First insights into the phylogeny of the order Cribrariales (Amoebozoa, Myxomycetes), with the definite exclusion of the genus Enteridium

1 First insights into the phylogeny of the order Cribrariales (Amoebozoa, Myxomycetes), with the definite exclusion of the genus Enteridium Juan Carlos Zamora1,2 , Daniel Rodrigues1,2 , Iván García-Cunchillos3,4 , Carlos Lado4 1 Conservatoire et Jardin botaniques de Genève, Chemin de l'Impératrice 1, 1292 Chambésy, Switzerland 2 Department of Plant Sciences, University of Geneva, Quai Ernest-Ansermet 30, 1205 Genève, Switzerland 3 Institute of Evolutionary Biology, Biological and Chemical Research Centre, Faculty of Biology, University of Warsaw, Warsaw, Poland 4 Real Jardín Botánico, CSIC, Plaza de Murillo 2, 28014 Madrid, Spain Corresponding author: Juan Carlos Zamora ([email protected]) Copyright: © Juan Carlos Zamora et al. This is an open access article distributed under terms of the Creative Commons Attribution License (Attribution 4.0 International – CC BY 4.0). Research Article Abstract The order Cribrariales is among the least studied higher groups in the Myxomycetes, with numerous taxonomic problems and scarce molecular data available in public databases. Of the three genera currently accepted, viz. Cribraria, Lindbladia, and Enteridium, the last one shows a set of morphological characters clearly disagreeing with the two former ones. Using a representative sampling and two unlinked loci (nuclear and mitochondrial SSU), we assessed the phylogenetic relationships in the bright-spored Myxomycetes (Lucisporomycetidae) and concluded that the genus Enteridium must be excluded from the order Cribrariales and placed instead within the order Trichiales, family Dianemataceae. We provide detailed explanations of why this genus has been misclassified in previous studies, and define its morphological and molecular boundaries, performing two necessary new combinations. On the other hand, the phylogeny of the order Cribrariales s.str. shows three main lineages that are distinguished as three subgenera, viz. C. subg. Cribraria, C. subg. Dictydium, and C. subg. Ionokylix subg. nov., the first one including the genus Lindbladia deeply nested and therefore treated as a heterotypic synonym of Cribraria. Key words: Bright-spored Myxomycetes, Cribraria, dictydine granules, Lindbladia, nomenclature, plasmodium, taxonomy, Trichiales Introduction A “natural” (phyletic) classification of the Myxomycetes has been aspired to for decades, and the combination of morphological and molecular data has allowed a more accurate and stable classification of the higher-level groups of these organisms. Early studies by Rostafiński (1874, 1875) and Lister (1894, 1925) roughly classified the Myxomycetes in two large groups, viz., Lamprosporeae/Lamprosporales and Amaurosporeae/Amaurosporales, according to the pigmentation of the spores, bright or dark, respectively. These two major lineages were retrieved by Fiore-Donno et al. (2010) in DNA-based phylogenies. At that time, the “bright-spored” clade comprised the orders Trichiales T. Macbr. and Cribrariales T. Macbr. s.l. (as Liceales), while the “dark-spored” Academic editor: Marco Thines Received: 23 May 2025 Accepted: 2 August 2025 Published: 2 October 2025 Citation: Zamora JC, Rodrigues D, García-Cunchillos I, Lado C (2025) First insights into the phylogeny of the order Cribrariales (Amoebozoa, Myxomycetes), with the definite exclusion of the genus Enteridium. IMA Fungus 16: e159960. https://doi. org/10.3897/imafungus.16.159960 IMA Fungus 16: e159960 (2025) DOI: 10.3897/imafungus.16.159960 2 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales clade included the orders Physarales T. Macbr., Stemonitidales T. Macbr. (as “Stemonitales”) s.l., and Echinosteliales G.W. Martin. Fiore-Donno et al. (2008) demonstrated the paraphyly of the order Stemonitidales, while Fiore-Donno et al. (2013) showed the paraphyly of both Trichiales and Cribrariales (as Liceales) in their original concepts. Leontyev et al. (2019) have proposed taxonomic amendments for all major groups of Myxomycetes, intending to construct a global classification exclusively based on monophyletic taxa, and providing new names in agreement with the International Code of Nomenclature for algae, fungi, and plants (ICN, Turland et al. 2025). In its current concept, i.e., in strict sense, the order Cribrariales, with the sole family Cribrariaceae Corda, stands out as the earliest diverging lineage of the bright-spored clade (Fiore-Donno et al. 2013; Leontyev et al. 2019). Ramírez-Ortega et al. (2009) published a morphology-based phylogeny of the Myxomycetes with especial emphasis on Cribraria Pers., but their results substantially differ from Myxomycetes phylogenies based on molecular data and published around that time (e.g., Fiore-Donno et al. 2005, 2008, 2010) and later on. Very few Cribrariaceae sequences are available in public databases, possibly due to the difficulties for PCR amplification caused by high sequence divergence and the presence of long introns (Fiore-Donno et al. 2013). Remarkably, incorporating this information into the phylogenies revealed that the species Lindladia tubulina Fr. is deeply nested within Cribraria, while C. cancellata (Batsch) Nann.-Bremek. represents an early-diverging lineage, sister to all other species of Cribrariaceae (Fiore-Donno et al. 2013). No other studies focused on the phylogenetic relationships of the Cribrariaceae have been published in the last decade and the taxonomic position of most of its members is far from being resolved. Most current taxonomic treatments of the family Cribrariaceae include two genera, viz., Lindbladia, with the single accepted species L. tubulina, characterized by the aethaliate or pseudoaethaliate sporophores, usually with a more or less unperforated peridium (Hatano et al. 1996), and Cribraria, with ca. 50 sporocarpic species in which the remnants of the peridium persist in the form of a net, ribs, or nodes, and often also as a basal calyculus (Poulain et al. 2011; Lado and Eliasson 2022). Leontyev et al. (2019) included the genus Enteridium Ehrenb. (as “Licaethalium Rostaf.”) in the order Cribrariales s.str., based on morphological and molecular data from specimens identified as E. olivaceum Ehrenb. in a previous study (Leontyev et al. 2015). However, E. olivaceum lacks one of the diagnostic characters of the order Cribrariales, the dictydine granules, while it presents clustered spores, a feature previously unknown in the Cribrariales. These inconsistencies, coupled with the high divergence between the two DNA sequences ascribed to E. olivaceum in Leontyev et al. (2015) and their absence from the large analysis of Leontyev et al. (2019), advise for a revised study focused on the taxonomy and classification of this taxon. Through the inference of a DNA-based phylogeny and detailed morphological studies of a representative taxon sampling, the present study aims at (i) reassessing the taxonomic placement of the genus Enteridium, establishing its boundaries with respect to the most closely related genera, (ii) providing an updated nomenclatural analysis of the names Enteridium and Licaethalium to contribute to their nomenclatural stability, and (iii) establishing the limits and diagnostic characters of the order Cribrariales s.str., revising the nomenclature at generic and infrageneric levels. 