCTCAAAGAAGAAGCAGACTT pGL4.23 FKBP5 For XhoI Reporter
ACATGAGCTCAGCCACGTTTTCTCCTTACCCATCCTTCT pGL4.23 FKBP5 Rev SacI Reporter
ACATAAGCTTTTTCCGCGAGGTTATTATGAGCTGAGTGTT pGL4.23 NFKBIA For HindIII Reporter
ACATGAGCTCGAAAGACGAGGAGTACGAGCAGATGGTCAAG pGL4.23 NFKBIA Rev SacI Reporter
ACATAAGCTTATCTCCCCTAACCCAGGCAGTCCTTGAT pGL4.23 PER1 For HindIII Reporter
ACATGAGCTCGTCTTTGGTACCAGGCCAGCAGATGTGT pGL4.23 PER1 Rev SacI Reporter
ACATGAGCTCCTGGTTACTAGGGAATTCCGCACAAGTTC pGL4.23 CALM1 For SacI Reporter
ACATAAGCTTTCTGGGAATAAGAAAGGGAAATGCTGCTA pGL4.23 CALM1 Rev HindIII Reporter
GCTATGAGCTCGTGGAGCCGCAGTTGGTTGAAT pGL4.23_MBLN1 For SacI Reporter
GCTATCTCGAGGCTGCAGAGGGCTCGAAAGTCTAA pGL4.23_MBLN1 Rev XhoI Reporter
22
Material and Methods
Sequence 5' - 3' Primer Name used for
GCTATCTCGAGCTAAATGGAAATAGCCCTTCATAAATCC pGL4.23 MGC21644 For XhoI Reporter
GCTATGAGCTCCAAAGTTGCATAGATGAATGTAGCAGTG pGL4.23 MGC21644 Rev SacI Reporter
GCTATCTCGAGAAATGAGGCGGAAGCCACATCTGACT pGL4.23 SCNN1A For XhoI Reporter
GCTATGAGCTCAATCTTTATGGGTGTGGGTGTGAGTGTG pGL4.23 SCNN1A Rev SacI Reporter
GCTATGAGCTCGCTGGCCCCTCTCCTGTCTCTAAAA pGL4.23 CXCR4 For SacI Reporter
GCTATCTCGAGGAGTAAAAATGGCTCTCCCCCAAAAA pGL4.23 CXCR4 Rev XhoI Reporter
GCTATGAGCTCTGGTCTTGGGCAGTGGCTCCTA pGL4.23 RHOB For SacI Reporter
GCTATCTCGAGGGGGGATCTCACCTGCTGAAAATAATAC pGL4.23 RHOB Rev XhoI Reporter
ACATCTCGAGGCATGGGGGCCGTACAGAAGGGGGAACT pGL4.23 KLF9 For XhoI Reporter
ACATAAGCTTCGGCCAGGCTGTGCGGGAGGAGATG pGL4.23 KLF9 Rev HindIII Reporter
ACATGCTAGCCCAGTTCTTTTGTGGGTACTGCCTC GRE1 mut Rev NheI Mutation
ACATGCTAGCTTGCCCTGAAGTGCAGAAGCTACTAA GRE1 mut For NheI Mutation
ACATCCCGGGACCCCCTATCGAGTTGCAGATTATCCA GRE2 mut Rev ApaI Mutation
ACATCCCGGGAGTAATAAAAATCCACAGGAAAAAATGCAG GRE2 mut For ApaI Mutation
ACATGAATTCGCTGGTGTAAATGGCATTCTGTTCT GRE3 mut Rev EcoRI Mutation
ACATGAATTCTACAGTTCCAATTTAACTTTATGGGACTC GRE3 mut For EcoRI Mutation
ACATCTTAAGTTTTGGATAATCTGCAACTCGATAG GRE4 mut Rev AflII Mutation
ACATCTTAAGGAATGCCATTTACACCAGCTGTTCT GRE4 mut For AflII Mutation
CTCCCCGGGATGAGAATGTGAG CNKSR3 mus musculus For qPCR
CGGGCAGCTGATCGGAATCT CNKSR3 mus musculus Rev qPCR
GTGCGCGACCCCTGCTACCT TSC22D3 mus musculus For qPCR
CACTGGCTCCGGAGGCACTGT TSC22D3 mus musculus Rev qPCR
CGGCCTGCCCCCGTTTTAT SGK1 mus musculus For qPCR
TTGGCACCCAGCCTCTTGGTC SGK1 mus musculus Rev qPCR
GCAGCCAGTGGAGCCTGTGGT SCNN1A mus musculus For qPCR
CTGGCCCCTCGTCCTGGAGA SCNN1A mus musculus Rev qPCR
ACCGCCCACTGTGGCTGAGC SCNN1B mus musculus For qPCR
CCCCGGGATGGGCAGAGTCT SCNN1B mus musculus Rev qPCR
ACTGGATTTCCCCGCTGTCACTATCT SCNN1G mus musculus For qPCR
CCCGGCGTTTCCGAGGTG SCNN1G mus musculus Rev qPCR
CTGGCCGGGACCTGACAGACTAC beta-Actin mus musculus For qPCR
CACGCACGATTTCCCTCTCAGC beta-Actin mus musculus Rev qPCR
CACCATGGAAACCAAAGGCTACCACAGTCTCCCTGAAGGCCTA CDS rattus MR For Expression
TCACTTTCTGTGAAAGTAAAGGGGTTTGGCATTCCCAGACT CDS rattus MR Rev Expression
CACCATGGAACCCGTGACCAAGTGGAG CDS hCNKSR3 For Expression
TCAGTGAGTCAACAGTTTGAGGCGCGTAAA CDS hCNKSR3 Rev + STOP Expression
GTGAGTCAACAGTTTGAGGCGCGTAAAC CDS hCNKSR3 Rev - STOP Expression
CACCATGGAGCCCGTGACCAAGTGGAGC CDS mCNKSR3 For Expression
TCAGTGAGTCAACAGCTTGAGGCG CDS mCNKSR3 Rev + STOP Expression
GTGAGTCAACAGCTTGAGGCG CDS mCNKSR3 Rev - STOP Expression
*blue highlighted bases are overhangs required for cleavage close to ends; red highlighted bases are
restriction sites
2.1.8. Vectors and plasmids
- pcDNA3.1/V5His®TOPO® vector (Invitrogen)
- pcDNA5/FRT (Invitrogen)
- pGL4.10 [luc2] (Promega, Madison, WI, USA)
23
Material and Methods
- pGL4.23 [luc2/ minP] (Promega)
- pENTR2B (Invitrogen)
- pENTR/U6 (Invitrogen)
- pGT4 Lentiviral backbone (provided by Dr. Dr. Florian Prinz)
- pGT3 Lentiviral backbone (provided by Dr. Dr. Florian Prinz)
- pGT4-JRed Lentivirus (provided by Dr. Dr. Florian Prinz)
2.1.9. Antibodies
Table 2.2: Primary antibodies
MR antibody 6G1* mouse monoclonal provided by Dr. C. Gomez-Sanchez
CNKSR3 mouse polyclonal Abnova #H00154043-A01
Beta-Actin mouse monoclonal Sigma-Aldrich #A3854
Pan-Cadherin rabbit polyclonal Abcam #ab16505
RNA polymerase II mouse monoclonal Abcam #ab24758
V5 epitope mouse monoclonal Invitrogen #R960-25
GR antibody mouse monoclonal Novocastra #NCL-GCR
Myc antibody goat polyclonal Abcam #ab9132
MEK1/2 rabbit polyclonal Cell Signaling #9122
phospho-MEK1/2 (Ser217/221) rabbit monoclonal Cell Signaling #2338
phospho-MAPK (Thr202/Tyr204) rabbit monoclonal Cell Signaling #4377
*the generation and epitope specificity for this antibody is described in Gomez-Sanchez et al., 2006 (88).
Table 2.3: HRP-labeled secondary antibodies
Goat anti rabbit HRP-conjugated Pierce #1858415
Goat anti mouse HRP-conjugated Pierce #1858413
24
Material and Methods
2.2. Methods
2.2.1. Molecular biology
2.2.1.1. Restriction digest
Restriction endonucleases including corresponding buffers were purchased from New
England BioLabs (NEB) (Ipswich, MA, USA). Restriction digest from 250 ng up to 3 µg
plasmid DNA was performed according to manufacturers’ recommendations.
2.2.1.2. Fill-in of cohesive ends
To generate blunt ends restriction digest was followed by fill-in of 5´ overhangs. To this
end purified DNA fragments were incubated with 1 mM dNTPs and 1U Klenow enzyme
(NEB) in NEBuffer2 at 37°C for 30 min. Inactivation of the enzyme was achieved by
incubating the reaction mixture at 75°C for 20 min. If different buffer conditions for
subsequent enzymatic reactions were required, DNA was phenol/chloroform extracted and
resolved in water.
2.2.1.3. Purification of DNA fragments
Purification of PCR products was performed using the QIAquick PCR purification kit
(Qiagen, Hilden, Germany) according to manufacturers’ recommendations. DNA fragments
obtained by restriction analysis were separated by agarose gel electrophoresis. Bands of
interest were excised and DNA was extracted using the QIAquick Gel Extraction Kit (Qiagen)
according to manufacturers’ instructions. DNA was eluted in 30-50 µl nuclease-free water
(Ambion).
2.2.1.4. Ligation of DNA fragments
DNA ligation was performed using a T4 DNA Quick-Ligase (NEB) and the 2x ligation
buffer supplied with the enzyme. 25-50 ng vector DNA was incubated with a 5-fold molar
excess of the insert fragment. The following equation was used to calculate the amount of
insert DNA: mInsert (ng) = 5 x mVector (ng) x lengthInsert (bp)/lengthVector (bp).
25
Material and Methods
2.2.1.5. Transformation of E. coli and bacterial cultures
Transformation of E. coli cells was performed using a heat shock transformation
procedure according to manufacturers’ recommendations. E. coli TOP10 cells (Invitrogen)
were thawed on ice. After application of vector DNA cells were incubated for 30 sec at 42°C
and mixed with S.O.C. medium. Cells were incubated for 1 h at 37°C in a shaker rotating at
200 rpm and then plated on LB agar containing selection marker. The same protocol was used
for transformation of E. coli Stbl3TM cells (Invitrogen) with Lentiviral constructs. Positive
transformants were identified either by PCR or restriction digest analysis.
Bacterial cultures for DNA mini preparations were grown overnight in 4 ml LB medium
containing either 100 µg/ml ampicillin or 50 µg/ml kanamycin as selection marker at 37°C in a
shaker rotating at 200 rpm. For DNA maxi preparation starter cultures were grown under the
conditions described above for 5 h and were then transferred to 200 ml LB medium containing
an appropriate selection marker. Cultures were grown overnight at 37°C in a shaker rotating at
200 rpm.
2.2.1.6. Preparation of plasmid and genomic DNA
The following kits were used for plasmid DNA preparation according to manufacturers’
instructions: QIAprep Spin Miniprep kit and QIAfilter Plasmid Maxi kit (Qiagen). DNA was
eluted in nuclease-free water (Ambion).
Genomic DNA was prepared from HEK293 cells by using the NucleoSpin® Tissue kit
(Macherey-Nagel, Düren, Germany) according to manufacturers’ recommendations. Purified
DNA was directly used as a template for restriction or PCR analysis.
2.2.1.7. Agarose gel electrophoreses
1% (w/v) agarose was melted in TAE buffer using a microwave oven and allowed to cool
down to 70-60°C before 0.5 µg/ml ethidium bromide was added. DNA samples were mixed
with loading buffer [50% glycerol (w/v), 10 mM Tris-EDTA, pH 7.5] [6:1, (v/v)] containing
Orange G dye (10 mg/ml) to track DNA migration. To assess the length of DNA fragments
appropriate size standards were loaded in one lane. DNA was visualized using the Versadoc
3000 Imaging System.
26
Material and Methods
2.2.1.8. RNA preparation and cDNA synthesis
Total RNA was isolated using QIAshredder and RNeasy Mini Kits (Qiagen) according
to manufacturers’ recommendations. To prevent genomic DNA contamination an on-column
DNase digestion step was included. The RNA integrity number (RIN), a measure of the RNA
degradation grade, was determined using RNA LabChips and the Agilent Bioanalyzer 2100
(Agilent Technologies Inc., Santa Clara, CA, USA). RNA concentrations were determined on
the Peqlab NanoDrop (Peqlab Biotechnology, Erlangen, Germany). Copy DNA (cDNA) was
synthesized from 1-3 μg of total RNA using the Superscript™ III reverse transcriptase
(Invitrogen) according to the manufacturers’ instructions. In order to enrich for mRNA
transcripts oligo(dT) primers were applied.
2.2.1.9. Polymerase chain reaction (PCR)
DNA amplification was performed using PfuUltraTM II Fusion HS DNA Polymerase
(Stratagene, La Jolla, CA, USA). In case of non-specific PCR products or a smear, a
touchdown PCR (TD-PCR) protocol was applied in order to enrich for specific PCR product
during the first cycles. In brief: during the first cycling steps the annealing temperature
followed a gradient, starting 2°C above predicted primer Tm. In decremental steps of 1°C per
cycle the annealing temperature was decreased until reaching a temperature 2°C below
calculated optimal primer annealing temperature, followed by a set of 25 amplification cycles.
2.2.1.10. Quantitative real time PCR analysis
Quantitative real time PCR (qPCR) was performed using a 7500 fast real-time PCR-
System (Applied Biosystems Inc, Foster City, CA, USA) to determine relative mRNA
expression. MR-expressing M1 and HEK293 cell clones and the non MR-expressing parental
cell lines were starved in culture medium containing 3% charcoal-treated FBS (see section
2.2.2.2) for 24 h before addition of indicated concentrations of aldosterone. Appropriate
amounts of DMSO were used as a vehicle control. RNA was isolated followed by reverse
transcription for cDNA synthesis (see section 2.2.1.8). PCR analyses were performed in
triplicates using QuantiFast SYBR Green mix (Qiagen) with 200 nm of each primer and 25 ng
of cDNA in a final reaction volume of 20 µl. An initial denaturation step at 95°C for 5 min
was necessary to activate the DNA polymerase. The program consisted of 40 cycles of a two-
step cycling protocol, including a denaturation step at 95°C for 10 sec and a combined
annealing/ extension step at 60°C for 30 sec. In order to check specificity of PCR products a
27
Material and Methods
melting curve analysis was performed subsequently to PCR analysis. Data were analyzed
using the 2-ΔΔCT method (89) and normalized to the expression of beta-actin gene (referred as
reference gene) [relative expression (fold induction) = 2-∆∆CT; ∆∆CT = (CTtarget – CTref
(treatment)) - (CTtarget – CTref (control))].
The qPCR on microdissected nephron samples (see section 2.2.3) was carried out on an
iCycler (Biorad Laboratories, Marnes La Coquette, France) using gene-specific primers to
quantify the relative abundance of each gene with SYBR Green I as the fluorescent molecule.
Relative expression of the mRNA was quantified using the equation described by M.W. Pfaffl
(90) (ratio = (Etarget)ΔCTtarget(control-sample)/(Eref)ΔCTref(control-sample)). Values of mRNA levels were
normalized for HPRT1 mRNA in mice (91).
2.2.1.11. Cloning of expression and reporter constructs
The coding sequence (CDS) for human wt MR was subcloned from a pcDNA3.1-hMR
expression plasmid (provided by Dr. Steffen Borden) into a pcDNA5/FRT vector (Invitrogen)
via XhoI and HindIII. The CDS for rat MR was amplified by RT-PCR from rat kidney total
mRNA and cloned into pcDNA3.1/V5His®TOPO® vector (Invitrogen). The CDS for human
wt CNKSR3 was amplified by RT-PCR from HEK293 total mRNA. In order to fuse the CDS
of CNKSR3 in frame to a V5 epitope tag on its C-terminus, a second primer-set was used,
which contained a reverse PCR primer lacking the stop codon (see Table 2.1). Both sequences
were inserted into pcDNA3.1 directional TOPO vector. Analogue to this, two plasmids
encoding for the wt and a C-terminal V5 tagged version of mouse CNKSR3 (CDS was
amplified from total mouse kidney mRNA) were generated accordingly. In order to generate
lentiviral expression constructs the CDS encoding the mouse wt CNKSR3 was subcloned into
pENTR2B vector and recombined by Gateway® cloning (92) according to manufacturers’
recommendations (93) into a pLenti6 (Invitrogen) derived destination vector, pGT4. shRNA
cassettes were subcloned into pENTR/U6 (see section 2.2.1.12) and selected pENTR/U6
shRNA constructs were recombined by Gateway® cloning into a modified pLenti-6
destination vector (pGT3).
For reporter assays, plasmids pGL4.10 and pGL4.23 (Promega) were used. Both
plasmids contain the firefly luc2 reporter gene. pGL4.23 contains an additional minimal
promoter upstream of luc2. MR binding regions identified by ChIP experiments were
amplified by PCR from human genomic DNA (Promega #G3041) with appropriate primer-
sets (see Table 2.1) containing restriction sites for inserting ~500 bp PCR fragments upstream
of the reporter gene. Plasmid pGL4.10 was used for fragments less than 600 bp distant from
28
Material and Methods
the transcription start site (TSS) of a gene (these included PDK4 and the proximal CNKSR3
promoter fragment). Plasmid pGL4.23 was used for fragments more than 600 bp distant from
the TSS of a gene (these included an upstream sequence of CNKSR3-4 kb up, GILZ, KLF9,
NFKBIA, FKBP5, PI3KR1, PER1, an intronic region of SCNN1A, RHOB, CALM1,
MGC21644, CXCR4 and MBNL1). Several pGL4.23-CNKSR3 derived reporter plasmids
were generated by PCR-based site-directed mutagenesis using primer-sets (see Table 2.1)
carrying the desired mutations. All constructs generated were confirmed by DNA sequencing.
The pcDNA5/FRT N-terminal 9-fold myc-tagged human MR expression plasmid was kindly
provided by Dr. Horst Irlbacher.
2.2.1.12. Constructs for RNA interference
Complementary synthetic DNA oligonucleotides for RNA interference (RNAi) were
designed using Invitrogens RNAi Designer online platform (94). Constructs for shRNA
expression were cloned according to the BLOCK-iT user manual (95). In brief:
oligonucleotides (Table 2.4) were hybridized with their respective complementary sequences
in order to generate double strand (ds) oligos. To this end, 200 µM of top and bottom strand
oligos were incubated in annealing buffer at 95°C for 5 min and cooled down to RT for 10
min. Annealed oligos were analyzed in comparison to single strand oligos by gel
electrophoresis on a 3% agarose gel. 10 nM ds oligos and 1 ng of pENTR/U6 vector
(Invitrogen) were mixed for the ligation reaction. 10 µl of ligation mixture were used for
transformation of E. coli TOP10 chemically competent cells. As a control a non-target
oligonucleotide (Qiagen) was used.
