Neuza Carvalho, Thomas Jorgensen, Mark Arentshorst, Benjamin Nitsche, Cees
van den Hondel, David Archer, Arthur Ram
Suggested Citation
Carvalho, Neuza ; Jorgensen, Thomas ; Arentshorst, Mark ; Nitsche, Benjamin ; van den Hondel, Cees ; Archer,
David ; Ram, Arthur: Genome-wide expression analysis upon constitutive activation of the HacA bZIP
transcription factor in Aspergillus niger reveals a coordinated cellular response to counteract ER stress. - In:
BMC Genomics. - ISSN 1471-2164 (online). - 13 (2012), art. 350. - doi:10.1186/1471-2164-13-350.
Terms of Use
This work is licensed under a CC BY 2.0 License (Creative
Commons Attribution 2.0 Generic). For more information see
http://creativecommons.org/licenses/by/2.0.
Powered by TCPDF (www.tcpdf.org)
Article, Published version
This version is available at http://nbn-resolving.de/urn:nbn:de:kobv:83-opus4-67698.
Genome-wide expression analysis upon constitutive
activation of the HacA bZIP transcription factor in
Aspergillus niger reveals a coordinated cellular response
to counteract ER stress
RESEARCH ARTICLE Open Access
Genome-wide expression analysis upon
constitutive activation of the HacA bZIP
transcription factor in Aspergillus niger reveals
a coordinated cellular response to counteract
ER stress
Neuza DSP Carvalho
1,2
, Thomas R Jørgensen
1,2,4
, Mark Arentshorst
1
, Benjamin M Nitsche
1,5
,
Cees AMJJ van den Hondel
1,2
, David B Archer
3
and Arthur FJ Ram
1,2*
Abstract
Background: HacA/Xbp1 is a conserved bZIP transcription factor in eukaryotic cells which regulates gene
expression in response to various forms of secretion stress and as part of secretory cell differentiation. In the
present study, we replaced the endogenous hacA gene of an Aspergillus niger strain with a gene encoding a
constitutively active form of the HacA transcription factor (HacA
CA
). The impact of constitutive HacA activity
during exponential growth was explored in bioreactor controlled cultures using transcriptomic analysis to
identify affected genes and processes.
Results: Transcription profiles for the wild-type strain (HacA
WT
) and the HacA
CA
strain were obtained using
Affymetrix GeneChip analysis of three replicate batch cultures of each strain. In addition to the well known HacA
targets such as the ER resident foldases and chaperones, GO enrichment analysis revealed up-regulation of genes
involved in protein glycosylation, phospholipid biosynthesis, intracellular protein transport, exocytosis and protein
complex assembly in the HacA
CA
mutant. Biological processes over-represented in the down-regulated genes
include those belonging to central metabolic pathways, translation and transcription. A remarkable transcriptional
response in the HacA
CA
strain was the down-regulation of the AmyR transcription factor and its target genes.
Conclusions: The results indicate that the constitutive activation of the HacA leads to a coordinated regulation
of the folding and secretion capacity of the cell, but with consequences on growth and fungal physiology to
reduce secretion stress.
Keywords: HacA, Unfolded protein response, Secretion stress, RESS, XBP1, Aspergillus niger, Protein secretion
Background
The secretion of extracellular proteins is very important
to the natural saprophytic lifestyle of Aspergillus niger.
The inherent ability of efficient protein secretion, found
among several Aspergillus species such as A. niger and
A. oryzae, has led to their biotechnological exploitation
as hosts for homologous and heterologous protein pro-
duction [1-5]. As protein yields for heterologous pro-
teins are often reported as low, efforts have been made
in order to describe and understand the processes that
limit their secretion [6,7], as well as efforts to prevent
proteolytic activity outside the cell [4,8,9].
Secretory proteins begin their journey by entering the
endoplasmic reticulum (ER) where they are assembled,
folded and modified. Then, they are packed into COPII
coated vesicles and transported into the Golgi-like struc-
tures where further modifications take place. Proteins
1
Institute of Biology Leiden, Leiden University, Molecular Microbiology and
Biotechnology, Sylviusweg 72, 2333 BE Leiden, The Netherlands
2
Kluyver Centre for Genomics of Industrial Fermentation, P.O box 5057, 2600
GA Delft, The Netherlands
Full list of author information is available at the end of the article
© 2012 Carvalho et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Carvalho et al. BMC Genomics 2012, 13:350
http://www.biomedcentral.com/1471-2164/13/350
destined for secretion are packed into secretory vesicles
to be transported to the tip of the growing hyphae,
where the proteins are released extracellularly [6,10,11].
Among the factors that disturb efficient secretion of
heterologous proteins is the mis-folding of these pro-
teins in the ER and the consequence that those proteins
are recognized as mis-folded by the Quality Control
system present in the ER [12,13]. The presence or accu-
mulation of aberrant proteins in the ER may become
fatal to the cell and to deal with the presence of mis-
folded proteins in the ER, eukaryotic cells react with the
expression of several genes related to protein folding
and degradation, a response termed the Unfolded Pro-
tein Response (UPR) [14]. The basic sensing pathway to
detect ER stress or an increase in folding load is highly
conserved from yeast to man. In Saccharomyces cerevi-
siae, the sensor protein is Ire1p which is an ER-resident
trans-membrane protein that contains a luminal domain
that functions as the sensor of the folded state of
the proteins, and has a site-specific endoribonuclease
(RNase) domain at the cytoplasmic C-terminus [15,16].
The accumulation of unfolded proteins is sensed through
a dynamic interaction between Ire1p and the chaperone
Kar2p (also known as Binding Protein - BiP) [17,18] or
by direct sensing by Ire1p [19]. As BiP/Kar2p is recruited
to help with the folding of the ER accumulating proteins,
its release from Ire1p leads to the oligomerization of
Ire1p proteins. In turn, the formed Ire1p oligomer is
activated by autophosphorylation and the RNase domain
is responsible for the splicing of a 252 nt intron present
in mRNA of the bZIP transcription factor Hac1p (HacA
in filamentous fungi and XBP-1 in the mammalian sys-
tem), a process well characterized in fungi [20-22] and
higher eukaryotes [23-26]. Alternatively, from the known
structures of the yeast and human lumenal and cytoplas-
mic domains of Ire1p, a model for direct binding of Ire1p
to unfolded proteins has been postulated that leads to
structural changes in Ire1p, oligomerization and activa-
tion of the kinase and endoribonuclease domains
[16,18,27,28]. In A. niger, the hacA mRNA splicing event
results in the excision of a 20 nt intron [29], releasing it
from a translational block [30]. Although it has not yet
been shown in the S. cerevisiae or mammalian homolo-
gues, in addition to the intron splicing, the hacA mRNA
of A. niger,Aspergillus nidulans and Trichoderma reesei
is truncated at the 5’-end during UPR induction [31,32].
However, Mulder and Nikolaev [30] showed that in
A. niger truncation of hacA is not a requirement for
induction of the pathway. Once translated, HacA mig-
rates into the nucleus where it binds to palindromic UPR
elements at the promoter regions of UPR targets [32].
Transcriptome analysis under UPR inducing conditions
in both fungi and mammalian cells has revealed the
induced expression of subsets of genes involved in
folding, secretion, phospholipid biosynthesis and protein
degradation [14,33-35]. Most of the UPR studies per-
formed have induced this pathway through the presence
of harsh chemicals (DTT or tunicamycin), which by itself
may impose collateral responses that might provoke ER
stress, and by expressing heterologous proteins such as
tPA and chymosin [35-37]. However, a recent study has
illustrated that the induction of UPR-target genes may
not be a stress response only induced by the presence of
mis-folded proteins, but may represent a more physiolo-
gically natural mechanism required and induced under
conditions where there is a demand for an increased
secretion capacity [38].
Manipulation of the UPR pathway and its components,
like BiP1 and PDI [39-41], has been a common approach
to improve the secreted production of heterologous pro-
teins. Valkonen et al. [42] have shown, in S. cerevisiae,
that controlling Hac1p expression has effects on native
and foreign protein production; hac1 deletion led to a
decrease of heterologous α-amylase and endoglucanase
production whereas overexpression of this transcription
factor resulted in an increase in the production of these
proteins when compared to the respective parental
strains. Similar results have been demonstrated in A.
niger var awamori, where a constitutive induction of the
UPR pathway enhanced the production of heterologous
laccase and of bovine preprochymosin [43]. The UPR is
activated to alleviate the stress caused by the accumula-
tion of mis-folded protein in the ER lumen by improving
protein folding, degrading unwanted proteins [14,37]
and reducing the entry of secretory proteins into the ER,
a mechanism known as REpression under Secretion
Stress (RESS) [44]. Studies have shown that there is a
selective down-regulation of genes coding extracellular
enzymes in the presence of chemicals which inhibit
protein folding [44-46].
In this study, we present a genome-wide overview of
the HacA responsive genes by comparing the transcrip-
tomic profiles of two genetically engineered A. niger
strains expressing either the wild-type hacA gene or the
active form of the HacA transcription factor. The com-
parison suggests HacA as a master regulator, coordinat-
ing several processes within the secretory pathway such
as the induction of protein folding, protein glycosylation
and intracellular transport. Additionally, we discovered
that constitutive activation of HacA results in the down
regulation of the AmyR transcription factor and the
AmyR regulon, which includes the most abundantly
produced extracellular glycoproteins, thereby reducing
import of new proteins into the ER. The down-
regulation of the AmyR regulon revealed by the genome
wide expression analysis was phenotypically confirmed
as the HacA
CA
mutant displayed a strongly reduced
growth phenotype on starch plates.
Carvalho et al. BMC Genomics 2012, 13:350 Page 2 of 17
http://www.biomedcentral.com/1471-2164/13/350
Results
Construction and analysis of a strain expressing a
constitutively activated form of hacA
To obtain an A. niger strain with a constitutively acti-
vated HacA (HacA
CA
) transcription factor, the wild-type
hacA gene was replaced by the spliced form of hacA that
lacks the 20 nucleotide intron. For the construction of a
reference strain and a strain only expressing the hacA
induced form, plasmids pHacWT and pHacCA were
used [Additional file 1 (A and B)]. Transformants with
the correct integration pattern for each plasmid were
selected after Southern blot analysis (data not shown)
and the absence of the intron was confirmed in the
HacA
CA
strain [Additional file 1 (C and D)]. Growth
assays were performed with both strains at different
temperatures (Figure 1A and B). At each temperature
tested, radial growth rate (colony size) of the HacA
CA
strain was reduced compared to the HacA
WT
strain, and
this growth impairment was more pronounced at 37 and
42 °C (Figure 1A). Differences in phenotype between
both strains were also apparent as HacA
CA
showed a
delay in growth and conidiation in comparison to
HacA
WT
(Figure 1B). As no phenotypic differences were
found between our reference strain HacA
WT
and N402
(data not shown), we conclude that the phenotypic
effects observed in HacA
CA
are due to the presence of
only the UPR-induced form of hacA. The effects of
having a constitutive activation of the UPR are different
from the absence of a functional UPR. The deletion of
the HacA transcription factor in A. niger has a profound
effect on growth and morphology of the fungus, result-
ing in smaller and more compact colonies that hardly
form conidia [30,47].
