Optimization of the method for Loop-mediated isothermal amplification (LAMP) of nucleic acids for field detection of food- and waterborne pathogens
Full text
University of Novi Sad Faculty of Sciences Department of Chemistry, Biochemistry and Environmental Protection Mila Đisalov Optimization of the method for Loop-mediated isothermal amplification (LAMP) of nucleic acids for field detection of foodand waterborne pathogens -PhD dissertationMentors: Marija Lesjak, PhD, Full professor Ivana Gađanski, PhD, Senior Research Associate Novi Sad, 2024
UNIVERSITY OF NOVI SAD FORM – 5a FACULTY OF SCIENCES KEY WORD DOCUMENTATION1 Document type: Doctoral dissertation Author: Mila Đisalov, MSc Supervisor (title, first name, last name, position, institution) Ivana Gađanski, PhD, Senior Research Associate, BioSense Institute, University of Novi Sad Marija Lesjak, PhD, Full professor, Faculty of Sciences, University of Novi Sad Thesis title: Optimization of the method for Loop-mediated isothermal amplification (LAMP) of nucleic acids for field detection of foodand waterborne pathogens Language of text (script): English language, latin script Physical description: Number of: Pages – 302 Chapters – 9 References – 175 Tables – 28 Figures– 47 Graphs – 94 Appendices – 1 Scientific field: Chemistry Scientific subfield (scientific discipline): Biochemistry Subject, Key words: LAMP; isothermal method; nucleic acids; detection of pathogenic microorganisms; food safety; food security; field detection Abstract in English language: The UN Food and Agriculture Organization (FAO) estimates that by 2050 there will be close to 10 billion people on Earth. The major global challenge is how to provide enough food for everyone, that is safe, ample and produced in a sustainable way. In regard to food safety, large-scale epidemics of foodborne diseases are a persistent threat to public health, as the number of foodand waterborne diseases significantly increases year by year, resulting in the on-going global public health issue. Foodand waterborne microbiological pathogens can be found in a variety of foodstuffs, and their early detection is extremely important to increase overall food safety, and to prevent enormous economic losses. The problems with health-unsafe food in the last 20 years, and a related rise in food poisoning cases internationally, have led to a growing and urgent demand for safe food products that will not pose a danger to consumers. On the other hand, it is equally important to ensure the absence of
microbiological pathogens in the whole process of food production e.g. during crop cultivation where it is very important to perform early detection of pathogens to prevent their further spread and avoid the negative effects on yield and quality of crops or during food processing and storage. Classical microbiological cultivation methods are still considered the "gold standard" in detection of different types of pathogens (bacteria, viruses, pathogenic fungi) during quality analysis, due to their sensitivity, relative low cost and ability to generate qualitative and quantitative information regarding the number and nature of microorganisms of a different origin. However, what is considered perhaps the biggest drawback of these methods is the fact that they require at least 3-4 days to get the first results, and even up to 7 days for confirmatory results. In addition, there are pathogens that cannot be cultivated i.e., so-called viable but non-culturable - VBNC pathogens that do not have the ability to form visible colonies, which further hinders the ability to use classical microbiological cultivation methods for their detection. Application of polymerase chain reaction, i.e. PCR, changed the way microbiological analyses are performed in the direction of detecting specific microbial DNA as a target. PCR-based methods that detect pathogen-derived nucleic acids are faster (last up to several hours), very reliable and allow the analysis of VBNC pathogens. However, these techniques depend on precise instruments, clean working conditions and hence, cannot be used in the field. In addition, PCR can give falsepositive or false-negative results due to the use of nonspecific primers or to the lack of differentiation between nucleic acids of the living (active) and dead (inactive) cells. To address these challenges, the primary focus of this doctoral dissertation is on development and optimization of innovative nucleic acid based methods for rapid detection of pathogens in food and water. More specifically, the research focus of the dissertation is the application of the isothermal loop-mediated amplification (LAMP) method, which allows for fast, simple, and reliable field detection. This approach for detection of pathogens in food of animal and plant origin and in the environment corresponds to the “One health” paradigm, recommended by the FAO, that is encompassing methods of optimizing the health and well-being of people, animals, plants and environment. In line with this, the primary objectives (O) of this doctoral dissertation have been formulated as follows: O1) To perform