Table 2.4 shRNAs targeting CNKSR3
CACCGGATTGCCTCATAGCAGAAATTTCAAGAGAATTTCTGCTATGAGGCAATCC shRNA1 top CNKSR3
AAAAGGATTGCCTCATAGCAGAAATTCTCTTGAAATTTCTGCTATGAGGCAATCC shRNA1 bottom CNKSR3
CACCGCCTGGGCATGTACATCAAGTTTCAAGAGAACTTGATGTACATGCCCAGGC shRNA2 top CNKSR3
AAAAGCCTGGGCATGTACATCAAGTTCTCTTGAAACTTGATGTACATGCCCAGGC shRNA2 bottom CNKSR3
CACCGCTACAGAGGACACAGTAAGATTCAAGAGATCTTACTGTGTCCTCTGTAGC shRNA3 top CNKSR3
AAAAGCTACAGAGGACACAGTAAGATCTCTTGAATCTTACTGTGTCCTCTGTAGC shRNA3 bottom CNKSR3
CACCGGAGCAGGTGCTACATCAACTTTCAAGAGAAGTTGATGTAGCACCTGCTCC shRNA4 top CNKSR3
AAAAGGAGCAGGTGCTACATCAACTTCTCTTGAAAGTTGATGTAGCACCTGCTCC shRNA4 bottom CNKSR3
CACCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAA shRNA non-target control top
AAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAA shRNA non-target control bottom
*blue highlighted bases represent the linker for directional integration into the pENTR/U6 vector, red
highlighted bases represent the loop sequence, black nucleotides represent the sense or antisense
sequence
29
Material and Methods
2.2.1.13. Western blot analysis
Equal amounts (20-40 µg) of protein were resolved by PAGE electrophoresis in SDS
12% gradient gels (Invitrogen) and transferred onto nitrocellulose membranes (Amersham
Biosciences, Freiburg, Germany) using a semi-dry blotting technique. Membranes were
blocked with Tris-buffered saline (TBST) containing 0.05% Tween20 and 5% dry milk
(Carnation purchased from Nestlé) for 1 h at room temperature. Primary antibodies (see Table
2.2) were incubated overnight in TBST containing 2% dry milk or 5% BSA at 4°C.
Membranes were washed 3 times with TBS and then incubated for 1 h at room temperature
with an appropriate HRP-conjugated secondary antibody (see Table 2.3) in TBST containing
5% dry milk. Finally, membranes were washed 3 times with PBS and incubated in West Dura
Substrate (Pierce, Rockford, IL, USA) and exposed to chemiluminescence films (Amersham
Bioscience).
2.2.1.14. Chromatin immunoprecipitation
Chromatin immunoprecipitation (ChIP) experiments were carried out as described in
reference (96) with the following modifications: for each ChIP sample 9 x 106 HEK293-
hMR-myc cells seeded in 14 cm cell culture plates were treated with 10 nM aldosterone or
0.001% DMSO as a vehicle control for 60 min. Cross-linking was performed using 1%
formaldehyde for 9 min at room temperature. Chromatin was sonicated in 1 ml sonication
buffer using a Bioruptor (Diagenode, Liège, Belgium) to an average chromatin size of 200–
500 bp. Sonicated chromatin of aldosterone or vehicle-treated cells was incubated with 3 µg
anti-myc antibody (see Table 2.2) and 30 µl magnetic protein A beads (Dynal, Invitrogen) and
incubated on a rotating platform overnight at 4°C. Beads were washed in RIPA buffer
containing increasing salt concentrations (140 mM NaCl to 500 mM NaCl). Finally, beads
were washed in a LiCl detergent solution containing 10 mM Tris-HCl pH 8.0, 250 mM LiCl,
1 mM EDTA and 0.5% Na-deoxycholate. Elution of antibody captured chromatin off the
magnetic beads was carried out with 10% Chelex100 for 10 min at 95°C as described.
Processed eluate was used as a template for qPCR analysis. As a reference negative control, a
sequence located in the second exon of the scnn1a gene was used, which is not bound by the
MR. “Fold enrichment” of myc-MR was calculated by the ∆∆CT method as described in
section 2.2.1.10. The ratio of sequence enriched in the aldosterone vs. vehicle group was
normalized for input DNA [fold enrichment = (∆CTAldo IP - ∆CTAldo Input)/ (∆CTVehicle IP -
∆CTVehicle Input)].
30
Material and Methods
2.2.1.15. Affymetrix microarray experiments
In order to determine aldosterone-regulated genes in HEK293-hMR+ cells on a genome-
wide level Affymetrix gene profiling experiments were carried out. The Affymetrix
microarray technology is based on a hybridization technique. In brief: for each covering
RefSeq sequence these arrays provide multiple independent oligonucleotides (25 mers), so-
called probe sets which consists of 11 probe pairs. Every probe pair contains a perfect match
(PM) oligonucleotide and a corresponding mismatch (MM) oligonucleotide. The average
differences between PM and MM provide data to quantify and control cross-hybridisation.
The HG-U133Plus2.0 arrays used in this study contains 54,120 probe sets covering 47,401
transcripts of 38,572 genes. Biotinylated cRNAs synthesized from total RNAs obtained from
different treatment groups were hybridized on arrays. The arrays were washed, stained with
phycoerythrin-coupled streptavidin and scanned for hybridisation signals. After data
collection, data adjustment, and statistical analysis an alteration of the gene regulation pattern
was extracted.
Microarray experiments were carried out by the Microarray Core Facility at Bayer
Schering Pharma AG. Statistical analyses were carried out by Dr. Florian Sohler.
Total RNA was isolated from aldosterone or vehicle treated HEK293-hMR+ cells and
checked for integrity as described in section 2.2.1.8. 2 µg of total RNA were used to prepare
biotinylated and fragmented cRNA following the instructions of the Affymetrix One-Cycle
Target Labeling protocol (Affymetrix, Santa Clara, CA, USA). Biotin-labeled cRNA quality
and quantity was determined by means of Agilent bioanalyzer RNA LabChips (expected
fragment size: 1000-2000 nucleotides) and by Nanodrop analysis respectively. A total of
15 µg fragmented cRNA from each sample was hybridized on an Affymetrix GeneChip HG-
U133Plus2.0 array at 45°C for 16 h under constant agitation. Arrays were scanned using a
GeneChip Scanner 3000 7G (Affymetrix), and scanned images were extracted utilizing the
Affymetrix GCOS Software. The generated data files (CEL format) containing probe level
expression data were refined and condensed by using GeneData Expressionist Refiner
(GeneData AG, Basel, Swiss) software with the implemented MAS5.0 statistical algorithm.
For background/noise adjustment a locally weighted linear regression analysis (LOWESS)
was carried out using all experiments as a reference. To identify differentially expressed
genes the following statistical analyses were applied: a 2-Way analysis of variance (ANOVA)
was performed with the factors time and treatment. The “fold change” was computed
separately for each time point. Probe sets with a fold change of 1.5-fold or higher at any time
31
Material and Methods
point and a p-value from the treatment effect in the 2-Way ANOVA > 10-5 [corresponding to
a false discovery rate of 0.018 according to the method of Benjamini and Hochberg (97)]
were considered as aldosterone-regulated.
2.2.1.16. Determination of MR copy number
The MR copy number per cell was determined by 3H-aldosterone binding assays as
described in (98). In brief: in Scatchard analysis the saturable binding concentration was
determined using increasing concentrations (0.1-10 nM) 3H-aldosterone (Perkin Elmer,
specific radioactivity 73.9 Ci/mmol). To determine the number of MR/cell 1.5 x 105 living
cells per sample were incubated for 1 h at RT under constant agitation with 5 nM 3H-
aldosterone in the absence (total binding) and presence of a 2000-fold excess of unlabeled
aldosterone (non-specific binding). Specific binding of aldosterone was calculated as the
difference between total and displaceable radioactivity measured. Experiments were also
carried out in presence of a 2000-fold excess of the GR antagonist RU486, to exclude binding
of aldosterone to the GR. The number of MR molecules expressed per cell was calculated by
the radioactivity determined for specific aldosterone binding to the MR, the specific activity
of 3H-aldosterone (cpm/fmol), and the number of cells applied [∆cpm (
3H-aldosterone in
presence of RU486 – aldosteronecold)/specific activity (cpm/fmol) x 6.022 x 108 = Value
X/cell number]. The specific activity (cpm/fmol) was determined by the 3H-aldosterone
(Ci/mmol) considering the counter efficiency (TopCount NXT, Perkin Elmer), scintillation
fluid and the disintegrations per minute [(dpm), a Curie (Ci) equals 2.22 x 1012 dpm].
2.2.2. Cell biology
2.2.2.1. Cell culture
HEK293 cells were maintained in DMEM high glucose supplemented with 100 U/ml
penicillin, 100 mg/ml streptomycin (PS), and 10% fetal bovine serum (FBS) (Gibco®). M1
cells were grown in Ham’s F12/DMEM supplemented with PS, 5% FBS and 1 µM
dexamethasone. MDCK cells were maintained in MEM with Earle’s Salts supplemented with
PS and 10% FBS. Cells were incubated in a humidified atmosphere at 37°C and 5% CO2. For
the maintenance of different cell clones (see section 2.2.2.5) derived from parental cell lines,
appropriate antibiotics were added to culture media to keep selective pressure.
32
Material and Methods
2.2.2.2. Charcoal treatment of serum
In order to deprive serum from hormones and growth factors, heat-inactivated FBS
(56°C for 30 min) was incubated with 10 mg/ml activated charcoal in an over-head-shaker for
4 h at room temperature. Charcoal was allowed to settle over night at 4°C. To remove residual
charcoal supernatant was centrifuged at 9,000 rpm for 1 h. Charcoal-treated FBS was sterile
filtered and stored in aliquots at -20°C.
2.2.2.3. Lentivirus production
Lentivirus production and infection of cells were carried out as described in (99). In
brief: 6 x 106 HEK 293FT cells were seeded in 75 cm2 flasks. Cells were transfected with
lentiviral vectors using Lipofectamine 2000 (Invitrogen) according to manufacturers’
recommendations. After transfection cells were incubated in 10 ml culture medium. Every
24 h medium was replaced and supernatants containing viruses were collected, centrifuged
(3,000 rpm for 5 min at 4°C), and stored at 4°C. In order to remove residual cellular debris,
viral supernatants were filtered through a low protein binding filter (Millipore, Ø 0.45 μm),
condensed by centrifugation at 18,000 rpm for 2 h at 4°C, and resuspended in 500 µl of
residual medium. Viral stocks were stored in 100 µl aliquots at -80°C. To determine viral titer
a HIV-1 P24 ELISA was performed according to manufacturers’ recommendations (Perkin
Elmer, Inc., Waltham, MA, USA). Titers ranged from 1-5 x 105 (for unconcentrated virus) up
to 2 x 107 (for concentrated virus) transducing units (TU)/ml.
2.2.2.4. Lentiviral transduction of mammalian cells
Cells were grown in 12-well plates until they reached 70% confluence. For lentiviral
transduction culture medium was replaced with medium containing supernatants from
lentivirus production (see section 2.2.2.3). The total volume of virus-containing medium was
kept as low as possible to maximize transduction efficiency. Cells were transduced with a
multiplicity of infection (MOI) of ~1. Cells were incubated at 37°C for 2 h. Then virus-
containing medium was removed and replaced by fresh antibiotic-free medium. Cell were
incubated overnight and seeded in 25 cm² cell culture flasks. After 48 h medium was replaced
with medium containing appropriate antibiotics for selection of recombinants as described in
section 2.2.2.5.
33
Material and Methods
2.2.2.5. Generation of expression cell lines
To generate different MR-expressing and appropriate control HEK293 cells, HEK293-
Flp-In cells (Invitrogen) were transfected with pcDNA5/FRT-MR, pcDNA5/FRT-myc-MR
(provided by Dr. Horst Irlbacher) or pcDNA5/FRT-empty, each together with a Flp
recombinase expression vector (pOG44). This Saccharomyces cerevisiae-derived DNA
recombination system allows the stable insertion of pcDNA5/FRT containing the gene of
interest into the genome of a host cell line carrying FRT site (100). 48 h post transfection
recombinants were selected with hygromycin (100 µg/ml) for 15 days. Cell colonies were
isolated under the microscope to obtain monoclonal cell clones and transferred to a 48-well
plate. Clones were expanded and screened for MR activity by reporter gene transactivation
assays. Clones that responded to physiological concentrations of aldosterone were further
characterized by genotyping.
Mouse cortical collecting duct cells (M1) were purchased from ECACC (Health
Protection Agency, Porton Down, UK). In order to generate MR-expressing M1 clones, cells
were transfected with pcDNA3.1-rMR. M1 cells stably expressing rMR (referred to as M1-
rMR+ cells) were selected with hygromycin (150 µg/ml) for 15 days and subjected to cloning
as described above. M1-rMR+ cells stably overexpressing or repressing CNKSR3 were
generated by infection with recombinant lentiviruses. Lentivirus production and infection of
cells were carried out as described in sections 2.2.2.3 and 2.2.2.4. M1-rMR+ cells stably
overexpressing CNKSR3 or JRed as a control were selected with blasticidin (5 µg/ml) for 14
days. To assess whether the polyclonal cells express sufficient protein level cells were
analyzed by Western blot or immunefluorescence using a fluorescence microscope (B2-
8000K, Keyence, Osaka, Japan). In order to repress the expression of endogenous CNKSR3,
M1-rMR+ cells were infected with recombinant lentiviruses coding for shRNA3 or shRNA4
specific for cnksr3 or a non-target control shRNA, respectively. Cells were selected with
puromycin (5 µg/ml) for 14 days. Individual clones were expanded and tested for relative
cnksr3 knockdown efficiency by qPCR. For the maintenance of recombinant cells appropriate
antibiotics were added to maintain selective pressure.
2.2.2.6. Luciferase reporter assays
Cells stably expressing MR were transfected with reporter plasmids containing the
reporter gene Luciferase (Luc) under the control of a steroid hormone responsive promoter
34
Material and Methods
element using Lipofectamine (Invitrogen) according to manufacturers’ instructions. 20,000-
30,000 cells per well were seeded in 96-well plates in assay medium containing 3% charcoal-
treated serum. Starving cells were cultured for 24 h before addition of hormones. To
determine the aldosterone response, cells were incubated with increasing aldosterone
concentrations in presence or absence of RU486 or RU26752 and luciferase activity was
determined after 6 h. Luciferase activity was measured with the Dual-Luciferase® reporter
assay system (Promega) according to the manufacturers’ instructions using a PHERAstar
plate reader (BMG Labtech, Offenburg, Germany).
2.2.2.7. Electrophysiological measurements (Ussing chamber)
For electrophysiological experiments M1-rMR+ cells were seeded onto Millicell-HA
filters (pore diameter 0.45 µm; Millipore, Schwalbach, Germany) and grown until they
formed polarized confluent monolayers (4-5 days post seeding). Typically, these monolayers
build up transepithelial resistances of ~300-600 Ω·cm2. To determine the effects of
aldosterone, cells were starved in assay medium with 3% charcoal-treated serum for 24 h and
then treated for 24 h with 10 nM aldosterone alone or in presence of 1 µM RU486 or
RU26752. For short-circuit current measurements, M1-rMR+ monolayers were mounted into
conventional Ussing-type chambers with an exposed area of 0.6 cm2. The bathing solution
consisted of: Na+ 140; Cl− 123.8; K+ 5.4; Ca2+ 1.2; Mg2+ 1.2; HPO42− 2.4; H2PO4− 0.6; HCO3−
21; D(+)-glucose 10 (mM). The solution was equilibrated with 95% O2 and 5% CO2 at pH
7.4. Short-circuit current (ISC, μA/cm2) and transepithelial resistance (Ω·cm2) were recorded
using a 8-channel computer-controlled voltage clamp device (CVC 8, Fiebig, Berlin,
Germany). At the end of the measurement, amiloride (10−5 M, Sigma-Aldrich) was added to
the apical site. At this concentration, amiloride blocks ENaC but not the Na+/H+ antiporter
NHE3. The drop in ISC after addition of amiloride, ΔISC (μA/cm2), was assigned to ENaC-
mediated Na+ absorption (101).
2.2.2.8. Determination of EC50 and IC50 values
The EC50 is defined as the concentration of an agonist or stimulator resulting in 50% of
a compound’s maximal effect. The antagonistic potency of a compound is described by its
IC50 value, which equals the concentration of the compound that results in 50% inhibition of
the maximal inhibitory activity. Dose response curves and the derived parameters EC50 and
IC50 were determined as follows: all replicate values measured in one experiment were
35
Material and Methods
averaged by taking the means. Mean values were transferred into the SigmaPlot software for
fitting a dose response curve using Chapman four parametric curve fit. Four parameters y0, a,
b and c are determined by that iterative approach. The Chapman equation is: y = y0 + a (1-e-
bx)c. The maximum value of the sigmoidal curve is ResponseMax and the minimum value is
ResponseMin. EC50/IC50 values were calculated as follows: y1/2 = ResponseMax-[(ResponseMax-
ResponseMin)/2]. The corresponding concentration (x1/2 = EC50/IC50) was calculated by
converting the Chapman equation with respect to x.
The relative efficacy is the maximal activation by a given compound (cpd) (Rmaxcpd)
divided by the maximal activity of the reference (ref) compound (Rmaxref) multiplied by 100
and expressed in percent (%).
2.2.3. Microdissection of renal tubules
Microdissection experiments were done in cooperation with Drs. Frederic Jassier and
Nicolette Farmann, ISERM Paris, France. Mice were sacrificed by cervical dislocation and
the left kidney was injected, using a fine needle, with 1-2 ml filtered (pore diameter 0.2 µm)
collagenase solution: DMEM/HamF12 culture medium, collagenase A (1 mg/ml, Roche
Diagnostics, Mannheim, Germany) and fetal bovine serum (2%). The kidney was excised, cut
into small slices that were incubated at 37°C for 45 min in the collagenase solution.
Microdissection was performed under sterile conditions under a binocular microscope as
described (102), allowing collection of the proximal tubule (convoluted portion, PCT, and
straight portion, PR), the distal convoluted tubule (DCT), the connecting tubule (CNT), and
the cortical collecting duct (CCD). Pools of tubules of each category (about 10 mm in length)
were transferred to 100 µl lysis buffer mix (RA1 Buffer, Macherey-Nagel) with 1% β-
mercaptoethanol, and stored at -80°C. One, two or three pools of tubules of each category
were collected from the same mouse kidney.
2.2.4. Statistical analysis
If not stated otherwise data are expressed as means ± standard error of the mean (SEM).
Statistical analysis was performed using Student’s two-tailed t-test and, if appropriate,
Bonferroni–Holm correction for multiple testing. Significance was assumed at p < 0.05.
