Morpho-phylogenetic evidence reveals two new species and two new host records of Diaporthe (Diaporthales, Diaporthaceae) from Phellodendron chinense in Sichuan, China

205 Morpho-phylogenetic evidence reveals two new species and two new host records of Diaporthe (Diaporthales, Diaporthaceae) from Phellodendron chinense in Sichuan, China Xinyue Li1,2,3 , Xiulan Xu4, Shasha Xiang1,2,3, Feng Liu1,2,3 , Feihu Wang1,2,3, Xuejing Jiang1,2,3, Yinggao Liu1,2,3, Chunlin Yang1,2,3 1 College of Forestry, Sichuan Agricultural University, Chengdu 611130, China 2 Forest Ecology and Conservation in the Upper Reaches of the Yangtze River Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, China 3 Sichuan Mt. Emei Forest Ecosystem National Observation and Research Station, Sichuan Agricultural University, Chengdu 611130, China 4 Forestry Research Institute, Chengdu Academy of Agricultural and Forestry Sciences, Chengdu 611130, China Corresponding author: Chunlin Yang ([email protected]) Copyright: © Xinyue Li et al. This is an open access article distributed under terms of the Creative Commons Attribution License (Attribution 4.0 International – CC BY 4.0). Research Article Abstract Diaporthe species are globally distributed with a wide variety of plant hosts inhabiting diverse ecological niches and functioning as endophytes, saprobes and pathogens. Numerous species in this genus are significant pathogens responsible for a wide range of diseases in both agricultural and forest plants. In this study, eight Diaporthe strains were isolated from branches of Phellodendron chinense collected in Sichuan Province, China. Using multi-locus phylogenetic analysis of five gene regions (ITS, tef1-α, tub2, cal and his3), along with morphological characterisation, two novel species — D. phellodendri and D. leshanensis — are introduced in the present study and two new host associations were recorded for D. eucommiigena and D. litseae. This study contributes to the growing understanding of Diaporthe diversity and host associations in China. Key words: Ascomycota, coelomycetous asexual morph, phylogeny, sapbrobic fungi, Sordariomycetes, taxonomy Introduction Diaporthe (syn. Phomopsis) is the type genus of the family Diaporthaceae, order Diaporthales (Nitschke 1867). Historically, Diaporthe (sexual morph) and Phomopsis (asexual morph) were considered as separate genera until the implementation of the “one fungus, one name” nomenclatural system, which resolved this taxonomic ambiguity by prioritising Diaporthe, the earlier-established name, as the accepted genus name (Rossman et al. 2015). Being a species-rich genus, Diaporthe currently comprises nearly 1,000 epithets listed in Species Fungorum (https://speciesfungorum.org/, accessed on 5 June 2025). Species of Diaporthe are globally distributed, functioning as pathogens, endophytes or saprobes across a wide range of hosts (Udayanga et al. 2014a; Dissanayake et al. 2020; Norphanphoun et al. 2022). In addition to this ecological Academic editor: Rungtiwa Phookamsak Received: 23 June 2025 Accepted: 17 September 2025 Published: 15 October 2025 Citation: Li X, Xu X, Xiang S, Liu F, Wang F, Jiang X, Liu Y, Yang C (2025) Morpho-phylogenetic evidence reveals two new species and two new host records of Diaporthe (Diaporthales, Diaporthaceae) from Phellodendron chinense in Sichuan, China. MycoKeys 123: 205–233. https://doi. org/10.3897/mycokeys.123.162866 MycoKeys 123: 205–233 (2025) DOI: 10.3897/mycokeys.123.162866 206 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense versatility, Diaporthe species display distinct morphological characteristics in both their sexual and asexual stages. The sexual morph is characterised by aggregated ascomata with tapering necks, unitunicate 8-spored asci and ellipsoid to fusiform ascospores bearing prominent guttules. The asexual morph produces black, ostiolate pycnidia lined with cylindrical phialides that generate three types of hyaline, aseptate conidia: commonly observed alpha-conidia and beta-conidia and the rarely-encountered gamma-conidia (Gomes et al. 2013; Gao et al. 2017; Chaisiri et al. 2022; Liu et al. 2024; Li et al. 2025). Morphological variation within Diaporthe is often insufficient for reliable species delimitation, as phenotypic traits can be influenced by host association and environmental factors, resulting in frequent misidentifications (Guo et al. 2020; Monkai et al. 2023; Aumentado and Balendres 2024a, b). To address this taxonomic challenge, multi-locus phylogenetic analyses, based on five gene loci (ITS, tef1-α, tub2, cal and his3), have substantially enhanced species resolution and clarified evolutionary relationships within the genus (Udayanga et al. 2012; Santos et al. 2017a). Although multi-locus phylogenetic analyses have improved species resolution in Diaporthe, challenges such as limited sampling and incomplete lineage sorting may still lead to inaccurate estimates of species diversity (Dissanayake et al. 2017b; Hilário et al. 2021a, b). To overcome these limitations, recent studies have applied GCPSR (genealogical concordance phylogenetic species recognition) and coalescent-based models, which have led to the synonymisation of previously over-split taxa and the reclassification of the genus into seven sections, including Betulicola, Crotalariae, Eres, Foeniculina, Psoraleae-pinnatae, Rudis and Sojae (Hilário et al. 2021a, b; Dissanayake et al. 2024). Our ongoing research work has been dedicated to investigating fungi associated with woody medicinal plants in Sichuan, China, with particular attention to important native host species, such as Phellodendron chinense, Eucommia ulmoides and Magnolia officinalis. In recent investigations targeting P. chinense in Sichuan Province, several isolates belonging to the genus Diaporthe were obtained from branch tissues. Detailed morphological characterisation, combined with multilocus phylogenetic analysis, resulted in the identification of two novel species and two new host records. These findings expand the current taxonomic framework of Diaporthe and enhance our understanding of its host range and lineage diversification on woody medicinal plants. Materials and methods Sampling and fungal isolation Samples from decaying branches of Phellodendron chinense were collected from the main planting regions in Leshan and Yibin, Sichuan Province, China, in May 2024. Samples were placed in sterile ziplock bags and transported to the laboratory for fungal isolation. Fungal isolation was carried out following the protocol described by Senanayake et al. (2020). All specimens were deposited in the Herbarium of Sichuan Agricultural University (SICAU), while living cultures were preserved in the Culture Collection of Sichuan Agricultural University (SICAUCC), Chengdu, China. 207 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Morphological characterisation Morphological observations were conducted on the specimens collected from host materials. Macroscopic structures, including conidiomata, were examined under a dissecting microscope (NVT-GG; Shanghai Advanced Photoelectric Technology Co., Ltd., China) and photographed using a digital camera (VS-800C, Shenzhen Weishen Times Technology Co., Ltd., China). Microscopic features, including conidiophores and conidia, were observed using BX53 compound microscope (Olympus Corporation, Japan), equipped with an SD1600AC digital camera and CapStudio software (v. 3.8.10.0; Image Technology Company, Suzhou, China). Measurements of key features were taken using Tarosoft Image Framework v. 0.9.7 (Tarosoft (R), Nontha Buri, Thailand). Images were edited and compiled using Adobe Photoshop CC 2022 (Adobe Systems, San Jose, CA, USA). DNA extraction, PCR and sequencing Genomic DNA was extracted from freshly growing mycelia on potato dextrose agar using the New Plant Genomic DNA Kit (Beijing Aidlab Biotechnologies Co., Ltd., Beijing, China), following the manufacturer’s protocol. Five gene regions, including the internal transcribed spacer (ITS), the translation elongation factor 1 alpha (tef1-α), the beta-tubulin (tub2), the calmodulin (cal) and the histone H3 (his3) were amplified using specific primer