advanced development of the LAMP method for research and potential practical purposes in order to detect pathogens in different complex matrices comprising foodstuffs (meat and vegetable), water, and soil-like matrix; O2) to determine applicability of the LAMP method for river water quality assessment as advised by the One health paradigm; O3) to improve and optimize procedures for nucleic acid (NA) isolation in order to enable rapid extraction in the field conditions and O4) comparison of the efficiency of the developed LAMP protocols versus both the conventional cultivation methods and the PCR method as the “gold standard” for NA amplification-based analyses. O1 formulated in the above described way comprises O1.1) establishing clearly defined protocols for LAMP detection of bacterial pathogens in various food matrices using Klebsiella aerogenes species as a model system; The protocol development includes de novo design of the specific primers,
and O1.2) developing LAMP protocol for early detection of pathogenic fungi Trichoderma spp. in soil-like matrix. The protocol development includes de novo design of the specific primers. Final protocol includes implementation of colorimetric detection of the LAMP products using gold nanoparticles, thereby increasing the technology readiness level (TRL) for real-life application of the developed protocol. O2 focuses on evaluating the potential application of the LAMP method in detecting fecal indicator bacteria (FIB), such as E. coli, for river water quality assessment. O3 deals with enhancing extraction protocols for rapid DNA isolation O3.1.1) from the foodstuffs and O3.1.2) from soil-like real-life samples (Chelex 100 method) and O3.2) from highly contaminated river water samples (a syringe-based DNA isolation method) and provides evaluation of developed protocols for application in the field conditions. O4 aims to provide conclusions on the applicability of developed LAMP protocols for use in early detection of pathogens of bacterial and fungal origin, in field conditions. The key conclusions derived from the research conducted in this dissertation are that the LAMP method has been successfully optimized for the specific detection of K. aerogenes and Trichoderma spp. in various types of real-life samples. Additionally, the LAMP protocol development included design of novel LAMP primers for both K. aerogenes and Trichoderma spp. as the primer sequences for these pathogens were not found in the literature. The developed LAMP procedures using novel primers are characterized by high sensitivity and low detection limits for all tested samples, as well as with better efficiency compared to the PCR method. These aspects confirm the significant potential of the LAMP method as a diagnostic tool for pathogen detection. Additionally, the field application of the LAMP method combined with the Chelex 100 method for DNA isolation enables practical use of the developed LAMP protocols under various conditions. Furthermore, the results demonstrated that the LAMP method can also be used for detecting E. coli in complex samples such as highly contaminated water, positioning the LAMP method as a very good tool for application following the One Health approach. Notably, the protocols for both LAMP and DNA extraction procedures developed within this thesis still require further increase in TRL before commercial field applications. Taking all of the above into account, this dissertation represents a significant contribution to the research on molecular detection methods and development of innovative diagnostic tools for enhancing food and water safety, that can be of significant importance in addressing the global challenge of ensuring safe food and sustainable environment for the growing population. Further research and application of these methods may greatly contribute to food poisoning prevention, public health and environmental management, as defined in the “One health” agenda.
Accepted by the Scientific Board on: Defended on: (Filled by the faculty service) Thesis Defense Board: (title, first name, last name, position, institution) President: Željko D. Popović, PhD, Associate professor, Faculty of Sciences, University of Novi Sad; Member: Ljiljana Šašić Zorić, PhD, Senior Research Associate, BioSense Institute, University of Novi Sad; Member: Jasmina Vidić, PhD, Ingènieur de recherche hors classe (equivalent to the title principal research fellow), National Institute for Agricultural, Food and Environmental Research (INRAE), Paris, France; Member (advisor): Ivana Gađanski, PhD, Senior Research Associate, BioSense Institute, University of Novi Sad; Member (advisor): Marija Lesjak, PhD, Full professor, Faculty of Sciences, University of Novi Sad Note: 1 The author of the doctoral dissertation has signed the following Statements: 5б – Statement on the authorship, 5в – Statement that the printed and e-version of the doctoral dissertation are identical and about personal data, 5г – Statement on copyright licenses. The paper and e-versions of the Statements are held at the faculty and are not included into the printed thesis.