36
Results
3. Results
3.1. Identification of early aldosterone-regulated genes
3.1.1. Generation of HEK293 cells stably expressing the human MR
Human embryonic kidney cells (HEK293) are devoid of functional MR while
maintaining the expression of functional endogenous GR (103, 104). To determine MR
specific gene regulation, HEK293-Flp-In cells were stably transfected with the
pcDNA5/FRT/hMR expression plasmid as described in section 2.2.2.5. Several cell clones
were screened for MR activity by reporter gene transactivation assays. To this end, cells were
transiently transfected with a luciferase expression construct driven by a mouse mammary
tumor virus (MMTV)-promoter (referred to as pMMTV-Luc reporter) and analyzed for
aldosterone-mediated luciferase response. The measured luciferase activity was normalized to
the respective vehicle control. Figure 3.1A shows the transactivation response to 10 nM
aldosterone of various clones. Four HEK293-hMR expressing clones, #2, #3, #7 and #10,
were further characterized by aldosterone dose-response transactivation assays (Fig. 3.1B).
All clones responded to physiological concentrations of aldosterone in a dose-dependent
manner with an EC50 of ~0.1 nM.
Fig. 3.1: Selection of HEK293 clones stably expressing the mineralocorticoid receptor
A: Aldosterone-mediated reporter gene activation of selected HEK293 hMR clones transiently
transfected with pMMTV-Luc. Response is expressed as fold induction (vehicle control = 1). B: Dose-
response curves of aldosterone-dependent reporter gene activation of 4 selected clones from A. All
clones show a comparable EC50 of ~0.1 nM. Reponse is expressed as relative luciferase units (RLU).
37
Results
The MR expression plasmid was integrated into the genome via Flp recombinase-
mediated DNA recombination at the flp recombination target (FRT) site in the genome of the
engineered HEK293-Flp-In cells (100). Every integration event of a pcDNA5/FRT expression
plasmid into a FRT site brings an additional FRT site that is contained in the integration
plasmid. Hence, this method does not exclude multiple integration events. The selected clones
were further characterized by genotyping to identify potential multiple integration events. The
integration of several MR open reading frames, each driven by a cytomegalovirus (CMV)
promoter, would probably cause unphysiological high MR expression level. A PCR strategy
was chosen for the genotyping. Figure 3.2A shows a schematic depiction of possible
integration events via FRT sites. Specific PCR primers were designed that allowed a
characterization of the Flp-In locus in the genome of the four selected clones (see Fig. 3.1)
using genomic DNA as PCR template. Figure 3.2B shows exemplarily the genotyping results
for the HEK293 hMR expression clones #3 and #10. As controls a HEK293 clone stably
transfected with the empty pcDNA5/FRT vector alone and polyclonal HEK293-hMR+ cells
were analyzed. Parent HEK293-Flp-In cells and the pcDNA5/FRT/hMR expression plasmid
were used as negative and/ or positive controls, respectively.
Fig. 3.2: Genotyping analysis of HEK293-
hMR+ cells
A: Schematic overview of possible
integration events via FRT sites. For details
see text. B: PCR based genotyping analysis
with primer-sets depicted in A is exemplarily
shown for HEK293-hMR+ clones #3 and #10.
As controls, a HEK293 clone stably
transfected with the empty pcDNA5/FRT
vector (referred to as HEK293-control) and
polyclonal HEK293-hMR+ cells were
analyzed. Parent HEK293-Flp-In cells and
the pcDNA5/FRT/hMR expression plasmid
were used as negative and/ or positive
controls, respectively.
38
Results
Primer-set 1 detects the initial genomic situation found in parent HEK293-Flp-In cells
with no integration at the FRT-site. By using primer-sets 2 and 4 it was possible to
differentiate between single and multiple integrations events. Primer-set 3 detects the
presence of the hMR CDS driven by a CMV promoter and was used to distinguish hMR
expressing cells from parent and control cells. PCR analysis for the cells referred to as
HEK293-hMR+ clone #3 revealed that some cells failed the integration of the hMR expression
plasmid. This indicates that these cells are not derived from a single clone. A heterogeneous
cell population would probably drift in its composition and thus change its characteristics
during maintenance. In contrast, for the HEK293-hMR+ clone #10 cells no PCR products
were obtained with primer-sets detecting a failed integration or multiple integration events,
indicating monoclonality. Thus HEK293-hMR+ clone #10 fulfilled all required quality criteria
and was chosen for further experiments. The clone is further referred to as HEK293-hMR+
cells. HEK293–control cells stably transfected with the empty pcDNA5/FRT vector exhibited
the same integration pattern as described for the HEK293-hMR+ cells and were used in
further experiments as control cells.
3.1.2. Characterization of HEK293-hMR+ cells
The expression of MR protein was determined by Western blot analysis in HEK293-
hMR+ and HEK293-control cells. As expected MR was only detected in HEK293-hMR+ cells
(Fig. 3.3A). Since supraphysiological concentrations of aldosterone can also activate the GR
(28, 29), GR protein expression analysis was included. HEK293-hMR+ and HEK293-control
cells exhibited a profound expression of endogenous GR (Fig. 3.3A).
To determine the number of MR molecules expressed per cell, binding assays with
tritium labeled aldosterone (3H-aldosterone) were performed. HEK293-hMR+ cells showed
specific aldosterone binding which was not blockable by the GR antagonist RU486
(Fig. 3.3B). A small fraction of aldosterone binding was blockable by RU486, indicating
binding of aldosterone to GR (Fig. 3.3B). In contrast, HEK293-control cells exclusively
showed RU486-blockable aldosterone binding (Fig. 3.3B). Specific binding of aldosterone to
MR was defined as the difference between the radioactivities measured for 3H-aldosterone
binding in presence of unlabeled RU486 and displaceable binding by unlabeled aldosterone.
By applying the equation described in section 2.2.1.16, the number of MR molecules
expressed per cell was calculated to 11,000. This was in good accordance with the
physiological MR expression range in principal cells of the cortical collecting duct (CCD)
39
Results
(102, 105). In contrast, for the HEK293-control cells no MR binding was determined, which
supported the results obtained by Western blot analysis.
Fig. 3.3: Characterization of HEK293-hMR+ and HEK293-control cells
A: Western blot analysis of MR (107 kDa) and GR (90 kDa) expression. Beta-Actin (42 kDa) was used
as a loading control. B: Determination of aldosterone binding sites. Cells were incubated with 5 nM
3H-aldosterone in the absence (black bars) or presence of unlabeled aldosterone (hatched bars) or
the GR antagonist RU486 (white bars). Only HEK293-MR+ cells show specific binding of aldosterone
to MR in presence of RU486 (white bars). The difference between total aldosterone binding (black
bars) and binding to MR (white bars) is indicative of binding to GR, which is comparable in both cell
clones. C: Aldosterone-mediated transactivation response in presence or absence of RU486.
Aldosterone concentrations above 10 nM activated endogenous GR, which was selectively blocked by
the GR antagonist RU486. Transactivation response is given in % relative to the maximal response at
1 nM aldosterone. D: Aldosterone-induced transactivation signals were completely blocked by the MR
antagonist RU26752 (grey curve) in dose-dependent manner. Transactivation response is given in
relative luciferase units (RLU).
HEK293-hMR+ and HEK293-control cells were further characterized by extended
reporter gene transactivation assays. Cells were transiently transfected with a pMMTV-Luc
reporter and analyzed for aldosterone-mediated luciferase response. HEK293-hMR+ cells
responded to physiological concentrations of aldosterone, whereas HEK293-control cells only
responded to supraphysiological aldosterone doses (> 0.1 µM). A second increase in
transactivation signal on top of the MR-mediated response at high aldosterone doses was
observed for the HEK293-hMR+ cells (Fig. 3.3C). High dose aldosterone responses were
selectively blocked with 1 µM RU486 in HEK293-hMR+ and HEK293-control cells
40
Results
(Fig. 3.3C), suggesting that this response was mediated through the endogenous GR and not
MR. In contrast, aldosterone at low concentrations (0.01-10 nM) induced transactivation
signals that were completely blocked by the MR antagonist RU26752. Figure 3.3D shows
exemplarily the dose-dependent transactivation blockade by RU26752 for HEK293-hMR+
cells simulated with 1 nM aldosterone. These data indicate that concentrations of 0.1-10 nM
aldosterone primarily activate MR.
In summary, HEK293 cells are devoid of MR but maintain expression of functional
endogenous GR as assessed by Western blot analysis, binding studies and reporter gene
assays. Importantly, the HEK293-hMR+ cells express functional MR in a physiological range
and allow the clear separation of MR- vs. GR-mediated effects.
3.1.3. The genome-wide aldosterone gene regulation pattern
To test whether overexpressed MR in HEK293-hMR+ cells was able to regulate
endogenous target genes (e.g. sgk1 and gilz) quantitative real time polymerase chain reaction
(qPCR) experiments were carried out. To minimize activation of co-present GR (see
Fig. 3.3A), HEK293-hMR+ cells were stimulated with 10 nM aldosterone. At this
concentration HEK293-MR+ cells showed full transactivation activity, while the HEK293-
control cells, devoid of MR, did not respond (see Fig. 3.3C). As expected mRNA levels of
sgk1 and gilz, two well known MR target genes (68, 80, 106), were markedly increased in
HEK293-hMR+ cells but not in HEK293-control cells (data not shown). Thus HEK293-hMR+
cells were considered as an appropriate cell system for the determination of MR responsive
genes. To explore the aldosterone-activated MR regulation pattern on a genome-wide level an
Affymetrix microarray gene expression study was carried out.
In order to identify early MR-regulated genes, a time course experiment was performed.
Therefore HEK293-MR+ cells were incubated with 10 nM aldosterone for 0, 1, 2, 4 and 8 h.
As a vehicle control HEK293-hMR+ cells were treated with appropriate amounts of DMSO
[0.01% (v/v)] for all indicated time points. For every time point three parallel experiments
were carried out. This experimental set-up required a total of 30 microarrays.
In order to identify aldosterone-regulated genes the two parameters, fold change and
level of statistical significance were arranged in a volcano plot (Fig. 3.4). Genes with a fold
change of 1.5-fold or higher at any time point and a p-value > 10-5 were considered as
aldosterone-regulated as described in section 2.2.1.15.
41
Results
Fig. 3.4: Volcano plot of
identified genes.
Genes with a fold change of
1.5 or higher at any time
point and a significance level
> 10-5 (corresponding to a
false discovery rate of 0.018)
were considered as
aldosterone-regulated.
Previously described MR-regulated genes such as per1, plzf (also known as zbtb16), gilz
or sgk1 (68, 80, 82, 107, 108) were among the most up-regulated genes (see Fig. 3.4),
supporting the validity of the study. In addition, a number of genes not previously described
as mineralocorticoid-regulated were identified, among them e.g. cnksr3, pdk4, or calm1
(Fig. 3.4 and Fig. 3.5).
Overall 36 transcripts were identified to be regulated by aldosterone, of which 31
transcripts were up-regulated and 5 were down-regulated (Fig. 3.5). Out of the 36
aldosterone-regulated genes 26 were verified by individual qPCR analysis with mRNAs
derived from separate experiments. Gene symbols of qPCR verified transcripts are depicted in
bold letters (Fig. 3.5). Interestingly, the majority of identified genes showed its maximum fold
change in regulation after 4 h of aldosterone stimulation (Fig. 3.5).
42
Results
Fig 3.5: Identification of aldosterone-
responsive genes
Colorimetric representation of aldosterone-
regulated genes in HEK293-MR+ cells; the
color intensity reflects the relative fold change
in gene expression in response to 10 nM
aldosterone vs. the vehicle control; the time
course spans 1, 2, 4, and 8 h; only genes
were considered that showed a higher than
1.5-fold change in regulation; gene symbols
depicted in bold were retested and confirmed
by qPCR analysis using mRNA of
independent experiments. Induced transcripts
(red) or repressed transcripts (green). The left
row represents p-values of an N-Way ANOVA
analysis across all different time points.
Aldosterone-regulated genes were classified by their biological functions according to data
obtained from the gene ontology (GO) platform and the human protein reference database
(HPRD) (Table 3.1). Consistent with the physiological role of aldosterone as a modulator of
cell communication and signal transduction the broad range of genes identified were
associated with these processes.
12 aldosterone-responsive genes code for transcription factors, among them per1, plzf,
and klf9 which have previously been shown as aldosterone-responsive (108-111). These
genes are considered to be involved in the late phase of aldosterone response (12).
43
Results
Furthermore, 15 genes responded to aldosterone stimulation that code for proteins that are
presumably involved in signal transduction. Among them sgk1 and gilz, which have been
demonstrated to mediate the early phase of the aldosterone response in renal transepithelial
Na+ transport by modulating the trafficking of the epithelial sodium channel (ENaC) (54).
Table 3.1: Summary of gene ontology categories
Gene Biological Process Molecular Function
pkp2 cell adhesion unknown
calm1* cell comunication, signal transduction calcium ion binding
cdc42ep3 GTPase activity
cnksr3 predicted scaffold function
cxcr4 g-protein coupled receptor activity
efnb2 receptor binding
fgf9 growth factor activity
pik3r1 receptor signaling compex scaffold activity
rasgef1b guanyl-nucleotide exchange factor
rhou GTPase activity
trib1 protein serin/threonine kinase activity
nrp1 Immune response receptor activity
fkbp5 protein folding and trafficking activity
gilz sodium ion transport, immunoregulation
sgk1 sodium ion transport, response to stress protein serin/threonine kinase activity
scnn1a* sodium and potassium ion transport ion channel activity
hist1h2bd chromosomal organisation DNA binding
pdk4 glucose metabolism catalytic activity
mica, micb immune response MHC class I receptor activity
arl7 not determined unknown
flj10970
flj11127
f3 protein metabolism co-factor binding
rbbp6 ubiquitin-specific protease activity
rpl13 RNA binding
phlda1 transcription factor activity, apoptosis
bcl6 regulation of nucleobase, nucleoside, transcription factor activity
emx2 nucleotide and nucleic acid metabolism
etv1
fosl2
foxg1b
klf9
mafb
nfkbia
pag1
per1
plzf
tbx3
*Not detected by microarray experiments; Gene symbols depicted in bold were validated by
qPCR experiments
44
Results
3.2. Identification of primary mineralocorticoid receptor target genes
The early phase of aldosterone action is traditionally considered to be exclusively mediated
through primary effects on gene expression (12). These mechanisms classically include direct
binding of activated MR to HREs in the promoter of target genes (5, 12, 112).
3.2.1. Generation of HEK293 cells stably expressing a myc-tagged hMR for ChIP analysis
Chromatin-immunoprecipitation (ChIP) followed by DNA microarray experiments
(chip), known as (ChIP-chip) is an efficient technique for the identification of DNA
transcription factor binding sites on a genome-wide level in cells (113). This approach
requires antibodies that are suitable for ChIP. To date there is no ChIP-grade MR antibody
available. For this reason the CDS encoding MR was fused to an N-terminal 9-fold myc-tag in
order to make the MR immunoreactive to a ChIP-grade anti-myc antibody. The pcDNA5/FRT
N-terminal 9-fold myc-tagged human MR expression plasmid was stably transfected to
HEK293-Flp-In cells. The selection of an appropriate clone was carried out according to the
procedure described for HEK293-hMR+ cells (see section 3.1.1). HEK293 cells stably
expressing the myc-MR are referred to as HEK293-myc-MR. By this approach it was possible
to integrate both MR versions into the same genomic context minimizing clonal differences.
HEK293-hMR+ and HEK293-myc-MR+ cells exhibited comparable expression level of
the MR protein while the parental cell line was devoid of functional MR as assessed by
Western blot analysis (Fig. 3.6A). The myc-tagged MR was detectable with a MR-specific
antibody as well as with an anti-myc antibody at 120 kDa, which corresponds to the predicted
107 kDa of the MR plus 13 kDa of the 9-fold myc-tag. As expected the untagged MR was
only detected with the MR-specific antibody at 107 kDa (Fig 3.6A).
The myc-MR copy number was assessed by binding assays as described in section 3.1.2
and calculated to ~13000 molecules per cell for the HEK293-myc-MR+ cells (data not
shown), which is slightly above the level in HEK293-MR+ cells (see section 3.1.2). To assure
the functionality of myc-MR reporter gene transactivation experiments were carried out. To
this end, HEK293-myc-MR+ and HEK293-hMR+ cells were transiently transfected with
pMMTV-Luc. Transactivation signals were near maximal at 1 nM aldosterone and both cell
clones exhibited comparable EC50 values of ~0.1 nM (Fig. 3.6B). This indicates that the 9-
fold myc tag does not compromise the function of the MR.
To further elaborate on the uncompromised function, it was analyzed whether myc-MR
was able to regulate MR target genes, e.g. sgk1 and gilz. To this end, HEK293-myc-MR+ and
45
Results
HEK293-hMR+ cells as a control were stimulated with 10 nM aldosterone or 0.001% (v/v)
DMSO as a vehicle control for 4 h. The aldosterone-induced alteration of target gene
expression was determined by qPCR and normalized to the expression level in the vehicle
group. Both cell clones showed comparable aldosterone-induced up-regulation of sgk1 and
gilz mRNA level (Fig 3.6C). These data indicate that the N-terminal MR myc-tag did not
constrain MR activity.
Fig. 3.6: Characterization of HEK293-myc-MR+ cells
A: Expression levels of MR and myc-MR compared to the parental HEK293 cell line by Western blot.
Molecular weight of MR: 107 kDa. Calculated molecular weight of myc-tagged MR: 120 kDa. B:
HEK293-MR+ and HEK293-myc-MR+ cells show comparable affinity for aldosterone. EC50 values were
~0.1 nM for both cell clones in a transactivation assay using the pMMTV-Luc reporter plasmid. Full
transactivation activity was observed at 1 nM. C: Expression of aldosterone target genes. HEK293-
myc-MR+ (black bars) and HEK293-hMR+ cells (white bars) exhibited comparable aldosterone-
mediated up-regulation of sgk1 and gilz. mRNA levels were determined after 4 h of incubation with 10
nM aldosterone and normalized to a time-matched vehicle control.
Taken together, it was shown that the HEK293-myc-MR+ cells do not significantly
differ from HEK293-hMR+ cells in respect to MR copy number, affinity for aldosterone, and
the ability to induce target gene expression. Therefore the HEK293-myc-MR+ cells were
considered to be suitable to perform ChIP-experiments.
3.2.2. Identification of functional MR binding sites
In order to identify novel MR binding regions (MBRs) on a genome-wide level,
chromatin immunoprecipitation of myc-MR followed by microarray hybridization (ChIP-
chip) experiments were performed (114). These experiments were carried out by Dr. Horst
Irlbacher. The results from the ChIP-chip study and from the above described Affymetrix
microarray gene expression study (see section 3.1.3) were compared, in order to identify
aldosterone-regulated genes in which the MR is part of the transcriptional regulatory complex.
