Channeling of newly synthesized fatty acids to cholesterol esterification limits triglyceride synthesis in SND1-overexpressing hepatoma cells
Abstract
This research was supported by the Basque Government, Spain (grant IT-971-16) and the Ministry of Economy and Competitiveness, Spain (grant SAF2015-64352-R). H.N.I. was recipient of a research training fellowship from the Basque Government.
Full text
1 Channeling of newly synthesized fatty acids to cholesterol esterification limits triglyceride synthesis in SND1-overexpressing hepatoma cells Hiart Navarro-Imaz, Yolanda Chico, Yuri Rueda and Olatz Fresnedo Lipids & Liver Research Group, Department of Physiology, Faculty of Medicine and Nursing, University of the Basque Country UPV/EHU. Bº Sarriena s/n, 48940 Leioa, Spain. Hiart Navarro-Imaz: hiart.navarr[email protected]om Yolanda Chico: [email protected] Yuri Rueda: [email protected] Corresponding author: Olatz Fresnedo, Department of Physiology, Faculty of Medicine and Nursing, University of the Basque Country UPV/EHU, 48940 Leioa, Spain. Tel: +34 946015667; Fax: +34 946015662. E-mail address: [email protected] This is the accepted manuscript of the article that appeared in final form in Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids 1864(2) : 137-146 (2019), which has been published in final form at https://doi.org/10.1016/j.bbalip.2018.11.004. © 2018 Elsevier under CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/)
2 Abstract SND1 is a putative oncoprotein whose molecular function remains unclear. Its overexpression in hepatocellular carcinoma impairs cholesterol homeostasis due to the altered activation of the sterol regulatory element-binding protein (SREBP) 2, which results in the accumulation of cellular cholesteryl esters (CE). In this work, we explored whether high cholesterol synthesis and esterification originates changes in glycerolipid metabolism that might affect cell growth, given that acetyl-coenzyme A is required for cholesterogenesis and fatty acids (FA) are the substrates of acyl-coenzyme A:cholesterol acyltransferase (ACAT). SND1-overexpressing hepatoma cells show low triglyceride (TG) synthesis, but phospholipid biosynthesis or cell growth are not affected. Limited TG synthesis is not due to low acetyl-coenzyme A or NADPH availability. We demonstrate that the main factor limiting TG synthesis is the utilization of FAs for cholesterol esterification. These metabolic adaptations are linked to high Scd1 expression, needed for the de novo production of oleic acid, the main FA used by ACAT. We conclude that high cholesterogenesis due to SND1 overexpression might determine the channeling of FAs to CEs. Key words: SND1, cholesterol homeostasis, triglyceride accumulation, cancer lipid metabolism, hepatocellular carcinoma Highlights SND1-overexpressing hepatoma cells (McA-S) show low triglyceride (TG) synthesis Limited TG synthesis in McA-S cells is not due to low substrate or NADPH availability Fatty acid (FA) utilization for cholesterol esterification limits TG synthesis High cholesterogenesis might determine the channeling of FAs to cholesteryl esters Abbreviations ACAT, acyl-coenzyme A:cholesterol acyltransferase; ACC, acetyl-coenzyme A carboxylase; ACLY, ATP-citrate lyase; CE, cholesteryl ester; CoA, coenzyme A; EMEM, Eagle’s minimum essential medium; FA, fatty acid; HCC, hepatocellular carcinoma; OA, oleic acid; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PL, phospholipid; PPAR, peroxisome proliferator-activated receptor; S-58035, Sandoz-58035; SCD1, stearoyl-coenzyme A desaturase-1; SN, staphylococcal nuclease; SND1, staphylococcal nuclease domain-containing protein 1; SREBP, sterol regulatory element-binding protein; TG, triglyceride.
3 1. Introduction Staphylococcal nuclease domain-containing protein 1 (SND1), also called Tudor-SN, TSN, SND p102 or p100, is a highly conserved protein. The structural pattern of four staphylococcal nuclease (SN) domains, a Tudor domain and a 5th incomplete SN domain has been found in the homologues of different species and different cell types [1-6]. Multiple functions have been discovered for SND1, which reveals a complex biology. It was first described as a transcriptional coactivator (p100 coactivator [7]) and since then the regulation of gene expression is the most reported function [8-11]. Functions based on the interaction of SND1 with nucleic acids include regulation of splicing activity [12], degradation of mRNA linked to RNA-induced silencing complex [13] and regulation of translation [11]. In the field of pathophysiology it is considered an oncogenic protein based on a variety of effects of the differential expression of SND1. Loss of contact-mediated growth inhibition [14], modulation of the response against induced apoptosis [15] and of the viability and degradation of tumor suppressor genes [16], promotion of the expression of angiogenic factors [17] and induction of epithelial-mesenchymal transition [3,18], among others, are processes of carcinogenesis in which SND1 overexpression seems to be involved. Several works also show that the promoter activity of Snd1 gene is associated to cell factors linked to carcinogenesis [1921]. It has been shown that SND1 expression is altered in several cancer types, for example breast cancer [22,23], colon cancer [14,24,25] prostate cancer [26,27], lung cancer [28,29] and gliomas [30]. There is also some evidence that relates SND1 pathophysiology with lipid metabolism. Rajasekaran et al. described that SND1 promotes the degradation of monoglyceride lipase, fact that has been associated to a lower endocannabinoid degradation rate in hepatocellular carcinoma (HCC) [31]. Therefore, SND1 might have antitumorigenic effects through the modulation of apoptosis, angiogenesis and cellular migration attributed to endocannabinoids [32]. Other studies found that SND1 associates to lipidic structures in different steatogenic conditions [33,34]. It also seems that SND1 plays an essential role in adipogenesis as a coactivator of fatty acid (FA) and glucose metabolism regulator peroxisome proliferatoractivated receptor (PPAR) γ [35]. PPARγ activation has been described to act as a possible initiator of toxicity pathways in hepatocytes, by inducing FA uptake and synthesis in the liver (reviewed in [36]). Increase of FA levels can lead to lipotoxicity and inflammation, therefore some of the deleterious effects of SND1 in liver carcinogenesis might be related to the alteration of FA metabolism.