3 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales Material and methods Sampling 49 new samples were selected for morphological and molecular study, comprising 31 specimens of Cribrariales, five of Reticulariales, one of Liceales, and 12 of Trichiales. This selection was complemented, for the molecular analyses, by a fair sampling of bright-spored Myxomycetes sequences analysed in Fiore-Donno et al. (2013) and García-Cunchillos et al. (2022), to retrieve the longest sequences of the targeted DNA regions (nrSSU and mtSSU, see below) while keeping most species and all major clades. In addition, we included the available genuine nrSSU sequences of Cribraria and Enteridium available in GenBank to compare them with our newly generated sequences, regardless of their length. This taxonomic sampling comprised a total of ca. 100 species and ca. 20 genera in the four recognized orders of bright-spored Myxomycetes. Finally, 18 specimens from the dark-spored clade (families Didymiaceae and Physaraceae) from García-Martín et al. (2023), with nearly complete nrSSU and mtSSU sequences, were selected as outgroup to root the phylogenies, based on Fiore-Donno et al. (2010). The list of newly sequenced specimens selected for phylogenetic analyses can be found in Table 1. Morphology The morphological characters of the studied specimens were gathered from both fresh samples, collected in the field or raised in moist chamber cultures (Gilbert and Martin 1933), and from dried specimens of the herbaria G (including the collections of M. Meyer), MA-Fungi (including the collections from C. Lado, S. Lloyd, and T. Van Der Heul), and O (https://sweetgum.nybg.org/science/ih/), and the private collections of H. Koskinen (Finland), M. Wilhelm (Switzerland), and B. Woerly (France). Herbarium specimens were directly observed and photographed with a Leica M165C stereomicroscope, coupled with a DMC2900 digital camera, and mounted in Hoyer’s medium (Martin and Alexopoulos 1969) or occasionally in water for study and photography under a Leica DM2000 light microscope, coupled with a DMC5400 digital camera. Some representative specimens were selected for study under the scanning electron microscopes (SEM) of the Royal Botanic Garden of Madrid, by using a Hitachi S-3000N SEM and a Jeol T330A (Tokyo, Japan) at 10–15 kV. All samples were dehydrated in acetone series starting at 30% up to 100% for 15 minutes each step, dried with the critical point technique and coated with gold in a Balzers SCD 004 sputter coat. The specimens were determined by using the general identification keys (e.g., Lister 1925; Martin and Alexopoulos 1969; Nannenga-Bremekamp 1974, 1991, 2022; Neubert et al. 1993; Lado and Pando 1997; Poulain et al. 2011), specific taxonomic treatments (e.g., Nannenga-Bremekamp 1958, 1962, 1964, 1971; Hatano 1988; Keller et al. 1988; Hatano et al. 1996), as well as information directly retrieved from the protologues. Our observations were complemented with those made by other authors and available in the literature. DNA extraction, PCR amplification and sequencing Two to ten adjacent sporocarps, or an equivalent amount for aethaliate species, were taken from each specimen for DNA extraction. Each sample was 4 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales transferred to a 1.5 ml tube containing one tungsten bead, frozen at -20 °C for at least one hour, and then mechanically disrupted in a TissueLyser II. DNA extractions were made using two commercial kits: the Norgen Biotek Corp Plant/ Table 1. Specimens from which Sanger DNA sequences were newly generated in this study, with geographical origin, voucher information and GenBank accession numbers. Taxon Country Herbarium voucher (collector number) Genbank asession numbers nrSSU-1 nrSSU-2 nrSSU-3 mtSSU Cribraria argillacea Switzerland G00586004 (D. Rodrigues 8/2022) PV943897 PV943897 PV943897 PV943852 Cribraria argillacea Sweden G00586061 (D. Rodrigues 39/2023) PV943898 PV943898 –PV943853 Cribraria aurantiaca Spain G00586271 (D. Rodrigues 225/2023) –PV943899 PV943900 PV943854 Cribraria cancellata var. cancellata Spain G00586046 (D. Rodrigues 38/2022) PV943901 PV943901 –PV943855 Cribraria cf. cancellata var. fusca Chile MA-Fungi 80564 (Lado 17172) PV943902 – – PV943856 Cribraria cancellata var. fusca France MA-Fungi 94033 (M. Meyer 49156) PV943903 – – PV943857 Cribraria confusa France MA-Fungi 89818 (M. Meyer 33037) PV943904 – – PV943858 Cribraria cribrarioides Japan MA-Fungi (Lado 25828) –––PV943859 Cribraria cf. intricata Sweden G00586150 (D. Rodrigues 46/2023) PV943905 PV943905 PV943905 PV943860 Cribraria aff. lepida Australia MA-Fungi (TVDH 531) PV943906 – – PV943861 Cribraria cf. macrocarpa Finland G00586115 (D. Rodrigues 103/2023) PV943907 PV943907 PV943907 PV943862 Cribraria meylanii Norway O F-371517 (E.W. Johannesen s/n) PV943908 – – PV943863 Cribraria meylanii Switzerland G00586187 (M. Wilhelm s/n) PV943909 PV943909 PV943909 PV943864 Cribraria minutissima Australia MA-Fungi (Lloyd, S.J. 2018) –––PV943865 Cribraria minutissima Spain MA-Fungi (Lado 27818) –––PV943866 Cribraria mirabilis Norway O F-371516 (K.A. Mandal s/n) PV943910 – – PV943867 Cribraria cf. piriformis Switzerland G00586042 (D. Rodrigues 34/2022) PV943911 PV943911 PV943911 PV943868 Cribraria purpurea Finland G00586358 (H. Koskinen JX.164888#7) PV943912 PV943912 –PV943869 Cribraria rubiginosa The Netherlands G00586350 (M. Meyer 30448) –––PV943870 Cribraria rufa Finland G00586359 (H. Koskinen JX.1648888#5) PV943913 PV943913 PV943913 PV943871 Cribraria rufa Finland G00586360 (H. Koskinen JX.1640936#3) PV943914 PV943914 PV943914 PV943872 Cribraria tubulina Spain G00586002 (D. Rodrigues 33/2022) PV943924 PV943924 PV943924 PV943879 Cribraria tubulina Spain G00586060 (D. Rodrigues 135/2023) PV943925 PV943925 –PV943880 Cribraria violacea Switzerland G00586003 (D. Rodrigues 9/2022) – – PV943915 PV943873 Cribraria vulgaris Spain MA-Fungi 61604 (Oltra 7197) PV943916 – – PV943874 Cribraria zonatispora Spain G00586255 (D. Rodrigues 208/2023) –––PV943875 Cribraria sp. Australia MA-Fungi (Lloyd, S.J. 1988) PV943917 PV943918 PV943919 PV943876 Cribraria sp. Australia MA-Fungi (TVDH 568) PV943920 –PV943921 PV943877 Cribraria sp. Switzerland G00586314 (J.C. Zamora s/n) PV943922 PV943922 PV943923 PV943878 Licea castanea Finland G00586172 (D. Rodrigues 83/2023) – – PV943926 PV943881 Arcyria cinerea s.l. Switzerland G00586054 (D. Rodrigues 13/2023) PV943927 –PV943928 PV943882 Enteridium corticatum France G00586351 (M. Meyer 24378) –––PV943883 Enteridium cf. liceoides France G00586352 (B. Woerly 3435a) PV943929 – – PV943884 Enteridium cf. liceoides Spain MA-Fungi 71211 (L.C. Rey CR77M99) –––PV943885 Enteridium olivaceum Spain MA-Fungi 57408 (Oltra 4138) PV943930 – – PV943886 Enteridium olivaceum Spain MA-Fungi 39466 (Oltra 1730) PV943931 – – PV943887 Enteridium olivaceum France G00586353 (M. Meyer 47160) PV943932 ––– Enteridium cf. simulans France G00586354 (M. Meyer 29889) –––PV943888 Enteridium variabile Finland G00586171 (D. Rodrigues 86/2023) –––PV943889 Enteridium variabile Finland G00586173 (D. Rodrigues 123/2023) PV943933 –PV943934 PV943890 Enteridium variabile Finland G00586174 (D. Rodrigues 115/2023) – – PV943935 PV943891 Enteridium variabile Finland G00586169 (D. Rodrigues 98/2023) PV943936 –PV943937 – Lycogala flavofuscum Italy G00586355 (M. Meyer 22037) –PV943938 –PV943892 Lycogala flavofuscum Spain G00586059 (D. Rodrigues 136/2023) PV943939 PV943939 PV943939 PV943893 Lycogala leopardinum Switzerland G00586053 (D. Rodrigues 12/2023) –PV943940 –PV943894 Reticularia lycoperdon France G00586356 (M. Meyer 22374) PV943941 – – PV943895 Tubifera ferruginosa France G00586357 (M. Meyer 31696) PV943942 PV943942 PV943942 PV943896 5 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales Fungi DNA Isolation Kit (Canada; Product # 26200) following the manufacturer protocol with two minor modifications: i) samples were incubated in the lysis buffer for at least one hour, and ii) DNA was eluted twice with 50 µl of the elution buffer each time, and the DNeasy Plant Mini Kit (Qiagen Product # 69106) with two minor modifications: i) samples were incubated in the lysis buffer overnight, and ii) DNA was eluted twice with 80 