46
Results
14 of 36 aldosterone-regulated genes had at least 1 MBR at a distance of less than 10 kb
of the transcription start site (TSS). Already known binding sites for MR and/or GR in the
promoter of e.g. sgk1, gilz, or scnn1a (39, 115, 116) were confirmed and thus supporting the
validity of the ChIP-chip data. Importantly, novel MBRs were identified for e.g. cnksr3, klf9
or pik3r1. Surprisingly, other genes e.g. rhob, mgc21644, and mbln1 exhibited strong MR
binding to regions upstream of their respective TSS even though these genes were less than
1.5-fold regulated by aldosterone in HEK293-hMR+ cells (data not shown).
11 of 14 identified MBRs were verified by manual ChIP-qPCR experiments (Fig. 3.7)
using the established HEK293-myc-MR+ cell clone (see section 3.2.1). Fold enrichment of
myc-MR was calculated as the ratio of PCR product in the aldosterone vs. vehicle group
normalized for input DNA (see section 2.2.1.14). Most notably, the region 4 kb upstream of
the TSS of cnksr3 exhibited a more than 40-fold MR enrichment. For this gene a second locus
-500 bp relative to the TSS was also found to be highly occupied by aldosterone-activated MR
(Fig. 3.7). For other genes e.g. pik3r1 or klf9 MR was also enriched higher than 15-fold at the
indicated loci close to their respective TSS.
Fig. 3.7: Aldosterone-induced MR occupancy in the promoter of aldosterone-responsive genes
ChIP-qPCR experiments performed in HEK293-myc-MR+ cells at indicated promoter loci of
aldosterone-regulated genes. Fold enrichment was calculated as the ratio of PCR product in the
aldosterone vs. vehicle group normalized for input DNA. Data are representative for at least three
independent experiments.
47
Results
A weaker, less than 10-fold MR enrichment was detected at previously described GR binding
sites for sgk1,gilz and scnn1a (39, 116) (Fig 3.7). Interestingly, several MBRs were found in
unexpected regions the latter genes such as in intronic region of e.g. scnn1a. This region had
also been discovered recently in a ChIP-chip study for genomic binding sites of
glucocorticoid-activated GR.
To examine whether the identified MBRs are active sites in terms of MR-mediated
transcriptional activity reporter gene assays were performed. As a proof of concept the MBR
of the gilz promoter was analyzed for MR responsiveness. This promoter region has been
shown to contain at least two functional GR responsive elements (GREs) (116). A 500 bp
promoter fragment of the gilz promoter, containing the ChIP-confirmed MBR was amplified
by PCR from human genomic DNA and inserted into a pGL4.23-Luc reporter plasmid,
referred to as pGL4.23-GILZ-Luc (Fig. 3.8).
HEK293-hMR+ cells were transiently transfected with pGL4.23-GILZ-Luc and treated
with aldosterone alone or in presence of the GR antagonist RU486 or the MR antagonist
RU26752. Treatment with aldosterone alone or in presence of RU486 did not abrogate
transactivation, whereas RU26752 completely blocked the luciferase response (Fig. 3.8). This
indicates that the observed effects at 10 nM aldosterone were specifically mediated through
MR and not by co-present GR. These results further suggest that the identified GREs within
the gilz promoter (116) are accessible for MR and confer to MR-mediated aldosterone
responsiveness.
Fig. 3.8: MR-specific transactivation
response
HEK293-hMR+ cells were transiently
transfected with pGL4.23-GILZ-Luc
containing MR binding regions;
transactivation response was specifically
blocked by the MR antagonist RU26752
but not by the GR antagonist RU486; the
response is given in relative luciferase
units (RLU).
According to the procedure described above, 15 promoter fragments found to be
occupied by MR close to aldosterone-responsive genes were cloned into pGL4 reporter
plasmids (Fig. 3.9). The pGL4.10 vector was used for promoter fragments close to the TSS of
a gene containing a TATA-box. The pGL4.23 vector contains a TATA-box promoter element.
48
Results
This vector was used for fragments more than 600 bp from the TSS of a gene lacking a
TATA-Box.
Fig. 3.9: Analysis of MR binding regions in the promoters of aldosterone-regulated genes
MBRs of aldosterone-regulated genes confer to MR responsiveness. HEK293-hMR+ cells were
transiently transfected with pGL4 reporter plasmids containing promoter fragments of ~500 bp length
from indicated genes. Fold aldosterone-mediated induction (black bars) in presence of the MR
antagonist RU26752 (hatched bars) and the GR antagonist RU486 (white bars) was normalized to the
respective vehicle control (grey bars). Empty pGL4 reporter plasmids were used as control constructs.
All MBRs of aldosterone-responsive genes mediated transactivation between 1.5 and 8-
fold compared to corresponding vehicle control (Fig. 3.9). Again, transactivation activities
were MR- and not GR-mediated since the activity was blocked in presence of the MR-specific
antagonist RU26752 but not with the GR antagonist RU486 (Fig. 3.8).
The previously described MR binding region of the sgk1 promoter was analyzed as a
second control. As expected, this promoter fragment was confirmed as an active MR binding
region. Importantly, by this approach it was possible to identify functional MBRs in the
promoter of aldosterone-regulated genes e.g. pik3r1, pdk4, or cnksr3. Most notably ChIP
49
Results
experiments revealed that the cnksr3 promoter exhibited strong MR occupancy 4 kb upstream
of the TSS and another weaker MR binding region close to the TSS (see Fig. 3.7). Both
MBRs did confer transactivation. Consistent with ChIP results, the distal cnksr3 promoter
region showed stronger transactivation capabilities in comparison to the weaker proximal
MBR.
Functional MBRs close to respective TSS of nfkb1a, fkbp5, per1, and calm1 were
identified by direct evaluation of the ChIP-chip data and were not additionally verified by
ChIP-qPCR experiments. Interestingly, two regions strongly bound by the MR, close to the
genes mbln1 and mgc21644, were not active in the transactivation assays (Fig. 3.9).
Congruent with this both genes did not alter mRNA expression level in response to
aldosterone stimulation (data not shown). These results suggest that the identified MBRs
within the promoter of aldosterone-regulated genes confer to their aldosterone responsiveness.
Surprisingly, functional MBRs were identified in intronic regions of scnn1a, nfkia, and fkbp5.
In summary, ChIP experiments confirmed MR binding to different promoter segments
of novel identified aldosterone-responsive genes, indicating that these are direct MR-regulated
genes. The functionality of these binding sites was confirmed by reporter gene assays and thus
reinforces mRNA expression data.
3.3. Cnksr3 is a direct MR target gene
Evidence that cnksr3 is an aldosterone target gene came from Affymetrix gene
expression profiling experiments. ChIP experiments revealed that cnksr3 exhibited two loci of
strong MR occupancy upstream of its TSS. Moreover, both identified MR binding regions
responded to aldosterone-activated MR as demonstrated by reporter gene assays. These data
strongly suggested that cnksr3 is a direct MR target gene. Hence, the mechanisms by which
MR regulates cnksr3 expression were studied in extended detail.
3.3.1. Characterization of MR binding sites within the cnksr3 -4 kb promoter fragment
Since the cnksr3 -4 kb promoter fragment showed the strongest MR responsiveness,
both in terms of MR binding and MR-mediated transcriptional activity, it was further
characterized. To determine whether this promoter fragment is also responsive for GR
transactivation assays were performed. To this end, Madin-Darby canine kidney (MDCK)
cells, devoid of functional endogenous GR and MR, were transiently co-transfected either
with pcDNA3.1-hMR or pcDNA3.1-hGR and the cnksr3 -4 kb reporter plasmid. 24 h post
50
Results
transfection cells were treated with increasing concentrations of aldosterone, cortisol, or the
GR-selective agonist RU28362 for 6 h. Figure 3.10A illustrates that the cnksr3 -4 kb promoter
fragment is responsive to ligand-activated MR or GR in a dose-dependent manner. The cnksr3
-4 kb reporter construct was also dose-dependently activated by aldosterone and cortisol in
HEK293-hMR+ cells with comparable EC50 values (data not shown).
Fig. 3.10: Characterization of MR binding sites within the cnksr3 -4 kb promoter region
A: MDCK cells, devoid of functional MR or GR were transiently co-transfected with an MR or GR
expression plasmid, respectively, and the cnksr3 -4 kb reporter plasmid. Cells were stimulated with
increasing doses of aldosterone, cortisol, or the GR-selective agonist RU28362. The luciferase
response of the cnksr3 -4 kb reporter construct was dose and ligand-dependet on MR and GR.
B: Putative GREs (depicted in capitol letters) in the cnksr3 -4 kb promoter fragment were mutated by
site-directed mutagenesis. C: GREs confer aldosterone responsiveness. Wild type (wt) and mutant
reporters were transfected in HEK293-hMR+ cells and luciferase activity was determined as described
previously.
Putative MR binding sites were computationally predicted by using a core consensus
sequence for glucocorticoid responsive element (GRE) family elements using experimentally
verified data of AR, PR and GR response elements (117). The bioinformatically identified
cluster of four putative GREs was further analyzed by site-directed mutagenesis. All predicted
GREs contain at least six of eight conserved nucleotides of the consensus sequence
(AGAACAnnnTGTTCT). A minimum of three conserved nucleotides of the more conserved
half-site of each GRE were mutated. GREs were replaced by endonuclease restriction sites as
51
Results
schematically depicted in figure 3.10B. Single and combinatorial mutations of GRE4 and
GRE3 resulted in a decreased aldosterone response (Fig. 3.10C). The mutation of GRE2 had
no effect on the aldosterone responsiveness. The mutation of GRE1, exhibiting the highest
homology to the consensus sequence, caused a complete loss of reporter gene activation,
indicating that this GRE is essential for the MR-mediated transcription initiation.
3.3.2. The aldosterone-induced cnksr3 expression pattern
Microarray expression analysis indicated that the aldosterone-induced cnksr3 mRNA
expression followed a time course. To study the cnksr3 mRNA expression profile in further
detail, aldosterone dose-response and time-course experiments in HEK293-hMR+ cells were
performed. Cnksr3 mRNA expression was induced by aldosterone in a dose-dependent
manner and peaked after 4 h (Fig. 3.11A). Importantly, the effects were near maximal at 1 nM
of aldosterone. This was in accordance with the results obtained in transactivation assays for
the cnksr3 -4 kb promoter reporter construct (see Fig. 3.10A left panel). To further assess the
role of aldosterone-activated MR in the regulation of cnksr3 expression, HEK293-hMR+ in
comparison to HEK293-control cells, devoid of functional MR (see Fig. 3.3A), were analyzed
by qPCR experiments. MR expressing cells showed a marked up-regulation of cnksr3 and
sgk1 mRNA when treated with 10 nM aldosterone, whereas parent cell lines showed no
regulation (Fig. 3.11B). These data further confirmed that the up-regulation is indeed
mediated by MR and not GR.
Western blot experiments were carried out in order to verify expression data on protein
level. Due to the fact that there was only one CNKSR3 specific antibody available by the time
of the study, this antibody was characterized for epitope specificity. To this end, two
CNKSR3 expression plasmids were cloned. To make CNKSR3 immunoreactive to an anti-V5
antibody one CDS coding for CNKSR3 was fused to a C-terminal V5 tag. A second coding
for wt CNKSR3 was generated as a control (see section 2.2.1.11). Both expression plasmids
were transiently transfected in HEK293 cells. 24 h post transfection cells were lysed and
probed with a CNKSR3 specific and a V5 specific antibody. As expected, the V5-tagged
CNKSR3 protein could only detected by the anti-V5 antibody at about 66 kDa, which
corresponds to the predicted 62 kDa of the CNKSR3 protein plus the 3.9 kDa of the V5-tag
(Fig. 3.11C). In both experiments the CNKSR3 specific antibody showed only a single band
corresponding to the predicted protein sizes (Fig 3.11C). Thus, the CNKSR3 antibody was
considered as suitable to study endogenous CNKSR3 protein expression.
52
Results
Fig. 3.11: Aldosterone-induced expression of CNKSR3
A: Cnksr3 mRNA transcription in response to increasing concentrations of aldosterone (left panel) and
during a time course after 10 nM aldosterone treatment (right panel). Aldosterone regulation of cnksr3
mRNA expression in HEK293-hMR+ cells was dose and time-dependent. B: mRNA up-regulation
(10 nM, 4 h) of sgk1 and cnksr3 is dependent on MR expression. qPCR values measured for
aldosterone-treated cells are time-matched to values obtained in vehicle-treated cells. (** p < 0.01)
C: CNKSR3-antibody specificity: HEK293 cells were transiently transfected with expression plasmids
coding for wt CNKSR3 or c-terminal V5-tagged CNKSR3, respectively. Cell lysates were probed with
an anti-CNKSR3 and an anti-V5 antibody. Molecular weight of wt CNKSR3: 62 kDa. Calculated
molecular weight of V5-tagged CNKSR3: 65.9 kDa. The CNKSR3 antibody recognizes specifically
human CNKSR3 protein. D: CNKSR3 Western blot of different subcellular protein fractions derived
from HEK293-hMR+ cells treated with 10 nM aldosterone or vehicle for 8 h. Endogenous CNKSR3
protein was induced after aldosterone treatment and was detected predominantly in the cytosolic
compartment. As expected, aldosterone treatment led to nuclear translocation of MR protein
(107 kDa). Beta-Actin (42 kDa), pan-cadherin (135 kDa) and RNA polymerase II (217 kDa) were
analyzed as compartment markers for the fractionation.
Cell fractionation experiments were performed followed by Western blot analysis
(Fig. 3.11D) to examine whether endogenous CNKSR3 protein expression is induced by
aldosterone and to further investigate where CNKSR3 protein is located in the cell. Increased
expression of endogenous CNKSR3 protein was detected predominantly in the cytosolic
compartment after 8 h of 10 nM aldosterone treatment. As expected, aldosterone treatment led
53
Results
to nuclear translocation of MR protein. Beta-actin (42 kDa), pan-cadherin (135 kDa) and
RNA polymerase II (217 kDa) were analyzed as compartment markers for the fractionation.
This experimental set-up revealed that cnksr3 mRNA expression was time and dose-
dependent to aldosterone stimulation and required expression of MR. CNKSR3 protein
expression was also strongly induced by aldosterone and was predominantly detected in the
cytosol of the cell.
3.4. Functional characterization of CNKSR3
The results from the above experiments suggested that cnksr3 as an early and directly
aldosterone-regulated gene might be an important mediator of aldosterone action.
3.4.1. Cnksr3 is expressed in the mouse aldosterone-sensitive distal nephron
In order to assess where cnksr3 is expressed in vivo, total RNA isolated from 10
different mouse tissues (purchased from Ambion) was analyzed by qPCR. Figure 3.12A
shows the cnksr3 expression level in tissues examined relative to expression level obtained in
mouse embryo. Highest cnksr3 expression was found in kidney, liver, heart and testicle.
Interestingly, the highest cnksr3 expression level was found in the heart, which may be in part
due to the fact that the cellular composition of the heart is rather uniform. In contrast the
kidney is composed of different tissues and the epithelia involved in aldosterone-controlled
Na+ retention are restricted to a small part of the distal nephron called aldosterone-sensitive
distal nephron (ASDN). Considering this and the fact that cnksr3 was identified as an
aldosterone-induced gene in human embryonic kidney cells, the expression pattern of cnksr3
in the kidney was studied in further detail. To this end the cnksr3 mRNA expression pattern
along different nephron segments microdissected from mice kidneys was analyzed by qPCR.
These experiments were carried out in co-orporation with Dr. Frederic Jaisser, INSERM,
Paris, France. QPCR analysis was performed in segments derived from the proximal tubule
(PCT), the distal convoluted tubule (DCT), the connecting tubule (CNT), and in the cortical
collecting duct (CCD). The cnksr3 expression level was low in the PCT and gradually
increased along the ASDN, reaching a 7-fold difference between CCD and the PCT
(Fig. 3.12B). This indicates that cnksr3, an aldosterone-modulated gene, is expressed in vivo
in the renal aldosterone target tissues.
54
Results
These results supported the view that CNKSR3 contributes to aldosterone-mediated
transepithelial Na+ transport in the kidney.
Fig. 3.12: In vivo expression
pattern of cnksr3
A: cnksr3 expression in various
mouse tissues was determined by
qPCR. Expression levels in different
organs were normalized to the
expression level obtained in mouse
embryo. Beta-Actin was used as a
reference gene for normalization.
B: qPCR analysis of cnksr3
expression in microdissected
nephrons segments from wt mice
kidneys. Cnksr3 expression
gradually increased along the
ASDN.
proximal tubule (PCT), distal
convoluted tubule (DCT), connecting
tubule (CNT), and cortical collecting
duct (CCD). Values are means
± SEM, n = 5-11 mice per group. (* p
< 0.05, ** p < 0.01 versus PCT,
Mann-Whitney test)
3.4.2. Generation and electrophysiological characterization of the MR stable M1 cell line
HEK293 cells do not develop a polarized electrically tight cell monolayer. Hence, to
explore the functional role of CNKSR3 in the mechanism of transepithelial Na+ transport , the
mouse cortical collecting duct (CCD) cell line M1 was chosen as an in vitro model (118).
However, M1 cells lack the expression of functional MR (119). To investigate the MR-
regulated Na+ transport, M1 cells were stably transfected with the rat MR. The cloning of the
rat MR expression plasmid pcDNA3.1/rMR is described in section 2.2.1.11.
Over 50 clones were isolated and screened for aldosterone-induced MR activity in
transactivation assays, as described in section 3.1.1. As a reference positive control for MR-
mediated transactivation response the previous characterized HEK293-hMR+ cells were used
(see section 3.1.2). M1 rMR expression clone #35 was selected and is further referred to as
M1-rMR+. M1-rMR+ cells exhibited an aldosterone-induced transactivation response at an
EC50 of ~0.5 nM (Fig. 3.13A). Expression level of rMR protein level was verified by Western
blot analysis (Fig. 3.13B). Additionally, the rMR expression number was determined in M1-
55
Results
rMR+ in comparison to parent M1 cells by 3H-aldosterone binding assays as described in
section 3.1.2. The range of rMR expression in M1-rMR+ cells was determined to ~2500
molecules per cell, which was less the MR expression range in the CCD in vivo (102, 105).
As expected, parent M1 cells did not exhibit measurable binding of 3H-aldosterone.
To examine whether overexpressed MR are functional in regard to target gene
regulation, qPCR experiments in M1-rMR+ and parent M1 cells were carried out. Cnksr3 and
sgk1 mRNA levels were determined after 4 h of incubation with 10 nM aldosterone and
normalized to a respective vehicle control (Fig. 3.13C). Consistent with the results obtained
for the HEK293-hMR+ and HEK293-control cells (cf. Fig. 3.11B) M1-rMR+ cells showed a
substantial up-regulation of sgk1 and cnksr3 mRNA, whereas parent M1 cells showed no
regulation (Fig. 3.13C).