УНИВЕРЗИТЕТ У НОВОМ САДУ ОБРАЗАЦ – 5а ПРИРОДНО-МАТЕМАТИЧКИ ФАКУЛТЕТ КЉУЧНA ДОКУМЕНТАЦИЈСКА ИНФОРМАЦИЈА2 Врста рада: Докторска дисертација Име и презиме аутора: MSc Мила Ђисалов Ментор (титула, име, презиме, звање, институција) др Ивана Гађански, виши научни сарадник, Институт БиоСенс, Универзитет у Новом Саду проф. др Марија Лесјак, редовни професор, Природно-математички факултет, Универзитет у Новом Саду Наслов рада: Оптимизација петљом-посредоване методе изотермалног умножавања нуклеинских киселина (LAMP) за примену у теренској детекцији патогена из хране и воде Језик публикације (писмо): Енглески језик, латиница Физички опис рада: Унети број: Страница – 302 Поглавља – 9 Референци – 175 Табела – 28 Слика – 47 Графикона – 94 Прилога – 1 Научна област: Хемија Ужа научна област (научна дисциплина): Биохемија Кључне речи / предметна одредница: LAMP; изотермална метода; нуклеинске киселине; детекција микробиолошких патогена; сигурност хране; безбедност хране; теренска детецкија Резиме на српском језику: Према проценама светске Организације за храну и пољопривреду (ФАО – од енгл. Food and Agriculture Organization of the United Nations), до 2050. године ће на планети Земљи бити близу 10 милијарди људи. Велики глобални изазов је како обезбедити довољно хране за све, која је безбедна, доступна у довољним количинама и произведена на одржив начин. Што се тиче безбедности хране, епидемије великих размера које могу бити узроковане преносом патогена путем хране представљају сталну претњу јавном здрављу, јер се број болести узрокованих овом врстом патогена значајно повећава из године у годину, што доводи до сталног глобалног проблема у области јавног здравља. Микробиолошки патогени који се преносе путем хране и воде могу се наћи у различитим врстама намирница, а њихово рано откривање је изузетно важно за свеукупно повећање безбедности хране, као и за спречавање великих економских губитака. Проблеми са здравствено
небезбедном храном у последњих 20 година, као и пораст примера тровања храном на међународном нивоу, довели су до све веће потражње за безбеднијим производима које неће представљати опасност за потрошаче. С друге стране, подједнако је важно осигурати одсуство микробиолошких патогена и у свим фазама производње хране, укључујући узгајање усева, где је рано откривање патогена кључно за спречавање њиховог ширења и избегавање негативних утицаја на принос и квалитет усева, као и у току прераде и складиштења хране. Класичне микробиолошке методе култивације се још увек сматрају „златним стандардомˮ у детекцији различитих врста патогена (бактерија, вируса и патогених гљива) приликом анализе квалитета, захваљујући њиховој осетљивости, релативно ниској цени и могућности генерисања квалитативних и квантитативних информација о броју и природи микроорганизама добијених из узорака различитог порекла. Међутим, оно што се сматра можда највећом маном ових метода јесте чињеница да захтевају најмање 3–4 дана да би се добили претпостављени резултати, а чак и до 7 дана за потврдне резултате. Такође, неки патогени могу бити вијабилни, али се не могу култивисати (енгл. viable but non culturable – VBNC), односно немају могућност формирања видљивих колонија, што даље омета могућност коришћења класичних микробиолошких метода култивације за њихово откривање. Примена ланчане реакције полимеразе, тј. PCRа, променила је начин извођења микробиолошких анализа у правцу детекције специфичне микробне ДНК као таргета. Методе засноване на PCR-у које откривају нуклеинску киселину која потиче од патогена, су брже (трају до неколико сати), веома поуздане и омогућују анализу VBNC патогена. Међутим, ове технике зависе од прецизних инструмената, чистоће радних услова и не могу се користити на лицу места тј. на терену. Осим тога, PCR може дати лажно позитивне или лажно негативне резултате услед неспецифичног умножавања, најчешће због примене неспецифичних почетница, или због немогућности разликовања нуклеинских киселина пореклом из живих (активних) и мртвих (инактивних) ћелија патогена. У циљу решавања ових изазова, примарни фокус ове докторске дисертације је на развоју и оптимизацији иновативних метода заснованих на нуклеинским киселинама за брзо и ефикасно откривање патогена у храни и води. Тачније, у жижи истраживања дисертације је примена петљом-посредоване изотермалне методе умножавања нуклеинских киселина тј. LAMP-а (од енгл. Loopmediated isothermal amplification) која омогућава брзу, једноставну и поуздану детекцију на терену. Овакав приступ откривања патогена у храни животињског и биљног порекла и у животној средини одговара парадигми „Једно здравље“ (енгл. “One health”), коју препоручује ФАО, а која обухвата методе оптимизације здравља и добробити људи, животиња, биљака и животне средине. У складу са овим, примарни циљеви ове докторске дисертације су формулисани на следећи начин: 1) спровођење напредног развоја LAMP методе за истраживачке и потенцијално практичне сврхе у циљу откривања патогена у различитим комплексним матрицама као што су намирнице (месо и поврће), вода и матрикс налик земљишту; 2)