µl of the elution buffer each time. When samples were too small or scarce, the eluted DNA was concentrated by evaporation in a refrigerated vacuum centrifuge. Two unlinked DNA regions were selected for this study: the nuclear small subunit ribosomal RNA or 18S RNA for being the classical region to reconstruct phylogenetic relationships in the Myxomycetes, and the mitochondrial small subunit ribosomal RNA or mtSSU, which has shown good resolution for internal nodes of the phylogeny in both dark and bright-spored Myxomycetes and it is comparatively easy to amplify (García-Cunchillos et al. 2022; Lado et al. 2022; García-Martín et al. 2023). Due to the length and presence of introns in the 18S RNA, we amplified and sequenced this region in three overlapping fragments: S1, S2 and S3 as defined by García-Cunchillos et al. (2022). To improve DNA amplification success, especially in Cribrariales, new primers were designed. The list of primers used in this study can be found in Table 2. Each PCR reaction contained 12.5 µl of Red Taq DNA Polymerase 2× Master Mix 1.5 mM MgCl2 (VWR®), 0.5 µl of each primer, forward and reverse, at 10 mM, 3–5 µl of template DNA, and completed with bidistillate water for a final volume of 25 µl. PCR conditions for the amplification of each region were: initial denaturation (94 °C, 1 min), 30 cycles of denaturation (94 °C, 30 sec), annealing (1 min at 52 °C for mtSSU, or 1 min at 55 °C for nrSSU, with minor adjustments for specific samples), and extension (72 °C, 3 min), and a final extension step (72 °C, 10 min). PCR amplifications were checked by electrophoresis in a 1–1.5% agarose gel and 1× TAE buffer. Successful amplifications were purified with ExoProStar (illustra, United Kingdom) and sent to sequence, in both directions and with the same primer pairs, at Macrogen Europe facilities. Table 2. Primers used in this study. DNA region Primer name Sense Sequence (3’–5’) Taxonomic range References nrSSU-1 S1 F AACCTGGTTGATCCTGCC Bright-spored Fiore-Donno et al. (2008) SR4Cri R CACCAGACTTTCCCACT Cribrariales This study SR4Lic R CCAGACTTGTCCTCCAAT Bright-spored except Cribrariales This study nSSU2Ret-F F AGAGGATTAGGGTTTGATCCT Reticulariales This study nrSSU-2 nSSU2Cri-F F TTCYAAGGAWGGCAGCAG Bright-spored except Reticulariales This study SR12Cri R GACTACAACGGTATCTAATC Cribrariales This study SR12Tri_bis R GGACTACGATGGTATCTGAT Trichiales This study SR12Lic† R CTGGACTACTGTGGTATCTGA Reticulariales and Liceales Fiore-Donno et al. (2010)† nrSSU-3 S5Bright F GGTGAAATCCGWTGAYCCT Bright-spored This study nSSUBright-34-F2 F TGGTGCATGGYCGTTCKTA Bright-spored This study nuSSUBright-R1 R GATCCTTCTGCAGGTTCACC Bright-spored This study mtSSU Kmit_F F AGTGTTATTCGTGATGACTGG Myxomycetes Lado et al. (2022) Kmit_R R CGAATTAAACCACATCTCCACC Myxomycetes Lado et al. (2022) †Modified to approach melting temperatures of other primers. 6 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales Sequences of nrSSU and mtSSU from G00586039 (C. cancellata var. fusca) and G00586052 (C. vulgaris) were extracted from low coverage genome sequencing data generated for an ongoing project (unpublished data). Bioinformatics Newly generated sequences were edited with Sequencher® v5.4.6 (Gene Codes Corporation) and trimmed to exclude primer sites and poorly read positions. These sequences were aligned together with those retrieved from GenBank with PASTA v1.9 (Mirarab et al. 2015) using the following settings: positions present in only one or two of the sequences masked, MAFFT (L-INS-i) as the algorithm, OPAL as the merger, fasttree as the tree estimator, and 10 (mtSSU) or 20 (nrSSU) iterations, retaining the best likelihood scored alignment. The resulting alignments were minimally adjusted, mainly towards the ends of some incomplete sequences. Regions that were highly variable and ambiguously aligned were removed, retaining the most conserved blocks for subsequent analyses as suggested by Fiore-Donno et al. (2013) and García-Cunchillos et al. (2022). The final alignments are available in http:// purl.org/phylo/treebase/phylows/study/TB2:S32191. Phylogenies were estimated by Maximum Likelihood (ML) and Bayesian Inference (BI) approaches. ML analyses were performed in IQ-TREE v1.6.12 (Nguyen et al. 2015) for each of the two loci separately to check for incongruences across datasets. An incongruence was considered when significantly supported contradictory topologies were obtained from each dataset, using a threshold of 95% ultrafast bootstrap as indicative of significant clade support. No such incongruences were detected and then the datasets were combined for further analysis. ML analyses of the combined dataset were equally performed in IQ-TREE v1.6.12, preliminary partitioning the data into the mtSSU and the nrSSU partitions, the models and final partitioning scheme of which were estimated by the partition merging option and the integrated version of ModelFinder (Kalyaanamoorthy et al. 2017). Ten independent replicates were performed, retaining the tree with the best likelihood score. Branch support was assessed by standard bootstrap (Felsenstein 1985), performing 1000 replicates. Branch support was additionally evaluated by 1000 replicates of the Shimodaira-Hasegawa-like approximate likelihood ratio test (SH-like aLRT, Guindon et al. 2010), to account for very short branches supported by nearly no data but that could receive spurious support by bootstrap. Finally, we calculated the transfer bootstrap expectation (TBE, Lemoine et al. 2018) in the online platform of BOOSTER (https://booster.pasteur.fr/), using 1000 standard bootstrap replicates, to account for the effect of rogue taxa in branch supports. Threshold values for significant support were considered as BS ≥ 70%, SH-like aLRT ≥ 75%, and TBE ≥ 80%. BI analyses were done in MrBayes 3.2.7a (Ronquist et al. 2012) with the same partitioning scheme used for the ML analysis and unlinking all parameters except topology. Models of evolution were estimated by model jumping (Huelsenbeck et al. 2004) with nst=mixed and allowing a proportion of invariant sites and a gamma-distributed rate heterogeneity across sites. We ran four simultaneous analyses with six chains each, five of them heated with a temperature factor of 0.1 after evaluating the swapping values among chains in 7 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales a preliminary run. The prior on branch lengths was set as unconstrained:gammadir(1,0.07386,1,1) based on the best replicate of the ML analysis. The analyses were run for 1×107 generations sampling every 1000th tree. Parameters and trees were summarized after discarding the first half of the runs as burn-in, and a 50% majority rule consensus tree with average branch lengths and posterior probability (PP) values was computed from the remaining trees. Branches were considered significantly supported when PP ≥ 0.95. Trees were edited with FigTree v1.4 and the best replicate of the ML tree is shown in Fig. 1. Results Sporophore development in the family Cribrariaceae Our observations in moist chamber cultures (Fig. 2) show that the plasmodium in the Cribrariaceae is usually visible only when it is ready to fructify, remaining within the substrate before this state. This “emerging” or “mature” plasmodium is flat and already contains fully formed dictydine granules, randomly distributed within the cytoplasm (Fig. 2A, B). Superficial plasmodia then concentrate to form one or more rounded sporophore initials (Fig. 2C), retaining the same colour and distribution of dictydine granules. In species with sporophores in the form of stalked sporocarps, a subhypothallic stipe develops, sometimes retaining part of the dictydine granules, while the immature sporotheca still remains rounded and with dictydine granules randomly distributed (Fig. 2D). In a more