Fig. 3.13: The rat MR regulates endogenous target genes in M1 cells
A: M1-rMR+ cells stably transfected with the rat MR were analyzed for MR activity by transient
transactivation assays using the pMMTV-Luc reporter as described above. M1-rMR+ cells exhibited an
aldosterone dose-dependent transactivation response with an EC50 of ~0.5 nM. B: Western blot
analysis of rMR (107 kDa) expression in M1-rMR+ and parent M1 cells, which are devoid of MR
expression. Beta-Actin (42 kDa) was used as a loading control. C: Aldosterone-dependent sgk1 and
cnksr3 mRNA up-regulation after 4 h of 10 nM aldosterone treatment in M1-rMR+ (black bars) in
comparison to parent M1 cells (white bars). qPCR values measured for aldosterone-treated cells are
time-matched to values obtained in vehicle-treated cells. (* p < 0.05)
To further elaborate whether the overexpressed MR was able to regulate ENaC-
mediated transepithelial Na+ transport (ISC) M1-rMR+ cells were electrophysiologically
characterized in Ussing chamber experiments. The epithelial sodium channel (ENaC) can be
blocked by application of 10-5 M amiloride. At these concentrations the diuretic amiloride
does not block the Na+/H+ antiporter NHE3 (101). Thus the drop in ISC after addition of
amiloride, ΔISC (μA/cm2), was assigned to ENaC-mediated Na+ absorption. ΔISC increased
within the first 6 h after 10 nM aldosterone stimulation until reaching a plateau, which was
maintained up to 72 h (Fig. 3.14A, left panel). Increasing aldosterone concentrations from 0.1
to 10 nM activated the ENaC-controlled transepithelial Na+ transport in a dose-dependent
manner (Fig. 3.14A, right panel). At 1 nM aldosterone the effects were near maximal, which
56
Results
is in accordance with the results obtained by transactivation assays using M1-rMR+ cells
(see Fig. 3.13A) or HEK-hMR+ cells (see Fig. 3.3C). To assure that the ENaC-mediated Na+
transport was induced via MR and not by co-present GR, M1-rMR+ cells were treated with 10
nM aldosterone in the presence of 1 µM RU486 or 1 µM RU26752. Treatment with the MR
antagonist RU26752 markedly inhibited the transepithelial Na+ current, whereas the GR
antagonist RU486 did not show a significant effect (Fig. 3.14B).
These results clearly indicate that this novel established M1-rMR+ cell line is a well
suited cell model to study the physiological effects of MR-mediated ENaC-controlled
transepithelial Na+ transport.
Fig. 3.14: Electrophysiological characterization of M1-rMR+ cells in Ussing chamber
experiments
A: Time-course in response to 10 nM aldosterone (left panel). Aldosterone dose-response curve
analyzed 24 h after aldosterone stimulation (right panel). The amiloride-sensitive Na+ current in M1-
rMR+ cells was time and dose-dependent. Values are means (n = 6) ± SEM. B: Transepithelial Na+
flux in response to aldosterone alone (black bar) or presence of 1 µM RU486 (open bar) and 1 µM
RU26752 (striped bar). MR blockade almost abolished aldosterone-mediated transepithelial Na+
transport. Values are means ± SEM. (*** p < 0.001, n.s. = not significant (p > 0.05))
3.4.3. Generation of different M1-rMR+ derived cell lines
Several M1-rMR+-derived cell clones were generated that either stably overexpress
mouse CNKSR3 or silence the expression by means of shRNA expression, in order to study
the effects of CNKSR3 in the mechanism of transepithelial Na+ transport by Ussing chamber
experiments.
57
Results
All these cell lines were generated by infection of M1-rMR+ cells with recombinant
lentiviruses as described in section 2.2.2.4. The CNKSR3 overexpressing cells and the control
cells, stably overexpressing JRed as a non-pathway related protein, were oligoclonal.
CNKSR3 expression levels in both cell pools were verified by qPCR and Western blot
analysis (Fig. 3.15A/C). Additionally, the expression of JRed was analyzed by
immunfluorecence microscopy (Fig. 3.15B).
Fig. 3.15: Characterization of different M1-rMR+ cell clones stably overexpressing or silencing
CNKSR3
A: M1-rMR+ cells stably overexpressing the murine CNKSR3 (62 kDa) as shown by Western blot B:
Expression of JRed in M1- control cells verified by immunfluorecence microscopy C: Quantification of
cnksr3 mRNA expression by qPCR. D: Characterization of different shRNAs (1-4) targeting cnksr3. A
non-target shRNA (Qiagen) was used as a control. For further details see text. E: shRNA3 and
shRNA4 were used for the generation of M1-rMR+ cells stably silencing cnksr3. Knock down efficiency
was verified by qPCR and is normalized to the endogenous cnksr3 expression in parent M1-rMR+
cells. M1-rMR+shRNA3 and M1-rMR+shRNA4 displayed over 80% reduction of cnksr3 expression.
M1-rMR+ cells stably expressing a non-target shRNA were used as a control. (*** p < 0.001)
To ensure a sufficient knock down of endogenous CNKSR3 expression in M1-rMR+
cells, different shRNAs (1-4) expression constructs were cloned as described in methods and
characterized by transient co-transfection experiments. To this end, shRNA expression
constructs pENTR/U6-shRNA #1-4 were co-transfected with pcDNA3.1-mCNKSR3-V5 into
M1 parent cells. CNKSR3-V5 expression was analyzed by Western blot 36 h after
transfection (Fig. 3.15D). A non-target shRNA (Qiagen) further referred to as shRNAcontrol
was used as a control. The shRNAs 3 and 4 strongly suppressed mCNKSR3-V5 expression,
whereas the non-target shRNA did not significantly reduce mCNKSR3-V5 protein level
(Fig. 3.15D). Therefore shRNA3 and shRNA4 were chosen for the generation of M1-rMR+-
58
Results
derived cell clones that stably repress endogenous CNKSR3 expression. The shRNAcontrol
was used for the generation of control cells. The cnksr3 knock down efficiency of several
selected clones was verified by qPCR. For the cnksr3 knock down analysis two independent
clones M1-rMR+shRNA3 (#4) and M1-rMR+shRNA4 (#8) were selected that were stably
transduced with different shRNAs targeting cnksr3 mRNA. Both clones displayed over 80%
reduction of cnksr3 expression as compared to parent M1-rMR+ cells as assessed by qPCR
analysis (Fig. 3.15E).
3.4.4. Impact of CNKSR3 on the aldosterone-induced ENaC-controlled Na+ transport
The impact of CNKSR3 on MR-mediated ENaC-controlled transepithelial Na+ transport
was studied in different M1-rMR+ derived cell clones stably overexpressing or silencing the
cnksr3 gene (see section 3.4.3) in Ussing chamber experiments. As shown in Figure 3.16
overexpression of CNKSR3 resulted in a markedly increased aldosterone-dependent
amiloride-blockable Na+ transport (ΔISC). In contrast, both M1-rMR+ cell clones stably
silencing the cnksr3 gene exhibited a dramatically decreased ΔISC. Compared to parent M1-
rMR+ cells, ΔISC was unchanged in M1-rMR+ cells stably over-expressing JRed as a non-
pathway-related protein control as well as in M1-rMR+ cells expressing a non-target shRNA.
These results strongly suggest that CNKSR3 is required for the maintenance of MR-mediated
ENaC-controlled transepithelial Na+ transport in M1 CCD cells.
Fig. 3.16: Impact of CNKSR3 on MR-mediated ENaC-controlled Na+ transport
ENaC-mediated transepithelial Na+ absorption (ΔISC) in response to 10 nM aldosterone in M1-rMR+-
derived cell clones. Overexpression of CNKSR3 increased Na+ transport (black bar), whereas
silencing of the cnksr3 gene almost abrogated Na+ transport (grey bars). ΔISC of appropriate control
cell clones (open bars) was unchanged compared to M-1rMR+ parent cells. Values were obtained after
24 h and are given as means (n = 6) ± SEM. (** p < 0.01, *** p < 0.001)
59
Results
3.4.5. CNKSR3 suppresses phospho-MEK1/2 level
Previous studies suggested that the ERK pathway has a potent inhibitory effect on ENaC in
CCD cells (76, 82, 120) and plays a role in aldosterone-controlled Na+ regulation (82). As its
name implies CNKSR3 is one of three members of the connector enhancer of kinase
suppressor of RAS (CNK) family of proteins. CNK proteins have been shown to function as
scaffolds in RHO/JNK and RAS/ERK signal transduction pathways (121-123). Due to the
modular structure of CNKSR3 and its high homology to the C-terminal moiety of CNK1 and
2 the involvement of CNKSR3 in RAS/RAF signaling was studied. To this end the
phosphorylation state of MEK1/2 and ERK1/2 was examined by Western blot analysis in M1-
rMR+ CNKSR3 overexpressing and silencing cells. M1-MR+ cells in which CNKSR3
expression was inhibited by means of shRNA silencing showed a marked increase in MEK1/2
and ERK1/2 phosphorylation. On the other hand, overexpression of CNKSR3 slightly reduced
phosphorylation of MEK1/2 and ERK1/2 (Fig. 3.17). In accordance with this the
phosphorylation state of ERK1/2, a downstream target of MEK1/2, was altered in the same
manner (Fig. 3.17), suggesting that CNKSR3 inhibits the RAS/ERK signaling cascade at the
level of MEK1/2 or further upstream. These results indicate that the lack of CNKSR3
expression leads to a MEK/ERK pathway activation which has been correlated with decreased
ENaC surface expression in previous studies (82). Preliminary results from Ussing chamber
experiments revealed that ΔISC in M1-rMR+ cells silencing the CNKSR3 gene can be
markedly increased by U0126, a pharmacological inhibitor of MEK1/2.
Fig. 3.17: CNKSR3 prevents phosphorylation of
MEK1/2 and ERK1/2
Western blot analysis for phospho-MEK1/2 and
phosho-ERK1/2 detection in M1-rMR+ cells stably
overexpressing or silencing the CNKSR3 gene.
Parent M1-rMR+ cells were used as a reference
control. Total MEK and beta-Actin were monitored
as loading controls.
In conclusion, these data show that cnksr3 is a novel direct aldosterone target gene and that its
expression is critical for the maintenance of aldosterone-mediated transepithelial Na+
transport in renal CCD cells. As a member of a scaffold protein family involved in RAS/ERK
signaling, it was demonstrated that CNKSR3 expression is correlated with decreased MEK1/2
ERK1/2 phosphorylation.
60
Discussion
4. Discussion
The present study examined the aldosterone-activated mineralocorticoid receptor-
mediated gene regulation pattern on a genome-wide level by DNA microarray experiments.
Chromatin immunoprecipitation (ChIP) in combination with reporter gene assays confirmed
that several aldosterone-regulated genes are directly regulated by MR. This approach led to
the identification of a so far unknown MR target gene, cnksr3. By using a renal cortical
collecting duct cell model it was shown that cnksr3 is a crucial element in the mechanism of
aldosterone-mediated ENaC-controlled transepithelial sodium transport. Moreover, it was
shown that cnksr3 is highly expressed in the connecting tubule and the cortical collecting duct
microdissected from mouse kidneys.
4.1. Early aldosterone target genes in HEK293 MR expressing cells
MR has a similar affinity for aldosterone and glucocorticoids (26, 27), and a number of
MR target genes identified so far were initially found to be glucocorticoid-regulated, e.g. sgk
and gilz (124, 125). In addition, supraphysiological concentrations of aldosterone also activate
the GR (28-30). This overlap makes it experimentally difficult to attribute observed functional
effects to either glucocorticoids or aldosterone, on the one hand, and to GR or MR activation,
on the other (126). In the past a number of studies for aldosterone-regulated genes have been
performed with supraphysiological concentrations of aldosterone ranging from 100 nM to
1 µM (80, 82, 109, 127). These studies face the disadvantage that the observed effects are not
exclusively mediated by the MR since the GR is ubiquitously expressed (11, 128). For the
present study HEK293-hMR+ cells were established which stably express human MR in a
physiological range, typical for cells of the CCD in the kidney. The HEK293-hMR+ cells
allow a clear separation of MR- vs. GR-mediated effects and were thus considered as an
appropriate cell system to study the MR-mediated transcriptional response. Albeit the 293 cell
line was derived by transformation of primary cultured human embryonic kidney (HEK) cells
with sheared fragments of adenovirus 5 DNA (129), these cells exhibit some properties
untypical for kidney epithelial cells. A recent study demonstrated that the constitutive
expression pattern of HEK293 cells includes genes typically found in neurons (130). Since
several genes identified as MR-regulated in kidney or kidney-derived cell lines, e.g. sgk1,
gilz, k-ras, or scnn1a (68, 71, 82, 131), were induced by aldosterone in HEK293-hMR+ cells
in the same order of magnitude, HEK293-hMR+ were considered as a suitable cell system for
61
Discussion
the identification of further MR target genes by an Affymetrix microarray gene expression
study.
The microarray study led to the identification of 36 aldosterone-regulated genes,
including the well characterized aldosterone target genes sgk1 and gilz, whereas the majority
of regulated genes had not been described as mineralocorticoid-responsive so far. A recent
microarray study carried out with a cardiomyocyte-derived cell line stably expressing MR
demonstrated that 48 genes were regulated by aldosterone (110) in a manner reminiscent of
the regulation pattern obtained in HEK293-hMR+ cells in terms of fold change and
distribution of induced and repressed genes. However, the overlap of common regulated
genes in both studies was restricted to sgk1, gilz, fkbp5, nfkbia, and klf9. This suggests that
the MR has a tissue-specific gene expression profile and consequently modulates different
pathways.
In HEK293-hMR+ cells 12 genes were identified as being regulated by aldosterone,
which code for transcription factors e.g. mafb, emx2, klf9, per1, or plzf. Recent studies
showed that per1 and plzf are regulated by aldosterone in the kidney and demonstrated that
these transcription factors modulate ENaC mRNA expression. PLZF overexpression in M1
CCD cells led to a reduced expression of the β and γ-ENaC mRNA and simultaneously
reduced transepithelial sodium transport (108). In contrast, PER1 seems to have a stimulatory
effect on α-ENaC mRNA expression. Silencing of per1 by means of siRNA in renal collecting
duct cells markedly decreased α-ENaC mRNA level. In line with this per1 knockout mice
excreted more sodium in comparison to their wt littermates (111). Also the krüppel-like
transcription factor 9 (KLF9) modulates gene transcription by binding through its C-terminal
C2H2 zinc finger motif to GC boxes in the promoter of many genes (132). As mentioned
above KLF9 was found to be aldosterone-induced in rat cardiomyocytes. Bonett and
colleagues (133) demonstrated that KLF9 is regulated by glucocorticoids in the Xenopus
leavis brain where it promotes neuronal differentiation. The role of KLF9 in aldosterone-
mediated signaling remains elusive at this time. As shown for PLZF and PER1 some
aldosterone-induced transcription factors indirectly regulate transepithelial sodium transport
by modulating the expression of components of the ion transport machinery. Although some
genes code for transcription factors that were early or directly regulated by MR, this group of
genes is assumed to be involved in the late phase of aldosterone-mediated regulatory effects.
These factors can exert their regulatory function after a lag period needed for expression and
translation before they can modulate the expression of other genes e.g. that code for the
transporter themselves (12). The roles of the majority of identified aldosterone-responsive
62
Discussion
transcription factors in MR signaling remains unclear. These factors may mediate the fine-
tune regulation of sodium reabsorption during a long period of aldosterone exposure.
4.2. Direct MR target genes and their regulatory elements
The present study aimed at the identification of direct MR target genes. To this end short
times of hormone exposure during a time-course experiment were chosen to identify early
aldosterone-regulated genes, where the MR is probably the determinant of the transcription
regulatory process. Early aldosterone-induced genes encoding regulatory factors have a great
potential to mediate the acute and dynamic response of sodium reabsorption through
modulation of ENaC activity e.g. sgk1 (68, 106) and gilz (82). It is generally assumed that the
early phase of aldosterone action is mediated through direct effects on gene expression
(12, 54). Direct regulatory mechanisms classically include binding of activated MR to DNA
responsive elements in the promoter of target genes (12, 112). Evidence that several of the
identified aldosterone responsive genes are directly regulated by MR came from a ChIP-chip
study carried out in HEK293-myc-MR+ cells scanning 10 kb promoter fragments of
approximately 25,500 promoters of the human genome for putative MR binding regions
(MBR) (114).
Distribution of regulatory elements in the promoter of target genes
The comparison of microarray data from this study with the results obtained by the
ChIP-chip analysis revealed that 12 out of 36 aldosterone-responsive genes (sgk1, gilz,
scnn1a, per1, cxcr4, pdk4, fkbp5, nfkbia, klf9, pik3r1, calm1, and cnksr3) contain a least one
MBR in the promoter region from 7.5 kb upstream through 2.5 kb downstream of the TSS.
MR binding to proximal promoter regions, i.e. within -800 bp to +200 bp from TSS, was
only detected for cnksr3 and pdk4. All other identified MBRs in vicinity to aldosterone-
responsive genes (including a second more distal MBR within the cnksr3 promoter) are
located in promoter regions more distant from the TSS. This is in good accordance with
binding studies for GR and the estrogen receptor (ER) in which less than 10% of all identified
binding sites were mapped to the -800 bp to +200 bp proximal promoter region (39, 134). For
the GR and the androgen receptor (AR) it has been demonstrated that approximately 30% of
all glucocorticoid and androgen-regulated genes contain respective receptor binding sites
within the 10 kb promoter region, whereas the majority of binding sites were found beyond 10
kb of TSS (39, 135). Thus it is likely that several aldosterone-regulated genes that do not have
63
Discussion
a MR binding site within the 10 kb promoter region might be regulated by sites that have a
larger distance to the TSS.
It is also conceivable that some of the aldosterone-responsive genes are regulated by a
DNA element that does not contain a high-affinity binding site for the MR, rather MR
recruitment is accomplished through stabilizing protein-protein interactions with other DNA-
binding factors. This tethered binding mode has been described for GR and AR (136, 137). It
is also possible that these genes are regulated by elements on different chromosomes (138).
For instance, the expression of the promyelocytic leukemia zinc finger protein (PLZF) is
described as regulated by androgens in the prostate (139) and was also found induced by
aldosterone-activated MR by us and others (108). PLZF expression does not require de novo
protein synthesis, suggesting a direct mechanism of action (108). However, no associated
steroid receptor binding site in the 100 kb region surrounding the TSS of the PLZF gene has
been identified so far.