4 In a previous work, we showed that SND1 overexpression in HCC impairs cellular cholesterol distribution and homeostasis [37]. Sterol regulatory element-binding protein (SREBP) 2 is overactivated due to low cholesterol content of endoplasmic reticulum membranes, which triggers an exacerbated cholesterogenesis linked to enhanced cholesterol esterification. Those alterations result in the accumulation of cholesteryl esters (CE), a distinctive trait of SND1overexpressing hepatoma cells. Cholesterol esterification is catalyzed by acyl-coenzyme A:cholesterol acyltransferase (ACAT) and requires FAs, which can be either newly synthesized or exogenous FAs. In this work, we explored whether the alterations in cholesterol regulatory systems caused by SND1 overexpression originate changes in glycerolipid metabolism that might affect cell growth. 2. Materials and Methods 2.1. Cell lines, culture and treatments The cell lines used in this study were obtained in a previous work [37]. McA-RH7777 rat hepatoma cells were transfected with linearized pcDNA6 (Invitrogen) containing Snd1 (McA-S cells) or LacZ cDNA (McA-L cells). The cell line with the highest SND1 expression level (McA-S2) was used in this work; relevant characteristics of McA-S1 cell line, which has a lower SND1 expression level [37] are also shown in Figure S1. Cells were cultured in gelatin-coated plates with Eagle’s minimum essential medium (EMEM) supplemented with 9% fetal bovine serum (ATTC), 1.675 mM L-glutamine, 85 U/ml penicillin, 85 μg/ml streptomycin and 2 μg/ml blasticidin. Analyses and experiments were performed 72 h after cell seeding. Atorvastatin (0.1 μM; Sigma) or vehicle (0.6% DMSO), Sandoz-58035 (S-58035; ACAT inhibitor) (10 μM; Sigma) or vehicle (0.03% DMSO) and stearoyl-CoA desaturase (SCD1) inhibitor A939572 (1 μM; Tocris) or vehicle (0.001% DMSO) treatments were done by adding them to culture medium. 2.2. MTT and BrdU incorporation assays The quantification of the cellular metabolic rate was performed using the “Cell proliferation kit (MTT)” commercial kit from Roche following the manufacturers’ instructions. For BrdU incorporation assays the “Cell proliferation ELISA, BrdU” commercial kit from Roche was used. For both assays, 104 cells were seeded in gelatin-coated 96-well plates.
5 2.3. Cell fractionation For the isolation of the cytosolic fraction McA-L and McA-S cells (5-7·106) were lysed by a freezethaw cycle as described elsewhere [38]. The supernatant of 20,000 xg (10 min, 4 °C) centrifugation was recovered (cytosolic fraction) and samples were diluted to adjust protein content to a final concentration of 3-6 mg/ml. Isolation of the membrane fraction was carried out basically as described in [39]. Briefly, McA-L and McA-S cells (5-7·106) were harvested and passed through a 27 gauge needle 30 times. Supernatant obtained by a 7 min 1,000 xg centrifugation was centrifuged at 100,000 xg for 30 min in a TLA-55 Beckman rotor. The pelleted membrane fraction was resuspended in the adequate buffer. 2.4. Quantification of metabolites and dehydrogenase assays The quantification of cytosolic acetyl-coenzyme A (CoA) was performed using the “Coenzyme A Colorimetric/Fluorometric Assay” kit from BioVision. Citrate and fumarate were quantified using commercially available kits from Sigma. Dehydrogenase assays were performed as described in [38]. Kinetic assays were done using 30100 µg of cytosolic protein in a 96-well plate and activities for all enzymes were expressed as nmol of NADPH produced/min/mg of protein. 2.5. Lipid extraction and quantification Lipids were exhaustively extracted following the method described by Bligh and Dyer [40]. Lipid quantification was performed by thin layer chromatography and image analysis as described elsewhere [41]. 2.6. Radioactive labeling Quantification of radioactive precursor incorporation into lipids was done as described by Aspichueta et al. [39] using hepatoma cells cultured in 60 mm diameter plates (3.5·105 cells seeded). In the acetate and oleate incorporation experiments, after 68 h of culture, medium was changed to serum-free EMEM medium supplemented with a trace of [3H]acetate (20 µCi per plate; Perkin Elmer) or [3H]oleate (2 µCi per plate; Perkin Elmer). In some cases, serum-free medium was additionally supplemented with 0.02 or 0.4 mM oleic acid (OA) (conjugated with