Physiological consequences of the constitutive hacA
activation in batch cultivations
Growth of batch cultures of the A. niger HacA
WT
and
HacA
CA
strains was characterized as filamentous and
highly reproducible. The growth kinetics of a representa-
tive culture of each strain is shown in Figure 2 and
results from all cultures are given in the supplemental
material [Additional file 2]. Cultures of the HacA
WT
strain exhibited exponential growth with a specific
growth rate (μ) of 0.22 ±0.01 h-1 (n = 4) from exit of lag
phase to depletion of glucose (Figure 2A). Initial growth
of HacA
CA
was similar to that of the HacA
WT
;itwas
exponential with a μof 0.21 ±0.01 h-1 (n = 3). How-
ever, after 21–22 h of batch cultivation, when half of
the glucose was consumed, the growth kinetics shifted
from exponential to apparently linear (Figure 2B). It was
not clear from the relatively few determinations of bio-
mass concentration whether growth was truly linear in
the second phase but this was strongly supported by
analysis of the growth-dependent alkali addition (inset
Figure 2A, B). We established a concordance between
growth and alkali added to maintain constant pH in the
cultures (not shown), and used this as an indirect meas-
ure of growth as described previously by Iversen et al.
[48]. Linearity was then confirmed by log-transformation
of alkali addition rates using the computer recorded
Figure 1 Growth and phenotypic profiles of HacA
WT
and HacA
CA
strains. (A) Differences on colony size (diameter) of HacA
WT
and HacA
CA
strains growing at different temperatures. 10
4
spores were spotted on solid CM plates and growth was monitored for 6 days. (B) Strains
phenotype on CM after 3 and 6 days of growth at 30 °C. HacA
CA
phenotype is characterized by a slower growth/colony size as well as a delay
in sporulation compared to the HacA
WT
. Bars indicate standard deviations from three individual measurements.
Carvalho et al. BMC Genomics 2012, 13:350 Page 3 of 17
http://www.biomedcentral.com/1471-2164/13/350
titrant addition data and the LOS program [49]. During
exponential growth, growth yield on substrate (Y
xs
)was
comparable in both strains: 0.53 ± 0.02 for HacA
WT
and
0.52 ± 0.04 for HacA
CA
.
Impact of the constitutive activation of hacA on the
transcriptome of A. niger
Three independent bioreactor cultures with the HacA
WT
strain were performed. From each cultivation experiment,
biomass was harvested from the mid-exponential growth
phase (biomass concentration 1.5 gr/kg (Figure 2A)) and
used for RNA extraction and subsequent microarray ana-
lysis (time point 1; HacA
WT-1
; [glucose] = 5.8 g/L). Like-
wise, for the HacA
CA
strain three bioreactor cultivations
were performed and biomass was harvested from each
culture and RNA was isolated from the mid-exponential
time point (time point 1; HacA
CA-1
; [glucose] = 5.7 g/L)
(Figure 2B). Global transcription profiles were determined
in triplicate for mid-exponential growth phase of HacA
WT
strain cultures and at the corresponding biomass concen-
tration for the HacA
CA
strain cultures, represented by
the arrows in Figure 2A and 2B. For the HacA
CA
cul-
tures, RNA was extracted from two additional time
points subsequent to the shift to linear growth and the
RNA was also analyzed (time point 2 and 3; HacA
CA-2
;
[glucose] = 3.5 g/L and HacA
CA-3
; [glucose] = 1.2 g/L)
(Figure 2B). Thus, the data set in this study consists of
four groups of triplicate biological replicates of HacA
WT
and HacA
CA
at three time points (HacA
CA-1
, HacA
CA-2
and HacA
CA-3
). The reproducibility of triplicate array
analyses was high with a mean coefficient of variation
(CV) ranging from 0.12 to 0.14 for transcripts rated as
present or marginal.
The number of differentially-expressed genes (FDR
<0.005) in a pair-wise comparison are given in Table 1.
In response to constitutive activation of hacA at time
point 1 (HacA
CA-1
), 1235 genes were differentially
expressed. The number of differentially expressed genes
increased when comparing the later time points
(HacA
CA-2
and HacA
CA-3
) to the wild-type strain to give
a total number of 1698 and 1978 differentially expressed
genes. Table 1 also shows that the transcriptomic differ-
ences between the different time points of the constitu-
tive HacA strain were relatively minor (48 and 179
differentially expressed genes comparing HacA
CA-2
vs.
HacA
CA-1
and HacA
CA-3
vs. HacA
CA-1
respectively).
Comparison of HacA
CA-2
with HacA
CA-3
revealed very
similar transcriptomes and with the stringent FDR of
<0.005, no differentially expressed genes were detected.
As a start to analyse the expression data, Venn diagrams
were made to identify genes that were differentially
expressed in HacA
CA
at all three time points when com-
pared to the wild-type strain. As shown in Figure 3A,
616 genes were up-regulated in the constitutive HacA
strain at all three time points and 433 genes were down-
regulated (Figure 3B). A complete list of all expression
data and the FDR-values for the pair-wise comparison
of the different strains and time points is given in [Add-
itional file 3].
Figure 2 Growth profiles of one of the triplicate A. niger
HacA
WT
(A) and HacA
CA
(B) batch cultures. Dry weight biomass
concentration (g
DW
kg
-1
) as a function of time (h) illustrates the
growth of the cultures. The maximum specific growth rate for each
culture was determined from the slope (α) of the ln transformation
of biomass (C
biomass
) in the exponential growth phase as a function
of time (h), as well from log transformation of alkali addition as a
function of time (h). Dash-line represents the end of the exponential
growth phase (depletion of glucose). Arrows indicate time-points
where mycelium was harvested for transcriptomic analysis.
Table 1 Overview of the number of differentially
expressed genes
HacA
WT
HacA
CA-1
HacA
CA-2
HacA
CA-1
1235 668 "
567 #
HacA
CA-2
1698 973 "48 43 "
725 #5#
HacA
CA-3
1978 1109 "179 155 "00"
869 #24 #0#
"up-regulated; #down-regulated.
Carvalho et al. BMC Genomics 2012, 13:350 Page 4 of 17
http://www.biomedcentral.com/1471-2164/13/350
From the 616 up-regulated genes [Additional file 4]
we were able to retrieve 598 upstream regions. These
upstream regions were analysed for the presence of
UPRE sequences (5’-CAN(G/A)NTGT/GCCT-3’, [32]).
From the up-regulated genes in the HacA
CA
strain, we
found 47 genes that contained at least one UPRE
sequence within the 400 bp region up-stream their start
codon [Additional file 5]. Compared to the frequency of
UPRE in the 400 bp up-stream region of the remaining
non up-regulated genes (457 out of 13156) a statistical
significant enrichment (p ≤5.4 × 10
-7
) was assessed with
the Fisher's exact test (one-sided). Although this analysis
indicates a statistical enrichment for genes containing a
HacA binding site in the promoter region of HacA
induced genes, it shows that only about 10% of the
HacA
CA
induced genes contain a putative HacA binding
site. It suggests that either the currently used HacA
binding consensus site is too stringent and that add-
itional sequences allow HacA to bind, or that additional
transcription factors are involved in the induction in
response to the constitutive activation of HacA. The data
set of HacA induced genes with a putative UPRE site
include genes related to protein folding (as previously
described [32]), lipid metabolism, transport within the
cell, glycosylation, ER quality control as well as a large
set of genes that code for hypothetical and unknown
function proteins [Additional file 5].
Identification of biological processes enriched in the
transcriptomic profiles of the HacA
CA
strain
To obtain an overview of the processes affected at
the transcriptional level between the HacA
WT
and the
HacA
CA-1
mutant, overrepresented GO-terms among
differentially expressed genes were identified. For this
analysis, we used the Fisher's exact test Gene Ontology
annotation tool (FetGOat) [50]. Network maps of related
GO-terms (Biological Processes), over- or under-
represented in the HacA
CA
strain, are given in Add-
itional file 6 and Additional file 7. In Additional file 8
and Additional file 9, the results of the GO-enrichment
analysis are given. To analyse the results, two comple-
mentary approaches were taken. Firstly, we rationally
defined GO-terms of higher order that include several
GO-terms. Secondly, we looked specifically at GO-terms
that are terminal in the network, as these annotations
are the most detailed (see Additional file 6). These
approaches enabled us to identify four major categories
of genes to describe the most relevant up-regulated bio-
logical processes in the HacA
CA
strain (Figure 4). The
four main categories of genes included those related to I)
ER translocation and protein folding [Additional file 10],
II) intracellular vesicle trafficking [Additional file 11], III)
protein glycosylation [Additional file 12] and IV) lipid
metabolism [Additional file 13]. These four main cat-
egories are further described in the following section.
In the HacA
CA
strain we found enriched GO-terms
linked to ER processes, such as those related to entry
in the ER: signal particle recognition, cleavage of signal
sequence, and translocation (e. g. Sec61 and related
subunits). In addition to the processes that mediate the
recognition, targeting and entering of proteins into the
ER, enriched GO-terms also included a large number of
genes involved in the subsequent events of protein fold-
ing and quality control. The genes related to protein
folding included the well known HacA targets such as
bipA,pdiA,tigA and prpA [32]. After being synthesized
and folded properly in the ER, proteins are packed
in vesicles and transported to the Golgi and from
there on, further transported to reach their final intra- or
extra-cellular destination. Our analysis identified a
number of genes that encode proteins that take part in
the vesicle/trafficking machinery such as those involved
in ER-to-Golgi (COPII associated components), Golgi-to-
ER (COPI transport vesicles, Sec components) and Golgi
Figure 3 Analysis of differentially expressed genes in HacA
CA
at all three time points in comparison to HacA
WT
.Venn diagrams of the
number of overlapping and non-overlapping induced (A) or repressed (B) genes on A. niger HacA
CA
mutant strain at different time points in
comparison to HacA
WT
strain.
Carvalho et al. BMC Genomics 2012, 13:350 Page 5 of 17
http://www.biomedcentral.com/1471-2164/13/350
to endosome transport. Additionally, genes involved in
exocytosis were also induced (Figure 4). GO-terms related
to processes involving protein glycosylation, were up-
regulated in the HacA
CA
strain. The processes include
genes involved in sugar nucleotide synthesis, oligosac-
charyl synthesis (ALG-genes) and transfer (OST-complex)
of the preassembled oligosaccharide to certain asparagine
residues (N-glycosylation). In addition, genes related to
the addition of O-glycans (genes homologous to the S.
cerevisiae Pmt-family and Kre2-family of mannosyltrans-
ferases) were up-regulated. Finally, several genes related
to the synthesis and transfer of glycosylphosphatidylinosi-
tol (GPI) anchors to proteins were found to be up-
regulated. Additional file 12 lists the differentially
expressed genes with a proposed function in relation to
protein glycosylation or GPI-anchor attachment. In
addition, the constitutive activation of HacA has a pro-
nounced effect on the transcription of genes involved in
phospholipid metabolism and includes proteins that are
homologous to proteins involved in ergosterol biosyn-
thesis as well as proteins involved in the metabolism of
fatty acids and inositol [Additional file 13]. Categories
containing fewer GO-terms included terms related to
intracellular pH regulation and terms related to glutathi-
one catabolic processes [Additional file 14].