advanced state of development of the sporophores, numerous dictydine granules (often the majority) migrate towards the surface and concentrate on the developing peridium (Fig. 2E). At this point, the immature spore mass clears up in many, but not all species, and may contrast with the young peridium (Fig. 2F). In a few species, notably in C. cancellata, C. purpurea Schrad. and allies, but also in Lindbladia tubulina, the immature spore mass never clears up, remaining dark-coloured until the maturation of the sporophores. Our observations indicate that many dictydine granules in those Cribraria species remain within the mature spore mass, possibly contributing to its dark colour, while in L. tubulina the intricate structure of the aethalium or pseudoaethalium contribute to its opacity, regardless of the position of the dictydine granules. Phylogeny and characterization of target clades 116 new sequences were generated in this study (Table 1). The final dataset contained 1742 characters of which 1164 were parsimony-informative and 76 were singleton sites. The evolutionary models selected by ModelFinder for the ML analysis were GTR+F+I+G4 for the mtSSU partition and SYM+I+G4 for the nrSSU partition. The overall topology of the bright-spored Myxomycetes tree (Fig. 1) shows four main imbricate and supported (aLRT = 79–100%, BS = 74–100%, TBE = 88–100%, PP = 0.99–1) monophyletic groups, which are distinguished as the following four orders: (i) Cribrariales, (ii) Reticulariales, (iii) Liceales, and (iv) Trichiales. The order Cribrariales s.str. includes all analysed species of Cribraria and Lindbladia (Fig. 1). Within it, we distinguish three main lineages. 8 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales Reticulariales Cribrariales Outgroup (Physarales) Lycogala leopardinum G00586053 Cribraria cf. macrocarpa G00586115 Cribraria cancellata var. cancellata G00586046 Didymium infundibuliforme MA-Fungi 78324 Didymium difforme MA-Fungi 64529 Cribraria rubiginosa M. Meyer 30448 Uncultured Cribraria clone 13 [GenBank: KP217015] Didymium difforme MA-Fungi 70268 Reticularia splendens UARK:20735 Dianema depressum MA-Fungi 82939 Cribraria meylanii O F-371517 Cribraria sp. Lloyd, S.J. 1988 Cribraria minutissima Lado 27818 Cribraria mirabilis O F-371516 Dianema subretisporum M. Meyer 46699 Cribraria rufa H. Koskinen JX.1640936#3 Cribraria violacea G00586003 Tubifera ferruginosa M. Meyer 31696 Cribraria cancellata var. fusca MA-Fungi 94033 Lycogala sp. MA-Fungi 83194 Cribraria vulgaris G00586052 Nannengaella mellea MA-Fungi 60322 Didymium iridis transcriptome SRR6706112 Cribraria sp. G00586314 Cribraria minutissima Lloyd, S.J. 2018 Cribraria rufa H. Koskinen JX.1648888#5 Physarum (Aethaliopsis) nivale MA-Fungi 70191 Cribraria [cf.] vulgaris AMFD98 Cribraria tubulina G00586060 Cribraria cribrarioides Lado 25828 Didymium umbilicatum MA-Fungi 64629 Reticularia lycoperdon M. Meyer 22374 Cribraria aff. lepida TVDH 531 Cribraria tubulina AMFD228 Dianema depressum MA-Fungi 80673 Cribraria cf. persoonii KRAM M-1075 Physarum (Aethaliopsis) nivale MA-Fungi 73457 Lycogala epidendrum AMFD271 Badhamia polycephala transcriptome [GDRG00000000] Nannengaella leucopus MA-Fungi 68971 Cribraria tubulina G00586002 Nannengaella globulifera MA-Fungi 51647 Cribraria purpurea H. Koskinen JX.164888#7 Cribraria cf. cancellata var. fusca MA-Fungi 80564 Cribraria argillacea G00586061 Lycogala epidendrum AMFD127 Cribraria sp. TVDH 568 Cribraria cancellata var. fusca G00586039 Cribraria argillacea G00586004 Cribraria meylanii G00586187 Cribraria cf. intricata G00586150 Nannengaella mellea MA-Fungi 60314 Cribraria aurantiaca G00586271 Cribraria tubulina [GenBank: FJ810500] Tubifera corymbosa AMFD251 Cribraria violacea AMFD172 Cribraria cancellata AMFD94 Dianema subretisporum M. Meyer 31413 Reticularia lycoperdon AMFD262 Physarum (Claustria) didermoides MA-Fungi 57262 Didymium anellus MA-Fungi 73335 Reticularia jurana MA-Fungi 83011 Lycogala flavofuscum M. Meyer 22037 Cribraria confusa MA-Fungi 89818 Cribraria cf. piriformis G00586042 Badhamia foliicola MA-Fungi 69058 Physarum (Claustria) licheniforme MA-Fungi 73290 Tubifera ferruginosa AMFD196 Cribraria tenella AMFD148 Reticularia splendens LE 259254 Lycogala flavofuscum G00586059 Physarum (Claustria) straminipes MA-Fungi 70363 Cribraria [cf.] argillacea AMFD146 Cribraria zonatispora G00586255 Cribraria vulgaris MA-Fungi 61604 Nannengaella contexta MA-Fungi 73321 81/93/99/0.91 95/89/95/1 92/91/99/1 94/93/93/1 98/99/99/1 99/98/98/1 99/100/100/1 99/100/100/1 100/100/100/0.96 99/100/100/1 92/75/83/0.99 99/97/99/1 95/74/84/1 99/98/100/1 62/64/82/0.94 93/88/99/1 100/86/92/1 * 90/85/85/1 85/63/80/0.96 100/99/100/1 94/92/95/1 99/100/100/1 94/92/98/1 99/100/100/1 90/66/83/0.99 100/98/100/1 99/100/100/1 99/97/97/1 96/79/89/1 85/83/97/0.97 96/78/78/0.96 90/98/98/1 * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Lindbladia Figure 1. Maximum likelihood phylogenetic tree of the bright-spored Myxomycetes (Lucisporomycetidae) based on the concatenated dataset of nrSSU and mtSSU DNA sequences. Values on branches represent the SH-like aLRT, the standard bootstrap (BS), the transfer bootstrap expectation (TBE), and the posterior probabilities (PP). These values are only indicated when SH-like aLRT, BS, and TBE ≥ 50%, and PP ≥ 0.9. Maximum support (SH-like aLRT = 100%, BS = 100%, PP = 1, and TBE = 100%) is denoted by an asterisk. Samples with newly generated sequences are in bold. The scale bar indicates the average number of substitutions per site. 9 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales Trichiales Liceales Dictydiaethaliaceae Dianemataceae Hemitrichiaceae Arcyriaceae Trichiaceae Licea parasitica AMFD341 Enteridium olivaceum MA-Fungi 57408 Dianema inconspicuum M. Meyer 39161 Prototrichia metallica M. Meyer 24907 Metatrichia horrida MA-Fungi 81778 Licea castanea G00586172 Hemitrichia minor MA-Fungi 80197 Enteridium variabile MA-Fungi 85637 Enteridium olivaceum CWU 3075 Oligonema affine MA-Fungi 83345 Ophiotheca pedata MA-Fungi 81941 Arcyria congesta Lado 25434 Enteridium variabile G00586171 Metatrichia floriformis MA-Fungi 83204 Oligonema persimile [GenBank: AY643826] Hemitrichia crassifila MA-Fungi 91885 Metatrichia floripara Lado 25103 Enteridium cf. simulans M. Meyer 29889 Hemitrichia serpula MA-Fungi 64060 Hemitrichia calyculata MA-Fungi 81807 Oligonema schweinitzii M. Meyer 29842 Enteridium corticatum KRM0040806 Enteridium olivaceum LE 25311 Ophiotheca calongei Lado 25554 Gulielmina vermicularis MA-Fungi 88424 Dianema sp. MA-Fungi 86506 Dianema nivale M. Meyer 29888 Heterotrichia ferruginea MA-Fungi 86467 Dianema sp. MA-Fungi 86507 Trichia alpina MA-Fungi 80534 Hemitrichia abietina M. Meyer 30370 Heterotrichia oerstedii MA-Fungi 61817 Arcyria incarnata MA-Fungi 83426 Oligonema affine MA-Fungi 78975 Enteridium variabile G00586169 Hemitrichia pardina MA-Fungi 80413 Calomyxa metallica MA-Fungi 82941 Licea marginata DWM7368 Enteridium corticatum KRM0040819 Enteridium variabile M. Meyer 28571 Arcyria leiocarpa M0142937 Trichia varia MA-Fungi 83469 Arcyria stipata AMFD257 Heterotrichia insignis MA-Fungi 87859 Dianema mongolicum M. Meyer 45002 Gulielmina patagonica MA-Fungi 91906 Enteridium variabile MA-Fungi 80591 Enteridium variabile G00586173 Enteridium olivaceum M. Meyer 47160 Enteridium variabile G00586174 Arcyria foliicola MA-Fungi 50720 Cornuvia serpula M. Meyer 29198 Perichaena nigra MA-Fungi 86774 Arcyria globosa MA-Fungi 52762 Ophiotheca chrysosperma MA-Fungi 64647 Arcyria denudata MA-Fungi 78718 Oligonema verrucosum MA-Fungi 83489 Dictydiaethalium plumbeum MA-Fungi 64421 Prototrichia metallica MA-Fungi 80049 Arcyria globosa AMFD252 Perichaena quadrata MA-Fungi 88308 Perichaena dictyonema MA-Fungi 59057 Calomyxa metallica AMFD483 Gulielmina megaspora MA-Fungi 82123 