Function of regulatory elements
All MR binding regions detected by the ChIP-chip approach could be verified by
manual ChIP-qPCR experiments. As a proof of concept the already known functional MR
binding site of the sgk1 promoter (115) was confirmed. The identified MBRs close to the TSS
of gilz, scnn1a, and nfkbia overlap with functional binding regions previously identified for
GR and AR (39, 116, 135). Reporter gene assays showed that all MBRs close to TSS of
aldosterone-regulated genes are sufficient to mediate MR-dependent transcription. Hence it is
likely that the identified MBRs confer to the aldosterone responsiveness of their associated
genes. Computational analysis revealed that all these MBRs contain at least one core
consensus sequence for glucocorticoid responsive element (GRE) family elements. For the
distal cnksr3 promoter fragment a cluster of four putative GREs was identified. Mutation
analysis revealed that three of four computationally predicted regulatory elements within the
-4 kb MR binding region of the cnksr3 promoter contributed to aldosterone responsiveness.
These experiments suggest that individual MR binding sites seem to be crucial for overall
promoter activity and thus for target gene regulation.
Interestingly, MR binding as assessed by ChIP was not predictive for the degree of
mRNA expression. As noted above the cnksr3 promoter exhibited two promoter regions with
strong MR occupancy, whereas the sgk1 promoter contains only one MR binding site with
moderate MR binding. However, aldosterone altered sgk1 and cnksr3 mRNA expression level
in the same order of magnitude in HEK293-hMR+ and M1-rMR+ cells. Moreover, for
64
Discussion
mgc21644 and rhob MR occupancy was detected close to their respective TSS, although both
genes were unresponsive to aldosterone in HEK293-hMR+ cells. This indicates that MR
binding to bona fide DNA responsive elements is not necessarily the limiting factor in
transcription initiation.
Another factor that might affect MR activity is the structure of the consensus DNA
binding sequence itself. For the GR it has been reported that GREs vary around a core
consensus sequence, but are highly conserved for a given sequence across species (39).
Evidence that binding sites carry a regulatory code that affects the receptors function came
from a recent study that demonstrated that consensus sequences differing in a single bp
differentially affect GR conformation and its regulatory activity (40). This raises the
possibility of distinct sets of MREs versus GREs for MR target genes. In this context it should
be noted that the mgc21644-luciferase reporter construct had different transactivating
capabilities with MR versus GR. Reporter gene transactivation assays revealed that
aldosterone-activated MR in HEK-hMR+ cells was unable to promote luciferase activity,
whereas the cortisol-activated GR in HEK293-hGR+ cells induced luciferase activity more
than 3-fold (data not shown). It is interesting to speculate whether this promoter segment
contains elements that force the MR in an inactive conformation or whether the vicinity to
binding sites for inhibitory factors preclude interaction of MR with the transcription
machinery.
4.3. The role of CNKSR3 in the mechanism of transepithelial sodium transport
Protein and mRNA expression data in combination with results obtained from ChIP
analysis strongly indicate that cnksr3 is directly induced by the aldosterone-activated MR.
Evidence that cnksr3 might be involved in the mechanism of sodium reabsorption came from
qPCR expression analysis along different nephron segments microdissected from mice
kidneys. Cnksr3 was found to be highly expressed in the connecting tubule (CNT) and the
cortical collecting duct (CCD). The CNT and the CCD are the essential compartments
whereby sodium reabsorption via ENaC is regulated by aldosterone (140). Murine CCD cells
(e.g. M1) have been used as a surrogate in vitro model to elucidate the function of genes
involved in transepithelial sodium transport, e.g. the recently identified MR target genes wnk1
(119) and plzf (108). Overexpression of murine CNKSR3 in M1-rMR+ cells markedly
increased ENaC activity, indicating that CNKSR3 is involved in the mechanism of
aldosterone-controlled sodium transport. More important, M1-MR+ cells that lack CNKSR3
gene expression by means of shRNA silencing showed almost abolished ENaC-mediated
65
Discussion
sodium absorption. Apparently basic expression levels of CNKSR3 are required to maintain
sodium reabsorption in the kidney.
CNKSR3 is one of three members of the ‘connector enhancer of kinase suppressor of
RAS’ (CNK) family of proteins. The CNK family was first described in Drosophila (141) and
homologues exist in vertebrates and C. elegans (142). CNK proteins have no catalytic motifes
but contain several protein interaction domains: an N-terminal sterile alpha motif (SAM
domain) followed by a conserved region in CNK proteins named the CRIC domain and a PDZ
domain. CNK1 and -2 further contain a proline-rich SRC-homology-3 (SH3) and a pleckstrin
homology (PH) domain (143). In contrast, CNKSR3 is much smaller, and is highly
homologous to the N-terminal half of full-length CNK1 and -2 proteins. However, it lacks the
part corresponding to the C-terminal half of CNK1 and -2. CNK proteins have been shown to
function as scaffolds in RHO/JNK and RAS/ERK signal transduction where their C-terminal
moiety associates with RAF (121, 122, 144, 145). CNK1 is ubiquitously expressed whereas
CNK2 expression seems to be restricted to neurons (123). In contrast to CNK1, CNK2 fails to
co-precipitate RAS, MEK, ERK or KSR1 (121), suggesting that CNK2 might scaffold RAF
signaling complexes that do not interact with components of the MEK, ERK pathway (123).
It is conceivable that CNKSR3 shares scaffolding properties of CNK1 but fails to
establish a fully active protein complex due to the lack of SH3 and PH domains. In effect,
CNKSR3 would diminish the activity of the RAF/ERK signaling possibly by recruiting kinase
suppressor of RAS (KSR) from the CNK1 signaling complex, which is required for MEK
activation and thus for the maintainance of the phosphorylation cascade, suggesting that
CNKSR3 might act as a dominant negative of CNK1 (Fig. 4.1). This model supports the view
that CNKSR3, as an early aldosterone responsive gene, regulates ENaC-mediated sodium
transport via inhibition of the RAF/ERK signaling cascade. Indeed, analysis of components of
the RAS/ERK signaling cascade revealed that shRNA-mediated CNKSR3 silencing markedly
increased MEK1/2 and ERK1/2 phosphorylation, while CNKSR3 overexpression had the
opposite effects. There is increasing evidence that scaffold proteins dynamically modulate
signal transduction by affecting assembly of individual components of signaling networks
(123). Furthermore, the subcellular localization and differential utilization of scaffold proteins
may represent a mechanism that ensures specific signal transduction through otherwise
pleiotropic signaling cascades (146).
There are several lines of evidence that the RAS/RAF-1/MEK/ERK kinase pathway has
a potent inhibitory effect on ENaC in CCD cells (76, 82, 120).
66
Discussion
Fig. 4.1: The possible function of CNKSR3 in the mechanism of ENaC regulation
A: In the absense of aldosterone the expression of MR target genes including cnksr3 is relatively low.
Nedd4-2 and ERK are fully active, which leads to ENaC degradation. CNK1 might function as
molecular platform that allows the assembly of proteins required for the RAS/RAF/MEK/ERK
phosphorylation cascade. B: In the presence of aldosterone CNKSR3 abundance increases and
interferes with the CNK1 signaling complex, by recruiting components (e.g. KSR1) from the signaling
complex and thus preventing ENaC from degradation, which leads to an interuption of the
phosphorylation cascade. An alternative model is depicted in B upper left: CNKSR3 is part of a
regulatory complex that protects ENaC from degradation. This complex contains SGK1, GILZ, RAF-1
Nedd4-2 and the α- and β-ENaC subunits. See text for details and references.
67
Discussion
It appears that activated ERK phosphorylates ENaC and thereby facilitates interaction
between Nedd4 proteins and ENaC, which triggers degradation of the channel and thus
decreases ENaC surface expression (82). The best characterized modulator that stimulates
ENaC activity by interfering with the ERK pathway is GILZ1. This protein is rapidly and
robustly induced by aldosterone in the native collecting duct (131), as well as in cultured
mpkCCDC14 cells (80). Overexpression of GILZ1 stimulates ENaC activity and inhibits
formation of phospho-ERK in progesterone-treated Xenopus laevis oocytes (82). Moreover it
has been demonstrated that GILZ1 stimulates transepithelial sodium transport and
concurrently inhibits ERK phosphorylation in mpkCCDC14 cells. GILZ1 directly interacts
with RAF-1 whereby it possibly interrupts the RAS/RAF/MEK/ERK signaling cascade by
displacing RAS from the ras-binding domain of RAF-1 (81). In effect, CNKSR3 stimulates
ENaC activity by a similar route as reported for GILZ proteins.
It is also conceivable that CNKSR3 acts as a scaffold by coordinating the assembly of
ENaC regulatory proteins in a complex and thereby promoting proper signal transduction
(Fig. 4.1B). A recent study from the Pearce laboratory demonstrated that RAF-1, SGK1,
Nedd4-2, and the α and β-ENaC subunits are assembled in a multi-protein complex (83).
Nevertheless, further studies will be needed, esspecially co-immunoprecipitation experiments,
to elucidate the specific role of CNKSR3 in the context of ENaC regulation. Moreover, it
would be interesting to study the role of CNKSR3 in other non-epithelial tissues particularly
in the heart where the pathological actions of MR are as yet poorly understood.
4.4. Conclusion
The present study provides new insights into the genome-wide gene regulation pattern
of aldosterone-activated MR. The identification of several functional MR DNA-binding sites
in the proximity to aldosterone-regulated genes is an important step studying DNA sequence
binding preferences and other functional properties by which the MR controls transcription.
Furthermore functional studies revealed that cnksr3, a novel identified direct MR target gene,
plays a key role in the regulation of ENaC-mediated sodium transport. CNKSR3 inhibits
RAS/MEK/ERK signaling and thereby stimulates ENaC activity. As a scaffold protein
CNKSR3 most probably interferes with the assembly of components of the RAS/MEK/ERK
pathway to a fully functional complex. The dynamic regulation of a scaffold protein appears
to be an effective mechanism to modulate ENaC activity. This mechanism of CNKSR3, and
GILZ, to affect ENaC activity describes a novel route how MR mediates its effects to regulate
sodium transport.
68
Appendix
5. References
1. Hanke, C. J., and Bauer-Dantoin, A. C. (2006) Teaching aldosterone regulation and
basic scientific principles using a classic paper by Dr. James O. Davis and colleagues.
Adv Physiol Educ 30, 141-144
2. Young, D. B. (1985) Analysis of long-term potassium regulation. Endocr Rev 6, 24-44
3. Berger, S., Bleich, M., Schmid, W., Cole, T. J., Peters, J., Watanabe, H., Kriz, W.,
Warth, R., Greger, R., and Schutz, G. (1998) Mineralocorticoid receptor knockout
mice: pathophysiology of Na+ metabolism. Proc Natl Acad Sci U S A 95, 9424-9429
4. Berger, S., Bleich, M., Schmid, W., Greger, R., and Schutz, G. (2000)
Mineralocorticoid receptor knockout mice: lessons on Na+ metabolism. Kidney Int 57,
1295-1298
5. Beato, M., Herrlich, P., and Schutz, G. (1995) Steroid hormone receptors: many actors
in search of a plot. Cell 83, 851-857
6. Lifton, R. P., Gharavi, A. G., and Geller, D. S. (2001) Molecular mechanisms of
human hypertension. Cell 104, 545-556
7. Zennaro, M. C., Farman, N., Bonvalet, J. P., and Lombes, M. (1997) Tissue-specific
expression of alpha and beta messenger ribonucleic acid isoforms of the human
mineralocorticoid receptor in normal and pathological states. J Clin Endocrinol Metab
82, 1345-1352
8. Pascual-Le Tallec, L., and Lombes, M. (2005) The mineralocorticoid receptor: a
journey exploring its diversity and specificity of action. Mol Endocrinol 19, 2211-
2221
9. Black, B. E., Holaska, J. M., Rastinejad, F., and Paschal, B. M. (2001) DNA binding
domains in diverse nuclear receptors function as nuclear export signals. Curr Biol 11,
1749-1758
10. Williams, S. P., and Sigler, P. B. (1998) Atomic structure of progesterone complexed
with its receptor. Nature 393, 392-396
11. Farman, N., and Rafestin-Oblin, M. E. (2001) Multiple aspects of mineralocorticoid
selectivity. Am J Physiol Renal Physiol 280, F181-192
12. Stockand, J. D. (2002) New ideas about aldosterone signaling in epithelia. Am J
Physiol Renal Physiol 282, F559-576
13. Geller, D. S., Farhi, A., Pinkerton, N., Fradley, M., Moritz, M., Spitzer, A., Meinke,
G., Tsai, F. T., Sigler, P. B., and Lifton, R. P. (2000) Activating mineralocorticoid
receptor mutation in hypertension exacerbated by pregnancy. Science 289, 119-123
14. Rafestin-Oblin, M. E., Souque, A., Bocchi, B., Pinon, G., Fagart, J., and Vandewalle,
A. (2003) The severe form of hypertension caused by the activating S810L mutation
in the mineralocorticoid receptor is cortisone related. Endocrinology 144, 528-533
15. McEwen, B. S., and Wallach, G. (1973) Corticosterone binding to hippocampus:
nuclear and cytosol binding in vitro. Brain Res 57, 373-386
16. Funder, J. W., Pearce, P. T., Smith, R., and Smith, A. I. (1988) Mineralocorticoid
action: target tissue specificity is enzyme, not receptor, mediated. Science 242, 583-
585
17. Caprio, M., Feve, B., Claes, A., Viengchareun, S., Lombes, M., and Zennaro, M. C.
(2007) Pivotal role of the mineralocorticoid receptor in corticosteroid-induced
adipogenesis. Faseb J 21, 2185-2194
18. Lim, H. Y., Muller, N., Herold, M. J., van den Brandt, J., and Reichardt, H. M. (2007)
Glucocorticoids exert opposing effects on macrophage function dependent on their
concentration. Immunology 122, 47-53
69
Appendix
19. Pitt, B., Zannad, F., Remme, W. J., Cody, R., Castaigne, A., Perez, A., Palensky, J.,
and Wittes, J. (1999) The effect of spironolactone on morbidity and mortality in
patients with severe heart failure. Randomized Aldactone Evaluation Study
Investigators. N Engl J Med 341, 709-717
20. Pitt, B., Remme, W., Zannad, F., Neaton, J., Martinez, F., Roniker, B., Bittman, R.,
Hurley, S., Kleiman, J., and Gatlin, M. (2003) Eplerenone, a selective aldosterone
blocker, in patients with left ventricular dysfunction after myocardial infarction. N
Engl J Med 348, 1309-1321
21. Rickard, A. J., and Young, M. J. (2009) Corticosteroid receptors, macrophages and
cardiovascular disease. J Mol Endocrinol 42, 449-459
22. Berger, S., Wolfer, D. P., Selbach, O., Alter, H., Erdmann, G., Reichardt, H. M.,
Chepkova, A. N., Welzl, H., Haas, H. L., Lipp, H. P., and Schutz, G. (2006) Loss of
the limbic mineralocorticoid receptor impairs behavioral plasticity. Proc Natl Acad Sci
U S A 103, 195-200
23. Fuller, P. J., Lim-Tio, S. S., and Brennan, F. E. (2000) Specificity in mineralocorticoid
versus glucocorticoid action. Kidney Int 57, 1256-1264
24. Funder, J. W. (1997) Glucocorticoid and mineralocorticoid receptors: biology and
clinical relevance. Annu Rev Med 48, 231-240
25. Arriza, J. L., Weinberger, C., Cerelli, G., Glaser, T. M., Handelin, B. L., Housman, D.
E., and Evans, R. M. (1987) Cloning of human mineralocorticoid receptor
complementary DNA: structural and functional kinship with the glucocorticoid
receptor. Science 237, 268-275
26. Krozowski, Z. S., and Funder, J. W. (1983) Renal mineralocorticoid receptors and
hippocampal corticosterone-binding species have identical intrinsic steroid specificity.
Proc Natl Acad Sci U S A 80, 6056-6060
27. Rupprecht, R., Reul, J. M., van Steensel, B., Spengler, D., Soder, M., Berning, B.,
Holsboer, F., and Damm, K. (1993) Pharmacological and functional characterization
of human mineralocorticoid and glucocorticoid receptor ligands. Eur J Pharmacol
247, 145-154
28. Claire, M., Machard, B., Lombes, M., Oblin, M. E., Bonvalet, J. P., and Farman, N.
(1989) Aldosterone receptors in A6 cells: physicochemical characterization and
autoradiographic study. Am J Physiol 257, C665-677
29. Schmidt, T. J., Husted, R. F., and Stokes, J. B. (1993) Steroid hormone stimulation of
Na+ transport in A6 cells is mediated via glucocorticoid receptors. Am J Physiol 264,
C875-884
30. Ziera, T., Irlbacher, H., Fromm, A., Latouche, C., Krug, S. M., Fromm, M., Jaisser, F.,
and Borden, S. A. (2009) Cnksr3 is a direct mineralocorticoid receptor target gene and
plays a key role in the regulation of the epithelial sodium channel. Faseb J
31. Edwards, C. R., Stewart, P. M., Burt, D., Brett, L., McIntyre, M. A., Sutanto, W. S., de
Kloet, E. R., and Monder, C. (1988) Localisation of 11 beta-hydroxysteroid
dehydrogenase--tissue specific protector of the mineralocorticoid receptor. Lancet 2,
986-989
32. Stewart, P. M., Corrie, J. E., Shackleton, C. H., and Edwards, C. R. (1988) Syndrome
of apparent mineralocorticoid excess. A defect in the cortisol-cortisone shuttle. J Clin
Invest 82, 340-349
33. Mune, T., Rogerson, F. M., Nikkila, H., Agarwal, A. K., and White, P. C. (1995)
Human hypertension caused by mutations in the kidney isozyme of 11 beta-
hydroxysteroid dehydrogenase. Nat Genet 10, 394-399
34. Albiston, A. L., Obeyesekere, V. R., Smith, R. E., and Krozowski, Z. S. (1994)
Cloning and tissue distribution of the human 11 beta-hydroxysteroid dehydrogenase
type 2 enzyme. Mol Cell Endocrinol 105, R11-17
70
Appendix
35. Funder, J. W. (2009) Reconsidering the roles of the mineralocorticoid receptor.
Hypertension 53, 286-290
36. Hellal-Levy, C., Fagart, J., Souque, A., and Rafestin-Oblin, M. E. (2000) Mechanistic
aspects of mineralocorticoid receptor activation. Kidney Int 57, 1250-1255
37. Rupprecht, R., Arriza, J. L., Spengler, D., Reul, J. M., Evans, R. M., Holsboer, F., and
Damm, K. (1993) Transactivation and synergistic properties of the mineralocorticoid