Concerning the biological processes over-represented
in the down-regulated set of genes we found one
major category linked to the central metabolic pathways
(Figure 4 and Additional file 15). This category includes
genes within glycolysis/gluconeogenesis; alcohol catabolic/
metabolic process; carboxylic acid cycle and carbon
metabolic/catabolic metabolism. Categories containing
fewer GO-terms included terms related to transporters and
response to oxidative stress. The down-regulation of genes
in central metabolic pathways may reflect the growth limi-
tation observed in the HacA
CA
mutant (Figures. 1 and 2).
Common and different features of the constitutive
activation of HacA and the UPR induction by chemicals or
heterologous protein expression
To gain a broader overview of the impact of a cons-
titutive activation of HacA on A. niger we compared
our data set (HacA
CA-1
/HacA
WT
) with the data of
Guillemette and co-workers ([37]; [Additional file 3 and
Additional file 16]) in which the genome-wide transcrip-
tional protein secretion-related stress responses was
analyzed. In this study [37], transcriptional targets of the
UPR pathway were identified by treatment of A. niger
with the ER-disturbing chemical agents tunicamycin and
dithiothreitol (DTT) and using a strain producing the
Figure 4 Functional classification of differentially expressed genes in HacA
CA
.Representation of the main significant induced and repressed
biological processes in the HacA
CA
mutant strain in comparison to HacA
WT
strain.
Carvalho et al. BMC Genomics 2012, 13:350 Page 6 of 17
http://www.biomedcentral.com/1471-2164/13/350
recombinant tissue plasminogen activator (t-PA) as a
model for heterologous protein production. As shown in
Figure 5, in the induced set of genes, 13 genes are com-
monly unregulated in both studies (all conditions) and
81 genes are differentially expressed in HacA
CA-1
/
HacA
WT
in at least two of the three conditions per-
formed by Guillemette et al. [37]. These 94 commonly
induced genes include all the genes identified in the
Guillemette et al.’study related to protein folding, trans-
location/signal peptidase complex and glycosylation and
most of the genes that belong to the categories of vesicle
trafficking and lipid metabolism [Additional file 16].
However, more genes belonging to each of these cat-
egories have been identified in the HacA
CA-1
/HacA
WT
comparison (Figure 4 and Additional file 10, Additional
file 11, Additional file 12, Additional file 13). Unique
genes found in at least two of the conditions tested (56)
and not in our data set relate mainly to the categories of
cellular transport, stress related, amino acid metabolism,
carbohydrate metabolism and unclassified genes.
For the repressed set of genes we found 45 common
genes to our study and Guillemette et al. [37] which are
evenly distributed throughout the categories established
by the authors (Additional file 6 in [37]). The fact that
the number of commonly down-regulated genes is small
between the two studies suggests important differences
and heterogeneous responses to the induction of the
UPR indirectly (chemicals and heterologous protein) and
the manipulation of the transcription factor that regu-
lates this pathway in the overall cell metabolism.
The constitutive activation of HacA triggers the induction
of ERAD genes
Secretory proteins that fail to fold properly usually accu-
mulate in the ER and are sooner or later targeted to
destruction by the proteasome, a process termed ER-
associated degradation (ERAD) [51]. Genes encoding
proteins that are putatively involved in ERAD have been
identified in the A. niger genome [52,53] and the expres-
sion of these genes was examined in the microarray data
set. As highlighted in Table 2, the expression of several
putative ERAD components was induced in the HacA
CA
mutant. For instance, the der1 homologue (derA,
An01g00560), involved in transport of unfolded proteins
out of the ER [54], is 4.0-fold induced; hrd3 (hrdC,
An03g04600), involved in recognition and presentation
of the substrate for degradation [55], is 3.3-fold induced.
The mifA (An01g14100) gene, a homologue of mam-
malian herp1/mif1 protein and suggested as the link
between the UPR and ERAD pathways [56], is 3.1-fold
induced. Furthermore, mns1 (mnsA, An18g06220), a
mannosidase that by removal of 1,2 α-mannose units
targets the substrate to degradation [57], is 4.2-fold
induced. In comparison to Travers et al. [14], our study
allowed us to unravel the regulation of other ERAD
related genes in relation to UPR, such as mns1,mif1,a
DSK2 homologue An08g09000, putatively encoding a
ubiquitin-like protein) (1.8-fold induction) and another
putative α-mannosidase (An12g00340, 3.2-fold induced).
Constitutive activation of HacA leads to the down-
regulation of the AmyR regulon
Although an increase in expression of secretion related
processes (folding, glycosylation, vesicle transport) is
observed in the HacA
CA
strain, the expression of several
genes encoding secreted proteins is down-regulated
[Additional file 15]. In addition, expression of the AmyR
transcription factor was repressed under these condi-
tions (−3.3 fold, FDR < 10
-5
). Starch is a polymeric car-
bon source consisting of glucose units joined together
by alpha1,4- and alpha1,6-glycosidic bonds and naturally
synthesized by plants. A. niger is able to degrade starch
Figure 5 Analysis of differentially expressed genes in HacA
CA
(this study) and Guillemette’study [37]. Venn diagrams of the number of
overlapping and non-overlapping induced or repressed genes of A. niger HacA
CA-1
/HacA
WT
(A) and genes from Guillemette et al. (2007) induced
(or repressed) at least in two conditions (B) or induced in all conditions (C).
Carvalho et al. BMC Genomics 2012, 13:350 Page 7 of 17
http://www.biomedcentral.com/1471-2164/13/350
by secreting various amylases that convert starch into
maltose and glucose [58]. The transcription of these
amylolytic enzymes is mediated by AmyR [59]. The
AmyR regulon has been defined and consists of several
alpha-glucosidases as well as two sugar transporters
[58,60]. Our transcriptome profiles show that the
enzymes and sugar transporters in the AmyR regulon
are commonly down-regulated (Table 3).
The down-regulation of genes involved in starch deg-
radation and uptake suggested that the HacA
CA
mutant’s
growth may be severely affected on starch as sole carbon
source. In order to test this, we performed growth tests
of HacA
CA
together with HacA
WT
and a ΔamyR strain
in which the AmyR-encoding gene has been deleted [58]
on solid media containing starch or its derivatives in a
range of different complexity (Figure 6).
As predicted from the transcriptomic data and similar
to the ΔamyR strain, HacA
CA
was unable to grow on the
plate containing starch as sole carbon source. With the
aim of testing if this reduced growth was specific for
growth on starch or if it would apply to other complex
carbohydrates, we performed a similar test on other
polymers, inulin, xylan and pectin and respective mono-
meric substrates, fructose, xylose and galacturonic acid
(Figure 7). In addition, growth of the HacA
CA
strain was
analysed on milk-plates (Figure 7). These results show
that the HacA
CA
strain is growth impaired when chal-
lenged to assimilate nutrients from complex substrates.
Although this was not so evident when grown on inulin,
growth of the HacA
CA
strain was clearly further reduced
on xylan, pectin and milk-plates suggesting that the
down-regulation of extracellular enzyme expression is
not limited to the amylolytic genes, but also for xylano-
lytic, pectinolytic and proteolytic genes.
Discussion
Genome-wide gene expression variations upon
constitutive activation of HacA
Using a defined A. niger strain bearing a constitutively
active form of HacA (HacA
CA
), the key regulator of the
UPR pathway in eukaryotic cells, together with Affyme-
trix GeneChips technology, we have defined a large set
of HacA-responsive genes. Unlike other studies, in
which the hacA mRNA splicing is stimulated by the
presence of unfolded proteins in the ER by chemicals or
by expression of heterologous proteins [29,37], we used
a different approach by creating a strain lacking the 20
nt intron in the hacA gene. To minimize additional
effects of expressing the constitutive form of hacA, the
hacA
CA
gene was targeted to its endogenous locus.
This contrasts to previous studies in which the constitu-
tive hacA was expressed from a highly-expressed pro-
moter [43] or expressed from the pyrG locus [30]. The
microarray data revealed, even under stringent criteria
(False Discovery Rate at q < 0.005), a large number of
differentially-expressed genes (1235 to 1978) upon HacA
activation (Table 1). The transcriptomic data obtained in
our study reflects the consequences of a constitutive
activation of the HacA transcription factor that results
in the induction of many genes associated with the
Table 2 Expression values of A. niger ERAD genes
Gene ID Gene name Description Fold change
HacA
CA-1
/HacA
WT
HacA
CA-2
/HacA
WT
HacA
CA-3
/HacA
WT
An15g00640 derA strong similarity to hypothetical protein
GABA-A receptor epsilon subunit –C. elegans
4.0 6.0 6.4
An01g12720 hrdC similarity to tumour suppressor TSA305
protein of patent WO9928457-A1 –H. sapiens
3.3 3.9 4.0
An01g14100 mifA weak similarity to stress protein Herp –M. musculus 3.1 4.3 4.6
An18g06220 mnsA strong similarity to alpha-mannosidase
MNS1 –S. cerevisiae
4.2 4.7 5.0
An08g09000 strong similarity to ubiquitin-like protein
DSK2 –S. cerevisiae
1.8 1.7 1.9
An16g07970 similarity to autocrine motility factor receptor
Amfr –M. musculus
2.9 2.9 3.1
An03g04340 strong similarity to ER membrane translocation
facilitator Sec61 –Y. lipolytica
2.6 2.6 2.6
An04g01720 similarity to DnaJ protein SIS1 –C. curvatus 1.8 2.3 2.2
An12g00340 similarity to alpha 1,2-mannosidase IB –H. sapiens 3.2 2.9 3.1
An04g00360 strong similarity to transport vesicle formation
protein Sec13p –S. cerevisiae
2.1 2.1 2.1
An09g06110 strong similarity to ubiquitin conjugating enzyme
ubcp3p –S. pombe
1.4* 1.6 1.7
* Not significantly differentially expressed.
Carvalho et al. BMC Genomics 2012, 13:350 Page 8 of 17
http://www.biomedcentral.com/1471-2164/13/350
secretory pathway (Figure 4) and related to ER transloca-
tion, glycosylation, folding, quality control, ERAD, GPI
anchor biosynthesis, vesicle-mediated transport between
organelles (ER-Golgi), lipid metabolism, endocytosis
and vacuolar sorting. Because of the highly defined
conditions (both the defined mutants and the bioreactor
controlled cultivations), this study revealed new categor-
ies of differentially-expressed genes as well as a much
larger number of genes related to each category. Our
data are however consistent with previous UPR-related
studies in fungal and mammalian cells where many
secretory functions are up-regulated by Hac proteins,
either directly or indirectly [14,33-35,37].