Arcyria cinerea s.l. G00586054 Trichia scabra MA-Fungi 81001 Arcyria afroalpina MA-Fungi 83613 Perichaena corticalis MA-Fungi 68850 Arcyria affinis MA-Fungi 61187 Hemitrichia decipiens MA-Fungi 83070 Arcyria cinerea s.l. MA-Fungi 83612 Enteridium olivaceum MA-Fungi 39466 Oligonema sp. MA-Fungi 78857 Hemitrichia minor U6369 Trichia scabra MS22055 Perichaena agaves MA-Fungi 50703 Perichaena stipitata MA-Fungi 79150 Hemitrichia abietina MA-Fungi 58838 Trichia sordida AMFD81 Licea castanea AMFD102 Enteridium cf. liceoides MA-Fungi 71211 Dictydiaethalium dictyosporum MA-Fungi 91171 Hemitrichia lutescens MA-Fungi 83355 Enteridium cf. liceoides B. Woerly 3435a Enteridium corticatum M. Meyer 24378 99/97/100/1 99/100/100/1 93/81/99/1 93/73/87/1 85/65/91/0.99 98/94/98/0.94 99/94/94/1 92/78/87/1 99/82/88/1 96/71/86/1 91/98/98/1 90/52/79/1 100/99/99/1 95/84/92/1 81/72/72/1 100/93/99/1 95/97/98/1 79/74/98/0.99 88/69/94/1 97/97/97/1 90/70/85/1 89/75/97/1 73/60/79/0.99 94/54/92/0.98 50/59/59/0.97 100/99/99/1 99/94/98/1 93/64/85/0.99 93/74/95/1 98/92/99/1 * * * * * * * * * * * * * * * * * * * * * * * * * * * 0.2 80/76/98/0.98 Dianema corticatum clade Licea variabilis clade Enteridium olivaceum clade Figure 1. Continued. 16 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales Figure 6. Morphological traits in the genus Enteridium. A Dried sclerotized plasmodium of E. variabile (≡ Licea variabilis) (G00586174) still showing a bright orange pigmentation; B–D mature sporophores of: E. olivaceum (B, C, Meyer 47160, image C showing a detail of the reticulate and membranous pseudocapillitium), E. variabile (D, G00586174), and E. corticatum (≡ Dianema corticatum) (E, Meyer 24378); F–I spores under the light microscope of E. variabile (F, G00586174), E. olivaceum (G, Meyer 47160), E. cf. liceoides (H, Woerly 3435a), and E. corticatum (I, Meyer 24378); J true capillitium of E. corticatum (Meyer 24378) with typical bead-like thickenings; K, L scanning electron microphotographs of E. olivaceum (MA-Fungi 57408) showing a spore cluster (K) and pseudocapillitial plates (L). Scale bars: 1 mm (A, B, D, E); 0.2 mm (C); 10 µm (F–J); 2 µm (K); 50 µm (L). 17 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales (CWU MR 0119 and CWU 2311, respectively) than to the other sequence of E. olivaceum (KP941454, from CWU 3075). BLAST searches of the two supposedly L. tubulina sequences (KP941456 and KP941457) show a high identity (> 98%) and coverage (≥ 94%) to several sequences from beetle species of the families Erotylidae (Pharaxonotha floridana, Pselaphacus nigropunctatus), Sphindidae (Protosphindus chilensis), Chrysomelidae (Aphthona spp., Phaedon tumidulus, Luperus sulphuripes), etc. These sequences are, however, very different to those of Lindbladia used by Fiore-Donno et al. (2013) and those generated by us in the present study. Sugiura et al. (2019) reported the interactions between different species of beetles and Myxomycetes, the former possibly aiding at the spore dispersal of the latter. Linbladia tubulina was the sixth species of Myxomycetes with the highest number of observed interactions, especially with members of the family Sphindidae. Therefore, we consider that the sequences KP941455 from CWU 2312 (as R. olivacea) and the sequences KP941456 and KP941457 from CWU MR 0119 and CWU 2311 (as L. tubulina) most likely represent contaminations. We found that the phylogenetic relationships presented in Leontyev et al. (2015) are misleading due to an inappropriate rooting (Fig. 7A). Following the BLAST results (Fig. 7B), if the phylogeny is rooted by using the most distant organism (a plant of probably the genus Pinus, sequence KP941455), then a clade with two animal sequences (Coleoptera, KP941456 and KP941457) appears sister to a main clade with only bright-spored Myxomycetes sequences. Within this Myxomycetes clade, three main lineages are identified, the first diverging one being the Cribrariales (with only Cribraria), and then another clade with Reticulariales (including Tubifera J.F. Gmel., Alwisia Berk. and Broome, Reticularia, and Lycogala Adans.) and Trichiales (with Enteridium olivaceum KP941454), exactly as expected and reported in other studies treating these taxonomic groups (e.g., Fiore-Donno et al. 2013), including ours (Fig. 1). Enteridium is, therefore, not nested in Cribrariales. Alwisia Reticularia KP941456 (as “Lindbladia tubulina”) Cribraria Reticularia olivacea KP941454 Tubifera Lycogala KP941457 (as “Lindbladia tubulina”) KP941455 (as “Reticularia olivacea”) Reticularia Enteridium olivaceum KP94145 4 Alwisia KP941455 (Pinus) Tubifera Cribraria KP941457 (Coleoptera) Lycogala KP941456 (Coleoptera) AB “Cribrariales” sensu Leontyev et al. Figure 7. Simplified phylogenetic tree from Leontyev et al. (2015), in A As rooted and interpreted in that study and in B as interpreted by us according to the BLAST results and our data (see discussion). The arrow indicates the branch we used for re-rooting. 18 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales Concerning the morphology of E. olivaceum, both the colour of the spore mass and the spore ornamentation (Fig. 6K) agree perfectly with the ample variety of morphologies present in the order Trichiales. Indeed, the spore morphology (Fig. 6G, K) is much closer to that of some species of Trichiales (e.g., Dianema corticatum, Fig. 6I) than to any species of Cribrariales, within which clustered and unevenly ornamented spores are currently unknown (Figs 3–5). The spore ornamentation does justify the exclusion of Enteridium from the order Reticulariales, as Leontyev et al. (2015) stated. Regarding the colour of the immature fructifications, E. olivaceum is only dark-coloured when the sporophores are almost mature, while the plasmodium and very young fructifications are bright pinkish orange, pinkish red, or pink as repeatedly stated in the literature (see, e.g., Lister 1911; Martin 1949; Martin and Alexopoulos 1969; Nannenga-Bremekamp 1991), a colour unknown in the Cribrariales but present in many species of Trichiales (see, e.g., Martin and Alexopoulos 1969, see also Fig. 6A). Therefore, both the molecular and the morphological data clearly place the genus Enteridium within the order Trichiales, specifically within the family Dianemataceae, of which Enteridiaceae M.L. Farr becomes a new heterotypic synonym. Why Enteridium and not Licaethalium? The nomenclature of the generic names Enteridium and Licaethalium has been addressed by Leontyev and Ronikier (2024), but some details missing in that study are relevant for the nomenclatural stability of the involved names and deserve a closer analysis. The generic name Enteridium was proposed by Ehrenberg (1819) to accommodate a single wood-inhabiting species forming aethalia, E. olivaceum Ehrenb. Ehrenberg’s description was rather detailed, indicating the presence of a membranous hypothallus, a peridium with bubbles or vesicles (resembling an intestine, hence the name), a netted or reticulate and membranous pseudocapillitium, and firmly conglobate spores in groups of 6–11, olivaceous in mass. The organism was found on rotten wood of Alnus glutinosa near Berlin (Ehrenberg 1819). The designation “Enteridium” had already been mentioned, but not validly published, in Ehrenberg’s dissertation (Ehrenberg 1818), just in a list, without description, diagnosis or any reference to a previously effectively published one but indicating that it was going to be published in “Jahrbücher de Gewächskunde von Sprengel Schrader und Link 1 Band 2 Heft”. Later, Fries (1827) mentioned “Reticularia olivacea” in a list but neither a basionym nor even an indirect reference to Ehrenberg’s protologue was included, and Fries also failed to provide any diagnosis, description or further information, so “Reticularia olivacea” cannot be considered