6 0.025 or 0.5 % bovine serum albumin, respectively) 4 h before the incorporation assays. When included, 0.05 and 0.2 mM acetate were added to culture medium with the radioactive trace. In the glucose incorporation assay a trace of [3H]glucose (20 µCi per plate; Perkin Elmer) was added after 68 h of culture and in the case of [14C]glycerol (2 µCi per plate; Perkin Elmer) after 72 h. Cells were incubated for 4 h with labeled acetate, oleate and glucose and for 10 min with glycerol. 2.7. Glucose quantification and uptake assay Glucose content of the culture medium was measured using a commercially available enzymatic kit (Menarini). The glucose uptake assay was performed in 35 mm diameter plates (1.2·105 cells seeded) by adding 10 µCi of [3H]glucose per plate. After 2 minutes, cells were washed twice with PBS and harvested to measure the total radioactivity incorporated by liquid scintillation. 2.8. Protein measurement and western blotting Protein concentration was determined by the bicinchoninic acid method (Thermo Fisher Scientific) including 2% SDS in all samples to avoid erroneous measures due to the presence of lipid. For western blotting analysis, protein fractionation by SDS-PAGE, immunodetection and quantification by image analysis were performed as described elsewhere [42]. Primary antibodies and dilutions were the following: anti acetyl-CoA carboxylase (ACC) (Cell Signalling 3662; 1:1000), anti phosphorylated ACC (P-ACC) (Cell Signalling 3661S; 1:1000), anti SCD1 (Cell Signalling 2794; 1:1000) and anti glyceraldehyde 3-phosphate dehydrogenase (Abcam ab8245; 1:20,000). 2.9. Relative mRNA quantification by real time RT-PCR Total RNA was extracted using Trizol Reagent (Life Technologies) and cDNAs were obtained by retrotranscription (SuperScript III RT; Life Technologies) following the manufacturers’ instructions. Quantification of mRNA by real time PCR was performed using the SYBR Green detection system (Applied Biosystems) in an Applied Biosystems 7000 Real Time PCR System. Samples were analyzed in triplicate and Gapdh mRNA was used for normalization. Primer sequences were the following:
7 Acaca f: tggtgcagaggtaccgaagtg, r: gtcgtagtggccgttctgaaag; Acly f: gcttacggacagagagccacac; r: ctctgaaattgccttggctgac; Agpat9 f: gtgaagctcctctccacctg; r: ctccaaggttttcaccagga; Dgat1 f: ttcctaccgggatgtcaatc, r: tacagtgttctgggcagcag; Fasn f: gtggacatggtcacagacgatg, r: gtggaccccaaaaaaggagg; Gapdh f: gtgccagcctcgtctgatagac, r: aaggcagccctggtaaccag; Gpam f: actgggttgactgtggcttc, r: cgtgcatgaatagcaacacc; Pnpla2 f: ctgactcgagtttcggatgga, r: caaacattggcctggataagctc; Scd1 f: gcctttaatcatcccaagaacctc, r: ttcagcgtgtcctcctgagc; Srebf1 f: cgcagacgaggatcatcca, r: tcacgaggctttgcacttga. 2.10. Statistics Data are presented as the mean ± standard deviation (SD). Statistical significance of results was assessed by the unpaired Student’s t-test using Prism software (GraphPad). 3. Results 3.1. McA-S hepatoma cells have low stored triglyceride levels Seeing that SND1 overexpression in hepatoma cells promotes an overactivation of cholesterol synthesis [37] we wondered whether this metabolic alteration affects other pathways of lipid biosynthesis. First, we characterized the glycerolipid profile of McA-S cells comparing it with McA-L control cells. Figures 1A and S1A show that SND1 overexpression is associated to low levels of triglyceride (TG) and no changes were observed in the summation of the phospholipids (PL) detected (phosphatidylcholine, PC; phosphatidylethanolamine, PE; phosphatidylinositol, phosphatidylserine and cardiolipin) or in the percentages of the major PLs, PC and PE (Figure 1B). To assess the contribution of gene expression modifications in maintaining low TG levels, we quantified mRNA levels of several relevant proteins involved in the de novo TG biosynthesis process (Figures 2A and 2B). Figures 2C and S1B show that mRNA levels of the major enzymes of the FA biosynthesis pathway are enhanced in SND1-overexpressing cells, particularly those of Scd1, responsible for the formation of the double bond of OA. Overexpression of SCD1 protein was also confirmed by western blotting analysis (Figure 2E). In addition, Agpat and Dgat1, the main enzymes involved in FA esterification into TGs, and TG hydrolase Pnpla2 are all overexpressed (Figures 2D and S1B), which suggests that the ability to store and mobilize TG is not unbalanced in McA-S cells.