Our results from the transcriptomic study also
revealed that constitutive activation had a negative effect
on central metabolism as well as on the production
of extracellular enzymes. Although a clear growth
reduction was observed for the HacA
CA
strain on milk-
plates (Figure 7), none of the main extracellular pro-
teases (PepA, PepB, PepD or PepF)) [8] was shown to be
transcriptionally down-regulated under the bioreactor
growth conditions (glucose and ammonium) (Additional
file 17). Possibly, the effect of downregulation of these
enzymes in the HacA
CA
strain is only occurring during
inducing conditions, which might explain the reduced
growth on milk-plates. The expression level of prtT,
which encodes the transcriptional activator of extracellu-
lar proteases [8] was significantly down-regulated in the
HacA
CA
strain (Additional file 17), but this has appar-
ently no effect of the four target genes indicated above.
Table 3 Expression values of genes involved in starch metabolism
Gene ID Gene name Description Fold change
HacA
CA-1
/HacA
WT
HacA
CA-2
/HacA
WT
HacA
CA-3
/HacA
WT
Starch regulation
An04g06910 amyR transcription regulator of maltose utilization
AmyR –A. niger
−3.3 −3.3 −3.3
An01g06900 weak similarity to transcription activator
AmyR –A. oryzae
−1.7* 1.4* 2.1
An09g03100 amyA strong similarity to alpha-amylase precursor
AMY –A. shirousamii
−5−5−5
Starch degradation
An11g03340 aamA acid alpha-amylase –A. niger −370 −50 −50
An04g06920 agdA extracellular alpha-glucosidase –A. niger −5−10 −10
An01g10930 agdB extracellular alpha-glucosidase –A. niger −10 −10 −10
An03g06550 glaA glucan 1,4-alpha-glucosidase –A. niger −10 −25 −25
An04g06930 amyC extracellular alpha-amylase –A. niger −10 −25 −25
Sugar uptake
An02g03540 mstC strong similarity to hexose transport protein
HXT3 –S. cerevisiae
−2−2−2
An15g03940 strong similarity to monosaccharide transporter
Mst-1 –A. muscaria
−2.5 −2−1.7
An09g04810 strong similarity to high affinity glucose transporter
HGT1 - K. lactis
−5−10 −10
An11g01100 strong similarity to high-affinity glucose transporter
HGT1 - K. lactis
−5−5−5
An12g07450 mstA Sugar/H + symporter −5−10 −10
*Not significantly differentially expressed.
Figure 6 Effects of the constitutive activation of the UPR on
the utilization of starch and starch related carbon sources. The
wild-type strain (HacA
WT
), the strain containing a constitutive active
form of hacA (HacA
CA
) and the AmyR disruptant (ΔamyR) strain were
grown on MM containing 1% of the different carbon sources
indicated at 30 °C for 3 days.
Carvalho et al. BMC Genomics 2012, 13:350 Page 9 of 17
http://www.biomedcentral.com/1471-2164/13/350
As the global mechanisms for energy generation and
cell development are arrested or directed towards up-
regulation of the protein secretion machinery, this might
account for the unbalanced growth observed in HacA
CA
in comparison to the HacA
WT
(Figure 2). These results
suggest an implication for heterologous protein produc-
tion if the protein causes ER stress. Studies on increasing
heterologous protein production by enhancing UPR tar-
gets are contradictory and vary according to the protein
expressed. Although protein-specific effects are likely,
most studies were not controlled for the levels of cha-
perones or foldases co-expressed and it has been shown
that there is an optimum level of both BipA [61] and
PdiA [62].
GO-enrichment analysis on the induced set of genes
showed that all the well-known UPR target genes related
to folding are represented in the HacA
CA
data set, and
include genes encoding the chaperone BipA, and homo-
logues of LhS1p (An01g13220), P58PK (An11g11250)
and Scj1p (An05g00880), as well as the protein disulfide
isomerases PdiA, PrpA and TigA . Glycosylation also
appeared as one of the enriched categories. Several
aspects of protein glycosylation including the categories
of oligosaccharide-lipid assembly, oligosaccharyl trans-
ferase complex, UDP-glucose transport, O-linked glyco-
sylation and GPI anchor biosynthesis (Figure 4), were
up-regulated indicating that the cell responds to ER
stress by increasing the capacity to glycosylate proteins.
The induction of genes associated with lipid metabolism
[Additional file 13] suggests a proliferation of the ER to
bear the increase of proteins that reside in this organelle,
as also indicated in UPR studies of S. cerevisiae [14].
The elimination of unfolded proteins from the ER
involves the ERAD pathway [51]. Travers et al. [14]
demonstrated that up-regulation of ERAD-related genes
in S. cerevisiae is part of the UPR. These ERAD genes
include DER1 and HRD3, UBC7, the ubiquitin-related
DOA4, the proteasome-related PEX4 and translocon-
related SEC61 [14]. From the ERAD components
defined in A. niger [52], 11 out of 20 genes are induced
in the HacA
CA
strain (Table 2). Furthermore, analysis
of the 400 bp of the up-stream regions of derA
(An15g00640), sec61 (An03g04340) and An04g06990
(high similarity with a human 1,2-mannosidase) revealed
that these genes contain at least one UPRE sequence
[Additional file 5]. These results support the connection
between the two pathways, as previously suggested
[14,53,63,64], although the mechanistic connection be-
tween the two pathways is unresolved. We compared
our data sets with those in Guillemette et al. [37] and
found broad agreement with a wide range of up-
regulated genes under ER stress conditions. However,
Guillemette et al. [37] showed trigger-specific responses
that do not complicate our analyses with HacA
CA
. Add-
itionally, we find several putative translation initiation
factors [Additional file 4], An18g06260 (highly homolo-
gous to the mammalian eIF3), repressed in HacA
CA-1
and
putative elongation factors An11g10630, An14g01030,
An16g06850, An16g05260, An01g06230, An06g01710,
An02g12320, An02g12420 and An04g01940 repressed in
the other time points (HacA
CA-2
and/or HacA
CA-3
).
New leads on the RESS mechanism
The accumulation of misfolded protein in the ER leads
to a selective down-regulation of genes encoding
secreted proteins in fungi and plants [44-46,64]. This
phenomenon is termed REpression under Secretion
Stress (RESS). In these studies, associated with the UPR
Figure 7 Effects of the constitutive activation of the UPR on the utilization of different polimeric and monomeric carbon sources. The
wild-type strain (HacA
WT
), the strain containing a constitutive active form of hacA (HacA
CA
) the amyR disruptant (ΔamyR) and inuR disruptant
(ΔinuR) strains were grown on MM containing 1% of the different carbon sources or 1% dried skim milk at 30 °C for 4 days.
Carvalho et al. BMC Genomics 2012, 13:350 Page 10 of 17
http://www.biomedcentral.com/1471-2164/13/350
activation by chemical induction is the down-regulation
of transcription encoding extracellular enzymes that
include cellulases and xylanases in T. reesei [44] and glu-
coamylase in A. niger [46] amongst other genes encoding
secreted proteins [37]. The mechanism by which the
down-regulation is mediated is unknown, but glaA pro-
moter studies in A. niger indicated that a promoter re-
gion between 1 and 2 kb upstream of translational start
is important and a direct mediation of RESS through the
UPR was questioned [46]. RESS has been recognized as
an effort from the cells to prevent the entry and over-
load of newly synthesized proteins into the already “full”
ER [44,46,64]. In our study, the activation the UPR by
introducing the constitutive active form of the HacA
transcription factor lead to the down-regulation not only
of glucoamylase (glaA), but also other genes coding for
starch-degrading enzymes that include acid α-amylase
(aamA), α-glucosidases A and B (agdA and agdB) and
α-amylase C (amyC), and additional sugar transporters
(Table 3). In addition, the expression of the transcrip-
tional activator of starch degrading enzymes is down-
regulated (3.3-fold) in the HacA
CA
strain. It has been
shown previously that the AmyR transcription factor is
induced (2.6-fold) upon the shift from xylose to maltose
medium, suggesting that this down-regulation is bio-
logically relevant. The down-regulation of the AmyR
regulon and sugar transporters (Table 3) had a clear
phenotypic effect resulting in the inability of the HacA
CA
strain to grow on starch (Figure 6). Growth assays on
other polymeric substrates (Figure 7) suggested that the
down-regulation might not to be specific for starch
but is relevant to other sugar polymers including xylan
(Figure 7). Several scenarios can be envisioned by which
the constitutive activation of HacA could result in
down-regulation of secreted enzymes. We speculate that
HacA activation leads to inactivation of the transcrip-
tional factor such as AmyR (starch regulator), and pos-
sibly XlnR (xylan regulator). The inactivation results in
down-regulation of the entire regulon of the transcrip-
tion factor. However, a direct effect of HacA-mediated
effects on individual promoters cannot be excluded.
It will be of interest for future studies to determine
the molecular mechanism that results in the down-
regulation of AmyR and AmyR target genes in response
to HacA activation.
Relation between yeast, filamentous fungi and
mammalian UPR counterparts
The mammalian ER contains three types of transmem-
brane proteins –IRE1P, PERK and ATF6 –which sense
the accumulation of unfolded proteins and are respon-
sible to activate three different branches of the UPR
pathway (reviewed in [65]). Most of the players in the
IRE1P pathway are conserved in fungi [66] in which, by
activation of the transcription factor Hac1p/HacA, there
is an induction of expression of UPR target genes rel-
ated to the folding machinery [20,29], but proteins hom-
ologous to PERK and ATF6 seem to be absent from
fungal systems.