утврђивање применљивости LAMP методе за процену квалитета речне воде у складу са парадигмом „Једно здравље“; 3) побољшање и оптимизација процедуре за изолацију нуклеинских киселина, како би се омогућила брза изолација нуклеинских киселина у теренским условима и 4) поређење ефикасности развијених LAMP протокола са конвенционалним методама култивације и PCR методом као „златног стандарда“ за анализе засноване на умножавању нуклеинских киселина. Циљ 1) формулисан на горе описани начин обухвата 1.1) успостављање јасно дефинисаних протокола за LAMP детекцију бактеријских патогена у различитим матрицама хране користећи врсту Klebsiella aerogenes као модел систем; 1.2) развој LAMP протокола за рано откривање патогених гљива Trichoderma spp. у матрицама налик земљишту. Финални протокол обухвата имплементацију колориметријске детекције LAMP производа коришћењем наночестица злата, чиме се повећава ниво технолошке спремности (ТРЛ – од енгл. technology readiness level) за реалну примену развијеног протокола; циљ 2) се фокусира на процену потенцијалне примене LAMP методе у откривању фекалних индикаторских бактерија (ФИБ), као што је E. coli, за процену квалитета речне воде; и циљ 3) се бави унапређењем протокола екстракције за брзу изолацију ДНК 3.1.1) из намирница и 3.1.2) из реалних узорака налик земљишту (Chelex 100 метода) и 3.2) из високозагађених узорака речне воде (методе екстракције ДНК на бази шприца) и обезбеђује евалуацију развијених протокола за примену у теренским условима. Циљ 4) тежи да пружи закључке о применљивости развијених LAMP протокола за примену у раном откривању патогена бактеријског и гљивичног порекла у теренским условима. Најзначајнији закључци који произилазе из истраживања спроведеног у оквиру ове докторске дисертације су да је LAMP метода успешно оптимизована за специфичну детекцију K. aerogenes и Trichoderma spp. у различитим врстама реалних узорака. Додатно, развој LAMP протокола подразумевао је и дизајн потпуно нових, до сада непостојећих LAMP почетница за K. aerogenes и Trichoderma spp., јер секвенце почетница за ове патогене нису биле доступне у литератури. Развијени LAMP протоколи који користе нове почетнице карактеришу се високом осетљивошћу и ниским границама детекције за све тестиране узорке, као и бољом ефикасношћу у поређењу са PCR методом. Ови аспекти потврђују значајан потенцијал LAMP методе као дијагностичког алата за откривање патогена. Поред тога, теренска примена LAMP методе у комбинацији са Chelex 100 методом за изолацију ДНК омогућава практичну употребу развијених LAMP протокола под различитим условима. Штавише, резултати су показали да се LAMP метода може користити и за детекцију E. coli у сложеним узорцима као што је високозагађена вода, позиционирајући LAMP методу као изузетно користан алат за примену у складу са приступом „Једно здравље“. Треба нагласити да протоколи за извођење LAMP-а и изолације ДНК развијени у оквиру ове докторске дисертације захтевају даље повећање ТРЛ-а пре комерцијалне примене на терену. Узимајући све наведено у обзир, ова дисертација представља значајан допринос истраживању метода молекуларне детекције и развоју иновативних
дијагностичких алата за унапређење безбедности хране и воде, који могу бити од великог значаја у решавању глобалног изазова – постојање безбедне хране и животне средине за растућу популацију. Даља истраживања и примена ових метода могу у великој мери допринети превенцији тровања храном, управљању јавним здрављем и животном средином, као што је дефинисано у агенди „Једно здравље“. Датум прихватања теме од стране надлежног већа: Датум одбране: (Попуњава одговарајућа служба) Чланови комисије: (титула, име, презиме, звање, институција) Председник: др Жељко Д. Поповић, ванредни професор, Природно-математички факултет, Универзитет у Новом Саду; Члан: др Љиљана Шашић Зорић, виши научни