8 Figure 1. Low triglyceride (TG) content of SND1-overexpressing McA-S2 cells. (A) Lipids were extracted and quantified by image analysis after thin layer chromatography separation. TGs and the summation of all identified phospholipid (PL) species are shown. (B) Percentage of PLs corresponding to the major species, phosphatidylethanolamine (PE) and phosphatidylcholine (PC). Values represent the mean ± SD of N ≥ 26 obtained in 6 independent experiments. Student's t-test: **P ≤ 0.01. It is well known that short-term regulators that affect enzyme activities also regulate the lipogenic flux. One of the major limiting metabolic steps is the catalyzed by ACC (Acaca gene). Not only its expression but also its enzymatic activity can be regulated. Citrate, which is a donor of cytosolic acetyl-CoA (Figure 2A), is an allosteric regulator of ACC activity, and the phosphorylation state of ACC is especially important. Figure 2E depicts that although ACC protein shows a 2-fold overexpression in McA-S2 cells, P-ACC/ACC ratio is not significantly altered. We also quantified the cytosolic citrate concentration and no significant differences were detected between McA-S2 and McA-L cells (Figure 2F). However, there was a tendency of citrate levels to be lower in McA-S2 cells, and so we also quantified the cytosolic acetyl-CoA, the precursor of lipogenesis and cholesterogenesis obtained from citrate by cytosolic ATP-citrate lyase (ACLY). The concentration of cytosolic acetyl-CoA in McA-S2 was only slightly higher (Student’s t test, P = 0.057) than in control cells and the levels of cytosolic fumaric acid (cytosolic dicarboxylic acids are indicative of citrate export from mitochondria and metabolizing) were higher (Figure 2F). Altogether, these results suggest that McA-S cells have the capacity to provide precursors and synthesize FAs, and to esterify them for glycerolipid production. TG 0 30 60 90 120 ** McA-L McA-S2 nmol/mg protein PL 0 100 200 300 400 500 McA-L McA-S2 nmol/mg protein %PE 0 10 20 30 40 50 McA-L McA-S2 % of total PL %PC 0 15 30 45 60 McA-L McA-S2 % of total PL
9 Figure 2. The lipogenic program is overexpressed in McA-S2 hepatoma cells. (A) Diagram with the main steps of the fatty acid synthesis pathway and important processes in the lipogenic program. (B) Diagram of the triglyceride biosynthetic pathway. (C) Relative mRNA levels of lipogenic enzymes analyzed by RT-qPCR. Gapdh expression was used for normalization. (D) Relative mRNA levels of triglyceride biosynthetic enzymes and triglyceride hydrolase Pnpla2 analyzed by RT-qPCR. Gapdh expression was used for normalization. (E) Protein level of acetyl-CoA carboxylase (ACC), phosphorylated ACC (PACC) and stearoyl-CoA desaturase (SCD1) analyzed by western blotting. Protein samples from 3 independent McA-L and McA-S2 culture plates were used. The graphs show the quantification performed by image analysis using the loading control, GAPDH, as normalizer. (F) Cytosolic citrate, acetyl-CoA and fumarate levels were measured using commercially available kits. Values represent the mean ± SD of N ≥ 5. Student's t-test: *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001. A Acaca Acly Fasn Scd1 Srebf1 0 3 6 9McA-L McA-S2 **** *** *** *** mRNA (arbitrary units) C 0 50 100 150 200 Acetyl-CoA p=0.057 McA-L McA-S2 % of control E 0 50 100 150 200 250 Fumarate McA-L McA-S2 *** % of control F B Gpam Agpat Dgat1 0 1 2 3 **** * mRNA (arbitrary units) D Pnpla2 0.0 0.5 1.0 1.5 *** mRNA (arbitrary units) 0 30 60 90 120 Citrate McA-L McA-S2 % of control McA-L McA-S2 ACC P-ACC GAPDH SCD1 GAPDH McA-L McA-S2 0 200 400 600 ** McA-L McA-S2 SCD1 0 1 2 McA-L McA-S2 PACC/ACC
16 aggressiveness of the tumors [46,47]. In a previous study, we showed that hepatoma cells overexpressing SND1 protein overaccumulate CEs due to the impairment of the homeostatic mechanism based on the activation of SREBP2 [37]. Here we wanted to analyze whether the acceleration of CE synthesis caused by overexpression of SND1 in hepatoma cells might have an effect on the metabolism of glycerolipids. Since McA-S cells have a lower TG content than control cells (Figures 1A and S1A) linked to a lower incorporation of lipogenic substrates into TGs (Figures 3B, 5C, 5D, 6B and S1C), we wanted to search for the metabolic factors linking CE and TG anabolic pathways. In recent years, many works have underlined the role that adaptations of FA metabolism play in tumor development. Several enzymes of the FA biosynthetic pathway such as ACLY, ACC and fatty acid synthase are overexpressed in most cancer types, ensuring an enhanced cytosolic acetyl-CoA availability and high FA synthesis rate [43,48,49]. Thus, low TG biosynthetic ability could be a consequence of some kind of antitumorigenic effect of SND1 overexpression. Nevertheless, mRNA level analysis showed that limitation in TG synthesis in McA-S cells is not due to modifications in the lipogenic program (Figures 2B, 2D and S1B). Therefore, data indicate that low TG accumulation capacity is linked to changes in the metabolic channeling of some metabolite involved in TG anabolism. First, to analyze whether SND1 overexpression-induced excess cholesterogenesis could have a direct consequence on TG synthesis, we inhibited cholesterol synthesis but TG synthesis was unaffected (Figure 3A). Given that lowering cholesterogenesis does not