To prevent the influx of proteins into the ER in mam-
malian cells, a mechanism of translation attenuation is
activated that is mediated by PERK. This transcription
factor mediates the phosphorylation of eIF2 (eukarytotic
translation initiation factor) which in turn leads to the
arrest of protein translation. The eIF2 is also required
for the translation of selective mRNAs such as the Acti-
vating Transcription Factor-4 (ATF4) [67]. ATF4 is
involved in the regulation of UPR genes involved in
ERAD, metabolism and apoptosis [68]. Gcn4p/CpcA are
the ATF4 homologues of S. cerevisiae and filamentous
fungi, respectively. Both S. cerevisiae and A. niger lack
an obvious PERK homologue. Gcn2p phosphorylates
eIF2 leading to a global reduction on protein synthesis
and stimulation of Gcn4 translation, that has been
shown to control amino acid biosynthesis [69]. Although
this resembles the PERK function, Gcn2p–eIF2 phos-
phorylation is only attributed to amino acid starvation
and not to ER stress [70,71]. In S. cerevisiae, the involve-
ment of Gcn2p and Gcn4p in the UPR has been shown
[72]. In our transcriptomic profiles, a gcn2 homologue
(An17g00860) is not differentially expressed, whereas
cpcA (An01g07900) shows 2 fold higher expression in
comparison with the wild-type strain. According to our
results the activation of cpcA is likely to occur in a
Gcn2p-independent way and it is tempting to speculate
that in filamentous fungi a similar PERK-eIF2-ATF4
pathway may exist. ATF4 is involved in glutathione bio-
synthesis [73] and glutathione-S-transferases have been
shown to be up-regulated under ER stress conditions
[74]. According to our data, the homologue to human
glutathione-S-transferase 3 (An12g03580) is 2-fold
induced in HacA
CA-1
and 2.6 fold induced at the later
time points. What we also observe is that as in the case
of ATF4-regulated genes, not all the genes involved in
glutathione metabolism are affected under secretion
stress situation [73], as for example asparagine synthase
(An01g07910) or glutathione reductase (An03g03660)
that are not differentially expressed. Similar results have
been observed in T. reesei [35].
Another interesting observation is the 4-fold induction
of the human homologue RNA-activated protein kinase
inhibitor P58 (An11g11250). In mammals, P58 is
induced via ATF6, a transcription factor also involved in
the regulation of UPR chaperones and apoptosis (no
homologue in fungi), and it is an important component
on the regulation of PERK-eIF2-ATF4 pathway, attenuat-
ing the UPR [75]. The up-regulation of P58 has been
shown in studies characterizing the UPR under different
Carvalho et al. BMC Genomics 2012, 13:350 Page 11 of 17
http://www.biomedcentral.com/1471-2164/13/350
conditions [37,38]; however, the role and (putative) in-
volvement of a fungi P58 homologue in this pathway
remains to be elucidated. ATF6, that induces XBP1
(HacA homologue), also possesses the ability to enhance
lipid biosynthesis and expansion of the ER [76]. The
identification of these potential regulatory genes
involved in mediating the HacA response in this study
has given multiple new leads for further research to bet-
ter understand the mechanism of how A. niger reacts to
secretion stress.
Conclusions
The combination of a genetic defined constitutively acti-
vated HacA transcription factor mutant and controlled
bioreactor cultivation conditions have provided a solid
basis for a genome-wide expression analysis to study the
response of A. niger towards ER stress. Comparison of
the transcriptome obtained form the constitutive HacA
mutant to previous studies in which ER stress was
induced by chemical treatments or the expression of a
heterologous protein revealed a consistent up-regulation
of genes associated with the secretory pathway. Because
of the highly defined conditions and reduced heterogen-
eity in our cultures, this study revealed new categories of
differentially expressed genes as well as a larger number
of genes related to individual categories. We also show
that constitutively activation of the HacA transcription
factor has a negative effect on the expression and conse-
quently the production of extracellular enzymes. We
conclude that activation of HacA induces a dual
response to cope with ER stress: increasing the folding
capacity of the cell by the up-regulation of genes related
to secretion processes in the ER on the one hand and
reducing the import of new proteins into the ER by
reducing the expression of genes encoding secreted pro-
teins on the other hand.
Methods
Strains and culture conditions
Aspergillus niger strains used throughout study (Table 4)
were cultivated in minimal medium (MM) [77] contain-
ing 1% (w/v) of glucose (or other as indicated) as a car-
bon source, 7 mM KCl, 11 mM KH
2
PO
4
,70mM
NaNO
3
, 2 mM MgSO
4
, 76 nM ZnSO
4
, 178 nM H
3
BO
3
,
25 nM MnCl
2
, 18 nM FeSO
4
, 7.1 nM CoCl
2
, 6.4 nM
CuSO
4
, 6.2 nM Na
2
MoO
4
, 174 nM EDTA; or in
complete medium (CM) containing, in addition to MM,
0.1% (w/v) casamino acids and 0.5% (w/v) yeast extract.
When required, 10 mM uridine was added. The glucose
minimal medium used for bioreactor cultivations has
been previously described [78]. For the protease assay,
strains were cultivated in MM containing 1% (w/v) dried
skim milk and 0.05% Triton X100. Plates were incubated
for 4 days at 30° and protease activity was verified by the
appearance of a clear halo around the colony.
Construction of the constitutive active hacA strain and
the hacA reference strain
To replace to endogenous hacA gene on the hacA locus
with a constitutive activated allele of the hacA gene, a
replacement cassette was constructed. As a control, a
similar replacement cassette was made with the wild-
type hacA gene. To construct the hacA reference strain,
three PCR fragments consisting of the hacA gene includ-
ing promoter and terminator regions, the Aspergillus
oryzae pyrG selection marker and a hacA terminator re-
gion were cloned into pBluescript-SK. Subsequently, this
plasmid was used as template to introduce the muta-
tions that led to a constitutive active hacA allele by site
directed mutagenesis (according to Quick Change II site
directed mutagenesis protocol, Stratagene). To construct
the wild-type hacA replacement construct the A. niger
hacA gene (accession number: AY303684), including
about 0.6 kb promoter and 0.6 kb of terminator regions,
was amplified by PCR using N402 genomic DNA as
template and primers NC8 and NC11 (Table 5) to which
NotIandXhoI restriction sites were added, respectively.
The amplified gene was cloned into pTZ57R/T (Fermen-
tas) and sequenced. The hacA terminator region (1 kb)
was amplified by PCR using N402 genomic DNA as
template and primers NC1 and NC2, to which SalI and
KpnI restriction enzymes were added, respectively. The
fragment was cloned into pGEM-T easy (Promega) and
sequenced. For PCR amplification, Phusion™High-
Fidelity PCR Kit (Finnzymes) was used according to
manufacturer’s instructions. The AopyrG gene (2 kb)
was PCR amplified using pAO4-13 [80] as template
DNA and primers NC7 and pAOpyrG-GA5rev, to which
XhoI and SalI restriction sites were added, respectively.
The fragment was cloned into pGEM-T easy (Promega)
and sequenced. The fragments corresponding to the
hacA terminal region and pyrG were digested from the
plasmids using the respective restriction enzymes men-
tioned above and cloned in a 3-way ligation step into
pBlue-SK, previously digested with XhoI-KpnI to give
pBS-pyrG-3’hac. To obtain the final construct, the hacA
gene was digested from pTZ57R/T using NotI-XhoI and
cloned into pBS-pyrG-3’hac, previously digested with
Table 4 Aspergillus niger strains used in this study
Strain Genotype Reference
N402 cspA1 derivative of ATCC9029 [79]
MA70.15 ΔkusA::amdS
+
in AB4.1 pyrG
-
[80]
NC1.1 Wild type hacA in MA70.15, pyrG
+
This study
NC2.1 Constitutive active hacA in MA70.15, pyrG
+
This study
YvdM1.1 ΔamyRin AB4.1 pyrG
+
[58]
XY3.1 ΔinuRin AB4.1 pyrG
+
[81]
Carvalho et al. BMC Genomics 2012, 13:350 Page 12 of 17
http://www.biomedcentral.com/1471-2164/13/350
the same enzymes. The final construct, named pHAC,
was linearized with NotI and transformed into the
A. niger MA70.15 strain. Transformants with a targeted
integration of the construct at the hacA locus were
screened by Southern blot analysis. To obtain a strain
only expressing the constitutively active hacA gene, a
construct was made lacking the 20 nucleotide intron
(see introduction for details) using the site-directed mu-
tagenesis technique. Mutagenic oligonucleotide primers
NC31 and NC32 (Table 5) were designed, surrounding
each side of the intron region. PCR was performed using
PfuUltra HF DNA polymerase (Stratagene), the pHAC
(10 ng) as template and conditions as follows: initial
denaturation of 1 min at 95 °C, 18 cycles of 30 sec
denaturation at 95 °C, annealing at 55 °C for 30 sec and
elongation for 8 min and 30 sec at 68 °C. Afterwards,
PCR products were digested with DpnI for one hour at
37 °C, for destruction of parental methylated and hemi-
methylated plasmid DNA. The mixture was directly used
for E. coli transformation. Plasmid pConstHac was ana-
lyzed by restriction enzymes and sequencing, confirming
the absence of the 20 nt intron. This construct was line-
arized with NotI and then transformed into A. niger
MA70.15. Southern analysis of putative transformants
carrying the wild-type hacA and the constitutively active
hacA was performed by digesting the genomic DNA
with NheI and probing with a 0.6 kb probe correspond-
ing to the hacA 3’-flanking region. Transformants NC1.1
containing expressing the wild-type hacA and NC2.1
expressing the activated hacA form at the endogeneous
hacA locus were chosen for further studies and these
strains are here referred as the HacA
WT
(wild-type) and
HacA
CA
(Constitutive Active) strains, respectively. The
absence of the intron in the NC2.1 strain was further
confirmed by PCR analysis using genomic DNA as tem-
plate, together with primers phac1 and phac2 (Table 5)
using Taq polymerase (Fermentas).
Bioreactor cultivation conditions
Conidia for inoculation of bioreactor cultures were har-
vested from solidified CM with a sterile detergent solu-
tion containing 0.05% (w/v) Tween80 and 0.9% (w/v)
NaCl. Batch cultivation of HacA
WT
and HacA
CA
was
initiated by inoculating 5 L MM with conidial sus-
pension to give 10
9
conidia L
-1
. Glucose was sterilized
separately and added to sterile MM to give a final con-
centration of 0.75% (w/v). During cultivation at 30 °C,
pH 3 was maintained by computer-controlled addition
of 2 M NaOH or 1 M HCl. Sterile air was supplied at 1 L
min
-1
through a ring-sparger. Dissolved oxygen tension
was above 40% of air saturation at any time, ensuring
sufficient oxygen for growth. After spore germination
0.01% (v/v) polypropyleneglycol P2000 was added as
antifoam agent. Submerged cultivation was performed
with 6.6 L BioFlo3000 bioreactors (New Brunswick
Scientific, NJ, USA). A more detailed description of the
medium and batch cultivation protocol is given in
Jørgensen et al. [78].
Biomass concentration and substrate determination
Dry weight biomass concentration was determined by
weighing lyophilized mycelium separated from a known
mass of culture broth. Culture broth was filtered
through GF/C glass microfibre filters (Whatman). The
filtrate was collected and frozen for use in solute ana-
lyses. The mycelium was washed with demineralised
water, rapidly frozen in liquid nitrogen and stored at
−80 °C until lyophilization. Glucose was determined
according to the method of Bergmeyer et al. [83] with a
slight modification: 250 mM triethanolamine (TEA) was
used as buffer (pH7.5).