сарадник, Инситут БиоСенс, Универзитет у Новом Саду; Члан: др Јасмина Видић, Ingènieur de recherche hors classe (еквивалент звању научни саветник), Национални институт за пољопривредна, прехрамбена и еколошка истраживања (ИНРАЕ), Париз, Француска; Члан (ментор): др Ивана Гађански, виши научни сарадник, Инситут БиоСенс, Универзитет у Новом Саду; Члан (ментор): др Марија Лесјак, редовни професор, Природноматематички факултет, Универзитет у Новом Саду Напомена: 2 Аутор докторске дисертације потписао је и приложио следеће Обрасце: 5б – Изјава о ауторству; 5в – Изјава o истоветности штампане и електронске верзије и о личним подацима; 5г – Изјава о коришћењу. Ове Изјаве се чувају на факултету у штампаном и електронском облику и не кориче се са тезом.
Doctoral dissertation Mila Đisalov Graph 20. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked chicken breast DNA extract samples obtained through isolation using the Chelex 100 method .................................................................... 112 Graph 21. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked salami DNA extract samples obtained through isolation using the Chelex 100 method .................................................................................. 113 Graph 22. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in salami DNA extract samples obtained through isolation using the Chelex 100 method ................................................................................................. 114 Graph 23. Comparison of Tt values for various food DNA extracts extracted using Chelex 100 method and spiked with K. aerogenes gDNA.. ..................................................................... 115 Graph 24. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked carrot DNA extract samples obtained using the Plant/Fungi DNA Isolation kit ............................................................................................... 118 Graph 25. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in carrot DNA extract samples obtained through isolation using Plant/Fungi DNA Isolation Kit .................................................................................... 119 Graph 26. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked cucumber DNA extract samples obtained using the Plant/Fungi DNA Isolation kit. ........................................................................................ 120 Graph 27. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked cucumber DNA extract samples obtained through isolation using Plant/Fungi DNA Isolation Kit ...................................................................... 121 Graph 28. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked lettuce DNA extract samples obtained through isolation using the Plant/Fungi DNA Isolation Kit . .............................................................. 122 Graph 29. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked DNA lettuce extract samples obtained through isolation using Plant/Fungi DNA Isolation Kit. ..................................................................... 123 Graph 30. Comparison of Tt values for various vegetable DNA extracts extracted using Plant/Fungi DNA Isolation Kit and spiked with K. aerogenes gDNA.. ................................ 124 Graph 31. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked chicken breast DNA extract samples obtained using the DNeasy PowerFood Microbial Kit. ........................................................................ 126 Graph 32. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked chicken breast DNA extract samples obtained using the DNeasy PowerFood Microbial Kit.. ....................................................................... 127 Graph 33. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked salami DNA extract samples obtained through isolation using the DNeasy PowerFood Microbial Kit. ......................................................... 128 Graph 34. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in salami DNA extract samples obtained through isolation using the DNeasy PowerFood Microbial Kit. ........................................................................ 129 Graph 35. Comparison of Tt values for various meat DNA extracts extracted using DNeasy PowerFood Microbial Kit and spiked with K. aerogenes gDNA. ......................................... 130