induce TG accumulation, the availability of lipogenic substrate acetyl-CoA and reducing power seem unlikely to be accountable for the low TG synthesis rate. We confirmed this idea by measurements of cytosolic acetyl-CoA and NADPHgenerating enzyme activities (Figure 2F and Table 1). Additionally, cells were cultured in presence of metabolically relevant acetate concentrations that should enhance intracellular acetyl-CoA availability. This treatment promoted minor changes in TG content in McA-S2 cells compared to control cells (Figure 3B). According to our results, scarcity of lipogenic substrates can be rejected as an explanation for the low TG synthesis rate of McA-S cells. One of the main alterations contributing to cholesterol homeostasis impairment in McA-S cells is the high esterification rate of cholesterol [37]. In fact, inhibition of the ACAT activity using the compound S-58035 reverts the overactivation of SREBP2 by rising free cholesterol levels in the microsomal membranes [37]. The induction of cholesterol esterification might be a protective cell strategy to respond to the high cholesterogenesis, but channeling FAs to that pathway might limit their availability for processes like TG synthesis. After incubation with the ACAT activity inhibitor, a rapid increase in TG synthesis rate and the accumulation of TG in the membrane
17 fraction were observed in McA-S2 cells but not in control cells. These results place, for the first time in our knowledge, the esterification of cholesterol as a limiting metabolic factor of TG accumulation, probably linked in to the enhanced cholesterogenic capacity of McA-S cells in this case. The fact that PL levels and their biosynthetic rate were not affected by SND1 overexpression or by the treatments that modify metabolite fluxes, strongly suggests that the regulatory events that channel FAs to CE or TG must occur in the last step of the lipogenic pathway, the esterification of diacylglycerol. Equalization of TG synthesis in McA-L and McA-S2 cells by extracellular OA availability (Figure 6B) points to rapid substrate channeling modifications as a potential regulatory mechanism. Due to the potential toxicity of free cholesterol, its esterification has to be guaranteed by a sufficient FA supply; thus, a parallel increase of both the cholesterogenic capacity and the lipogenic program makes sense. In the cholesterol esterification reaction ACAT activity preferentially uses oleoyl-CoA as the acyl donor [50]. Miyazaki et al. [51] showed that SCD1 deficiency abolishes CE accumulation in mouse liver, thus, the cholesterol synthesis pathway and OA production seem to be linked. In our SND1-overexpressing hepatoma cell model, the enhanced lipogenic program includes the nearly 5-fold increased levels of SCD-1 protein (Figure 2E). By inhibiting SCD1 activity, TG levels dropped in McA-S2 cells but not in control ones indicating higher dependence on OA production (Figure 7). The fact that the simultaneous inhibition of ACAT activity recovered at least partially the TG levels in SND1-overexpressing hepatoma (Figure 7) agrees with the idea of channeling of newly synthesized OA to cholesterol esterification as a limiting factor of TG synthesis. Figure 8 summarizes the processes of lipid metabolism that characterize the metabolic fluxes in SND1-overexpressing hepatoma. This work shows a metabolic link between two alterations distinctive of cancer development and aggressiveness, i.e. CE accumulation and alteration of FA metabolism. Using stably transfected hepatoma cells, we have shown that overexpression of SND1, a putative oncoprotein that induces cholesterogenesis and CE accumulation, induced a reduction of the use of FA for TG synthesis but not a reduction of FA synthesis. The lipogenic process leading to oleoyl-CoA synthesis seems to be linked to cholesterol synthesis. These results emphasize the pathophysiological importance of SND1 in lipid homeostasis and represent a novel discovery in the link between cholesterol and acylglycerol metabolism in cancer cells and therefore a new field of potential therapeutic interest.
18 Figure 8. Proposed model for the glycerolipid metabolism alteration induced by SND1 overexpression. (A) SND1 induces cholesterogenesis and overexpression of stearoyl-CoA desaturase-1 (SCD1), which produces oleic acid for cholesterol esterification. Altogether, that reduces fatty acid availability for triglyceride (TG) synthesis but not for phospholipid (PL) synthesis. (B) When oleic acid is exogenously added, part of the fatty acid pool can be diverted to TG synthesis. CE, cholesteryl ester; DG, diglyceride. Funding This research was supported by the Basque Government grant IT-971-16 and the Spanish Ministry of Economy and Competitiveness grant SAF2015-64352-R. H.N.I. was recipient of a research training fellowship from the Basque Government. References [1] Porta A, Colonna-Romano S, Callebaut I, Franco A, Marzullo L, Kobayashi GS, et al. An homologue of the human 100-kDa protein (p100) is differentially expressed by Histoplasma capsulatum during infection of murine macrophages. Biochem Biophys Res Commun 1999 Jan 27;254(3):605-13. [2] Sami-Subbu R, Choi SB, Wu Y, Wang C, Okita TW. Identification of a cytoskeleton-associated 120 kDa RNA-binding protein in developing rice seeds. Plant Mol Biol 2001 May;46(1):79-88.