RNA isolation and quality control
Mycelium intended for gene-expression analyses was
separated from culture medium and frozen in liquid ni-
trogen within 15–20 s from sampling RNA was
extracted from mycelium and quickly frozen in liquid ni-
trogen using Trizol reagent (Invitrogen). Frozen ground
mycelium (200 mg) was directly suspended in 800 μl
Trizol reagent and vortexed vigorously for 1 min. After
centrifugation for 5 min at 10000 × g, 450 μlofthesuper-
natant was transferred to a new tube. Chloroform (150 μl)
was added and after 3 min incubation at room tempe-
rature, samples were centrifuged and the upper aqueous
phase was transferred to a new tube to which 400 μlof
isopropanol was added, followed by 10 min incubation at
room temperature and centrifugation for 10 min at
10000 × g. The pellet was washed with 75% (v/v) ethanol
and finally dissolved in 100 μlH
2
O. RNA samples for
micro-array analysis were additionally purified on Nucleo-
Spin RNA II columns (Machery-Nagel) according to the
Table 5 Primers used throughout this study
Name Sequence
pNC1 ACGCGTCGACGCTGTTGAGGTTCCGGCTGTA
pNC2 GGGGTACCAATCTTCAGAGCGCGCCAG
pNC7 CCGCTCGAGGGATCTCAGAACAATATACCAG
pAOpyrG-GA5rev ACGCGTCGACCCGCTGTCGGATCAGGATTA
pNC8 ATAAGAATGCGGCCGCCTCCATACCACTTTGTGCTAG
pNC11 CCGCTCGAGGGCGCATGAGAGAGTTAGG
pNC31 CGTGACACAACATCCTCCAGCGGTGTTGTGCGACCT-
CCAGTGTCCGTCGCTGG
pNC32 CCAGCGACGGACACTGCAGGTCGCACAACACCGCT-
CCAGGATGTTGTGTCACG
phac1 CTTCTCCTACCCTAACTCCT
phac2 TCAAAGAGAGAGAGGGCA
Carvalho et al. BMC Genomics 2012, 13:350 Page 13 of 17
http://www.biomedcentral.com/1471-2164/13/350
manufacturer’s instructions. RNA quantity and quality was
determined on a Nanodrop spectrophotometer.
Microarray analysis
Probe synthesis and fragmentation were performed at
ServiceXS (Leiden, The Netherlands) according to the
GeneChip Expression Analysis Technical Manual [82].
DSM (Delft, The Netherlands) proprietary A. niger
GeneChips were hybridised, washed, stained and scanned
as described in the GeneChip Expression Analysis Tech-
nical Manual [84]. The 3’to 5’signal ratio of probe sets
of internal control genes, like gpdA (glyceraldehyde-3-
phosphate dehydrogenase), pkiA (pyruvate kinase), hxk
(hexokinase) and actin, were below 3 on all 12 arrays.
Transcriptomic data analysis
Bioconductor, a collection of open source and open de-
velopment packages for the statistical programming lan-
guage R, was used for data analyses [85,86]. The
transcriptomic data set comprises 12 arrays representing
independent triplicates for each of the following four
conditions: HacA
WT
,HacA
CA-1
,HacA
CA-2
and HacA
CA-3
.
Using the robust multi-array analysis (RMA) package
[87], RMA expression values were computed from the
perfect match probes only. Background correction,
normalization and probe summarization steps were per-
formed according to the default settings of the
RMA package. Defining the following contrast matrix
(HacA
CA-1
-HacA
WT
,HacA
CA-2
- HacA
WT
,HacA
CA-3
-
HacA
WT
), three sets of differentially expressed genes were
determined by moderated t-statistics using the Limma
package [88]. The Benjamini and Hochberg False Discov-
ery Rate [89] (FDR) was controlled at q < 0.005. A min-
imal fold change criterion was not applied for the
identification of differentially expressed genes, as fold
changes are not necessarily related to biological relevance
[90,91]. RMA expression values (log2 scale) for each
array, mean expression values (normal scale) for each
condition, fold-changes and FDR q-values for each of the
three comparisons as well as classifiers for the moderated
t-statistics are summarized in [Additional file 3]. Results
are presented as the relative fold change in a linear scale.
To make the interpretation more intuitive, we have
expressed the relative reduction in transcript level (down-
regulated genes) with a “-”(minus). Microarray data
described in this study is available at the GEO database
under accession number GSE39070.
Enrichment analysis of Gene Ontology (GO) terms
Controlling the FDR at q < 0.05, over-represented GO
terms in sets of differentially expressed genes were
determined with the Fisher's exact test Gene Ontology
Annotation tool (FetGOat) [50].
Additional files
Additional file 1: Construction plasmids and confirmation of a
reference strain and a strain only expressing the hacA induced
form. Schematic representation of the plasmids pHAC (A) and
pConstHac (B) (Note: fragment sizes are not on scale). (C) Sequence
alignment of pHAC and pConstHAC showing the absence of the 20 nt
intron on pConstHac. (D) PCR amplification of gDNA of HacA
WT
(NC1.1)
and HacA
CA
(NC2.1) transformants. Primers were designed about 100 bp
upstream and 100 bp downstream of the hacA intron region, giving rise
to a band of 200 bp for HacA
CA
and 220 bp for HacA
WT
. Sizes of the DNA
Marker (M) are indicated.
Additional file 2: Growth profiles of A. niger HacA
WT
(A, B, C) and
HacA
CA
(D, E, F) triplicate batch cultures. Dry weight biomass
concentration (g
DW
kg
-1
) as a function of time (h) illustrates the growth of
the cultures. The maximum specific growth rate for each culture was
determined from the slope (α) of the ln transformation of biomass
(C
biomass
) (lnX) in the exponential growth phase as a function of time (h),
as well from log transformation of alkali addition as a function of time
(h). Dash-line represents the end of the exponential growth phase
(depletion of glucose).
Additional file 3: Complete list of all differentially expressed genes
in HacA
CA
.Expression data and the FDR-values for the pair wise
comparison of the different strains and time points.
Additional file 4: Overview of the 616 HacA
CA
up-regulated genes
in the 3 time points. Subset of all differentially expressed genes
(Additional file 3).
Additional file 5: HacA
CA
up-regulated genes that contain at least
one UPRE sequence. Subset of all differentially expressed genes
(Additional file 3).
Additional file 6: Network maps of related up-regulated GO-terms.
Results of the GO-enrichment analysis of biological processes of all
differentially expressed genes in HacA
CA-1
/HacA
WT
.
Additional file 7: Network maps of related down-regulated GO-
terms. Results of the GO-enrichment analysis of biological processes of
all differentially expressed genes in HacA
CA-1
/HacA
WT
.
Additional file 8: GO analysis of biological processes enriched in
the up-regulated set of genes in HacA
CA
.Subset of all differentially
expressed genes (Additional file 3).
Additional file 9: GO analysis of biological processes enriched in
the down-regulated set of genes in HacA
CA
.Subset of all differentially
expressed genes (Additional file 3).
Additional file 10: Expression values of selected genes related to
enriched GO terms of ER associated processes. Subset of all
differentially expressed genes (Additional file 3).
Additional file 11: Expression values of selected genes related to
enriched GO terms associated with vesicle transport within the cell.
Subset of all differentially expressed genes (Additional file 3).
Additional file 12: Expression values of selected genes related to
enriched GO terms associated with glycosylation processes. Subset
of all differentially expressed genes (Additional file 3).
Additional file 13: Expression values of selected genes related to
enriched GO terms associated with lipid metabolic processes. Subset
of all differentially expressed genes (Additional file 3).
Additional file 14: Expression values of selected genes related to
the GO terms “hydrolase activity”,“glutathione catabolic processes”
and “vacuolar acidification”.Subset of all differentially expressed genes
(Additional file 3).
Additional file 15: Expression values of selected down-regulated
genes related to enriched GO terms. Subset of all differentially
expressed genes (Additional file 3).
Additional file 16: Commonly induced and repressed genes in the
HacA
CA
strain and A. niger strains treated with DTT and
Tunicamycin and expressing tPA. Subset of all differentially expressed
genes (Additional file 3) and Guillemette’study [37].
Carvalho et al. BMC Genomics 2012, 13:350 Page 14 of 17
http://www.biomedcentral.com/1471-2164/13/350
Additional file 17: Expression values of genes related to
extracellular proteases production.
Competing interests
The authors declare that they have no competing interests.
Authors’contributions
NDSPC constructed the Aspergillus strains used in this study. NDSPC, TJR and
MA carried out and analysed the bioreactor cultivations. BMN carried out the
statistical analysis of the transcriptomic data. NDSPC, TRJ, BMN, DBA and
AFJR interpreted the transcriptomic data. NDSPC, TRJ, MA, CAMJJvdH, and
AFJR designed the experiments. All authors contributed to the writing of the
manuscript. All authors read and approved the final manuscript.
Acknowledgements
This project was carried out within the research programme of the Kluyver
Centre for Genomics of Industrial Fermentation, which is part of the
Netherlands Genomics Initiative/Netherlands Organization for Scientific
research.
Author details
1
Institute of Biology Leiden, Leiden University, Molecular Microbiology and
Biotechnology, Sylviusweg 72, 2333 BE Leiden, The Netherlands.
2
Kluyver
Centre for Genomics of Industrial Fermentation, P.O box 5057, 2600 GA Delft,
The Netherlands.
3
School of Biology, University of Nottingham, University
Park, Nottingham NG7 2RD, United Kingdom.
4
Present address: Protein
Expression, Novo Nordisk, Novo Nordisk Park 2760, Måløv, Denmark.
5
Present
address: Applied and Molecular Microbiology, Institute of Biotechnology,
Berlin University of Technology, Gustav-Meyer-Allee 25, 13355 Berlin,
Germany.
Received: 27 February 2012 Accepted: 9 July 2012
Published: 30 July 2012
References
1. Jeenes DJ, Mackenzie DA, Roberts IN, Archer DB: Heterologous protein
production by filamentous fungi. Biotechnol Genet Eng Rev 1991,
9:327–367.
2. Gouka RJ, Punt PJ, van den Hondel CA: Efficient production of secreted
proteins by Aspergillus: progress, limitations and prospects. Appl Microbiol
Biotechnol 1997, 47:1–11.
3. Braaksma M, Smilde AK, van der Werf MJ, Punt PJ: The effect of
environmental conditions on extracellular protease activity in controlled
fermentations of Aspergillus niger.Microbiology 2009, 155:3430–3439.
4. Nemoto T, Maruyama J, Kitamoto K: Improvement of heterologous protein
production in Aspergillus oryzae by RNA interference with alpha-amylase
genes. Biosci Biotechnol Biochem 2009, 73:2370–2373.
5. Lubertozzi D, Keasling JD: Developing Aspergillus as a host for
heterologous expression. Biotechnol Adv 2009, 27:53–75.
6. Conesa A, Punt PJ, van Luijk N, van den Hondel CA: The secretion pathway
in filamentous fungi: a Biotechnological view. Fungal Gene and Biol 2001,
33:155–171.