Doctoral dissertation Mila Đisalov Graph 36. Amplification graph of the Real Time LAMP analysis of DNA extracts from inoculated vegetable samples isolated by the Chelex 100 method. ....................................... 133 Graph 37. Melting curve graph for Real Time LAMP analysis of DNA extracts from inoculated vegetable samples isolated by the Chelex 100 method. ....................................... 134 Graph 38. Amplification graph of the Real Time LAMP analysis of DNA extracts from inoculated meat samples isolated by the Chelex 100 method................................................ 135 Graph 39. Melting curve graph for Real Time LAMP analysis of inoculated meat samples isolated by the Chelex 100 method. ....................................................................................... 136 Graph 40. Amplification graph of Real Time LAMP analysis of DNA extracts from inoculated vegetable samples isolated by Plant/Fungi DNA Isolation Kit. ............................................ 137 Graph 41. Melting curve graph for Real Time LAMP analysis of DNA extracts from inoculated vegetable samples isolated by Plant/Fungi DNA Isolation Kit. ........................... 138 Graph 42. Amplification graph for the results of Real Time LAMP analysis of DNA extracts from inoculated meat samples isolated by using DNeasy PowerFood Microbial Kit. .......... 139 Graph 43. Melting curve graph for Real Time LAMP analysis of DNA extracts from inoculated meat samples isolated by using DNeasy PowerFood Microbial Kit. ................... 140 Graph 44. Real Time PCR Analysis for DNA extracts of inoculated vegetable samples isolated by the Chelex 100 method: amplification curve in relation to cycle number. ....................... 141 Graph 45. Real Time PCR Analysis for DNA extracts of inoculated vegetable samples isolated by the Chelex 100 method: amplification curve in relation to reaction time. ........................ 142 Graph 46. Real Time PCR analysis for DNA extracts of inoculated vegetable samples isolated by the Plant/Fungi DNA Isolation Kit: amplification curve in relation to cycle number.. .... 143 Graph 47. Real Time PCR analysis for DNA extracts of inoculated vegetable samples isolated by the Plant/Fungi DNA Isolation Kit: multiplication curve in relation to reaction time. .... 143 Graph 48. Real Time PCR analysis of DNA extracts from inoculated meat samples isolated using Chelex 100 and DNeasy PowerFood Microbial Kit: amplification curve in relation to cycle number. ......................................................................................................................... 144 Graph 49. Real Time PCR analysis of DNA extracts from inoculated meat samples isolated by Chelex 100 and DNeasy PowerFood Microbial Kit: amplification curve in relation to reaction time........................................................................................................................... 145 Graph 50. Real Time LAMP amplification graph for testing primer candidates for Trichoderma spp. detection. .................................................................................................. 154 Graph 51. Tt values of different primer candidates for Trichoderma spp. detection. .......... 154 Graph 52. Real Time LAMP melting curve for testing primer candidates for Trichoderma spp. detection ................................................................................................................................. 155 Graph 53. Amplification graph for assessing the specificity of PC2 set for Trichoderma spp. amplification using the Real Time LAMP method ................................................................ 156 Graph 54. Melting curve for assessing the specificity of PC2 set for Trichoderma spp. amplifiaction using the Real Time LAMP method ................................................................ 157 Graph 55. Amplification graph showing LOD of the Real Time LAMP for detection of Trichoderma spp. using primer set PC2.. .............................................................................. 160 Graph 56. Tt values for various tested concentrations of T. harzianum gDNA using PC2 in Real Time LAMP.. ................................................................................................................. 161 Graph 57. Melting curve graph for Real Time LAMP amplification products from reaction for determining the LOD of Trichoderma spp. using primer set PC2. ........................................ 162