receptor: relationship to the glucocorticoid receptor. Mol Endocrinol 7, 597-603
38. Rogerson, F. M., and Fuller, P. J. (2003) Interdomain interactions in the
mineralocorticoid receptor. Mol Cell Endocrinol 200, 45-55
39. So, A. Y., Chaivorapol, C., Bolton, E. C., Li, H., and Yamamoto, K. R. (2007)
Determinants of cell- and gene-specific transcriptional regulation by the
glucocorticoid receptor. PLoS Genet 3, e94
40. Meijsing, S. H., Pufall, M. A., So, A. Y., Bates, D. L., Chen, L., and Yamamoto, K. R.
(2009) DNA binding site sequence directs glucocorticoid receptor structure and
activity. Science 324, 407-410
41. Viengchareun, S., Le Menuet, D., Martinerie, L., Munier, M., Pascual-Le Tallec, L.,
and Lombes, M. (2007) The mineralocorticoid receptor: insights into its molecular and
(patho)physiological biology. Nucl Recept Signal 5, e012
42. Hermanson, O., Glass, C. K., and Rosenfeld, M. G. (2002) Nuclear receptor
coregulators: multiple modes of modification. Trends Endocrinol Metab 13, 55-60
43. O'Malley, B. W. (2007) Coregulators: from whence came these "master genes". Mol
Endocrinol 21, 1009-1013
44. Fuse, H., Kitagawa, H., and Kato, S. (2000) Characterization of transactivational
property and coactivator mediation of rat mineralocorticoid receptor activation
function-1 (AF-1). Mol Endocrinol 14, 889-899
45. Zennaro, M. C., Souque, A., Viengchareun, S., Poisson, E., and Lombes, M. (2001) A
new human MR splice variant is a ligand-independent transactivator modulating
corticosteroid action. Mol Endocrinol 15, 1586-1598
46. Hultman, M. L., Krasnoperova, N. V., Li, S., Du, S., Xia, C., Dietz, J. D., Lala, D. S.,
Welsch, D. J., and Hu, X. (2005) The ligand-dependent interaction of
mineralocorticoid receptor with coactivator and corepressor peptides suggests multiple
activation mechanisms. Mol Endocrinol 19, 1460-1473
47. Kitagawa, H., Yanagisawa, J., Fuse, H., Ogawa, S., Yogiashi, Y., Okuno, A.,
Nagasawa, H., Nakajima, T., Matsumoto, T., and Kato, S. (2002) Ligand-selective
potentiation of rat mineralocorticoid receptor activation function 1 by a CBP-
containing histone acetyltransferase complex. Mol Cell Biol 22, 3698-3706
48. Tallec, L. P., Kirsh, O., Lecomte, M. C., Viengchareun, S., Zennaro, M. C., Dejean,
A., and Lombes, M. (2003) Protein inhibitor of activated signal transducer and
activator of transcription 1 interacts with the N-terminal domain of mineralocorticoid
receptor and represses its transcriptional activity: implication of small ubiquitin-
related modifier 1 modification. Mol Endocrinol 17, 2529-2542
49. Obradovic, D., Tirard, M., Nemethy, Z., Hirsch, O., Gronemeyer, H., and Almeida, O.
F. (2004) DAXX, FLASH, and FAF-1 modulate mineralocorticoid and glucocorticoid
receptor-mediated transcription in hippocampal cells--toward a basis for the opposite
actions elicited by two nuclear receptors? Mol Pharmacol 65, 761-769
50. Pascual-Le Tallec, L., Simone, F., Viengchareun, S., Meduri, G., Thirman, M. J., and
Lombes, M. (2005) The elongation factor ELL (eleven-nineteen lysine-rich leukemia)
is a selective coregulator for steroid receptor functions. Mol Endocrinol 19, 1158-1169
51. Hu, X., and Funder, J. W. (2006) The evolution of mineralocorticoid receptors. Mol
Endocrinol 20, 1471-1478
71
Appendix
52. Verrey, F., Fakitsas, P., Adam, G., and Staub, O. (2008) Early transcriptional control
of ENaC (de)ubiquitylation by aldosterone. Kidney Int 73, 691-696
53. Pearce, D., Bhargava, A., and Cole, T. J. (2003) Aldosterone: its receptor, target
genes, and actions. Vitam Horm 66, 29-76
54. Bhalla, V., Soundararajan, R., Pao, A. C., Li, H., and Pearce, D. (2006) Disinhibitory
pathways for control of sodium transport: regulation of ENaC by SGK1 and GILZ. Am
J Physiol Renal Physiol 291, F714-721
55. Hummler, E., Barker, P., Gatzy, J., Beermann, F., Verdumo, C., Schmidt, A., Boucher,
R., and Rossier, B. C. (1996) Early death due to defective neonatal lung liquid
clearance in alpha-ENaC-deficient mice. Nat Genet 12, 325-328
56. McDonald, F. J., Yang, B., Hrstka, R. F., Drummond, H. A., Tarr, D. E., McCray, P.
B., Jr., Stokes, J. B., Welsh, M. J., and Williamson, R. A. (1999) Disruption of the
beta subunit of the epithelial Na+ channel in mice: hyperkalemia and neonatal death
associated with a pseudohypoaldosteronism phenotype. Proc Natl Acad Sci U S A 96,
1727-1731
57. Barker, P. M., Nguyen, M. S., Gatzy, J. T., Grubb, B., Norman, H., Hummler, E.,
Rossier, B., Boucher, R. C., and Koller, B. (1998) Role of gammaENaC subunit in
lung liquid clearance and electrolyte balance in newborn mice. Insights into perinatal
adaptation and pseudohypoaldosteronism. J Clin Invest 102, 1634-1640
58. Bens, M., Vallet, V., Cluzeaud, F., Pascual-Letallec, L., Kahn, A., Rafestin-Oblin, M.
E., Rossier, B. C., and Vandewalle, A. (1999) Corticosteroid-dependent sodium
transport in a novel immortalized mouse collecting duct principal cell line. J Am Soc
Nephrol 10, 923-934
59. Garty, H., and Palmer, L. G. (1997) Epithelial sodium channels: function, structure,
and regulation. Physiol Rev 77, 359-396
60. Renard, S., Voilley, N., Bassilana, F., Lazdunski, M., and Barbry, P. (1995)
Localization and regulation by steroids of the alpha, beta and gamma subunits of the
amiloride-sensitive Na+ channel in colon, lung and kidney. Pflugers Arch 430, 299-
307
61. Snyder, P. M. (2005) Minireview: regulation of epithelial Na+ channel trafficking.
Endocrinology 146, 5079-5085
62. Geering, K. (2006) FXYD proteins: new regulators of Na-K-ATPase. Am J Physiol
Renal Physiol 290, F241-250
63. Horisberger, J. D. (2004) Recent insights into the structure and mechanism of the
sodium pump. Physiology (Bethesda) 19, 377-387
64. Lingrel, J. B., Van Huysse, J., O'Brien, W., Jewell-Motz, E., and Schultheis, P. (1994)
Na,K-ATPase: structure-function studies. Ren Physiol Biochem 17, 198-200
65. Whorwood, C. B., and Stewart, P. M. (1995) Transcriptional regulation of Na/K-
ATPase by corticosteroids, glycyrrhetinic acid and second messenger pathways in rat
kidney epithelial cells. J Mol Endocrinol 15, 93-103
66. Kolla, V., and Litwack, G. (2000) Transcriptional regulation of the human Na/K
ATPase via the human mineralocorticoid receptor. Mol Cell Biochem 204, 35-40
67. Staub, O., and Verrey, F. (2005) Impact of Nedd4 proteins and serum and
glucocorticoid-induced kinases on epithelial Na+ transport in the distal nephron. J Am
Soc Nephrol 16, 3167-3174
68. Naray-Fejes-Toth, A., Canessa, C., Cleaveland, E. S., Aldrich, G., and Fejes-Toth, G.
(1999) sgk is an aldosterone-induced kinase in the renal collecting duct. Effects on
epithelial na+ channels. J Biol Chem 274, 16973-16978
69. Naray-Fejes-Toth, A., and Fejes-Toth, G. (2000) The sgk, an aldosterone-induced
gene in mineralocorticoid target cells, regulates the epithelial sodium channel. Kidney
Int 57, 1290-1294
72
Appendix
70. Wulff, P., Vallon, V., Huang, D. Y., Volkl, H., Yu, F., Richter, K., Jansen, M.,
Schlunz, M., Klingel, K., Loffing, J., Kauselmann, G., Bosl, M. R., Lang, F., and
Kuhl, D. (2002) Impaired renal Na(+) retention in the sgk1-knockout mouse. J Clin
Invest 110, 1263-1268
71. Brennan, F. E., and Fuller, P. J. (2006) Mammalian K-ras2 is a corticosteroid-induced
gene in vivo. Endocrinology 147, 2809-2816
72. Foschi, M., Chari, S., Dunn, M. J., and Sorokin, A. (1997) Biphasic activation of
p21ras by endothelin-1 sequentially activates the ERK cascade and
phosphatidylinositol 3-kinase. Embo J 16, 6439-6451
73. Ichimura, T., Yamamura, H., Sasamoto, K., Tominaga, Y., Taoka, M., Kakiuchi, K.,
Shinkawa, T., Takahashi, N., Shimada, S., and Isobe, T. (2005) 14-3-3 proteins
modulate the expression of epithelial Na+ channels by phosphorylation-dependent
interaction with Nedd4-2 ubiquitin ligase. J Biol Chem 280, 13187-13194
74. Bhalla, V., Daidie, D., Li, H., Pao, A. C., LaGrange, L. P., Wang, J., Vandewalle, A.,
Stockand, J. D., Staub, O., and Pearce, D. (2005) Serum- and glucocorticoid-regulated
kinase 1 regulates ubiquitin ligase neural precursor cell-expressed, developmentally
down-regulated protein 4-2 by inducing interaction with 14-3-3. Mol Endocrinol 19,
3073-3084
75. Liang, X., Peters, K. W., Butterworth, M. B., and Frizzell, R. A. (2006) 14-3-3
isoforms are induced by aldosterone and participate in its regulation of epithelial
sodium channels. J Biol Chem 281, 16323-16332
76. Shi, H., Asher, C., Chigaev, A., Yung, Y., Reuveny, E., Seger, R., and Garty, H.
(2002) Interactions of beta and gamma ENaC with Nedd4 can be facilitated by an
ERK-mediated phosphorylation. J Biol Chem 277, 13539-13547
77. Spindler, B., Mastroberardino, L., Custer, M., and Verrey, F. (1997) Characterization
of early aldosterone-induced RNAs identified in A6 kidney epithelia. Pflugers Arch
434, 323-331
78. Boulkroun, S., Fay, M., Zennaro, M. C., Escoubet, B., Jaisser, F., Blot-Chabaud, M.,
Farman, N., and Courtois-Coutry, N. (2002) Characterization of rat NDRG2 (N-Myc
downstream regulated gene 2), a novel early mineralocorticoid-specific induced gene.
J Biol Chem 277, 31506-31515
79. Wielputz, M. O., Lee, I. H., Dinudom, A., Boulkroun, S., Farman, N., Cook, D. I.,
Korbmacher, C., and Rauh, R. (2007) (NDRG2) stimulates amiloride-sensitive Na+
currents in Xenopus laevis oocytes and fisher rat thyroid cells. J Biol Chem 282,
28264-28273
80. Robert-Nicoud, M., Flahaut, M., Elalouf, J. M., Nicod, M., Salinas, M., Bens, M.,
Doucet, A., Wincker, P., Artiguenave, F., Horisberger, J. D., Vandewalle, A., Rossier,
B. C., and Firsov, D. (2001) Transcriptome of a mouse kidney cortical collecting duct
cell line: effects of aldosterone and vasopressin. Proc Natl Acad Sci U S A 98, 2712-
2716
81. Ayroldi, E., Zollo, O., Macchiarulo, A., Di Marco, B., Marchetti, C., and Riccardi, C.
(2002) Glucocorticoid-induced leucine zipper inhibits the Raf-extracellular signal-
regulated kinase pathway by binding to Raf-1. Mol Cell Biol 22, 7929-7941
82. Soundararajan, R., Zhang, T. T., Wang, J., Vandewalle, A., and Pearce, D. (2005) A
novel role for glucocorticoid-induced leucine zipper protein in epithelial sodium
channel-mediated sodium transport. J Biol Chem 280, 39970-39981
83. Soundararajan, R., Melters, D., Shih, I. C., Wang, J., and Pearce, D. (2009) Epithelial
sodium channel regulated by differential composition of a signaling complex. Proc
Natl Acad Sci U S A
73
Appendix
84. Beguin, P., Crambert, G., Guennoun, S., Garty, H., Horisberger, J. D., and Geering, K.
(2001) CHIF, a member of the FXYD protein family, is a regulator of Na,K-ATPase
distinct from the gamma-subunit. Embo J 20, 3993-4002
85. Brennan, F. E., and Fuller, P. J. (1999) Acute regulation by corticosteroids of channel-
inducing factor gene messenger ribonucleic acid in the distal colon. Endocrinology
140, 1213-1218
86. Capurro, C., Coutry, N., Bonvalet, J. P., Escoubet, B., Garty, H., and Farman, N.
(1996) Cellular localization and regulation of CHIF in kidney and colon. Am J Physiol
271, C753-762
87. Wald, H., Goldstein, O., Asher, C., Yagil, Y., and Garty, H. (1996) Aldosterone
induction and epithelial distribution of CHIF. Am J Physiol 271, F322-329
88. Gomez-Sanchez, C. E., de Rodriguez, A. F., Romero, D. G., Estess, J., Warden, M. P.,
Gomez-Sanchez, M. T., and Gomez-Sanchez, E. P. (2006) Development of a panel of
monoclonal antibodies against the mineralocorticoid receptor. Endocrinology 147,
1343-1348
89. Livak, K. J., and Schmittgen, T. D. (2001) Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25,
402-408
90. Pfaffl, M. W. (2001) A new mathematical model for relative quantification in real-
time RT-PCR. Nucleic Acids Res 29, e45
91. Ouvrard-Pascaud, A., Sainte-Marie, Y., Benitah, J. P., Perrier, R., Soukaseum, C., Cat,
A. N., Royer, A., Le Quang, K., Charpentier, F., Demolombe, S., Mechta-Grigoriou,
F., Beggah, A. T., Maison-Blanche, P., Oblin, M. E., Delcayre, C., Fishman, G. I.,
Farman, N., Escoubet, B., and Jaisser, F. (2005) Conditional mineralocorticoid
receptor expression in the heart leads to life-threatening arrhythmias. Circulation 111,
3025-3033
92. Technologies, L. GATEWAY Cloning Technology Instruction Manual Version 1
93. Invitrogen (2003) Gateway® LR ClonaseTM Enzyme Mix; Catalog no. 11791-019
94. Invitrogen (2008) RNAi Designer Online Platform
https://rnaidesigner.invitrogen.com/rnaiexpress/setOption.do?designOption=shrna
95. Invitrogen (2007) BLOCK-iTTMU6 RNAi Entry Vector Kit Catalog nos. K4944-00
and K4945-00.
96. Nelson, J. D., Denisenko, O., and Bomsztyk, K. (2006) Protocol for the fast chromatin
immunoprecipitation (ChIP) method. Nat Protoc 1, 179-185
97. Benjamini, Y., Drai, D., Elmer, G., Kafkafi, N., and Golani, I. (2001) Controlling the
false discovery rate in behavior genetics research. Behav Brain Res 125, 279-284
98. Fuhrmann, U., Slater, E. P., and Fritzemeier, K. H. (1995) Characterization of the
novel progestin gestodene by receptor binding studies and transactivation assays.
Contraception 51, 45-52
99. Invitrogen (2006) ViraPower™ Lentiviral Expression Systems.
100. Invitrogen (2002) Flp-InTM System For Generating Stable Mammalian Expression Cell
Lines by Flp Recombinase-Mediated Integration; Catalog nos. K6010-01, K6010-02.
101. Fromm, M., Schulzke, J. D., and Hegel, U. (1993) Control of electrogenic Na+
absorption in rat late distal colon by nanomolar aldosterone added in vitro. Am J
Physiol 264, E68-73
102. Farman, N., Vandewalle, A., and Bonvalet, J. P. (1983) Autoradiographic
determination of dexamethasone binding sites along the rabbit nephron. Am J Physiol
244, F325-334
103. Tian, L., Hammond, M. S., Florance, H., Antoni, F. A., and Shipston, M. J. (2001)
Alternative splicing determines sensitivity of murine calcium-activated potassium
channels to glucocorticoids. J Physiol 537, 57-68
74
Appendix
104. Oakley, R. H., Webster, J. C., Sar, M., Parker, C. R., Jr., and Cidlowski, J. A. (1997)
Expression and subcellular distribution of the beta-isoform of the human
glucocorticoid receptor. Endocrinology 138, 5028-5038
105. Naray-Fejes-Toth, A., Rusvai, E., and Fejes-Toth, G. (1994) Minealocorticoid
receptors and 11 beta-steroid dehydrogenase activity in renal principal and intercalated
cells. Am J Physiol 266, F76-80
106. Chen, S. Y., Bhargava, A., Mastroberardino, L., Meijer, O. C., Wang, J., Buse, P.,
Firestone, G. L., Verrey, F., and Pearce, D. (1999) Epithelial sodium channel regulated
by aldosterone-induced protein sgk. Proc Natl Acad Sci U S A 96, 2514-2519
107. Tanaka, K., Ashizawa, N., Kawano, H., Sato, O., Seto, S., Nishihara, E., Terazono, H.,
Isomoto, S., Shinohara, K., and Yano, K. (2007) Aldosterone induces circadian gene
expression of clock genes in H9c2 cardiomyoblasts. Heart Vessels 22, 254-260
108. Naray-Fejes-Toth, A., Boyd, C., and Fejes-Toth, G. (2008) Regulation of epithelial
sodium transport by promyelocytic leukemia zinc finger protein. Am J Physiol Renal
Physiol 295, F18-26
109. Gumz, M. L., Popp, M. P., Wingo, C. S., and Cain, B. D. (2003) Early transcriptional
effects of aldosterone in a mouse inner medullary collecting duct cell line. Am J
Physiol Renal Physiol 285, F664-673
110. Fejes-Toth, G., and Naray-Fejes-Toth, A. (2007) Early aldosterone-regulated genes in
cardiomyocytes: clues to cardiac remodeling? Endocrinology 148, 1502-1510
111. Gumz, M. L., Stow, L. R., Lynch, I. J., Greenlee, M. M., Rudin, A., Cain, B. D.,
Weaver, D. R., and Wingo, C. S. (2009) The circadian clock protein Period 1 regulates
expression of the renal epithelial sodium channel in mice. J Clin Invest 119, 2423-
2434
112. Fuller, P. J., and Young, M. J. (2005) Mechanisms of mineralocorticoid action.
Hypertension 46, 1227-1235
113. Hanlon, S. E., and Lieb, J. D. (2004) Progress and challenges in profiling the
dynamics of chromatin and transcription factor binding with DNA microarrays. Curr
Opin Genet Dev 14, 697-705
114. Irlbacher, H., Ziera, T., Sommer, A., Weiss, B., and Borden, S. A. (2009) Genome-
wide promoter localization of the mineralocorticoid receptor. manuscript in
preparation
115. Itani, O. A., Liu, K. Z., Cornish, K. L., Campbell, J. R., and Thomas, C. P. (2002)
Glucocorticoids stimulate human sgk1 gene expression by activation of a GRE in its
5'-flanking region. Am J Physiol Endocrinol Metab 283, E971-979
116. Wang, J. C., Derynck, M. K., Nonaka, D. F., Khodabakhsh, D. B., Haqq, C., and
Yamamoto, K. R. (2004) Chromatin immunoprecipitation (ChIP) scanning identifies
primary glucocorticoid receptor target genes. Proc Natl Acad Sci U S A 101, 15603-
15608
117. Genomatix Software GmBH Munich, G. (2008) www.genomatix.de.
118. Nakhoul, N. L., Hering-Smith, K. S., Gambala, C. T., and Hamm, L. L. (1998)
Regulation of sodium transport in M-1 cells. Am J Physiol 275, F998-F1007
119. Naray-Fejes-Toth, A., Snyder, P. M., and Fejes-Toth, G. (2004) The kidney-specific
WNK1 isoform is induced by aldosterone and stimulates epithelial sodium channel-
mediated Na+ transport. Proc Natl Acad Sci U S A 101, 17434-17439
120. Zentner, M. D., Lin, H. H., Wen, X., Kim, K. J., and Ann, D. K. (1998) The amiloride-
sensitive epithelial sodium channel alpha-subunit is transcriptionally down-regulated
in rat parotid cells by the extracellular signal-regulated protein kinase pathway. J Biol
Chem 273, 30770-30776
75
Appendix
121. Lanigan, T. M., Liu, A., Huang, Y. Z., Mei, L., Margolis, B., and Guan, K. L. (2003)
Human homologue of Drosophila CNK interacts with Ras effector proteins Raf and
Rlf. Faseb J 17, 2048-2060
122. Jaffe, A. B., Aspenstrom, P., and Hall, A. (2004) Human CNK1 acts as a scaffold
protein, linking Rho and Ras signal transduction pathways. Mol Cell Biol 24, 1736-
1746
123. Kolch, W. (2005) Coordinating ERK/MAPK signalling through scaffolds and
inhibitors. Nat Rev Mol Cell Biol 6, 827-837
124. Webster, M. K., Goya, L., Ge, Y., Maiyar, A. C., and Firestone, G. L. (1993)
Characterization of sgk, a novel member of the serine/threonine protein kinase gene
family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol
13, 2031-2040
125. D'Adamio, F., Zollo, O., Moraca, R., Ayroldi, E., Bruscoli, S., Bartoli, A., Cannarile,
L., Migliorati, G., and Riccardi, C. (1997) A new dexamethasone-induced gene of the
leucine zipper family protects T lymphocytes from TCR/CD3-activated cell death.