19 [3] Abe S, Sakai M, Yagi K, Hagino T, Ochi K, Shibata K, et al. A Tudor protein with multiple SNc domains from pea seedlings: cellular localization, partial characterization, sequence analysis, and phylogenetic relationships. J Exp Bot 2003 Mar;54(384):971-83. [4] Zhao CT, Shi KH, Su Y, Liang LY, Yan Y, Postlethwait J, et al. Two variants of zebrafish p100 are expressed during embryogenesis and regulated by Nodal signaling. FEBS Lett 2003 May 22;543(1-3):190-5. [5] Abe S, Wang PL, Takahashi F, Sasaki E. Structural analysis of cDNAs coding for 4SNc-Tudor domain protein from fish and their expression in yellowtail organs. Mar Biotechnol (NY) 2005 Nov-Dec;7(6):677-86. [6] Hossain MJ, Korde R, Singh S, Mohmmed A, Dasaradhi PV, Chauhan VS, et al. Tudor domain proteins in protozoan parasites and characterization of Plasmodium falciparum tudor staphylococcal nuclease. Int J Parasitol 2008 Apr;38(5):513-26. [7] Tong X, Drapkin R, Yalamanchili R, Mosialos G, Kieff E. The Epstein-Barr virus nuclear protein 2 acidic domain forms a complex with a novel cellular coactivator that can interact with TFIIE. Mol Cell Biol 1995 Sep;15(9):4735-44. [8] Leverson JD, Koskinen PJ, Orrico FC, Rainio EM, Jalkanen KJ, Dash AB, et al. Pim-1 kinase and p100 cooperate to enhance c-Myb activity. Mol Cell 1998 Oct;2(4):417-25. [9] Yang J, Aittomaki S, Pesu M, Carter K, Saarinen J, Kalkkinen N, et al. Identification of p100 as a coactivator for STAT6 that bridges STAT6 with RNA polymerase II. EMBO J 2002 Sep 16;21(18):4950-8. [10] Low SH, Vasanth S, Larson CH, Mukherjee S, Sharma N, Kinter MT, et al. Polycystin-1, STAT6, and P100 function in a pathway that transduces ciliary mechanosensation and is activated in polycystic kidney disease. Dev Cell 2006 Jan;10(1):57-69. [11] Paukku K, Kalkkinen N, Silvennoinen O, Kontula KK, Lehtonen JY. p100 increases AT1R expression through interaction with AT1R 3'-UTR. Nucleic Acids Res 2008 Aug;36(13):4474-87. [12] Yang J, Valineva T, Hong J, Bu T, Yao Z, Jensen ON, et al. Transcriptional co-activator protein p100 interacts with snRNP proteins and facilitates the assembly of the spliceosome. Nucleic Acids Res 2007;35(13):4485-94. [13] Caudy AA, Ketting RF, Hammond SM, Denli AM, Bathoorn AM, Tops BB, et al. A micrococcal nuclease homologue in RNAi effector complexes. Nature 2003 Sep 25;425(6956):411-4. [14] Tsuchiya N, Ochiai M, Nakashima K, Ubagai T, Sugimura T, Nakagama H. SND1, a component of RNA-induced silencing complex, is up-regulated in human colon cancers and implicated in early stage colon carcinogenesis. Cancer Res 2007 Oct 1;67(19):9568-76. [15] Sundstrom JF, Vaculova A, Smertenko AP, Savenkov EI, Golovko A, Minina E, et al. Tudor staphylococcal nuclease is an evolutionarily conserved component of the programmed cell death degradome. Nat Cell Biol 2009 Nov;11(11):1347-54.