pairs. The corresponding primer sequences and thermal cycling conditions are provided in Table 1. PCR products were visualised on 2% agarose gels to verify successful amplification and subsequently sequenced bidirectionally using the same primers by Hangzhou Youkang Biotech Co., Ltd. (Chengdu, China). Consensus sequences were assembled using BioEdit v. 7.0.5.3 and submitted to GenBank. All obtained sequences were compared with those in GenBank using the BLASTn algorithm (http://www.ncbi.nlm.nih.gov/BLAST/) to determine the closest matches. Phylogenetic analyses Sequences of Diaporthe species used for constructing the multigene dataset were downloaded from GenBank (Table 2). Multiple sequence alignments for each of the five gene regions (ITS, tef1-α, tub2, cal and his3) were performed separately using the online platform of MAFFT v. 7.490 (Katoh et al. 2019). Minor manual adjustments were subsequently done using BioEdit v. 7.0.5.3 (Hall 1999). The aligned gene regions were concatenated using PhyloSuite v. 1.2.3 (Zhang et al. 2020). Model selection was performed with the OFPT tool (Zeng et al. 2023). Phylogenetic trees were inferred using Maximum Likelihood (ML) in RAxML v. 8.2.12 and Bayesian Inference (BI) in MrBayes v. 3.2.7a, both run on the CIPRES Science Gateway (Stamatakis 2014). ML node support was evaluated with 1,000 bootstrap replicates, while BI posterior probabilities were estimated using MCMC sampling, which stopped automatically when the average standard deviation of split frequencies dropped below 0.01. Resulting phylogenetic trees were visualised and refined using ChiPlot (https://www.chiplot. online) (Xie et al. 2023) and Adobe Illustrator CS6 (Adobe Systems Inc., USA). 208 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Table 1. Primers and PCR amplification procedures used in this study. Gene Primer Primer sequence (5’-3’) PCR condition Reference ITS ITS5 GGAAGTAAAAGTCGTAACAAGG 94 °C for 3 min, 35 cycles of 94 °C for 30 s, 55 °C for 50 s and 72 °C for 1 min and 72 °C for 10 min White et al. (1990) ITS4 TCCTCCGCTTATTGATATGC tef1-α EF1-728F CATCGAGAAGTTCGAGAAGG 94 °C for 3 min, 35 cycles of 94 °C for 30 s, 55 °C for 50 s and 72 °C for 1 min and 72 °C for 10 min Carbone and Kohn (1999) EF1-986R TACTTGAAGGAACCCTTACC tub2Bt2a GGTAACCAAATCGGTGCTGCTTTC 94 °C for 3 min, 35 cycles of 94 °C for 30 s, 51 °C for 50 s and 72 °C for 1 min and 72 °C for 10 min Glass and Donaldson (1995), O’Donnell and Cigelnik (1997) Bt2b ACCCTCAGTGTAGTGACCCTTGGC cal CAL228F GAGTTCAAGGAGGCCTTCTCCC 95 °C for 4 min, 35 cycles of 94 °C for 30 s, 60 °C for 50 s and 72 °C for 1 min and 72 °C for 10 min Carbone and Kohn (1999) CAL737R CATCTTTCTGGCCATCATGG his3CYLH3F AGGTCCACTGGTGGCAAG 96 °C for 5 min, 30 cycles of 96 °C for 30 s, 52 °C for 30 s and 72 °C for 1 min and 72 °C for 5 min Glass and Donaldson (1995), Crous et al. (2004) x H3-1b GCGGGCGAGCTGGATGTCCTT Table 2. GenBank accession numbers used in the phylogenetic analyses. Strains GenBank accession number Reference ITS tef1-α tub2cal his3 Section Eres Diaporthe alnicola CFCC 70997 T PQ636515 PQ635059 PQ635065 PQ635047 PQ635053 Li et al. (2025) D. alnicola CFCC 70998 PQ636516 PQ635060 PQ635066 PQ635048 PQ635054 Li et al. (2025) D. apiculata CGMCC3.17533 T KP267896 KP267970 KP293476 NA NA Gao et al. (2016) D. apiculata CFCC 53069 MK432652 MK578128 MK578055 MK442974 MK442999 Yang et al. (2021) D. apiculata LC3187 KP267866 KP267940 KP293446 NA NA Gao et al. (2016) D. azadirachtae TN 01 KC631323 NA NA NA NA Vedashree et al. (2015) D. charlesworthii BRIP 54884 m T KJ197288 KJ197250 KJ197268 NA NA Perera et al. (2018) D. citri CBS 135422 T KC843311 KC843071 KC843187 KC843157 MF418281 Udayanga et al. (2014b) D. citri AR4469 KC843321 KC843081 KC843197 KC843167 NA Udayanga et al. (2014b) D. citrichinensis ZJUD34 T JQ954648 JQ954666 KJ490396 KC357494 KJ490516 Huang et al. (2015) D. citrichinensis ZJUD85 KJ490620 KJ490499 KJ490441 NA KJ490562 Huang et al. (2015) D. collaria MFLUCC 17-2636 T MG806115 MG783040 MG783041 MG783042 NA Perera et al. (2018) D. collaria SAUCC 194.12 MT822540 MT855854 MT855737 MT855625 MT855509 Sun et al. (2021) D. conica CFCC 52571 T MH121506 MH121548 MH121588 MH121428 MH121466 Yang et al. (2018a) D. conica CFCC 52572 MH121507 MH121549 MH121589 MH121429 MH121467 Yang et al. (2018a) D. corylopsidis CGMCC3.28211 T PQ319517 PQ336407 PQ336435 PQ336463 PQ336491 Zhang et al. (2025) D. corylopsidis SAUCC5501 PQ319518 PQ336408 PQ336436 PQ336464 PQ336492 Zhang et al. (2025) D. cryptostegiae CGMCC3.28204 T PQ319542 PQ336432 PQ336460 PQ336488 PQ336516 Zhang et al. (2025) D. cryptostegiae SAUCC0103 PQ319543 PQ336433 PQ336461 PQ336489 PQ336517 Zhang et al. (2025) D. eres AR5193 T KJ210529 KJ210550 KJ420799 KJ434999 KJ420850 Udayanga et al. (2014a) D. eres DLR12a KJ210518 KJ210542 KJ420783 KJ434996 KJ420833 Udayanga et al. (2014a) D. eres LCM11401a KJ210521 KJ210545 KJ420787 KJ435027 KJ420837 Udayanga et al. (2014a) D. fengmingensis CGMCC3.28225 T PQ319519 PQ336409 PQ336437 PQ336465 PQ336493 Zhang et al. (2025) D. fengmingensis SAUCC5330 PQ319520 PQ336410 PQ336438 PQ336466 PQ336494 Zhang et al. (2025) D. gardeniae CBS 288.56 T KC343113 KC343839 KC344081 KC343355 KC343597 Gomes et al. (2013) D. gardeniae step 1 KY797655 MF158048 MF158050 NA MF158049 Li et al. (2023) D. grandiflori SAUCC194.84 T MT822612 MT855924 MT855809 MT855691 MT855580 Sun et al. (2021) D. hanceae CGMCC3.27974 T PQ319538 PQ336428 PQ336456 PQ336484 PQ336512 Zhang et al. (2025) D. hanceae SAUCC0164 PQ319539 PQ336429 PQ336457 PQ336485 PQ336513 Zhang et al. (2025) D. heterophyllae CBS 143769 T MG600222 MG600224 MG600226 MG600218 MG600220 Marin-Felix et al. (2019) D. irregularis CGMCC3.20092 T MT385951 MT424686 MT424706 MT424721 NA Dissanayake et al. (2020) D. irregularis GZCC 19-0344 MT797179 MT793022 MT793033 MT786249 NA Dissanayake et al. (2020) D. linzhiensis CFCC 71057 T PQ636519 PQ635063 PQ635069 PQ635051 PQ635057 Li et al. (2025) 209 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Strains GenBank accession number Reference ITS tef1-α tub2cal his3 D. linzhiensis N266C PQ636520 PQ635064 PQ635070 PQ635052 PQ635058 Li et al. (2025) D. litseae GUCC:24-0055 T PQ208460 PQ243584 NA PQ213368 PQ213369 Sun et al. (2024) D. litseae GUCC:23-0022 PQ208459 PQ243583 NA PQ213367 PQ213366 Sun et al. (2024) D. litseae SICAUCC 25-0133 PV741481 PV764957 PV764948 PV769972 PV759343 In this study D. litseae SICAUCC 25-0134 PV741482 PV764958 PV764949 PV769973 PV759344 In this study D. mianyangensis SICAUCC 23-0059 T PP060675 PP061149 PP061174 NA NA Wang et al. (2025) D. mianyangensis SICAUCC 23-0150 PP844878 PP850055 PP850062 NA NA Wang et al. (2025) D. oraccinii CGMCC3.17531 T KP267863 KP267937 KP293443 NA KP293517 Gao et al. (2016) D. oraccinii LC3296 KP267884 KP267958 KP293464 NA KP293536 Gao et al. (2016) D. penetriteum LC3353 T KP714505 KP714517 KP714529 NA KP714493 Guo et al. (2020) D. penetriteum LC3215 KP267879 KP267953 KP293459 NA KP293532 Guo et al. (2020) D. sennicola CFCC 51634 T KY203722 KY228883 KY228889 KY228873 KY228879 Yang et al. (2017) D. sennicola CFCC 51635 KY203723 KY228884 KY228890 KY228874 KY228880 Yang et al. (2017) D. shennongjiaensis CNUCC201905 T MN216229 MN224672 MN227012 MN224551 MN224560 Zhou et al. (2019) D. shennongjiaensis CNUCC 201906 MN216228 MN224673 MN227013 MN224552 MN224561 Zhou et al. (2019) D. subclavata ZJUD95 T KJ490630 KJ490509 KJ490451 NA KJ490572 Sun et al. (2021) D. subclavata SAUCC3349 PQ319523 PQ336413 PQ336441 PQ336469 PQ336497 Zhang et al. (2025) D. virgiliae CMW 40755 T KP247573 NA KP247582 NA NA Machingambi et al. (2015) D. virgiliae CMW 40748 KP247566 NA KP247575 NA NA Machingambi et al. (2015) D. zaofenghuang CGMCC3.20271 T MW477883 MW480871 MW480875 MW480867 MW480863 Wang et al. (2021) D. zaofenghuang TZFH3 MW477884 MW480872 MW480876 MW480868 MW480864 Wang et al. (2021) Section Sojae Diaporthe acaciarum CBS 138862 T KP004460 NA KP004509 NA KP004504 Crous et al. (2014) D. alpiniae CGMCC3.28221 T PQ321210 PQ336519 PQ336537 PQ336555 PQ336573 Zhang et al. (2025) D. alpiniae SAUCC3248 PQ321211 PQ336520 PQ336538 PQ336556 PQ336574 Zhang et al. (2025) D. amaranthophila MAFF 246900 T LC459575 LC459577 