validly published there (Arts. 41.3 and 41.4 of the ICN do not apply). The same is true for the later edition entitled “Stirpium agri Femsionensis index”, dated in 1826 but surely published after 8 Dec 1827 (see Silva 1959; Stafleu and Cowan 1976), which Leontyev and Ronikier (2024) incorrectly considered the place of valid publication of R. olivacea. It is not until Fries (1829: 89) that R. olivacea was validly published. Fries (1829: 90) separately commented on Ehrenberg’s Enteridium olivaceum as: “Enteridium olivaceum Ehrenb. […] habitu priori simillibum est, nullumque mihi dubium, quin status imperfectior in evolutione impeditus”, which freely translates to “Enteridium olivaceum Ehrenb. […] is very similar to the former in habit, and I have no doubt 19 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales that it is nothing more than an imperfect state hindered in development”. By this statement and by the adoption of the final epithet, we conclude that R. olivacea is a combination based on E. olivaceum, in agreement with previous studies (e.g., Martin and Alexopoulos 1969) and following the established custom. On the other hand, Rostafiński (1873: 4) published Licaethalium as a new generic name, citing “Z.B. (zum Beispiel) Reticularia olivacea Fr., pag. 89”, an unambiguous reference to Reticularia olivacea (Ehrenb.) Fr., Syst. Mycol. 3: 89. 1829 (see above). Because R. olivacea is treated as a combination based on E. olivaceum, both names are necessarily homotypic, and Licaethalium becomes nomenclaturally superfluous and illegitimate due to the inclusion of the type of an earlier, legitimate name at the same rank (Enteridium), which name ought to have been adopted (Art. 52.1, ICN). The combination “Licaethalium olivaceum” was not validly published in 1873 because the epithet “olivaceum” was not definitely associated with the generic name “Licaethalium” (Art. 35.2, ICN). Soon after, Rostafiński (1875: 227) recognised that both generic names were synonyms and accepted Enteridium as the correct one, explaining that he was unaware of Ehrenberg’s name in his dissertation of 1873. Additionally, Rostafiński (1875) listed “Licaethalium olivaceum Rfski., Versuch., etc., p. 4” as if it had already been published in 1873, but this does also not constitute a valid publication of the name because it was merely cited as a synonym (Art. 36.1(b), ICN). Indeed, although Leontyev and Ronikier (2024) refer to “Rostafiński’s combination of Licaethalium olivaceum” in their study, we are not aware that “Licaethalium olivaceum” has ever been validly published. As a result, Enteridium and E. olivaceum are the correct names for Ehrenberg’s taxon for being the earliest legitimate ones in their respective ranks (Arts. 11.3 and 11.4, ICN). Updated taxonomy and nomenclature of Enteridium As shown in our DNA-based phylogeny (Fig. 1), all specimens identified as Enteridium olivaceum belong to a fully supported clade that is closely related to two other morphologically similar species: Licea variabilis and Dianema corticatum. The similarity between Enteridium (including also E. liceoides and E. simulans) and these species has been noted several times by different authors (Lister 1911; Nannenga-Bremekamp 1974; Ing 1999), being unsurprising that they are evolutionarily related. Both L. variabilis and D. corticatum produce plasmodiocarps or irregular sporocarps (Fig. 6D, E) that may resemble those of E. liceoides or small sporophores of E. olivaceum. The three species E. olivaceum, L. variabilis, and D. corticatum form a well-supported clade that can be recognized as the genus Enteridium (see diagnosis in the taxonomic treatment). The two possible alternatives to this choice are (i) the recognition of a different genus for each of these three species or species complexes, an option that we consider as highly oversplitting, or (ii) Enteridium could encompass the whole family Dianemataceae, including Calomyxa, Dianema s.str., and Prototrichia (see also comments in García-Cunchillos et al. 2022), but this option is unsustained and discouraged until having a deeper knowledge on the diversity of these putative genera, as it would imply a non-negligible taxonomic lumping. Enteridium is nevertheless the oldest name and, as conservatively defined here, requires new combinations only for L. variabilis and D. corticatum (see below). Two more species have been usually, but not always, accepted in Enteridium s.str.: Enteridium simulans and E. liceoides. The former was published by Ros- 20 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales tafiński (1876) indicating, in comparison with E. olivaceum, that the spores were not clustered and that they were uniformly ornamented with small warts. One of the specimens included in our analyses (M. Meyer 29889 in herb. G) was identified as E. simulans because, indeed, the spores are mostly free when mounted, e.g., in Hoyer’s medium. However, the spores only have verrucae on one of their sides, and their shape is identical to those from typical specimens of E. olivaceum. The molecular data place this sample within the clade of E. olivaceum (Fig. 1), and it is possible that it represents a specimen of this species where the spore clusters are particularly fragile and dissociate easily, rather than truly being E. simulans in its original sense. This kind of easily dissociating spore clusters has been observed in other species of the family Dianemataceae (see Dianema sp. 1 in Ronikier et al. 2020). Martin and Alexopoulos (1969) stated that all intermediates between clustered and free spores exist and considered E. simulans as a synonym of E. olivaceum, while Nannenga-Bremekamp (1991) treated E. simulans as a variety of E. olivaceum. With the expressed doubts about the identification of the specimen of E. simulans included in our analyses, and waiting for further data, we provisionally accept this species based on the information from its protologue. Enteridium liceoides was originally described as a variety of E. olivaceum by Lister (1896) and later risen to species level by her daughter Gulielma Lister (Lister 1919), being distinguished from E. olivaceum by producing isolated plasmodiocarps, simple or combined into a flat net, and by the very reduced pseudocapillitium. Two specimens identified as E. liceoides fall in two different groups in our phylogeny (Fig. 1), one is nested in the E. olivaceum clade, while another is closely related to Dianema corticatum, but neither molecularly nor morphologically identical to it (Fig. 6H, I). It may be possible that the morphology of E. liceoides corresponds to reduced forms lacking capillitium or pseudocapillitium, and the revision and detailed analyses of original material would be critical to assess its true identity. We provisionally accept it based on data from the literature and the distinctiveness of at least one of the analysed specimens. In any case, the species-level taxonomy of this group is out of the scope of the present study and needs to be investigated with a larger sampling of specimens (including type material) and DNA regions before reaching firm conclusions. According to our morphological and molecular data, the following treatment of the genus Enteridium is proposed: Enteridium Ehrenb., Jahrb. Gewächsk. 1(2): 55. 1819 MycoBank No: 12084 Fig. 6 ≡ Licaethalium Rostaf., Vers. Syst. Mycetozoen: 4. 1873, nom. illeg. (Art. 52.1). Type. Enteridium olivaceum Ehrenb., Jahrb. Gewächsk. 1(2): 57. 1819. Updated diagnosis. Within the family Dianemataceae, Enteridium is characterized by the flat, usually effused sporophores with either a pseudocapillitium consisting of perforated plates or flat pillar-like structures, a true capillitium of sparse, simple threads, or lacking any capillitium or pseudocapillitium, and free or clustered spores, ornamented with warts or spines, these concentrated on the outer side of the cluster when the spores are not free. 21 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales Accepted species names Enteridium olivaceum Ehrenb., Jahrb. Gewächsk. 