20 [16] Yoo BK, Santhekadur PK, Gredler R, Chen D, Emdad L, Bhutia S, et al. Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma. Hepatology 2011 May;53(5):1538-48. [17] Santhekadur PK, Das SK, Gredler R, Chen D, Srivastava J, Robertson C, et al. Multifunction protein staphylococcal nuclease domain containing 1 (SND1) promotes tumor angiogenesis in human hepatocellular carcinoma through novel pathway that involves nuclear factor kappaB and miR-221. J Biol Chem 2012 Apr 20;287(17):13952-8. [18] Santhekadur PK, Akiel M, Emdad L, Gredler R, Srivastava J, Rajasekaran D, et al. Staphylococcal nuclease domain containing-1 (SND1) promotes migration and invasion via angiotensin II type 1 receptor (AT1R) and TGFbeta signaling. FEBS Open Bio 2014 Apr 1;4:35361. [19] Armengol S, Arretxe E, Rodriguez L, Ochoa B, Chico Y, Martinez MJ. NF-kappaB, Sp1 and NFY as transcriptional regulators of human SND1 gene. Biochimie 2013 Apr;95(4):735-42. [20] Armengol S, Arretxe E, Enzunza L, Mula S, Ochoa B, Chico Y, et al. The promoter of cell growthand RNA protection-associated SND1 gene is activated by endoplasmic reticulum stress in human hepatoma cells. BMC Biochem 2014 Dec 11;15:25,014-0025-2. [21] Armengol S, Arretxe E, Enzunza L, Llorente I, Mendibil U, Navarro-Imaz H, et al. SREBP-2driven transcriptional activation of human SND1 oncogene. Oncotarget 2017 Nov 21;8(64):108181-94. [22] Ho J, Kong JW, Choong LY, Loh MC, Toy W, Chong PK, et al. Novel breast cancer metastasisassociated proteins. J Proteome Res 2009 Feb;8(2):583-94. [23] Yu L, Di Y, Xin L, Ren Y, Liu X, Sun X, et al. SND1 acts as a novel gene transcription activator recognizing the conserved Motif domains of Smad promoters, inducing TGFbeta1 response and breast cancer metastasis. Oncogene 2017 Jul 6;36(27):3903-14. [24] Tsuchiya N, Nakagama H. MicroRNA, SND1, and alterations in translational regulation in colon carcinogenesis. Mutat Res 2010 Nov 10;693(1-2):94-100. [25] Wang N, Du X, Zang L, Song N, Yang T, Dong R, et al. Prognostic impact of Metadherin-SND1 interaction in colon cancer. Mol Biol Rep 2012 Dec;39(12):10497-504. [26] Kuruma H, Kamata Y, Takahashi H, Igarashi K, Kimura T, Miki K, et al. Staphylococcal nuclease domain-containing protein 1 as a potential tissue marker for prostate cancer. Am J Pathol 2009 Jun;174(6):2044-50. [27] Cappellari M, Bielli P, Paronetto MP, Ciccosanti F, Fimia GM, Saarikettu J, et al. The transcriptional co-activator SND1 is a novel regulator of alternative splicing in prostate cancer cells. Oncogene 2014 Jul 17;33(29):3794-802. [28] Zagryazhskaya A, Surova O, Akbar NS, Allavena G, Gyuraszova K, Zborovskaya IB, et al. Tudor staphylococcal nuclease drives chemoresistance of non-small cell lung carcinoma cells by regulating S100A11. Oncotarget 2015 May 20;6(14):12156-73.
21 [29] Xing A, Pan L, Gao J. p100 functions as a metastasis activator and is targeted by tumor suppressing microRNA-320a in lung cancer. Thorac Cancer 2018 Jan;9(1):152-8. [30] Tong L, Wang C, Hu X, Pang B, Yang Z, He Z, et al. Correlated overexpression of metadherin and SND1 in glioma cells. Biol Chem 2016 Jan;397(1):57-65. [31] Rajasekaran D, Jariwala N, Mendoza RG, Robertson CL, Akiel MA, Dozmorov M, et al. Staphylococcal Nuclease and Tudor Domain Containing 1 (SND1 Protein) Promotes Hepatocarcinogenesis by Inhibiting Monoglyceride Lipase (MGLL). J Biol Chem 2016 May 13;291(20):10736-46. [32] Hermanson DJ, Marnett LJ. Cannabinoids, endocannabinoids, and cancer. Cancer Metastasis Rev 2011 Dec;30(3-4):599-612. [33] Keenan TW, Winter S, Rackwitz HR, Heid HW. Nuclear coactivator protein p100 is present in endoplasmic reticulum and lipid droplets of milk secreting cells. Biochim Biophys Acta 2000 Sep 1;1523(1):84-90. [34] Garcia-Arcos I, Rueda Y, Gonzalez-Kother P, Palacios L, Ochoa B, Fresnedo O. Association of SND1 protein to low density lipid droplets in liver steatosis. J Physiol Biochem 2010 Mar;66(1):73-83. [35] Duan Z, Zhao X, Fu X, Su C, Xin L, Saarikettu J, et al. Tudor-SN, a novel coactivator of peroxisome proliferator-activated receptor gamma protein, is essential for adipogenesis. J Biol Chem 2014 Mar 21;289(12):8364-74. [36] Al Sharif M, Alov P, Vitcheva V, Pajeva I, Tsakovska I. Modes-of-Action Related to Repeated Dose Toxicity: Tissue-Specific Biological Roles of PPAR gamma Ligand-Dependent Dysregulation in Nonalcoholic Fatty Liver Disease. PPAR Res 2014;2014:432647. [37] Navarro-Imaz H, Rueda Y, Fresnedo O. SND1 overexpression deregulates cholesterol homeostasis in hepatocellular carcinoma. Biochim Biophys Acta 2016 Sep;1861(9 Pt A):988-96. [38] Brown LJ, Longacre MJ, Hasan NM, Kendrick MA, Stoker SW, Macdonald MJ. Chronic reduction of the cytosolic or mitochondrial NAD(P)-malic enzyme does not affect insulin secretion in a rat insulinoma cell line. J Biol Chem 2009 Dec 18;284(51):35359-67. [39] Gong Y, Lee JN, Lee PC, Goldstein JL, Brown MS, Ye J. Sterol-regulated ubiquitination and degradation of Insig-1 creates a convergent mechanism for feedback control of cholesterol synthesis and uptake. Cell Metab 2006 Jan;3(1):15-24. [40] Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol 1959 Aug;37(8):911-7. [41] Ruiz JI, Ochoa B. Quantification in the subnanomolar range of phospholipids and neutral lipids by monodimensional thin-layer chromatography and image analysis. J Lipid Res 1997 Jul;38(7):1482-9. [42] Palacios L, Ochoa B, Gomez-Lechon MJ, Castell JV, Fresnedo O. Overexpression of SND p102, a rat homologue of p100 coactivator, promotes the secretion of lipoprotein phospholipids in primary hepatocytes. Biochim Biophys Acta 2006 Jul;1761(7):698-708.