LC459579 LC459583 LC459581 Rossman et al. (2015) D. amaranthophila MAFF 246901 LC459576 LC459578 LC459580 LC459584 LC459582 Rossman et al. (2015) D. ambigua CBS 114015 T MH862953 KC343736 KC343978 KC343252 KC343494 Vu et al. (2019) D. ambigua CBS 117167 KC343011 KC343737 KC343979 KC343253 KC343495 Vu et al. (2019) D. angelicae CBS 111592 T KC343027 KC343753 KC343995 KC343269 KC343511 Gomes et al. (2013) D. angelicae CBS 100871 KC343025 KC343751 KC343993 KC343267 KC343509 Gomes et al. (2013) D. arctii CBS 139280 T KJ590736 KJ590776 KJ610891 KJ612133 KJ659218 Udayanga et al. (2015) D. arezzoensis MFLU 19-2880 T MT185503 MT454019 MT454055 NA NA Li et al. (2020) D. batatas CBS 122.21 T KC343040 KC343766 KC344008 KC343282 KC343524 Udayanga et al. (2015) D. beilharziae BRIP 54792 T JX862529 JX862535 KF170921 NA NA Tan et al. (2013) D. betae HMPHU 3001 T MW882216 MW882222 MW882228 MW882219 MW882225 Shao et al. (2025) D. betae HUMCC 3268 MW882217 MW882223 MW882229 MW882220 MW882226 Shao et al. (2025) D. biguttulata CFCC 52584 T MH121519 MH121561 MH121598 MH121437 MH121477 Gao et al. (2015) D. biguttulata CFCC 52585 MH121520 MH121562 MH121599 MH121438 MH121478 Gao et al. (2015) D. brasiliensis CBS 133183 T KC343042 KC343768 KC344010 KC343284 KC343526 Dissanayake et al. (2017b) D. brasiliensis LGMF926 KC343043 KC343769 KC344011 KC343285 KC343527 Dissanayake et al. (2017b) D. breyniae CBS 148910 T ON400846 ON409188 ON409186 ON409189 ON409187 Matio Kemkuignou et al. (2022) D. caatingaensis URM7485 KY085927 KY115604 KY115601 KY115598 KY115605 Crous et al. (2016) D. caatingaensis URM7484 KY085928 NA KY115602 KY115599 KY115606 Crous et al. (2016) D. caryae CFCC 52563 T MH121498 MH121540 MH121580 MH121422 MH121458 Yang et al. (2018b) D. caryae CFCC 52564 MH121499 MH121541 MH121581 MH121423 MH121459 Yang et al. (2018b) D. chiangraiensis MFLUCC 17-1669 T MF190119 MF377598 NA NA NA Senanayake et al. (2017) D. chiangraiensis MFLUCC 17-1670 MF190118 MF377599 NA NA NA Senanayake et al. (2017) D. chimonanthi SCHM 3614 T AY622993 NA NA NA NA Chang et al. (2005) 210 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Strains GenBank accession number Reference ITS tef1-α tub2cal his3 D. chimonanthi SCHM 3603 AY620820 NA NA NA NA Chang et al. (2005) D. cichorii MFLUCC 17-1023 T KY964220 KY964176 KY964104 KY964133 NA Dissanayake et al. (2017b) D. cinnamomi CFCC 52569 T MH121504 MH121546 MH121586 NA MH121464 Zhu et al. (2023) D. cinnamomi CFCC 52570 MH121505 MH121547 MH121587 NA MH121465 Zhu et al. (2023) D. citriasiana ZJUD30 T JQ954645 JQ954663 KC357459 KC357491 NA Huang et al. (2013) D. citriasiana ZJUD81 KJ490616 KJ490495 KJ490437 NA KJ490558 Huang et al. (2015) D. convolvuli CBS 124654 T KC343054 KC343780 KC344022 KC343296 KC343538 Dissanayake et al. (2017b) D. convolvuli FAU649 KJ590721 KJ590765 NA KJ612130 KJ659210 Udayanga et al. (2015) D. coracoralinae URM 8912 T NR_198716 PP430449 PP402241 PP408214 PP421133 Ferro et al. (2024) D. cucurbitae DAOM 42078 T KM453210 KM453211 KP118848 NA KM453212 Udayanga et al. (2015) D. cucurbitae CBS 136.25 KC343031 KC343757 KC343999 KC343273 KC343515 Gomes et al. (2013) D. cuppatea CBS 117499 T KC343057 KC343783 KC344025 KC343299 KC343541 Van et al. (2006) D. cyatheae YMJNA1364 T JX570889 KC465406 KC465403 KC465410 NA Fu et al. (2013) D. desmotis CGMCC3.28203 T PQ321216 PQ336525 PQ336543 PQ336561 PQ336579 Zhang et al. (2025) D. desmotis SAUCC1130 PQ321217 PQ336526 PQ336544 PQ336562 PQ336580 Zhang et al. (2025) D. discoidispora ZJUD89 T KJ490624 KJ490503 KJ490445 NA KJ490566 Huang et al. (2015) D. discoidispora ZJUD87 KJ490622 KJ490501 KJ490443 NA KJ490564 Huang et al. (2015) D. eleutharrhenae 1 T OK017069 OK017070 OK017071 NA NA Song et al. (2022) D. eleutharrhenae 2OK648457 OK648458 OK648459 NA NA Song et al. (2022) D. ervatamiae HKAS 138717 T PQ637066 NA NA NA NA Sun et al. (2025) D. eucommiigena GUCC 420.19 OP581224 OP688529 OP688554 NA NA Wang et al. (2022) D. eucommiigena GUCC 420.9TOP581223 OP688528 OP688553 NA NA Wang et al. (2022) D. eucommiigena SICAUCC 25-0131 PV741477 PV764953 PV764944 NA PV759339 In this study D. eucommiigena SICAUCC 25-0132 PV741478 PV764954 PV764945 NA PV759340 In this study D. fici-macrocarpae SAUCC0412 T PQ321225 PQ336534 PQ336552 PQ336570 PQ336588 Zhang et al. (2025) D. fici-macrocarpae SAUCC0141 PQ321226 PQ336535 PQ336553 PQ336571 PQ336589 Zhang et al. (2025) D. fici-septicae NCYUCC 19-0108 T MW114349 MW192212 MW148269 NA NA Tennakoon et al. (2021) D. fici-septicae MFLU 20-20178 MW114348 MW192211 MW148268 NA NA Tennakoon et al. (2021) D. foliorum CMRP 1321 T MT576688 MT584310 MT584327 MT584341 MT584338 dos Santos et al. (2021) D. foliorum CMRP 1330 MT576671 MT584309 MT584328 MT584342 MT584340 dos Santos et al. (2021) D. ganjae CBS 180.91 T KC343112 KC343838 KC344080 KC343354 KC343596 Gomes et al. (2013) D. ganjae CGMCC3.17536 KP267854 KP267928 KP293434 NA KP293508 Gao et al. (2016) D. goulteri BRIP 55657a T KJ197290 KJ197252 KJ197270 NA NA Thompson et al. (2015) D. guangzhouensis CFCC 58151 T PP864725 PP938601 PP938605 PP938609 PP938613 Zhu et al. (2024) D. gulyae BRIP 54025 T JF431299 JN645803 NA NA NA Thompson et al. (2011) D. gulyae BRIP 53158 JF431284 JN645799 NA NA NA Thompson et al. (2011) D. guttulata CGMCC3.20100 T MT385950 MT424685 MT424705 MW022470 MW022491 Dissanayake et al. (2020) D. guttulata GZCC 19-0371 MT797178 MT793021 MT793032 MW022471 MW022492 Dissanayake et al. (2020) D. helianthi CBS 592.81 T KC343115 KC343841 KC344083 KC343357 KC343599 Gomes et al. (2013) D. helianthi CBS 344.94 KC343114 KC343840 KC344082 KC343356 KC343598 Gomes et al. (2013) D. hordei CBS 481.92 T KC343120 KC343846 KC344088 KC343362 KC343604 Gomes et al. (2013) D. infecunda CBS 133812 T KC343126 KC343852 KC344094 KC343368 KC343610 Gomes et al. (2013) D. infertilis CBS 230.52 T KC343052 KC343778 KC344020 KC343294 KC343536 Guarnaccia et al. (2017) D. infertilis CPC 20322 KC343053 KC343779 KC344021 KC343295 KC343537 Guarnaccia et al. (2017) D. juglandige GUCC 422.16 T OP581229 OP688534 OP688559 NA NA Wang et al. (2022) D. juglandige GUCC 422.161 OP581230 OP688535 OP688560 NA NA Wang et al. (2022) D. kunmingensis HKAS 136905 T PQ637068 NA NA NA NA Sun et al. (2025) D. kyushuensis STENAU2675 T AF230749 NA NA NA NA Mostert et al. (2001) D. kyushuensis chNADNA1 AB302250 NA NA NA NA Mostert et al. (2001) D. leucospermi CBS 111980 T NA KY435632 KY435673 KY435663 KY435653 Hilário et al. (2020) 211 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Strains GenBank accession number Reference ITS tef1-α tub2cal his3 D. leucospermi CAA762 MK792290 MK828063 MK837914 MK883822 MK871432 Hilário et al. (2020) D. leshanensis SICAUCC 25-0129 PV741475 PV764951 PV764942 PV769970 PV759337 In this study D. leshanensis SICAUCC 25-0130 TPV741476 PV764952 PV764943 PV769971 PV759338 In this study D. longicolla FAU599 T KJ590728 KJ590767 KJ610883 KJ612124 KJ659188 Udayanga et al. (2015) D. longicolla FAU644 KJ590730 KJ590769 KJ610885 KJ612126 KJ659190 Udayanga et al. (2015) D. longispora CBS 194.36 T KC343135 KC343861 KC344103 KC343377 KC343619 Gomes et al. (2013) D. lusitanicae CBS 123213 T KC343137 KC343863 KC344105 KC343379 KC343621 Gomes et al. (2013) D. lusitanicae CBS 123212 KC343136 KC343862 KC344104 KC343378 KC343620 Gomes et al. (2013) D. machilii SAUCC194.111 T MT822639 MT855951 MT855836 MT855718 MT855606 Huang et al. (2021) D. mayteni CBS 133185 T KC343139 KC343865 KC344107 KC343381 KC343623 Gomes et al. (2013) D. megalospora CBS 143.27 T KC343140 KC343866 KC344108 KC343382 KC343624 Gomes et al. (2013) D. melongenae MBELPIC61.1 T OQ123525 OR099712 OR099714 NA NA Aumentado et al. (2024a) D. melongenicola CGMCC3.27978 T PQ321221 PQ336530 PQ336548 PQ336566 PQ336584 Zhang et al. (2025) D. melongenicola SAUCC0472 PQ321222 PQ336531 PQ336549 PQ336567 PQ336585 Zhang et al. (2025) D. melonis CBS 507.78 T KC343142 KC343868 KC344110 KC343384 KC343626 Gomes et al. (2013) D. melonis FAU640 KJ590702 KJ590741 KJ610858 KJ612099 KJ659184 Udayanga et al. (2015) D. middletonii BRIP 54884e T KJ197286 KJ197248 KJ197266 NA NA Thompson et al. (2015) D. middletonii BRIP 57329 KJ197285 KJ197247 KJ197265 NA NA Thompson et al. (2015) D. minusculata