Immunity 7, 803-812
126. Muller, O., Pradervand, S., Berger, S., Centeno, G., Milet, A., Nicod, P., Pedrazzini,
T., Tronche, F., Schutz, G., Chien, K., Rossier, B. C., and Firsov, D. (2007)
Identification of corticosteroid-regulated genes in cardiomyocytes by serial analysis of
gene expression. Genomics 89, 370-377
127. Kellner, M., Peiter, A., Hafner, M., Feuring, M., Christ, M., Wehling, M., Falkenstein,
E., and Losel, R. (2003) Early aldosterone up-regulated genes: new pathways for renal
disease? Kidney Int 64, 1199-1207
128. Gross, K. L., and Cidlowski, J. A. (2008) Tissue-specific glucocorticoid action: a
family affair. Trends Endocrinol Metab 19, 331-339
129. Graham, F. L., Smiley, J., Russell, W. C., and Nairn, R. (1977) Characteristics of a
human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36,
59-74
130. Shaw, G., Morse, S., Ararat, M., and Graham, F. L. (2002) Preferential transformation
of human neuronal cells by human adenoviruses and the origin of HEK 293 cells.
Faseb J 16, 869-871
131. Muller, O. G., Parnova, R. G., Centeno, G., Rossier, B. C., Firsov, D., and
Horisberger, J. D. (2003) Mineralocorticoid effects in the kidney: correlation between
alphaENaC, GILZ, and Sgk-1 mRNA expression and urinary excretion of Na+ and
K+. J Am Soc Nephrol 14, 1107-1115
132. Kobayashi, A., Sogawa, K., Imataka, H., and Fujii-Kuriyama, Y. (1995) Analysis of
functional domains of a GC box-binding protein, BTEB. J Biochem 117, 91-95
133. Bonett, R. M., Hu, F., Bagamasbad, P., and Denver, R. J. (2009) Stressor and
glucocorticoid-dependent induction of the immediate early gene kruppel-like factor 9:
implications for neural development and plasticity. Endocrinology 150, 1757-1765
134. Carroll, J. S., Meyer, C. A., Song, J., Li, W., Geistlinger, T. R., Eeckhoute, J.,
Brodsky, A. S., Keeton, E. K., Fertuck, K. C., Hall, G. F., Wang, Q., Bekiranov, S.,
Sementchenko, V., Fox, E. A., Silver, P. A., Gingeras, T. R., Liu, X. S., and Brown,
M. (2006) Genome-wide analysis of estrogen receptor binding sites. Nat Genet 38,
1289-1297
135. Bolton, E. C., So, A. Y., Chaivorapol, C., Haqq, C. M., Li, H., and Yamamoto, K. R.
(2007) Cell- and gene-specific regulation of primary target genes by the androgen
receptor. Genes Dev 21, 2005-2017
136. Luecke, H. F., and Yamamoto, K. R. (2005) The glucocorticoid receptor blocks P-
TEFb recruitment by NFkappaB to effect promoter-specific transcriptional repression.
Genes Dev 19, 1116-1127
76
Appendix
137. McDonnell, D. (2009) Gene Regulation by Androgen Receptor Coregulators. ENDO
2009 Washington DC, USA SYMPOSIUM SESSION: BASIC - On Again, Off Again:
Coregulators & Gene Expression
138. Spilianakis, C. G., Lalioti, M. D., Town, T., Lee, G. R., and Flavell, R. A. (2005)
Interchromosomal associations between alternatively expressed loci. Nature 435, 637-
645
139. Jiang, F., and Wang, Z. (2004) Identification and characterization of PLZF as a
prostatic androgen-responsive gene. Prostate 59, 426-435
140. Loffing, J., Zecevic, M., Feraille, E., Kaissling, B., Asher, C., Rossier, B. C.,
Firestone, G. L., Pearce, D., and Verrey, F. (2001) Aldosterone induces rapid apical
translocation of ENaC in early portion of renal collecting system: possible role of
SGK. Am J Physiol Renal Physiol 280, F675-682
141. Therrien, M., Wong, A. M., and Rubin, G. M. (1998) CNK, a RAF-binding
multidomain protein required for RAS signaling. Cell 95, 343-353
142. Rocheleau, C. E., Ronnlund, A., Tuck, S., and Sundaram, M. V. (2005)
Caenorhabditis elegans CNK-1 promotes Raf activation but is not essential for
Ras/Raf signaling. Proc Natl Acad Sci U S A 102, 11757-11762
143. Claperon, A., and Therrien, M. (2007) KSR and CNK: two scaffolds regulating RAS-
mediated RAF activation. Oncogene 26, 3143-3158
144. Ziogas, A., Moelling, K., and Radziwill, G. (2005) CNK1 is a scaffold protein that
regulates Src-mediated Raf-1 activation. J Biol Chem 280, 24205-24211
145. Jaffe, A. B., Hall, A., and Schmidt, A. (2005) Association of CNK1 with Rho guanine
nucleotide exchange factors controls signaling specificity downstream of Rho. Curr
Biol 15, 405-412
146. Casar, B., Arozarena, I., Sanz-Moreno, V., Pinto, A., Agudo-Ibanez, L., Marais, R.,
Lewis, R. E., Berciano, M. T., and Crespo, P. (2009) Ras subcellular localization
defines extracellular signal-regulated kinase 1 and 2 substrate specificity through
distinct utilization of scaffold proteins. Mol Cell Biol 29, 1338-1353
77
Appendix
6. Appendix
6.1. Experimental flow-chart
Experimental set-up for the identification of direct MR target genes and for the
functional characterization of CNKSR3 in the mechanism of transepithelial sodium
transport; Orange boxes indicate novel established cell clones; Grey boxes indicate the
experimental purpose; applied experimental techniques are highlighted in blue; Results are
framed in green
Appendix
6.2. Abbreviations
11β-HSD2 11β-hydroxysteroid dehydrogenase type 2
A6 Xenopus leavis oocytes
AF transactivating function
AR androgen receptor
ASDN aldosterone-sensitive distal nephron
ATP adenosinetriphosphate
c centi
CCD cortical collecting duct
cDNA copy DNA
CDS coding sequence
CHIF channel inducing factor
ChIP chromatin immunoprecipitation
CNK connector enhancer of KSR
CNKSR3 connector enhancer of kinase suppressor of Ras
CNT connecting tubule
cRNA copy RNA
°C degree celcius
DBD DNA binding domain
DCT distal convoluted tubule
DNA desoxyribonucleic acid
ENaC epithelial sodium channel
ERK1/2 extracellular signal-regulated kinase
EtBr ethidium bromide
EtOH ethanol
FBS fetal bovine serum
g gram
GILZ glucocorticoid-induced leucine zipper
GR glucocorticoid receptor
GRE glucocorticoid response element
h hour
HEK293 human embryonic kidney cell line
HRE hormone response element
KSR kinase suppressor of Ras
l liter
LBD ligand binding domain
m milli
M molar (mol/l)
M-1 mouse CCD derived cell line
MDCK madin-darby canine kidney cells
MEK1/2 mitogen-activated protein kinase kinase
min minutes
MR mineralocorticoid receptor
mRNA messenger RNA
µ micro
79
Appendix
n nano
Na-K-ATP sodium potassium adenosinetriphosphatase
Nedd4 neural precursor cell expressed, developmentally down-regulated 4
NTD N-terminal domain
p plasmid
PBS phosphate buffered saline
PCR polymerase chain reaction
PCT proximal convoluted tubule
PDK1 pyruvate dehydrogenase kinase, isozyme 1
PI3K phosphatidylinositol 3-kinase
PIC preinitiation complex
PLZF promyolotic leucin zink finger
PR progesterone receptor
qPCR quantitative PCR
r rat
RAF1 v-raf-1 murine leukemia viral oncogene homolog 1
RNA ribonucleic acid
RNAi RNA interference
RT room temperature
RTPCR reverse transcription PCR
SDS sodium dodycyl sulfate
sec seconds
SGK serum and glucocorticoid-induced kinase
shRNA short hairpin RNA
t time
TAF TBP associated factors
TBP TATA-Box binding protein
TBS tris buffered saline
TD-PCR touch down PCR
TSS transcription start site
80
Appendix
6.3. List of Figures and Tables
Figure 1.1 Schematic representation of the NR3C2 gene ........................................... 9
Figure 1.2 Inactivation of cortisol by the 11-βHSD2 .................................................. 11
Figure 1.3 Co-regulator recruitment by MR ................................................................ 13
Figure 1.4 Schematic depiction of aldosterone-regulated ENaC activity
in an epithelial cell ..................................................................................... 17
Figure 3.1 Selection of HEK293 clones stably expressing the
mineralocorticoid receptor ......................................................................... 37
Figure 3.2 Genotyping analysis of HEK293-hMR+ cells ............................................ 38
Figure 3.3 Characterization of HEK293-hMR+ and HEK293-control cells ................ 40
Figure 3.4 Volcano plot of identified genes. ............................................................... 42
Figure 3.5 Identification of aldosterone-responsive genes .......................................... 43
Figure 3.6 Characterization of HEK293-myc-MR+ cells ............................................ 46
Figure 3.7 Aldosterone-induced MR occupancy in the promoter of
aldosterone-responsive genes ..................................................................... 47
Figure 3.8 MR-specific transactivation response ........................................................ 48
Figure 3.9 Analysis of MR binding regions in the promoters of
aldosterone-regulated genes ....................................................................... 49
Figure 3.10 Characterization of MR binding sites within the cnksr3 -4 kb
promoter region .......................................................................................... 51
Figure 3.11 Aldosterone-induced expression of CNKSR3 ............................................ 53
Figure 3.12 In vivo expression pattern of CNKSR3 ...................................................... 55
Figure 3.13 The rat MR regulates endogenous target genes in M1 cells ...................... 56
Figure 3.14 Electrophysiological characterization of M1-rMR+ cells
in Ussing chamber experiments ................................................................. 57
Figure 3.15 Characterization of different M1-rMR+ cell clones stably
overexpressing or silencing CNKSR3 ....................................................... 58
Figure 3.16 Impact of CNKSR3 on MR-mediated ENaC-controlled Na+ transport .... 59
Figure 3.17 CNKSR3 prevents phosphorylation of MEK1/2 and ERK1/2 .................. 60
Figure 4.1 The possible function of CNKSR3 in the mechanism of ENaC regulation 67
Table 2.1 Oligonucleotides ........................................................................................ 20
Table 2.2 Primary antibodies ..................................................................................... 24
Table 2.3 HRP-labeled secondary antibodies ............................................................ 24
Table 2.4 shRNAs targeting CNKSR3 ...................................................................... 29
Table 3.1 Summary of gene ontology categories ...................................................... 44
81
Appendix
6.4. Publications and Awards
Publications
Ziera, T., Irlbacher, H., Fromm, A., Latouche, C., Krug, S. M., Fromm, M., Jaisser, F., and
Borden, S. A. (2009) Cnksr3 is a direct mineralocorticoid receptor target gene and plays a key
role in the regulation of the epithelial sodium channel. The FASEB Journal
Irlbacher, H.*, Ziera, T.*, Sommer, A., Weiss, B., and Borden, S. A. (2009) Genome-wide
promoter localization of the mineralocorticoid receptor. Manuscript in preparation
*shared first-authorship
Poster presentations
Tim Ziera, Horst Irlbacher, Steffen Borden (2008) Specific Gene Regulation by the
Mineralocorticoid Receptor, 34th Annual Meeting of the International Aldosterone
Conference, 2008, San Francisco, USA
Tim Ziera, Horst Irlbacher, Steffen Borden (2008) Specific Gene Regulation by the
Mineralocorticoid Receptor, 90th ENDO Annual Meeting, 2008, San Francisco, USA
Tim Ziera, Horst Irlbacher, Michael Fromm, Steffen Borden, (2008) The aldosterone
signature: Identification and functional characterization of a novel mineralocorticoid receptor
target gene, Bayer Schering Pharma Young Scientist Postersession, 2008, Berlin, Germany
Horst Irlbacher, Tim Ziera, Bertram Weiss, Anette Sommer, Steffen Borden (2008) Genome-
wide promoter localization of the Mineralocorticoid Receptor, 90th ENDO Annual Meeting,
2008, San Francisco, USA
Horst Irlbacher, Tim Ziera, Bertram Weiss, Anette Sommer, Steffen Borden (2008) Genome-
wide promoter localization of the Mineralocorticoid Receptor, Keystone Conference Steroid
Sisters, 2008, Whistler, Canada
Sebastian Mendyk, Tim Ziera*, Steffen Borden (2008) Generation of a Mineralocorticoid
Receptor Screening Cell Line, Bayer Schering Pharma Young Scientist Postersession, 2008,
Berlin, Germany
Awards
Bayer Schering Pharma Young Scientist Competition, 2008, Berlin, Germany
First place winner of the Young Investigator Competition at the 35th Annual Meeting of the
International Aldosterone Conference, 2009, Washington DC, USA – Oral presentation
82
Appendix
6.5. Acknowledgements
Diese Arbeit wurde in der Bayer Schering Pharma AG in der Arbeitsgruppe von
Dr. Steffen Borden in der Zeit von April 2006 bis August 2009 angefertigt. Mein Dank gilt
Prof. Dr. Ursula Habenicht und Dr. Karl-Heinrich Fritzemeier die mir das Anfertigen dieser
Arbeit in der Abteilung Women's Health ermöglicht haben, sowie die Teilnahme an
internationalen Konferenzen unterstützt haben.
Meinen Gutachtern Prof. Dr. Roland Lauster, PD Dr. Katja Prelle und Prof. Dr. L.-A.
Garbe danke ich für ihre Hilfsbereitschaft sowie für die stets freundliche und angenehme
Gesprächsatmosphäre.
Mein ganz besonderer Dank gilt Dr. Steffen Borden für die zahlreichen Diskussionen, das
“challenging Feedback”, den Support über all die Jahre und vor allem für die
freundschaftliche Arbeitsatmosphäre. Es hat einfach Spaß gemacht!
Meinem Laborkollegen Dr. Horst Irlbacher danke ich die vielen Diskussionen die gute
und produktive Zusammenarbeit, sowie für die freundschaftliche Stimmung im Labor.
Den Studenten Sebastian Mendyk und besonders Hans-Hermann Wessels danke ich für
ihre Unterstützung und Vitalität im Labor.
Dr. Dr. Florian Prinz danke ich für die gute Zusammenarbeit und den Support mit
lentiviralen Konstrukten.
Dr. Florian Sohler danke ich für die statistische Auswertung der Microarrayergebnisse
sowie für seine stete Hilfsbereitschaft.
Den Kooperationspartnern Prof. Dr. Michael Fromm und Dr. Frederic Jaisser sowie ihren
Arbeitsgruppen möchte ich für die sehr gute Zusammenarbeit und hilfreichen Diskussionen
danken.
Anja Fromm danke ich für zahlreiche elektrophysiologische Messungen.
Für kritische Anmerkungen und Feedback danke ich Dr. Peter Muhn.
Weiter möchte ich mich bei allen Mitarbeitern und Mitarbeiterinnen der Abteilung
Women's Health bedanken, die auf die eine oder andere Art zum Gelingen dieser Arbeit
beigetragen haben, ohne dass ich alle persönlich nennen kann.
Meiner Familie danke ich ganz besonders für die stete Unterstützung und das in mich
gesetzte Vertrauen und natürlich nicht nur dafür…
83
Appendix
6.6. Curriculum vitae
Persönliche Daten
Name Tim Ziera
Geburtsdatum 28.04.1976
Geburtsort Hamburg
Dissertation
03/ 2006 – 10/ 2009 Bayer Schering Pharma AG, Berlin, Therapeutic Research
Women’s Health, AG Dr. Steffen Borden
Hochschulausbildung
02/ 2006 Diplom-Ingenieur - Schwerpunkt Medizinische Biotechnologie
WS 1998/ 1999 Biotechnologie an der Technischen Universität Berlin
WS 1997 – SS 1998 Wirtschaftsingenieurwesen an der Universität Bremen
Schulausbildung
06/ 1997 Abitur
1986 – 1997 Gymnasium in Jaderberg
1983 – 1986 Grundschule in Oldenburg
84