22 [43] Santos CR, Schulze A. Lipid metabolism in cancer. FEBS J 2012 Aug;279(15):2610-23. [44] Rao S, Porter DC, Chen X, Herliczek T, Lowe M, Keyomarsi K. Lovastatin-mediated G1 arrest is through inhibition of the proteasome, independent of hydroxymethyl glutaryl-CoA reductase. Proc Natl Acad Sci U S A 1999 Jul 6;96(14):7797-802. [45] Clendening JW, Pandyra A, Boutros PC, El Ghamrasni S, Khosravi F, Trentin GA, et al. Dysregulation of the mevalonate pathway promotes transformation. Proc Natl Acad Sci U S A 2010 Aug 24;107(34):15051-6. [46] Yue S, Li J, Lee SY, Lee HJ, Shao T, Song B, et al. Cholesteryl ester accumulation induced by PTEN loss and PI3K/AKT activation underlies human prostate cancer aggressiveness. Cell Metab 2014 Mar 4;19(3):393-406. [47] de Gonzalo-Calvo D, Lopez-Vilaro L, Nasarre L, Perez-Olabarria M, Vazquez T, Escuin D, et al. Intratumor cholesteryl ester accumulation is associated with human breast cancer proliferation and aggressive potential: a molecular and clinicopathological study. BMC Cancer 2015 Jun 9;15:460,015-1469-5. [48] Baenke F, Peck B, Miess H, Schulze A. Hooked on fat: the role of lipid synthesis in cancer metabolism and tumour development. Dis Model Mech 2013 Nov;6(6):1353-63. [49] Beloribi-Djefaflia S, Vasseur S, Guillaumond F. Lipid metabolic reprogramming in cancer cells. Oncogenesis 2016 Jan 25;5:e189. [50] Chang TY, Chang CC, Cheng D. Acyl-coenzyme A:cholesterol acyltransferase. Annu Rev Biochem 1997;66:613-38. [51] Miyazaki M, Kim YC, Gray-Keller MP, Attie AD, Ntambi JM. The biosynthesis of hepatic cholesterol esters and triglycerides is impaired in mice with a disruption of the gene for stearoylCoA desaturase 1. J Biol Chem 2000 Sep 29;275(39):30132-8.
23 Supplementary material Figure S1. Characterization of McA-S1 cells. (A) Lipid contents. Lipids were extracted and quantified by image analysis after thin layer chromatography separation. Triglycerides (TG), cholesteryl esters (CE) and the summation of all identified phospholipid (PL) species are shown. Values represent the mean ± SD of N = 7. (B) Relative mRNA levels of lipogenic enzymes, triglyceride biosynthetic enzymes and triglyceride hydrolase Pnpla2 analyzed by RT-qPCR. Gapdh expression was used for normalization. Presented data are relative to cellular protein. (C) Incorporation of radioactive acetic acid (AA) or oleic acid (OA) into TGs. Cells cultured for 68 h were treated with a 20 µCi/plate trace of [3H]acetate or with 20 µM OA with a 2 µCi/plate trace of [3H]oleate for 4 h. Cells were harvested, lipids extracted and separated by thin layer chromatography and radioactivity associated to TG measured by liquid scintillation. Values represent the mean ± SD of N = 5. Data organization in graphs is the same as in Fig. 2. Values represent the mean ± SD of N = 4. Student's t-test: *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001. TG CE PL 0 50 150 250 McA-L McA-S1 ** *** nmol/mg prot Acaca Acly Fasn Scd1 Srebf1 0 3 6 9 12 * *** *** *** *** mRNA (arbitrary units) Gpam Agpat Dgat1 0 1 2 3 4 *** *** ** mRNA (arbitrary units) Pnpla2 0.0 0.5 1.0 1.5 *** mRNA (arbitrary units) A Lipid content C Incorporation of lipogenic substrates into cellular TG B mRNA levels 0 5 10 15 20 AA OA *** *** % of total lipids