CGMCC3.20098 T MT385957 MT424692 MT424712 MW022475 MW022499 Dissanayake et al. (2020) D. minusculata GZCC 19-0345 MT797184 MT793027 MT793038 MW022476 MW022500 Dissanayake et al. (2020) D. monetii MF Ha18-048 T MW008493 MW008515 MW008504 MZ671938 MZ671964 Gomzhina et al. (2022) D. monetii MF Ha18-049 MW008494 MW008516 MW008505 MZ671939 MZ671965 Gomzhina et al. (2022) D. morindendophytica ZHKUCC 22-0069 T ON322897 ON315053 ON315087 NA ON315027 Luo et al. (2022) D. morindendophytica ZHKUCC 22-0070 ON322898 ON315054 ON315088 NA ON315028 Luo et al. (2022) D. myracrodruonis URM 7972 T MK205289 MK213408 MK205291 MK205290 NA da Silva et al. (2019) D. neoarctii CBS 109490 T KC343145 KC343871 KC344113 KC343387 KC343629 Gomes et al. (2013) D. novem CBS 127270 T KC343156 KC343882 KC344124 KC343398 KC343640 Gomes et al. (2013) D. novem CBS 127271 KC343157 KC343883 KC344125 KC343399 KC343641 Gomes et al. (2013) D. orixae KUNCC 21-10714 T OK283041 NA NA OK484485 OK484486 Lu et al. (2022) D. orixae GZCC 21-1085 OL889852 OL944724 OL944726 NA NA Lu et al. (2022) D. ovalispora CGMCC3.17256 T KJ490628 KJ490507 KJ490449 NA KJ490570 Huang et al. (2015) D. oxe CBS 133186 T KC343164 KC343890 KC344132 KC343406 KC343648 Gomes et al. (2013) D. oxe CBS 133187 KC343165 KC343891 KC344133 KC343407 KC343649 Gomes et al. (2013) D. pachirae CDA 728 T MG559537 MG559539 MG559541 MG559535 NA Milagres et al. (2018) D. pachirae CDA 730 MG559538 MG559540 MG559542 MG559536 NA Milagres et al. (2018) D. paranensis CBS 133184 T KC343171 KC343897 KC344139 KC343413 KC343655 Gomes et al. (2013) D. paranensis LMICRO417 KY461115 KY461116 NA NA NA dos Santos et al. (2021) D. passiflorae CBS 132527 T JX069860 KY435633 KY435674 KY435664 KY435654 Crous et al. (2012) D. passiflorae CAA734 KY435638 KY435627 KY435668 KY435658 KY435648 Santos et al. (2017b) D. passiflorae CAA953 MN190308 MT309430 MT309456 MT309447 MT309439 Santos et al. (2017b) D. pedratalhadensis URM8304 T PP192073 PP430438 PP402232 PP408216 PP421129 Ferro et al. (2024) D. phaseolorum AR4203 T KJ590738 KJ590739 KJ610893 KJ612135 KJ659220 Gomes et al. (2013) D. phellodendri SICAUCC 23-0174 T PV741479 PV764955 PV764946 NA PV759341 In this study D. phellodendri SICAUCC 23-0175 PV741480 PV764956 PV764947 NA PV759342 In this study D. pseudofoliicola HNCM045 T OR647680 OR671940 OR671948 NA OR671932 Liu et al. (2024) D. pygmaeae CDP 1370 T PP577992 PP579317 PP579332 PP579348 NA Pereira et al. (2024) D. quercicola CSUFTCC104 T ON076567 ON081659 NA ON081670 ON081667 Cao et al. (2022) D. quercicola CSUFTCC105 ON076568 ON081660 NA ON081671 ON081668 Cao et al. (2022) D. racemosae CBS 143770 T MG600223 MG600225 MG600227 MG600219 MG600221 Marin-Felix et al. (2019) D. raonikayaporum CBS 133182 T KC343188 KC343914 KC344156 KC343430 KC343672 Gomes et al. (2013) 212 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Strains GenBank accession number Reference ITS tef1-α tub2cal his3 D. raonikayaporum MFLUCC 14-1133 KU712448 KU749368 KU743987 KU749355 NA Doilom et al. (2017) D. rosae MFLUCC 17-2658 T MG828894 NA MG843878 MG829273 NA Wanasinghe et al. (2018) D. rosae MFLUCC 17-2574 MG906793 MG968954 MG968952 NA NA Wanasinghe et al. (2018) D. rosiphthora COAD 2913 T MT311197 MT313693 NA MT313691 NA Pereira et al. (2021) D. sackstonii BRIP 54669b T KJ197287 KJ197249 KJ197267 NA NA Thompson et al. (2015) D. schini CBS 133181 T KC343191 KC343917 KC344159 KC343433 KC343675 Gomes et al. (2013) D. schini LGMF 910 KC343192 KC343918 KC344160 KC343434 KC343676 Gomes et al. (2013) D. schoeni MFLU 15-1279 T KY964226 KY964182 KY964109 KY964139 NA Dissanayake et al. (2017a) D. schoeni MFLU 15-2609 KY964229 KY964185 KY964112 KY964141 NA Dissanayake et al. (2017a) D. sclerotioides CBS 296.67 T MH858974 KC343919 KC344161 KC343435 KC343677 Gomes et al. (2013) D. sclerotioides CBS 710.76 KC343194 KC343920 KC344162 KC343436 KC343678 Gomes et al. (2013) D. serafiniae BRIP 55665a T KJ197274 KJ197236 KJ197254 NA NA Thompson et al. (2015) D. serafiniae BRIP 54136 KJ197273 KJ197235 KJ197253 NA NA Thompson et al. (2015) D. siamensis MFLUCC 10NA0573a T JQ619879 JX275393 JX275429 JX197423 NA Udayanga et al. (2012) D. siamensis MFLUCC 12-0300 KT459417 KT459451 KT459435 KT459467 NA Doilom et al. (2017) D. sinoadinae CGMCC3.27970 T PQ321214 PQ336523 PQ336541 PQ336559 PQ336577 Zhang et al. (2025) D. sinoadinae SAUCC5606 PQ321215 PQ336524 PQ336542 PQ336560 PQ336578 Zhang et al. (2025) D. sojae FAU635 T KJ590719 KJ590762 KJ610875 KJ612116 KJ659208 Udayanga et al. (2015) D. sojae AR3602 KJ590714 KJ590757 KJ610870 KJ612111 KJ659203 Udayanga et al. (2015) D. sojae CBS 116019 KC343175 KC343901 KC344143 KC343417 KC343659 Gomes et al. (2013) D. solani-melongenae MCCNAMNH 2729 T OQ123551 OR943642 OR943679 NA NA Aumentado et al. (2024b) D. stewartii CBS 193.36 MH867279 GQ250324 JX275421 JX197415 NA Santos et al. (2010) D. stewartii MN1 KX668416 KX852355 NA NA NA Olson et al. (2017) D. submersa CGMCC3.24297 T OP056717 OP150556 OP150633 OP150710 OP150786 Dissanayake et al. (2024) D. submersa GZCC 22-0007 OP056718 OP150557 OP150634 OP150711 OP150787 Dissanayake et al. (2024) D. subordiria CBS 464.90 T KC343214 KC343940 KC344182 KC343456 KC343698 Gomes et al. (2013) D. subordiria CBS 101711 KC343213 KC343939 KC344181 KC343455 KC343697 Gomes et al. (2013) D. talong MCCNAMNH 2727 T OQ123540 OR943636 OR943673 NA NA Aumentado et al. (2024a) D. tarchonanthi CBS 146073 T MT223794 NA MT223733 NA MT223759 Gomes et al. (2013) D. tecomae CBS 100547 T KC343215 KC343941 KC344183 KC343457 KC343699 Doilom et al. (2017) D. tectonendophytica MFLUCC 13-0471 T KU712439 KU749367 KU743986 KU749354 NA Doilom et al. (2017) D. tectonendophytica LC8115 KY491550 KY491560 KY491570 NA NA Gao et al. (2017) D. terebinthifolii CBS 133180 T KC343216 KC343942 KC344184 KC343458 KC343700 Gomes et al. (2013) D. terebinthifolii LGMF907 KC343217 KC343943 KC344185 KC343459 KC343701 Gomes et al. (2013) D. thunbergiicola MFLUCC 12-0033 T KP715097 KP715098 NA NA NA Liu et al. (2015) D. tulliensis BRIP 62248a T KR936130 KR936133 KR936132 NA NA Crous et al. (2015) D. ueckerae FAU656 T KJ590726 KJ590747 KJ610881 KJ612122 KJ659215 Huang et al. (2015) D. ueckerae BRIP 54736j KJ197282 KJ197244 KJ197262 NA NA Thompson et al. (2015) D. unshiuensis ZJUD50 T KJ490585 KJ490464 KJ490406 NA KJ490527 Huang et al. (2015) D. unshiuensis ZJUD52 KJ490587 KJ490466 KJ490408 NA KJ490529 Huang et al. (2015) D. vangoghii MF Ha18-045 T MW008491 MW008513 MW008502 MZ671936 MZ671962 Gomzhina et al. (2022) D. vangoghii MF Ha18-046 MW008492 MW008514 MW008503 MZ671937 MZ671963 Gomzhina et al. (2022) D. vargemgrandensis URM8784 T PP192069 PP430456 PP421092 PP421068 PP421135 Ferro et al. (2024) D. vexans CBS 127.14 KC343229 KC343955 KC344197 KC343471 KC343713 Crous et al. (2015) D. vexans FAU597 KJ590734 KJ590774 KJ610889 KJ612131 KJ659216 Udayanga et al. (2015) D. vochysiae LGMF1583 T MG976391 MK007526 MK007527 MK007528 MK033323 Noriler et al. (2019) D. yunnanensis CGMCC3.18289 T KX986796 KX999188 KX999228 KX999290 KX999267 Gao et al. (2017) D. yunnanensis LC8107 KY491542 KY491552 KY491562 KY491572 NA Gao et al. (2017) Diaporthella corylina CBS 121124 KC343004 KC343730 KC343972 KC343246 KC343488 Gomes et al. (2013) Note: The newly-generated sequences are indicated in bold. Ex-type or ex-epitype strains are marked with “T”. “NA” means sequence is unavailable. 