7. Jacobs DI, Olsthoorn MM, Maillet I, Akeroyd M, Breestraat S, Donkers S, van
der Hoeven RA: van den Hondel, et al.: Effective lead selection for
improved protein production in Aspergillus niger based on integrated
genomics. Fungal Genet Biol 2009, 46:S141–152.
8. Punt PJ, Schuren FH, Lehmbeck J, Christensen T, Hjort C, van den Hondel CA:
Characterization of the Aspergillus niger prtT, a unique regulator of
extracellular protease encoding genes. Fungal Genet Biol 2008,
45:1591–1599.
9. Yoon J, Kimura S, Maruyama J, Kitamoto K: Construction of quintuple
protease gene disruptant for heterologous protein production in
Aspergillus oryzae.Appl Microbiol Biotechnol 2009, 82:691–701.
10. Wösten HA, Moukha SM, Sietsma JH, Wessels JG: Localization of growth
and secretion of proteins in Aspergillus niger.J Gen Microbiol 1991,
137(8):2017–23.
11. Taheri-Talesh N, Horio T, Araujo-Bazán L, Dou X, Espeso EA, Peñalva MA,
Osmani SA, Oakley BR: The tip growth apparatus of Aspergillus nidulans.
Mol Biol Cell 2008, 19:1439–1449.
12. Sagt CM, Müller WH, van der Heide L, Boonstra J, Verkleij AJ, Verrips CT:
Impaired cutinase secretion in Saccharomyces cerevisiae induces
irregular endoplasmic reticulum (ER) membrane proliferation, oxidative
stress, and ER-associated degradation. Appl Environ Microbiol 2002,
68:2155–2160.
13. Rakestraw A, Wittrup KD: Contrasting secretory processing of
simultaneously expressed heterologous proteins in Saccharomyces
cerevisiae.Biotechnol Bioeng 2006, 93:896–905.
14. Travers KJ, Patil CK, Wodicka L, Lockhart DJ, Weissman JS, Walter P:
Functional and genomic analyses reveal an essential coordination
between the unfolded protein response and ER-associated degradation.
Cell 2000, 101:249–258.
15. Gonzalez TN, Walter P: Ire1p: a kinase and site-specific endoribonuclease.
Methods Mol Biol 2001, 160:25–36.
16. Lee KP, Dey M, Neculai D, Cao C, Dever TE, Sicheri F: Structure of the dual
enzyme Ire1 reveals the basis for catalysis and regulation in
nonconventional RNA splicing. Cell 2008, 132:89–100.
17. Kimata Y, Kimata YI, Shimizu Y, Abe H, Farcasanu IC, Takeuchi M, Rose MD,
Kohno K: Genetic evidence for a role of BiP/Kar2 that regulates Ire1 in
response to accumulation of unfolded proteins. Mol Biol Cell 2003,
14:2559–2569.
18. Credle JJ, Finer-Moore JS, Papa FR, Stroud RM, Walter P: On the mechanism
of sensing unfolded protein in the endoplasmic reticulum. Proc Natl Acad
Sci USA 2005, 102:18773–18784.
19. Gardner BM, Walter P: Unfolded proteins are Ire1-activating ligands that
directly induce the unfolded protein response. Science 2011,
333(6051):1891–1894.
20. Sidrauski C, Walter P: The transmembrane kinase Ire1p is a site-specific
endonuclease that initiates mRNA splicing in the unfolded protein
response. Cell 1997, 90:1031–1039.
21. Kawahara T, Yanagi H, Yura T, Mori K: Unconventional splicing of HAC1/
ERN4 mRNA required for the unfolded protein response. Sequence-specific
and non-sequential cleavage of the splice sites. J Biol Chem. 1998,
273:1802–1807.
22. Valkonen M, Penttilä M, Saloheimo M: The ire1 and ptc2 genes involved in
the unfolded protein response pathway in the filamentous fungus
Trichoderma reesei.Mol Genet Genomics 2004, 272:443–451.
23. Shen X: Ellis RE, Lee K, Liu CY, Yang K, Solomon A, Yoshida H,
Morimoto R, Kurnit DM, Mori K. Kaufman RJ: Complementary signaling
pathways regulate the unfolded protein response and are required for C.
elegans development. Cell 2001, 107:893–903.
24. Calfon M, Zeng H, Urano F, Till JH, Hubbard SR, Harding HP, Clark SG,
Ron D: IRE1 couples endoplasmic reticulum load to secretory capacity by
processing the XBP-1 mRNA. Nature.Erratum in: Nature 420:202 2002,
415:92–96.
25. Lee K, Tirasophon W, Shen X, Michalak M, Prywes R, Okada T, Yoshida H,
Mori K, Kaufman RJ: IRE1-mediated unconventional mRNA splicing and
S2P-mediated ATF6 cleavage merge to regulate XBP1 in signaling the
unfolded protein response. Genes Dev 2002, 16:452–466.
26. Plongthongkum N, Kullawong N, Panyim S, Tirasophon W: Ire1 regulated
XBP1 mRNA splicing is essential for the unfolded protein response
(UPR) in Drosophila melanogaster.Biochem Biophys Res Commun 2007,
354:789–794.
27. Zhou J, Liu CY, Back SH, Clark RL, Peisach D, Xu Z, Kaufman RJ: The crystal
structure of human IRE1 luminal domain reveals a conserved
dimerization interface required for activation of the unfolded protein
response. Proc Natl Acad Sci U S A 2006, 103:14343–14348.
28. Korennykh AV, Egea PF, Korostelev AA, Finer-Moore J, Zhang C, Shokat KM,
Stroud RM, Walter P: The unfolded protein response signals through
high-order assembly of Ire1. Nature 2009, 457:687–693.
29. Mulder HJ, Saloheimo M, Penttila M, Madrid SM: The transcription factor
HacA mediates the unfolded protein response in Aspergillus niger, and
up-regulates its own transcription. Mol Genet Genomics 2004, 271:130–140.
30. Mulder HJ, Nikolaev I: HacA-dependent transcriptional switch releases
hacA mRNA from a translational block upon endoplasmic reticulum
stress. Eukaryot Cell 2009, 8:665–675.
31. Saloheimo M, Wang H, Valkonen M, Vasara T, Huuskonen A, Riikonen M,
Pakula T, Ward M, Penttilä M: Characterization of secretory genes ypt1/
yptA and nsf1/nsfA from two filamentous fungi: induction of secretory
pathway genes of Trichoderma reesei under secretion stress conditions.
Appl Environ Microbiol 2004, 70:459–467.
Carvalho et al. BMC Genomics 2012, 13:350 Page 15 of 17
http://www.biomedcentral.com/1471-2164/13/350
32. Mulder HJ, Nikolaev I, Madrid SM: HacA, the transcriptional activator of
the unfolded protein response (UPR) in Aspergillus niger, binds to partly
palindromic UPR elements of the consensus sequence 5'-CAN(G/A)
NTGT/GCCT-3'. Fungal Genet Biol 2006, 43:560–572.
33. Lee AH, Iwakoshi NN, Glimcher LH: XBP-1 regulates a subset of
endoplasmic reticulum resident chaperone genes in the unfolded
protein response. Mol Cell Biol 2003, 23:7448–59.
34. Shaffer AL, Shapiro-Shelef M, Iwakoshi NN, Lee AH, Qian SB, Zhao H, Yu X,
Yang L, Tan BK, Rosenwald A, Hurt EM, Petroulakis E, Sonenberg N,
Yewdell JW, Calame K, Glimcher LH, Staudt LM: XBP1, downstream of
Blimp-1, expands the secretory apparatus and other organelles, and
increases protein synthesis in plasma cell differentiation. Immunity 2004,
1:81–93.
35. Arvas M, Pakula T, Lanthaler K, Saloheimo M, Valkonen M, Suortti T,
Robson G, Penttilä M: Common features and interesting differences in
transcriptional responses to secretion stress in the fungi Trichoderma
reesei and Saccharomyces cerevisiae.BMC Genomics 2006, 7:32.
36. Sims AH, Gent ME, Lanthaler K, Dunn-Coleman NS, Oliver SG, Robson GD:
Transcriptome analysis of recombinant protein secretion by Aspergillus
nidulans and the unfolded-protein response in vivo. Appl Environ
Microbiol 2005, 71:2737–2747.
37. Guillemette T, van Peij NN, Goosen T, Lanthaler K, Robson GD,
van den Hondel CA, Stam H, Archer DB: Genomic analysis of the secretion
stress response in the enzyme-producing cell factory Aspergillus niger.
BMC Genomics 2007, 8:158.
38. Jørgensen TR, Goosen T, Hondel CA, Ram AF, Iversen JJ: Transcriptomic
comparison of Aspergillus niger growing on two different sugars reveals
coordinated regulation of the secretory pathway. BMC Genomics 2009,
10:44.
39. Robinson AS, Hines V, Wittrup KD: Protein disulfide isomerase
overexpression increases secretion of foreign proteins in Saccharomyces
cerevisiae.Biotechnology 1994, 12:381–384.
40. Harmsen MM, Bruyne MI, Raué HA, Maat J: Overexpression of binding
protein and disruption of the PMR1 gene synergistically stimulate
secretion of bovine prochymosin but not plant thaumatin in yeast. Appl
Microbiol Biotechnol 1996, 46:365–370.
41. Shusta EV, Raines RT, Plückthun A, Wittrup KD: Increasing the secretory
capacity of Saccharomyces cerevisiae for production of single-chain
antibody fragments. Nat Biotechnol 1998, 16:773–777.
42. Valkonen M, Penttilä M, Saloheimo M: Effects of inactivation and
constitutive expression of the unfolded- protein response pathway on
protein production in the yeast Saccharomyces cerevisiae.Appl Environ
Microbiol 2003, 69:2065–2072.
43. Valkonen M, Ward M, Wang H: Penttilä M. Saloheimo M: Improvement of
foreign-protein production in Aspergillus niger var. awamori by constitutive
induction of the unfolded-protein response. Appl Environ Microbiol 2003,
69:6979–6986.
44. Pakula TM, Laxell M, Huuskonen A, Uusitalo J, Saloheimo M, Penttilä M:
The effects of drugs inhibiting protein secretion in the filamentous
fungus Trichoderma reesei. Evidence for down-regulation of genes
that encode secreted proteins in the stressed cells. J Biol Chem 2003,
278:45011–45020.
45. Martínez IM, Chrispeels MJ: Genomic analysis of the unfolded protein
response in Arabidopsis shows its connection to important cellular
processes. Plant Cell 2003, 15:561–576.
46. Al-Sheikh H, Watson AJ, Lacey GA, Punt PJ, MacKenzie DA, Jeenes DJ,
Pakula T, Penttilä M, Alcocer MJ, Archer DB: Endoplasmic reticulum
stress leads to the selective transcriptional downregulation of the
glucoamylase gene in Aspergillus niger.Mol Microbiol 2004,
53:1731–1742.