Doctoral dissertation Mila Đisalov Graph 58. Results of Trichoderma spp. Real Time LAMP amplification for eDNA extracted from compost and casing soil using Chelex 100 isolation approach. .................................... 165 Graph 59. Melting curve graph of Trichoderma spp. Real Time LAMP amplification from eDNA extracted from compost and casing soil using Chelex 100 isolation approach.. ........ 166 Graph 60. Results of Trichoderma spp. Real Time LAMP amplification for eDNA extracted from compost and casing soil using GenElute™ Soil DNA Isolation Kit.. .......................... 167 Graph 61. . Melting curve graph of Trichoderma spp. Real Time LAMP amplification from eDNA extracted from compost and casing soil using the GenElute™ Soil DNA Isolation Kit.. ................................................................................................................................................ 168 Graph 62. Real Time LAMP amplification graph for determining LOD of Trichoderma spp. using PC2 primer set in compost eDNA extract samples obtained using the Chelex 100 method. ................................................................................................................................................ 169 Graph 63. . Real Time LAMP melting curve graph for determining LOD of Trichoderma spp. using PC2 primer set in compost eDNA extract samples obtained using the Chelex 100 method.................................................................................................................................... 170 Graph 64. Real Time LAMP amplification graph for determining LOD of Trichoderma spp. using PC2 primer set in casing soil eDNA extract samples obtained through isolation using the Chelex 100 method ................................................................................................................ 171 Graph 65. Real Time LAMP melting curve graph for determining LOD of detection of Trichoderma spp. using PC2 primer set in casing soil eDNA extract samples obtained through isolation using the Chelex 100 method .................................................................................. 172 Graph 66. Comparison of Tt values for compost and casing soil eDNA extracts obtained using Chelex 100 method and spiked with T. harzianum gDNA.. .................................................. 173 Graph 67. Real Time LAMP amplification graph for determining LOD of Trichoderma spp. using PC2 primer set in compost eDNA extract samples obtained through isolation using the GenElute™ Soil DNA Isolation Kit ...................................................................................... 175 Graph 68. Real Time LAMP melting curve graph for determining LOD of Trichoderma spp. using PC2 primer set in compost eDNA extract samples obtained through isolation using the GenElute™ Soil DNA Isolation Kit ...................................................................................... 176 Graph 69. Real Time LAMP amplification graph for determining LOD of Trichoderma spp. using PC2 primer set in casing soil eDNA extract samples obtained through isolation using the GenElute™ Soil DNA Isolation Kit ...................................................................................... 177 Graph 70. Real Time LAMP melting curve graph for determining LOD of Trichoderma spp. using PC2 primer set in casing soil eDNA extract samples obtained through isolation using the GenElute™ Soil DNA Isolation Kit ...................................................................................... 178 Graph 71. Comparison of Tt values for compost and casing soil eDNA extracts extracted using GenElute™ Soil DNA Isolation Kit and spiked with different concentration of T. harzianum gDNA.. ................................................................................................................................... 179 Graph 72. Amplification graph of Real Time LAMP analysis of eDNA from inoculated compost samples isolated by the Chelex 100 method. .......................................................... 182 Graph 73. Melting curve graph for Real Time LAMP analysis of eDNA from inoculated compost samples isolated by the Chelex 100 method.. ......................................................... 183 Graph 74. Amplification graph of Real Time LAMP analysis of eDNA from inoculated casing soil samples isolated by the Chelex 100 method. .................................................................. 184 Graph 75. Melting curve graph for Real Time LAMP analysis of eDNA from inoculated casing soil samples isolated by the Chelex 100 method.. ................................................................. 185