213 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Genealogical concordance phylogenetic species recognition analysis The Genealogical Concordance Phylogenetic Species Recognition (GCPSR) approach was applied to assess potential recombination amongst phylogenetically closely-related taxa, based on the multi-locus sequence data (Taylor et al. 2000). Five gene regions (ITS, tef1-α, tub2, cal and his3) were aligned and concatenated into a single dataset. The concatenated alignment was analysed in SplitsTree v.4.17.1 (Huson and Bryant 2006) using the Pairwise Homoplasy Index (PHI, Φw) test to detect signals of recombination. Significant recombination was inferred when Φw < 0.05. The relationships amongst the closely-related taxa were further visualised by constructing a split network using the LogDet transformation and Splits options. Results Phylogenetic analysis For all eight isolates, BLASTn results for ITS, tef1-α, tub2, cal and his3 consistently matched Diaporthe, confirming placement at the generic level. To confirm the phylogenetic position, representative sequences of Diaporthe were downloaded from GenBank and incorporated into a combined dataset (ITS, tef1-α, tub2, cal and his3), which placed our isolates within the genus Diaporthe, distributed across two major sections corresponding to Section Sojae and Section Eres (Dissanayake et al. 2024). Finally, a combined five-gene dataset comprising 229 in-group taxa in Diaporthe, belonging to Section Sojae and Section Eres and one out-group taxon (D. corylina, CBS 121124) was used to construct the phylogenetic tree. The alignment contained a total of 3,884 characters (ITS: 1–663, tef1-α: 664–1,533, tub2: 1,534–2,569, his3: 2,570–3,201, cal: 3,202–3,884) after alignment. Single-gene analyses were conducted and they resulted in similar tree topologies between the ML and BI methods, ensuring the consistent comparisons of clade stability. The best-scoring RAxML tree with a final likelihood value of –58,926.815664 is presented. The matrix had 2,642 distinct alignment patterns, with 46.91% of undetermined characters or gaps. Estimated base frequencies were as follows: A = 0.214476, C = 0.325660, G = 0.238024, T = 0.221840; substitution rates AC = 1.190748, AG = 3.397866, AT = 1.269937, CG = 0.994576, CT = 4.742139, GT = 1.000000. Bayesian analyses reached convergence, with a final average standard deviation of split frequencies of 0.009999. Based on the phylogenetic tree, six isolates are phylogenetically grouped within Section Sojae (Fig. 1). Two new species identified as Diaporthe phellodendri and D. leshanensis are clustered in two independent clades within this section. The isolates SICAUCC 25-0131 and SICAUCC 25-0132 clustered with strains of D. eucommiigena, forming a well-supported monophyletic clade with 100% MLBS and 1.00 BYPP support. Another two isolates obtained in this study (SICAUCC 25-0133 and SICAUCC 25-0134) are grouped within the Section Eres, forming a distinct clade with D. litseae, supported by 100% MLBS and 1.00 BYPP. The network relationships of closely-related species of D. phellodendri and D. leshanensis are depicted in Fig. 2, indicating no significant recombination, based on the PHI test (Фw = 1). 220 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Material examined. • China, Sichuan Province, Leshan City, Jinkouhe County, Jixing Village, 29°16'58.10"N, 103°13'7.42"E, 1599 m elev., from branches of Phellodendron chinense, 1 May 2024, X.Y. Li, LXY202405010A (SICAU 25-0158, holotype), ex-type culture (SICAUCC 25-0130). ibid., LXY202405010B (SICAU 25-0157), culture (SICAUCC 25-0129). Notes. Phylogenetic analysis of combined ITS, tef1-α, tub2, cal and his3 sequence data revealed that Diaporthe leshanensis formed a separate clade sister to D. phellodendri (100% MLBS / 1.00 BYPP; Fig. 1) and nested with D. eucommiigena and D. passiflorae. Morphologically, conidiogenous cells of D. leshanensis are shorter than those of D. phellodendri (14.1–30.4 × 1.4–2.8 μm vs. 7.1–11.2 × 1.2–2.2 μm for producing beta-conidia). Compared to D. passiflorae, D. leshanensis possesses larger alpha-conidia (6.6–10 × 2.1–3.2 μm vs. 5.5–7 × 2–3 μm) and beta-conidia (19.7–22.5 × 1.3–1.7 μm vs. 16–18 × 1.5 μm) (Crous et al. 2012). In addition, the beta-conidia of D. leshanensis are smaller than those of D. eucommiigena (19.7–22.5 × 1.3–1.7 μm vs. 27–37 × 1–2 μm) (Wang et al. 2022). Pairwise nucleotide comparisons further support the distinction of D. leshanensis from related taxa. Diaporthe leshanensis (SICAUCC 25-0130, holotype) differs from D. phellodendri (SICAUCC 25-0174, holotype) by 0.21% (1/482, 0 gap) differences in ITS, 3.85% (8/208, 2 gaps) differences in tef1-α, 1.22% (5/410, 0 gap) differences in tub2 and 34.6% differences (127/367, 2 gaps) in his3. Furthermore, sequence data between D. leshanensis and D. passiflorae (CBS 132527, holotype) showed 3.11% (15/482, 1 gap), 23.63% (60/254, 36 gaps), 2.48% (10/404, 0 gap), 5.02% (16/319, 0 gap) and 34.19% (133/389, 9 gaps) differences in ITS, tef1-α, tub2, cal and his3, respectively. Additional comparisons showed that D. leshanensis differs from D. eucommiigena (GUCC 420.9) by 2.39% (12/482, 1 gap) in ITS, 21.77% (54/248, 30 gaps) in tef1-α and 3.11% (14/450, 1 gap) in tub2. Hence, based on its morphological characteristics, phylogenetic analysis, and nucleotide polymorphism comparison, D. leshanensis is described here as a new species. Diaporthe litsease Y.R. Sun, Yong Wang bis & K.D. Hyde, Phytotaxa 665(3): 248 (2024) Fig. 5 Description. Saprobic on decaying branch of Phellodendron chinense. Sexual morph: Not observed. Asexual morph: Coelomycetous. Conidiomata 298–341 × 207–257 μm (x – = 316 × 228 μm, n = 10), solitary, scattered, dark brown to black, discoid to elliptical, unilocular. Conidiomatal wall 13–48 μm wide, parenchymatous consisting of multi-layers of brown, thick-walled cells of textura angularis or textura globulosa. Conidiophores hyaline, smooth, straight to flexural, basally branched or unbranched. Conidiogenous cells 12–23 × 1.7–2.8 μm (x – = 16 × 2.3 μm, n = 20) for producing alpha-conidia, 11–15 × 1.2–2.5 μm (x – = 12.6 × 1.7 μm, n = 20) for producing beta-conidia, terminal, enteroblastic, monophialidic, cylindrical, slightly tapering towards the apex. Alpha-conidia 6–10 × 2.3–3.3 μm (x – = 8.4 × 2.7 μm, n = 50), hyaline, aseptate, ellipsoid to fusiform, smooth-walled, containing 1–5 guttules, base subtruncate. Beta-conidia 27– 36 × 1.1–1.8 μm (x – = 32 × 1.4 μm, n = 50), hyaline, aseptate, filiform, curved, tapering towards both ends. Gamma-conidia not observed. 221 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Figure 5. Diaporthe litsease (SICAU 25-0161). a. Habitat of Phellodendron chinense; b, c. Conidiomata on host surface; d. Section through a conidioma; e. Conidiomatal wall; f–i. Conidiogenous cells bearing conidia; j. Alpha-conidia; k. Beta-conidia; l. Germinating alpha-conidium; m. Colony on PDA (left: above, right: reverse). Scale bars: 500 μm (c), 50 μm (d, e), 10 μm (f–l). Culture characteristics. Alpha-conidia germinated in sterile water within 24 h at 25 °C. Colonies on PDA reached 55–60 mm in diameter after 7 d at 25 °C. Colony circular to slightly lobate, distinctly zonate, with a darker olivaceous-brown central disc surrounded by a thick pale buff to grey-green annulus of floccose tufts and an outer olivaceous ring. Surface uneven, numerous punctiform pycnidia, densest in the central disc. Aerial mycelium dense and cottony-floccose, forming small fasciculate tufts, margin entire to slightly lobate, with a thin band of submerged hyaline mycelium at the extreme edge. Reverse blackish to dark brown in the centre, becoming olivaceous-brown and then light brown towards the margin, with a conspicuous diffusing olivaceous-brown pigment in the PDA. Sporulation observed after approximately 20 d in culture, producing abundant alpha-conidia. Material examined. • China, Sichuan Province, Leshan City, Jinkouhe County, Jixing Village, 29°16'58.10"N, 103°13'7.42"E, 1599 m elev., from branches of Phellodendron chinense, 1 May 2024, X.Y. Li, LXY202405031A (SICAU 25-0161), culture (SICAUCC 25-0133); ibid., LXY202405031B (SICAU 25-0162), culture (SICAUCC 25-0134). Notes. Diaporthe litseae was described as an endophyte on healthy leaves of Litsea kobuskiana from Guizhou Province, China (Sun et al. 2024). In our phylogenetic analysis, two isolates obtained from branches 222 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense of Phellodendron chinense grouped within the D. litseae clade with strong statistical support (100% MLBS / 1.00 BYPP; Fig. 1). Morphologically, the new isolates exhibit characteristics consistent with D. litseae, particularly in having ellipsoid to fusiform, multiguttulate alpha conidia (6–10 × 2.3–3.3 μm vs. 5–9 × 2–3.5 μm). Pairwise sequence comparisons between our representative strain SICAUCC 25-0133 and the ex-type strain of D. litseae (GUCC 23-0055) revealed high similarity, viz. 99.61% in