1(2): 57. 1819 MycoBank No: 148249 ≡ Reticularia olivacea (Ehrenb.) Fr., Syst. Mycol. 3: 89. 1829. Enteridium simulans Rostaf., Sluzowce monogr. suppl.: 30. 1876 MycoBank No: 222329 ≡ Reticularia olivacea var. simulans (Rostaf.) Nann.-Bremek., Proc. Kon. Ned. Akad. Wetensch., C. 76(5): 486. 1973. ≡ Reticularia simulans (Rostaf.) D.W. Mitch., Syst. Geogr. Pl. 74: 261. 2004 Enteridium liceoides (Lister) G. Lister in Lister, Guide Brit. Mycetozoa, ed. 4: 48. 1919 MycoBank No: 269378 ≡ Enteridium olivaceum var. liceoides Lister, J. Bot. 34: 211. 1896 [basion.]. ≡ Reticularia liceoides (Lister) Nann.-Bremek., Proc. Kon. Ned. Akad. Wetensch., C. 76(5): 485. 1973. Enteridium variabile (Schrad.) J.C. Zamora, D. Rodrigues, García-Cunch. and Lado, comb. nov. MycoBank No: 860087 ≡ Licea variabilis Schrad., Nov. gen. pl. 18. 1797 [basion.]. ≡ Tubulina variabilis (Schrad.) Poir., in Lamarck, Encycl. 8:131. 1808. Enteridium corticatum (Lister) J.C. Zamora, D. Rodrigues, García-Cunch. and Lado, comb. nov. MycoBank No: 860088 ≡ Dianema corticatum Lister, Monogr. Mycetozoa 1: 205. 1894 [basion.]. Finally, there are some currently accepted species that could not be analysed in our study, but which might as well be included in the genus Enteridium. Both Enteridium aureum (Nann.-Bremek.) M.L. Farr (≡ Reticularia aurea Nann.-Bremek.) and E. rubiginosum Gràcia, Illana and G. Moreno (≡ Reticularia rubiginosa [Gràcia, Illana and G. Moreno] Lado) share a similar spore ornamentation and are surely members of the order Trichiales (the type of E. rubiginosum was requested to AH herbarium, but it is apparently missing). Leontyev and Ronikier (2024) hypothesised that these two species may belong to the genus Dictydiaethalium. On the other hand, Dianema repens Lister was described indicating a close similarity to D. corticatum G. Lister and Cran but with slender plasmodiocarps, a thin membranous peridium, 22 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales and coarse capillitium threads with membranous expansions (Lister 1925). In light of our results showing that Enteridium also belongs to Trichiales and is not necessarily restricted to species with clustered olivaceous spores and pseudocapillitium, we cannot discard the alternative hypothesis of any of the abovementioned species being included in Enteridium. Diagnosis of the order Cribrariales, taxonomy, and nomenclature With the exclusion of Enteridium from the Cribrariales, the diagnosis of this order, in strict sense, returns to the broadly accepted conception of its single family Cribrariaceae, as defined and accepted in a plethora of publications (Lister 1925; Martin and Alexopoulos 1969; Nannenga-Bremekamp 1974, 1991, 2022; Lado and Pando 1997; Ing 1999; Poulain et al. 2011). Cribrariales is characterized by the presence of the so-called “plasmodic” or “dictydine” granules, which are globular structures, usually hollow, containing calcium (Schoknecht 1975) and possibly phosphorus and other elements (Hatano et al. 1996). These last authors traced the use of the terms “plasmodic granules” and “dictydine granules” to Lister (1894) and Martin (1949), respectively. However, we found that Rex (1891) already used “plasmodic granules” to refer to these structures, and their presence in the mature plasmodia (McManus 1963; Lado et al. 1999, Fig. 2 in our study) indicate that this terminology is probably correct, being employed in a few publications, even recently (e.g., Ramírez-Ortega et al. 2017, as plasmodial granules). On the other hand, the term “dictydine granules” was already used by Meylan (1908) as “grains de plasma ou dictydine” and has become common in recent publications (Lado et al. 1999; Estrada-Torres et al. 2001; Hooff 2009; Poulain et al. 2011; Leontyev et al. 2019), unambiguously and uniquely referring to these structures as found in Cribrariales; it is therefore the term used in the present study. Other terminologies, such as lime globules (Nannenga-Bremekamp 1991, 2022, not recommended by Hatano et al. 1996) and calcic granules (Lado and Pando 1997; Lado et al. 2019; Lado and Eliasson 2022), can be found in the literature. The transformation of the whole protoplasm surrounded by the peridium into spores is another synapomorphy of all known species of the order Cribrariales, lacking the capillitium or pseudocapillitum that is usually present in the Reticulariales and Trichiales (occasionally reduced or secondarily lost in some species, see García-Cunchillos et al. 2022). The peridium, as already noted by de Bary (1866), also shows some peculiarities, as it is typically formed by a very thin and evanescent membrane with thickenings persisting in the form of nodes, ribs, threads, a calyculus, or a combination of those, rarely almost entirely persistent (L. tubulina). Our analyses provide some insights into the phylogenetic relationships of different species of Cribrariales. As noted in the results, there are three well-defined lineages in Cribrariales (Fig. 1) that can be characterized by morphological traits. We have noted that the colour of the emerging plasmodium, the distribution of the dictydine granules in the mature sporophores, and the overall pigmentation of the fruiting bodies are useful taxonomic characters. The colour of the plasmodium has been used for taxonomic purposes in Cribrariaceae since a long time ago, notably to distinguish C. aurantiaca (with a strik- 23 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales ing green plasmodium) from others (Meylan 1913; Nannenga-Bremekamp 1971). However, caution is advised when interpreting data from the literature because some authors have considered a “plasmodial” state even when the sporophores are almost fully formed, but still soft. As a result, it is possible to find reports of “whitish” plasmodia for some species (e.g., C. rufa [Roth] Rostaf., see Lister 1911; Martin and Alexopoulos 1969; Nannenga-Bremekamp 1991) referring to the developmental stage where the spore mass cleared up after the dictydine granules had migrated to the peridium, as shown in our Fig. 2F for C. violacea. In fact, Martin and Alexopoulos (1969) precisely indicate this change of colour for C. oregana and C. pachydictyon. The colours reported in our study are either from our own observations of fresh material or from photographs showing the development of a specimen. The earliest-diverging lineage of the family Cribrariaceae (Fig. 1) includes species that were segregated as the genera Dictydium and Heterodictyon in the past (Rostafiński 1873; Lister 1894; Martin and Alexopoulos 1969), the types of which are D. umbilicatum (= C. cancellata) and H. mirabile (≡ C. mirabilis), respectively. The fact that C. mirabilis is closely related to C. cancellata and should belong to the same group has been broadly accepted (Lister 1925; Nannenga-Bremekamp 1962; Martin and Alexopoulos 1969), and is fully supported by our results (Fig. 1). Therefore, Heterodictyon is simply considered as a later synonym of Dictydium because the alternative option would imply the recognition of a genus for almost every species. The distinction between Dicytidium and Cribraria is more open to debate. Dictydium was usually kept as an independent genus by North American authors (Macbride 1899; Hagelstein 1944; Martin and Alexopoulos 1969; Keller and Braun 1999), and also in Europe (Lister 1925) until Nannenga-Bremekamp (1962) proposed to unite all species under Cribraria. We also consider that the best option with the current data is to keep Cribraria unsplit, thus retaining a genus that is easily and