47. Carvalho ND, Arentshorst M: Jin Kwon M, Meyer V, Ram AF: Expanding
the ku70 toolbox for filamentous fungi: establishment of
complementation vectors and recipient strains for advanced gene
analyses. Appl Microbiol Biotechnol 2010, 87:1463–1473.
48. Iversen JJL, Thomsen JK, Cox RP: On-line growth measurements in
bioreactors by titrating metabolic proton exchange. Appl Microbiol
Biotechnol 1994, 42:256–262.
49. Poulsen BR, Ruiter G, Visser J, Iversen JJ: Determination of first order
rate constants by natural logarithm of the slope plot exemplified by
analysis of Aspergillus niger in batch culture. Biotechnol Lett 2003,
25:565–571.
50. Nitsche BM, Crabtree J, Cerqueira GC, Meyer V, Ram AF, Wortman JR: New
resources for functional analysis of omics data for the genus Aspergillus.
BMC Genomics 2011, 12:486.
51. Nishikawa SI, Brodsky JL, Nakatsukasa K: Roles of molecular chaperones in
endoplasmic reticulum (ER) quality control and ER-associated
degradation (ERAD). J Biochem 2005, 137:551–555.
52. Pel HJ, de Winde JH, Archer DB, Dyer PS, Hofmann G, Schaap PJ, Turner G,
et al:Genome sequencing and analysis of the versatile cell factory
Aspergillus niger CBS 513.88. Nat Biotechnol 2007, 25:221–231.
53. Carvalho ND, Arentshorst M: Kooistra R, Stam H, Sagt CM, van den Hondel CA,
Ram AF: Effects of a defective ERAD pathway on growth and
heterologous protein production in Aspergillus niger.Appl Microbiol
Biotechnol 2011, 89:357–373.
54. Ye Y, Shibata Y, Yun C, Ron D, Rapoport TA: A membrane protein complex
mediates retro-translocation from the ER lumen into the cytosol. Nature
2001, 429:841–847.
55. Plemper RK, Bordallo J, Deak PM, Taxis C, Hitt R, Wolf DH: Genetic
interactions of Hrd3p and Der3p/Hrd1p with Sec61p suggest a
retro-translocation complex mediating protein transport for ER
degradation. J Cell Sci 1999, 112:4123–4134.
56. van Laar T, van der Eb AJ, Terleth C: Mif1: a missing link between the
unfolded protein response pathway and ER-associated protein
degradation? Curr Protein Pept Sci 2001, 2:169–190.
57. Tremblay LO, Herscovics A: Cloning and expression of a specific human
alpha 1,2-mannosidase that trims Man9GlcNAc2 to Man8GlcNAc2 isomer
B during N-glycan biosynthesis. Glycobiology 1999, 9:1073–1078.
58. Yuan XL, van der Kaaij RM, van den Hondel CA, Punt PJ, van der Maarel MJ,
Dijkhuizen L, Ram AF: Aspergillus niger genome-wide analysis reveals a
large number of novel alpha-glucan acting enzymes with unexpected
expression profiles. Mol Genet Genomics 2008, 279:545–561.
59. Petersen KL, Lehmbeck J, Christensen T: A new transcriptional activator
for amylase genes in Aspergillus.Mol Gen Genet 1999, 262:668–676.
60. VanKuyk PA, Benen JA, Wösten HA, Visser J, de Vries RP: A broader role
for AmyR in Aspergillus niger: regulation of the utilisation of D-glucose
or D-galactose containing oligo- and polysaccharides. Appl Microbiol
Biotechnol 2012, 93(1):285–93.
61. Lombraña M, Moralejo FJ, Pinto R, Martín JF: Modulation of Aspergillus
awamori thaumatin secretion by modification of bipA gene expression.
Appl Environ Microbiol 2004, 70:5145–5152.
62. Moralejo FJ, Watson AJ, Jeenes DJ, Archer DB, Martín JF: A defined level
of protein disulfide isomerase expression is required for optimal
secretion of thaumatin by Aspegillus awamori.Mol Genet Genomics 2001,
266:246–253.
63. de Virgilio M: Kitzmüller C, Schwaiger E, Klein M, Kreibich G, Ivessa NE:
Degradation of a short-lived glycoprotein from the lumen of the
endoplasmic reticulum: the role of N-linked glycans and the unfolded
protein response. Mol Biol Cell 1999, 10:4059–4073.
64. Wang B, Guo G, Wang C, Lin Y, Wang X, Zhao M, Guo Y, He M, Zhang Y,
Pan L: Survey of the transcriptome of Aspergillus oryzae via massively
parallel mRNA sequencing. Nucleic Acids Res 2010, 38:5075–5087.
65. Malhotra JD, Kaufman RJ: The endoplasmic reticulum and the unfolded
protein response. Semin Cell Dev Biol 2007, 18:716–731.
66. Niwa M, Sidrauski C, Kaufman RJ, Walter P: A role for presenilin-1 in
nuclear accumulation of Ire1 fragments and induction of the
mammalian unfolded protein response. Cell 1999, 99:691–702.
67. Vattem KM, Wek RC: Reinitiation involving upstream ORFs regulates ATF4
mRNA translation in mammalian cells. Proc Natl Acad Sci U S A 2004,
101:11269–11274.
68. Fels DR, Koumenis C: The PERK/eIF2alpha/ATF4 module of the UPR in
hypoxia resistance and tumor growth. Cancer Biol Ther 2006, 5:723–728.
69. Hinnebusch AG: Gene-specific translational control of the yeast GCN4
gene by phosphorylation of eukaryotic initiation factor 2. Mol Microbiol
1993, 10:215–223.
70. Harding HP, Zhang Y, Bertolotti A, Zeng H, Ron D: Perk is essential for
translational regulation and cell survival during the unfolded protein
response. Mol Cell 2000, 5:897–904.
71. Harding HP, Novoa I, Zhang Y, Zeng H, Wek R, Schapira M, Ron D:
Regulated translation initiation controls stress-induced gene expression
in mammalian cells. Mol Cell 2000, 6:1099–1108.
72. Patil CK, Li H, Walter P: Gcn4p and novel upstream activating sequences
regulate targets of the unfolded protein response. PLoS Biol 2004, 2:E246.
Carvalho et al. BMC Genomics 2012, 13:350 Page 16 of 17
http://www.biomedcentral.com/1471-2164/13/350
73. Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Calfon M, Sadri N, Yun C,
Popko B, Paules R, Stojdl DF, Bell JC, Hettmann T, Leiden JM, Ron D: An
integrated stress response regulates amino acid metabolism and
resistance to oxidative stress. Mol Cell 2003, 11:619–633.
74. Gilmore WJ, Kirby GM: Endoplasmic reticulum stress due to altered
cellular redox status positively regulates murine hepatic CYP2A5
expression. J Pharmacol Exp Ther 2004, 308:600–608.
75. van Huizen R, Martindale JL, Gorospe M, Holbrook NJ: P58IPK, a novel
endoplasmic reticulum stress-inducible protein and potential negative
regulator of eIF2alpha signaling. J Biol Chem 2003, 278:15558–15564.
76. Bommiasamy H, Back SH, Fagone P, Lee K, Meshinchi S, Vink E, Sriburi R,
Frank M, Jackowski S, Kaufman RJ, Brewer JW: ATF6alpha induces XBP1-
independent expansion of the endoplasmic reticulum. J Cell Sci 2009,
122:1626–1636.
77. Bennett JW, Lasure L: More gene manipulations in fungi. Academic; 1991.
78. Jørgensen TR, Nitsche BM, Lamers GE, Arentshorst M, van den Hondel CA,
Ram AF: Transcriptomic insights into the physiology of Aspergillus niger
approaching a specific growth rate of zero. Appl Environ Microbiol 2010,
76:5344–5355.
79. Bos CJ, Debets AJ, Swart K, Huybers A, Kobus G, Slakhorst SM: Genetic
analysis and the construction of master strains for assignment of genes
to six linkage groups in Aspergillus niger.Curr Genet 1988, 14:437–443.
80. Meyer V, Arentshorst M, El-Ghezal A, Drews AC, Kooistra R, van den Hondel
CA, Ram AF: Highly efficient gene targeting in the Aspergillus niger kusA
mutant. J Biotechnol 2007, 128:770–775.
81. Yuan XL, Roubos JA, van den Hondel CA, Ram AF: Identification of InuR,
a new Zn(II)2Cys6 transcriptional activator involved in the regulation
of inulinolytic genes in Aspergillus niger.Mol Genet Genomics 2008,
279:11–26.
82. de Ruiter-Jacobs YM, Broekhuijsen M, Unkles SE, Campbell EI, Kinghorn JR,
Contreras R, Pouwels PH, van den Hondel CA: A gene transfer system
based on the homologous pyrG gene and efficient expression of
bacterial genes in Aspergillus oryzae.Curr Genet 1989, 16:159–163.
83. Bergmeyer HU, Bernt E, Schmidt F, Stork H, Glucose. In Methods of
Enzymatic Analysis: Volume 3. Edited by Bergmeyer HU. New York: Academic;
1974:1196–1201.
84. Affymetrix (2002): Affymetrix. ExpressionAnalysis Technical Manual; 2002
http://www.affymetrix.com/support/technical/manuals.affx.
85. Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B,
Gautier L, Ge Y, Gentry J, et al:Bioconductor: open software development
for computational biology and bioinformatics. Genome Biol 2004, 5:R80.
86. Team RDC (2010): R: A language and environment for statistical computing.
Vienna, Austria: R Foundation for Statistical Computing; 2010.
87. Irizarry RA, Bolstad BM, Collin F, Cope LM, Hobbs B, Speed TP: Summaries
of Affymetrix GeneChip probe level data. Nucleic Acids Res 2003, 31:e15.
88. Smyth GK: Linear models and empirical bayes methods for assessing
differential expression in microarray experiments. Stat Appl Genet Mol Biol: 3:
Article3; 2004.
89. Benjamini Y, Hochberg Y: Controling the false discovery rate: a practical
and powerful approach to multiple testing. J Royal Stat Soc B 1995,
57:289–300.
90. Van den Berg RA, Hoefsloot HCJ, Westerhuis JA, Smilde AK, van der Werf
MJ: Centering, scaling, and transformations: improving the biological
information content of metabolomics data. BMC Genomics 2006, 7:142.
91. Van den Berg RA, Braaksma M, van der Veen D, van der Werf MJ, Punt PJ,
van der Oost J, de Graaff LH: Identification of modules in Aspergillus niger
by gene co-expression network analysis. Fungal Genet Biol 2010,
47:539–50.
doi:10.1186/1471-2164-13-350
Cite this article as: Carvalho et al.:Genome-wide expression analysis
upon constitutive activation of the HacA bZIP transcription factor in
Aspergillus niger reveals a coordinated cellular response to counteract
ER stress. BMC Genomics 2012 13:350.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Carvalho et al. BMC Genomics 2012, 13:350 Page 17 of 17
http://www.biomedcentral.com/1471-2164/13/350