ITS (508/510 bp, 1 gap), 97.98% in tef1-α (291/297 bp, 0 gap), 100% in his3 (422/422 bp, 0 gap) and 99.33% in cal (446/449 bp, 0 gap). Therefore, we identify the new collections as D. litseae, marking the first record on P. chinense as saprobe in Sichuan, China. Diaporthe phellodendri X.Y. Li & C.L. Yang, sp. nov. Index Fungorum: IF901258 Fig. 6 Etymology. Refers to the host genus Phellodendron. Description. Saprobic on decaying branch of Phellodendron chinense. Sexual morph: Not observed. Asexual morph: Coelomycetous. Conidiomata 257– 291 × 211–240 μm (x – = 271 × 223 μm, n = 10), immersed, discoid to conical or irregular, brown to dark brown, solitary, scattered, unilocular. Conidiomatal wall 17–40 μm wide, parenchymatous consisting of multi-layers of pale brown to reddish-brown, thick-walled cells of textura angularis or textura globulosa. Conidiophores hyaline, smooth, straight to flexural, basally branched or unbranched. Conidiogenous cells 6.7–37 × 1.2–2.7 μm (x – = 18.7 × 1.8 μm, n = 20) for producing alpha-conidia, 14.1–30.4 × 1.4–2.8 μm (x – = 22.1 × 1.9 μm, n = 20) for producing beta-conidia, terminal, enteroblastic, monophialidic, cylindrical, slightly tapering towards the apex. Alpha-conidia 6.6–9.7 × 1.9–3.2 μm (x – = 8.1 × 2.6 μm, n = 50), hyaline, straight, ovate to ellipsoidal, aseptate, thinwalled, base sub-truncate, usually with two guttules. Beta-conidia 16.3–27.1 × 1.5–1.7 μm (x – = 20.4 × 1.6 μm, n = 50), hyaline, aseptate, filiform, curved, tapering towards both ends, scattered amongst the alpha conidia. Gamma-conidia not observed. Culture characteristics. Alpha-conidia germinated in sterile water within 24 h at 25 °C. Colonies on PDA attaining 40–50 mm diam. in 7 d. Colony irregular, with a fimbriate margin, mycelium sparse, surface floccose to cottony. Initially producing white aerial mycelium appressed to the medium surface, later developing into off-white to greyish-white colonies. Colony slightly raised, highest at the centre and gradually lower towards the margin. Reverse pale yellow with uneven pigmentation. Sporulation observed after approximately 20 d in culture, forming pale yellow to brown conidial masses irregularly distributed across the colony. Material examined. • China, Sichuan Province, Yibin City, Junlian County, Haoba Village, 27°55'20.16"N, 104°33'23.89"E, 1337 m elev., from branches of Phellodendron chinense, 2 May 2024, X.Y. Li, LXY202405030A (SICAU 24-0065, holotype), ex-type culture (SICAUCC 23-0174); ibid., LXY202405030B (SICAU 24-0066), culture (SICAUCC 23-0175). Notes. In the phylogenetic analysis, Diaporthe phellodendri formed a well-supported clade (100% MLBS / 1.00 BYPP; Fig. 1), showing its closest affinities to D. eucommiigena, D. passiflorae and D. leshanensis. Morphologically, 223 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Figure 6. Diaporthe phellodendri (SICAU 24-0065, holotype). a. Habitat of Phellodendron chinense; b, c. Conidiomata on host surface; d. Section through a conidioma; e. Ostiole; f. Conidiomatal wall; g–j. Conidiogenous cells bearing conidia; k. Alpha-conidia; l. Beta-conidia; m. Germinating alpha-conidium; n. Colony on PDA (left: above, right: reverse). Scale bars: 200 μm (c), 50 μm (d), 30 μm (e, f), 10 μm (g–m). D. phellodendri differs from D. passiflorae by having larger alpha conidia (6.6– 9.7 × 1.9–3.2 μm vs. 5.5–7 × 2–3 μm), as well as larger beta conidia (16.3– 27.1 × 1.5–1.7 μm vs. 16–18 × 1.5–2 μm) (Crous et al. 2012). In contrast to D. eucommiigena, D. phellodendri produces smaller beta conidia (16.3–27.1 × 1.5–1.7 μm vs. 27–37 × 1–2 μm) (Wang et al. 2022). Pairwise nucleotide comparisons further support the distinctiveness of D. phellodendri. It differs from D. passiflorae (CBS 132527, holotype) by 2.78% in ITS (16/575 bp, 1 gap), 19.57% in tef1-α (45/230 bp, 8 gaps), 3.75% in tub2 (16/427 bp, 0 gap) and 7.69% in his3 (31/403 bp, 6 gaps). In comparison with D. eucommiigena (GUCC 420.9, holotype), D. phellodendri shows sequence divergence of 2.26% in ITS (13/574 bp, 1 gap), 20.58% in tef1-α (50/243 bp, 8 gaps) and 3.06% in tub2 (14/457 224 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense bp, 1 gap). In addition, D. phellodendri is clearly separable from D. leshanensis, with diagnostic characters provided in the description of the latter. Therefore, D. phellodendri is described as a new species within Section Sojae. Discussion According to the United States Department of Agriculture (USDA) Fungal Database (https://fungi.ars.usda.gov/, accessed 20 May 2025), only five fungal species have been previously reported on Phellodendron chinense, including Coleosporium phellodendri, Diplodia rutaecola, Heteroconium phellodendri, Nigrospora guilinensis and Passalora phellodendricola (Zhang et al. 1997; Crous and Braun 2003; Dudka et al. 2004; Ma et al. 2012; Zeng et al. 2020). To date, the occurrence of Diaporthe species on this host has not been documented. In the present study, eight Diaporthe isolates were obtained from decaying branches of Phellodendron chinense. Phylogenetic analyses, based on a five-locus dataset (ITS, tef1-α, tub2, cal and his3) combined with morphology, supported the introduction of two new species, Diaporthe phellodendri and D. leshanensis. In addition, D. eucommiigena and D. litseae were isolated from P. chinense for the first time. These findings expand the known host range of Diaporthe and refine species delimitation within the genus. The taxonomic delimitation of Diaporthe species continues to present significant challenges, particularly given the dynamic re-definition of sectional classifications (Hilário et al. 2021a, b; Norphanphoun et al. 2022; Pereira et al. 2023; Dissanayake et al. 2024; Ferro et al. 2024; Li et al. 2025; Zhang et al. 2025). Recent systematic revisions have delineated seven sections within the genus: Betulicola, Crotalariae, Eres, Foeniculina, Psoraleae-pinnatae, Rudis and Sojae (Dissanayake et al. 2024). Our phylogenetic analyses placed three species (Diaporthe eucommiigena, D. phellodendri and D. leshanensis) within Section Sojae, which contains nine species/species-complexes. Within the section, these taxa occupy lineages outside the currently recognised species/species-complexes and, together, form a strongly supported clade with D. passiflorae. Historically, D. eucommiigena was synonymised with D. passiflorae due to overlap in alpha conidial characters (Dissanayake et al. 2024). However, our multilocus phylogeny resolves them as distinct sister lineages, corroborated by differences in beta and gamma conidial dimensions and by divergence across ITS, tef1-α and tub2. Likewise, D. litseae is phylogenetically nested within Section Eres, which contains five species/species-complexes, but occupies an isolated position outside the established species/species-complexes. This study further expands the morphological characterisation of D. litseae by documenting its previously undescribed beta-conidia. This refined morphological profile facilitates a more comprehensive understanding of its morphological variability and will contribute to enhancing future identification efforts within Section Eres. In recent years, China has become a hotspot for Diaporthe research, with numerous studies documenting novel taxa and expanding host records across diverse ecosystems. Based on the USDA Fungal database (https://fungi.ars. usda.gov/, accessed 15 August 2025), 389 records from China across 63 host families indicate that Diaporthe is concentrated in a subset of woody, economically important families, particularly Rutaceae, Rosaceae and Theaceae, with notable representation in Fagaceae, Actinidiaceae, Sapindaceae and Vitaceae. This pattern is consistent with recent studies on diverse plant hosts across Chi- 225 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense na that collectively document substantial Diaporthe diversity and associations with important plant diseases (Huang et al. 2015; Gao et al. 2016; Dissanayake et al. 2020; Yang et al. 2020; Wang et al. 2021; Cao et al. 2022; Lu et al. 2022; Luo et al. 2022; Bai et al. 2023; Xiao et al. 2023; Liu et al. 2024; Zhu et al. 2024; Li et al. 2025; Shao et al. 