intuitively recognized, even in the field, by both specialists and amateurs. Within this lineage, Cribraria purpurea occupies a relatively isolated position. This distinctive species has very large dictydine granules (usually 3–4 µm in diam., sometimes larger) that are typically aggregated in packages in the spore mass (Fig. 3G), but rarely adhering to the spores themselves. Even with this unique characteristic, we think it is preferable to keep C. purpurea within the Dictydium group, considering that other species share characters with it; for example, C. meylanii also has a sporotheca with a well-developed calyculus and a fully reticulate peridium (Fig. 3C, F), pink to purplish pigments leaching in Hoyer’s medium are observable in specimens of C. meylanii and C. cancellata (Fig. 3F), and the early stages of development of C. purpurea and C. cancellata are very similar, with blackish emerging plasmodia (Fig. 3A) that sometimes stain the substrate of pink-purple. The second lineage corresponds to the species with dark violet pigments. Previous studies have reported a dark violaceous plasmodium for C. violacea (Rex 1891; McManus 1963) and C. zonatispora (Lado et al. 1999), which agree with our own observations (Fig. 2). However, the developing plasmodium of the non-sequenced C. tecta, which probably belongs to this clade, is reported to be pale-coloured (Hooff 2009), but we lack data on the morphology of the concentrating plasmodium and sporophores initials. Other species that surely belong to this group, but from which we currently 24 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales lack DNA data, are C. fragilis Lado and Estrada (Estrada et al. 2001), C. bicolor S.L. Stephenson, Novozh. and P. Wellman (Stephenson et al. 2018), and C. spinispora Lado and D. Wrigley (Lado et al. 2019). Interestingly, the unique spore ornamentation of C. fragilis (Fig. 4I) is somehow intermediate between those of C. zonatispora and C. violacea, adding to the large morphological variation displayed in this clade. The third lineage contains the majority of studied specimens. The earliest-diverging species in this group is C. minutissima (Figs 1, 5D, I). To our knowledge, this is the only species of Cribraria with brick red emerging plasmodia (personal observations in the field), and the dictydine granules are frequently paler than in most other Cribraria species. Otherwise, C. minutissima is morphologically a typical member of C. subg. Cribraria that was even considered conspecific with C. confusa Nann.-Bremek. and Y. Yamam. until Nannenga-Bremekamp and Yamamoto (1983) definitely separated them. For this reason, some reports from the literature indicating a dark bluish plasmodium for this species (Lister 1925; Martin and Alexopoulos 1969) should be taken with caution, as those observations may refer to C. confusa. Our results confirm that Lindbladia is deeply nested within this third lineage, as shown by Fiore-Donno et al. (2013). The morphological similarity between Lindbladia (Fig. 5F) and one species of Cribraria, C. argillacea (Pers. ex J.F. Gmel.) Pers. (Fig. 5A, B), has been pointed out in several publications, even noting that intermediate forms occur (Rex 1892; Lister 1894; Macbride 1922; Nannenga-Bremekamp 1974, 2022). Because Lindbladia tubulina, the type of the genus Lindbladia, belongs to the same group of C. rufescens (= C. rufa, Fig. 5C), the type of Cribraria, and it is very closely related to other species of typical Cribraria, such as C. argillacea, Lindbladia cannot be kept as an independent genus without describing a large number of putative new genera that would be difficult to diagnose. This option is strongly discouraged because it would imply an excessive and unnecessary over splitting. We then accept L. tubulina as a species of Cribraria, requiring the following combination: Cribraria tubulina (Fr.) J.C. Zamora, D. Rodrigues, García-Cunch. and Lado, comb. nov. (≡ Lindbladia tubulina Fr., Summa veg. Scand.: 449. 1849 [basion.]; MycoBank MB 860089). This decision is taken in parallel with other studies showing the occurrence of aethalic morphologies within genera mainly composed of sporocarpic species, such as the inclusion of the former genus Mucilago within Didymium in the order Physarales (García-Martín et al. 2023). The three lineages indicated above are morphologically distinguishable and well-supported by our molecular analyses, and their recognition as infrageneric taxa may be useful in a genus where species are often very difficult to distinguish. As a result, we decide to treat them as the following three subgenera. We cite a non-exhaustive list of included species to help define our current concept of these three groups and those included in our molecular analyses (albeit sometimes with an uncertain identification or treated in broad sense) are in bold. Some species, with an uncertain placement, are purposely omitted. Cribraria Pers., Neues Mag. Bot. 1: 91. 1794, nom. cons. Note. See Gams 2005; Lado et al. 2005. 25 IMA Fungus 16: e159960 (2025), DOI: 10.3897/imafungus.16.159960 Juan Carlos Zamora et al.: Phylogeny of Cribrariales Cribraria Pers., Neues Mag. Bot. 1: 91. 1794 subg. Cribraria MycoBank No: 12058 Fig. 5 = Cribraria subg. Schraderella Rostaf., Sluzowce monogr.: 232. 1875 ― MycoBank MB 860090. Type [designated here, MBT 10027663]: Cribraria rufa (Roth) Rostaf. = Lindbladia Fr., Summa veg. Scand. 449. 1849. Type: L. tubulina Fr., Art. 40.2, ICN. – Cribraria subg. Eucribraria Rostaf., nom. inval., Art. 21.3, ICN. Type. Cribraria rufescens Pers. (= C. rufa [Roth] Rostaf.), designated by Martin (1949: 26). Diagnosis. Emerging plasmodium usually greyish or bluish grey (light grey to dark lead grey), occasionally of other colours (e.g., green, brick red, blackish). Mature sporophores aethaliate, pseudoaethaliate or sporocarpic, sessile or stalked, yellowish, ochre, copperish, orange, brownish red, or light to dark brown, with dictydine granules concentrated on the peridium, sometimes also present in the stalk. Species included. C. angulospora C.H. Liu and J.H. Chang, C. argillacea (Pers. ex J.F. Gmel.) Pers., C. aurantiaca Schrad., C. confusa Nann.-Bremek and Y. Yamam., C. cribrarioides (Emoto) Hatano, C. dictyospora G.W. Martin and Lovejoy, C. filiformis Nowotny and H. Neubert, C. gothica Sadykov, C. intricata Schrad., C. languescens Rex, C. macrocarpa Schrad., C. macrostipitata H. Neubert and Nann.-Bremek., C. martinii Nann.-Bremek., C. microcarpa (Schrad.) Pers., C. minutissima Schwein., C. oregana H.C. Gilbert s.l. (including C. montana Nann.-Bremek.), C. pachydictyon Nann.-Bremek., C. paucidictyon Yu Li, C. persoonii Nann.-Bremek., C. pertenuis Flatau and Schirmer, C. piriformis Schrad., C. rubiginosa Fr., C. rufa (Roth) Rostaf., C. splendens (Schrad.) Pers., C. stellifera Nowotny and H. Neubert, C. tenella Schrad., C. tubulina (Fr.) J.C. Zamora, D. Rodrigues, García-Cunch. and Lado, C. vulgaris Schrad. Cribraria subg. Dictydium (Schrad.) Y. Yamam., The Myxomycete biota of Japan: 94. 1998 MycoBank No: 859338 Fig. 3 ≡ Dictydium Schrad., Nov. gen. pl.: 11. 1797 [basion.]. = Heterodictyon Rostaf., Vers. Syst. Mycetozoen: 5. 1873. Type: H. mirabile Rostaf., Art. 40.2, ICN. Type. Dictydium umbilicatum Schrad. (= Cribraria cancellata [Batsch] Nann.- Bremek.), designated by Martin (1949: 32). Diagnosis. Emerging plasmodium very dark brown to blackish, sometimes with purplish hues. Mature sporophores always sporocarpic, stalked, brownish, maroon to pink-purplish, with dictydine granules abundantly present both in the peridium and in the spore mass (attached to the spores or not), sometimes also present in the stalk. Species included. C. cancellata (Batsch) Nann.-Bremek., C. mirabilis (Rostaf.) Massee, C. meylanii Brândza, C. purpurea Schrad., C. rutila (G. Lister) Nann.-Bremek.