2025; Zhang et al. 2025). Sichuan Province, located at the intersection of diverse climatic and topographic zones, harbours rich biodiversity of medicinal plants and provides unique ecological niches for fungal colonisation. Despite its status as a key region for authentic Chinese medicinal plants, fungal surveys targeting woody medicinal plants in Sichuan remain limited. The identification of Diaporthe taxa from Phellodendron chinense underscores the underexplored fungal diversity associated with woody medicinal plants in this region. Future studies should survey fungal communities on woody medicinal hosts, focusing on their pathogenic potential to clarify disease patterns and inform sustainable management of forest-derived medicinal resources in this ecologically rich region. Additional information Conflict of interest The authors have declared that no competing interests exist. Ethical statement No ethical statement was reported. Use of AI No use of AI was reported. Funding No funding was reported. Author contributions Conceptualization: CY. Investigation: XJ, FW. Methodology: FL. Writing – original draft: XL. Writing – review and editing: YL, SX, XX. Author ORCIDs Xinyue Li https://orcid.org/0009-0006-5189-0922 Xiulan Xu https://orcid.org/0000-0002-6832-5421 Feng Liu https://orcid.org/0000-0003-4580-7169 Chunlin Yang https://orcid.org/0000-0002-3854-8835 Data availability All of the data that support the findings of this study are available in the main text. References Aime MC, Miller AN, Aoki T, Bensch K, Cai L, Crous PW, Hawksworth DL, Hyde KD, Kirk PM, Lücking R, May TW, Malosso E, Redhead SA, Rossman AY, Stadler M, Thines M, Yurkov AM, Zhang N, Schoch CL (2021) How to publish a new fungal species, or name, version 3.0. IMA Fungus 12: 1–11. https://doi.org/10.1186/s43008-021-00063-1 226 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Aumentado HD, Balendres MA (2024a) Diaporthe melongenae sp. nov., a new fungal species causing leaf blight in eggplant. Journal of Phytopathology 172: e13246. https://doi.org/10.1111/jph.13246 Aumentado HD, Balendres MA (2024b) Novel species and new records of Diaporthe causing eggplant leaf and fruit blight in the Philippines. Mycological Progress 23: 1–23. https://doi.org/10.1007/s11557-024-01957-1 Bai Y, Lin L, Pan M, Fan X (2023) Studies of Diaporthe (Diaporthaceae, Diaporthales) species associated with plant cankers in Beijing, China, with three new species described. MycoKeys 98: 59–86. https://doi.org/10.3897/mycokeys.98.104156 Cao L, Luo D, Lin W, Yang Q, Deng X (2022) Four new species of Diaporthe (Diaporthaceae, Diaporthales) from forest plants in China. MycoKeys 91: 25–47. https://doi. org/10.3897/mycokeys.91.84970 Carbone I, Kohn LM (1999) A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91(3): 553–556. https://doi.org/10.1080/0027 5514.1999.12061051 Chaisiri C, Liu X, Lin Y, Luo C (2022) Diaporthe citri: A fungal pathogen causing melanose disease. Plants 11(12): e1600. https://doi.org/10.3390/plants11121600 Chang CQ, Cheng YH, Xiang MM, Jiang ZD (2005) New species of Phomopsis on woody plants in Fujian Province. Junwu Xuebao 24: 6–11. Chethana KWT, Manawasinghe IS, Hurdeal VG, Bhunjun CS, Appadoo MA, Gentekaki E, Raspé O, Promputtha I, Hyde KD (2021) What are fungal species and how to delineate them? Fungal Diversity 109: 1–25. https://doi.org/10.1007/s13225-021-00483-9 Crous PW, Braun U (2003) Mycosphaerella and its Anamorphs: 1. Names Published in Cercospora and Passalora. Centraalbureau voor Schimmelcultures, Utrecht, 571 pp. Crous PW, Groenewald JZ, Risède J-M, Simoneau P, Edwards J, Groenewald JZ (2004) Calonectria species and their Cylindrocladium anamorphs: Species with sphaeropedunculate vesicles. Studies in Mycology 50: 415–430. Crous PW, Summerell BA, Shivas RG, Burgess TI, Decock CA, Dreyer LL, Granke LL, Guest DI, Hardy GE, Hausbeck MK, Hüberli D, Jung T, Koukol O, Lennox CL, Liew EC, Lombard L, McTaggart AR, Pryke JS, Roets F, Saude C, Shuttleworth LA, Stukely MJ, Vánky K, Webster BJ, Windstam ST, Groenewald JZ (2012) Fungal Planet description sheets: 107–127. Persoonia 28: 138–182. https://doi.org/10.3767/003158512X652633 Crous PW, Wingfield MJ, Schumacher RK, Summerell BA, Giraldo A, Gené J, Guarro J, Wanasinghe DN, Hyde KD, Camporesi E, Jones EBG, Thambugala KM, Malysheva EF, Malysheva VF, Acharya K, Álvarez JL, Alvarado P, Assefa A, Barnes CW, Groenewald JZ (2014) Fungal Planet Description Sheets: 281–319. Persoonia 33: 212–289. https://doi.org/10.3767/003158514X685680 Crous PW, Wingfield MJ, Le Roux JJ, Richardson DM, Strasberg D, Shivas RG, Alvarado P, Edwards J, Moreno G, Sharma R, Sonawane MS, Tan YP, Altés A, Barasubiye T, Barnes CW, Blanchette RA, Boertmann D, Bogo A, Carlavilla JR, Cheewangkoon R, Daniel R, de Beer ZW, Yáñez-Morales MDJ, Duong TA, Fernández-Vicente J, Geering ADW, Guest DI, Held BW, Heykoop M, Hubka V, Ismail AM, Kajale SC, Khemmuk W, Kolařík M, Kurli R, Lebeuf R, Lévesque CA, Lombard L, Magista D, Manjón JL, Marincowitz S, Mohedano JM, Nováková A, Oberlies NH, Otto EC, Paguigan ND, Pascoe IG, Pérez-Butrón JL, Perrone G, Rahi P, Raja HA, Rintoul T, Sanhueza RMV, Scarlett K, Shouche YS, Shuttleworth LA, Taylor PWJ, Thorn RG, Vawdrey LL, Solano-Vidal R, Voitk A, Wong PTW, Wood AR, Zamora JC, Groenewald JZ (2015) Fungal Planet description sheets: 371–399. Persoonia 35: 264–327. https://doi. org/10.3767/003158515X690269 227 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Crous PW, Wingfield MJ, Burgess TI, Hardy GESJ, Crane C, Barrett S, Cano-Lira JF, Le Roux JJ, Thangavel R, Guarro J, Stchigel AM, Martín MP, Alfredo DS, Barber PA, Barreto RW, Baseia IG, Cano-Canals J, Cheewangkoon R, Ferreira RJ, Gené J, Lechat C, Moreno G, Roets F, Shivas RG, Sousa JO, Tan YP, Wiederhold NP, Abell SE, Accioly T, Albizu JL, Alves JL, Antoniolli ZI, Aplin N, Araújo J, Arzanlou M, Bezerra JDP, Bouchara JP, Carlavilla JR, Castillo A, Castroagudín VL, Ceresini PC, Claridge GF, Coelho G, Coimbra VRM, Costa LA, da Cunha KC, da Silva SS, Daniel R, de Beer ZW, Dueñas M, Edwards J, Enwistle P, Fiuza PO, Fournier J, García D, Gibertoni TB, Giraud S, Guevara-Suarez M, Gusmão LFP, Haituk S, Heykoop M, Hirooka Y, Hofmann TA, Houbraken J, Hughes DP, Kautmanová I, Koppel O, Koukol O, Larsson E, Latha KPD, Lee DH, Lisboa DO, Lisboa WS, López-Villalba Á, Maciel JLN, Manimohan P, Manjón JL, Marincowitz S, Marney TS, Meijer M, Miller AN, Olariaga I, Paiva LM, Piepenbring M, Poveda-Molero JC, Raj KNA, Raja HA, Rougeron A, Salcedo I, Samadi R, Santos TAB, Scarlett K, Seifert KA, Shuttleworth LA, Silva GA, Silva M, Siqueira JPZ, Souza-Motta CM, Stephenson SL, Sutton DA, Tamakeaw N, Telleria MT, Valenzuela-Lopez N, Viljoen A, Visagie CM, Vizzini A, Wartchow F, Wingfield BD, Yurchenko E, Zamora JC, Groenewald JZ (2016) Fungal Planet description sheets: 469–557. Persoonia 37: 218–403. https://doi.org/10.3767/003158516X694499 da Silva RMF, Soares AM, Pádua APSL, Firmino AL, Souza-Motta CM, da Silva GA, Plautz Jr HL, Bezerra JDP, Paiva LM, Ryvarden L, Oliani LC, de Mélo MAC, Magalhães OMC, Pereira OL, Oliveira RJV, Gibertoni TB, Oliveira TGS, Svedese VM, Fan XL (2019) Mycological Diversity Description II. Acta Botanica Brasílica 33(1): 163–173. https://doi. org/10.1590/0102-33062018abb0411 Dissanayake AJ, Camporesi E, Hyde KD, Zhang W, Yan JY, Li XH (2017a) Molecular phylogenetic analysis reveals seven new Diaporthe species from Italy. Mycosphere: Journal of Fungal Biology 8(5): 853–877. https://doi.org/10.5943/mycosphere/8/5/4 Dissanayake AJ, Phillips AJL, Hyde KD, Yan JY, Li XH (2017b) The current status of species in Diaporthe. Mycosphere: Journal of Fungal Biology 8(5): 1106–1156. https:// doi.org/10.5943/mycosphere/8/5/5 Dissanayake AJ, Chen YY, Liu JK (2020) Unravelling Diaporthe species associated with woody hosts from karst formations (Guizhou) in China. Journal of Fungi 6(4): e251. https://doi.org/10.3390/jof6040251 Dissanayake AJ, Zhu JT, Chen YY, Maharachchikumbura SS, Hyde KD, Liu JK (2024) A re-evaluation of Diaporthe: Refining the boundaries of species and species complexes. Fungal Diversity 126: 1–125. https://doi.org/10.1007/s13225-024-00538-7 Doilom M, Dissanayake AJ, Wanasinghe DN, Saranyaphat B, Liu JK, Bhat DJ, Taylor JE, Bahkali AH, McKenzie EHC, Hyde KD (2017) Microfungi on Tectona grandis (teak) in Northern Thailand. Fungal Diversity 82: 107–182. https://doi.org/10.1007/s13225-016-0368-7 dos Santos GD, Gomes RR, Gonçalves R, Fornari G, Maia BH, Schmidt-Dannert C, Gaascht F, Glienke C, Schneider GX, Colombo IR, Degenhardt-Goldbach J, Pietsch JLM, Costa-Ribeiro MCV, Vicente VA (2021) Molecular identification and antimicrobial activity of foliar endophytic fungi on the Brazilian pepper tree (Schinus terebinthifolius) reveal new species of Diaporthe. Current Microbiology 78(8): 3218–3229. https://doi. org/10.1007/s00284-021-02582-x Dudka IO, Heluta VP, Tykhonenko YY, Andrianova TV, Hayova VP, Prydiuk MP, Dzhagan VV, Isikov VP (2004) Fungi of the Crimean Peninsula. M.G. Kholodny Institute of Botany, National Academy of Sciences of Ukraine, 452 pp. Ferro LO, Bezerra JDP, da Silva TM, de Oliveira CS, dos S Nascimento S, Paiva LM, Fan X, Crous PW, Souza-Motta CM (2024) Endophytic Diaporthe species from Brazil. Fungal Systematics and Evolution 14: 251–270. https://doi.org/10.3114/fuse.2024.14.16 228 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Fu CH, Hsieh HM, Chen CY, Chang TT, Huang YM, Ju YM (2013) Ophiodiaporthe cyatheae gen. et sp. nov., a diaporthalean pathogen causing a devastating wilt disease of Cyathea lepifera in Taiwan. Mycologia 105(4): 861–872. https://doi.org/10.3852/12-346 Gao YH, Su YY, Sun W, Cai L (2015) Diaporthe species occurring on Lithocarpus glabra in China, with descriptions of five new species. Fungal Biology 119(5): 295–309. https://doi.org/10.1016/j.funbio.2014.06.006 Gao Y, Liu F, Cai L (2016) Unravelling Diaporthe species associated with Camellia. Systematics and Biodiversity 14(1): 102–117. https://doi.org/10.1080/14772000.2015.1101027 Gao Y, Liu F, Duan W, Crous PW, Cai L (2017) Diaporthe is paraphyletic. IMA Fungus 8: 153–187. https://doi.org/10.5598/imafungus.2017.08.01.11 Glass NL, Donaldson GC (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology 61(4): 1323–1330. https://doi.org/10.1128/aem.61.4.1323-1330.1995 Gomes RR, Glienke C, Videira SIR, Lombard L, Groenewald JZ, Crous PW (2013) Diaporthe: A genus of endophytic, saprobic and plant pathogenic fungi. Persoonia 31: 1–41. https://doi.org/10.3767/003158513X666844 Gomzhina MM, Gannibal PhB (2022) Diaporthe species infecting sunflower (Helianthus annuus) in Russia, with the description of two new species. Mycologia 114: 556–574. https://doi.org/10.1080/00275514.2022.2040285 Guarnaccia V, Crous PW (2017) Emerging citrus diseases in Europe caused by Diaporthe spp. IMA Fungus 8(2): 317–334. https://doi.org/10.5598/imafungus.2017.08.02.07 Guo YS, Crous PW, Bai Q, Fu M, Yang MM, Wang XH, Du YM, Hong N, Xu WX, Wang GP (2020) High diversity of Diaporthe species associated with pear shoot canker in China. Persoonia 45: 132–162. https://doi.org/10.3767/persoonia.2020.45.05 Hall TA (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. Hilário S, Amaral IA, Gonçalves MFM, Lopes A, Santos A, Alves A (2020) Diaporthe species associated with twig blight and dieback of Vaccinium corymbosum in Portugal, with description of four new species. Mycologia 112(2): 293–308. https://doi.org/10 .1080/00275514.2019.1698926 Hilário S, Gonçalves MFM, Alves A (2021a) Using genealogical concordance and coalescent-based species delimitation to assess species boundaries in the Diaporthe eres complex. Journal of Fungi 7(7): e507. https://doi.org/10.3390/jof7070507 Hilário S, Santos L, Alves A (2021b) Diaporthe amygdali, a species complex or a complex species? Fungal Biology 125(7): 505–518. https://doi.org/10.1016/j.funbio.2021.01.006 Huang F, Hou X, Dewdney MM, Fu Y, Chen G, Hyde KD, Li H (2013) Diaporthe species occurring on citrus in China. Fungal Diversity 61(1): 237–250. https://doi.org/10.1007/ s13225-013-0245-6 Huang F, Udayanga D, Wang XH, Hou X, Mei XF, Fu YS, Li HY (2015) Endophytic Diaporthe associated with Citrus: A phylogenetic reassessment with seven new species from China. Fungal Biology 119(5): 331–347. https://doi.org/10.1016/j.funbio.2015.02.006 Huang S, Xia J, Zhang X, Sun W (2021) Morphological and phylogenetic analyses reveal three new species of Diaporthe from Yunnan, China. MycoKeys 78: 49–77. https:// doi.org/10.3897/mycokeys.78.60878 Huson DH, Bryant D (2006) Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23(2): 254–267. https://doi.org/10.1093/molbev/msj030 229 MycoKeys 123: 205–233 (2025), DOI: 10.3897/mycokeys.123.162866 Xinyue Li et al.: Diaporthe on Phellodendron chinense Jeewon R, Hyde KD (2016) Establishing species boundaries and new taxa among fungi: Recommendations to resolve taxonomic ambiguities. Mycosphere: Journal of Fungal Biology 7(11): 1669–1677. https://doi.org/10.5943/mycosphere/7/11/4 Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20(4): 1160–1166. https://doi.org/10.1093/bib/bbx108 Li WJ, McKenzie EHC, Liu JK, Bhat DJ, Dai DQ, Camporesi E, Tian Q, Maharachchikumbura SSN, Luo ZL, Shang QJ, Zhang JF, Tangthirasunun N, Karunarathna SC, Xu JC, Hyde KD (2020) Taxonomy and phylogeny of hyaline-spored coelomycetes. Fungal Diversity 100(1): 279–801. https://doi.org/10.1007/s13225-020-00440-y Li F, Xie YY, Wu J, Wang LP, Wang HR (2023) First report of Diaporthe gardeniae causing branch blight of Gardenia jasminoides in Zhejiang Province, China. Plant Disease 107(4): e1218. https://doi.org/10.1094/PDIS-03-22-0460-PDN Li J, Li Y, Li J, Jiang N (2025) Species of Diaporthe (Diaporthaceae, Diaporthales) associated with Alnus nepalensis leaf spot and branch canker diseases in Xizang, China. MycoKeys 116: 185–204. https://doi.org/10.3897/mycokeys.116.142750 Liu JK, Hyde KD, Jones EBG, Ariyawansa HA, Bhat DJ, Boonmee S, Maharachchikumbura SSN, McKenzie EHC, Phookamsak R, Phukhamsakda C, Shenoy BD, Abdel-Wahab MA, Buyck B, Chen J, Chethana KWT, Singtripop C, Dai DQ, Dai YC, Daranagama DA, Dissanayake AJ, Doilom M, D’souza MJ, Fan XL, Goonasekara ID, Hirayama K, Hongsanan S, Jayasiri SC, Jayawardena RS, Karunarathna SC, Li WJ, Mapook A, Norphanphoun C, Pang KL, Perera RH, Peršoh D, Pinruan U, Senanayake IC, Somrithipol S, Suetrong S, Tanaka K, Thambugala KM, Tian Q, Tibpromma S, Udayanga D, Wijayawardene NN, Wanasinghe D, Wisitrassameewong K, Zeng XY, Abdel-Aziz FA, Adamčík S, Bahkali AH, Boonyuen N, Bulgakov T, Callac P, Chomnunti P, Greiner K, Hashimoto A, Hofstetter V, Kang JC, Lewis D, Li XH, Liu XZ, Liu ZY, Matsumura M, Mortimer PE, Rambold G, Randrianjohany E, Sato G, Sri-Indrasutdhi V, Tian CM, Verbeken A, von Brackel W, Wang Y, Wen TC, Xu JC, Yan JY, Zhao RL, Camporesi E (2015) Fungal diversity notes 1–110: Taxonomic and phylogenetic contributions to fungal species. Fungal Diversity 72(1): 1–197. https://doi.org/10.1007/s13225-015-0324-y Liu HY, Luo D, Huang HL, Yang Q (2024) Two new species of Diaporthe (Diaporthaceae, Diaporthales) associated with Camellia oleifera leaf spot disease in Hainan Province, China. MycoKeys 102: 225–243. https://doi.org/10.3897/mycokeys.102.113412 Lu QT, Zhang JY, Sun YR, Tang X, Lu YZ, Zhang Z (2022) Diaporthe orixae sp. nov., an endophytic species isolated from Orixa japonica in southern China. Phytotaxa 544(1): 37–51. https://doi.org/10.11646/phytotaxa.544.1.3 Luo M, Guo W, Zhao M, Manawasinghe IS, Guarnaccia V, Liu J, Hyde KD, Dong Z, You C (2022) Endophytic Diaporthe associated with Morinda officinalis in China. Journal of Fungi 8(8): e806. https://doi.org/10.3390/jof8080806 Ma J, Ma LG, Zhang YD, Castaneda-Ruiz RF, Zhang XG (2012) New species or records of Endophragmiella and Heteroconium from southern China. Cryptogamie. Mycologie 33(2): 127–135. https://doi.org/10.7872/crym.v33.iss2.2012.127 Machingambi NM, Dreyer LL, Oberlander KC, Roux J, Roets F (2015) Death of endemic Virgilia oroboides trees in South Africa caused by Diaporthe virgiliae sp. nov. Plant Pathology 64(5): 1149–1156. https://doi.org/10.1111/ppa.12341 Marin-Felix Y, Hernández-Restrepo M, Wingfield MJ, Akulov A, Carnegie AJ, Cheewangkoon R, Gramaje D, Groenewald JZ, Guarnaccia V, Halleen F, Lombard L, Luangsa-ard J, Marincowitz S, Moslemi A, Mostert L, Quaedvlieg W, Schumacher RK, Spies CFJ,