Doctoral dissertation Mila Đisalov Graph 76. Amplification graph of Real Time LAMP analysis of eDNA from inoculated compost samples isolated by GenElute™ Soil DNA Isolation Kit. ...................................... 186 Graph 77. Melting curve graph for Real Time LAMP analysis of eDNA from inoculated compost samples isolated by GenElute™ Soil DNA Isolation Kit. ...................................... 187 Graph 78. Amplification graph of Real Time LAMP analysis eDNA from of inoculated casing soil samples isolated by GenElute™ Soil DNA Isolation Kit. .............................................. 188 Graph 79. Melting curve Graph for Real Time LAMP analysis of eDNA from inoculated casing soil samples isolated by GenElute™ Soil DNA Isolation Kit. ................................... 189 Graph 80. Amplification graph of Real Time PCR Analysis for testing specificity of F3 and B3 primers from the PC1 LAMP primer set for Trichoderma spp. detection: amplification curve in relation to cycle number ........................................................................................... 190 Graph 81. Amplification graph of Real Time PCR Analysis for testing specificity of F3 and B3 primers from the PC1 LAMP primer set for Trichoderma spp. detection: multiplication curve in relation to reaction time.. ......................................................................................... 191 Graph 82. Amplification graph of Real Time PCR Analysis for testing specificity of F3 and B3 primers from the PC2 LAMP primer set for Trichoderma spp. detection: multiplication curve in relation to cycle number. .......................................................................................... 192 Graph 83. Amplification graph of Real Time PCR Analysis for testing specificity of F3 and B3 primers from the PC2 LAMP primer set for Trichoderma spp. detection: multiplication curve in relation to reaction time.. ......................................................................................... 192 Graph 84. Amplification graph for the results of Real Time LAMP analysis of eDNA from compost and casing soil samples isolated by GenElute™ Soil DNA Isolation Kit. .............. 196 Graph 85. Melting curve graph for Real Time LAMP analysis of eDNA from compost and casing soil samples isolated by GenElute™ Soil DNA Isolation Kit. ................................... 197 Graph 86. Amplification graph for the results of Real Time LAMP analysis of eDNA from compost and casing soil samples isolated by GenElute™ Soil DNA Isolation Kit. .............. 198 Graph 87. Melting curve graph for Real Time LAMP analysis of eDNA from compost and casing soil samples isolated by GenElute™ Soil DNA Isolation Kit. ................................... 199 Graph 88. Amplification graph for the results of Real Time LAMP analysis of eDNA from compost and casing soil samples isolated by Chelex 100 method......................................... 200 Graph 89. Melting curve graph for Real Time LAMP analysis of eDNA from compost and casing soil samples isolated by Chelex 100 method. ............................................................. 201 Graph 90. Amplification graph for the results of Real Time LAMP analysis of eDNA from compost and casing soil samples isolated by Chelex 100 method......................................... 202 Graph 91. Melting curve graph for Real Time LAMP analysis of eDNA from compost and casing soil samples isolated by Chelex 100 method. ............................................................. 203 Graph 92. Amplification graph for the results of Real Time LAMP analysis of eDNA from highly polluted water samples. .............................................................................................. 212 Graph 93. Melting curve graph for Real Time LAMP analysis of eDNA from highly polluted water samples ......................................................................................................................... 213 Graph 94. Real Time PCR analysis of eDNA from highly polluted water samples. ........... 215
Doctoral dissertation Mila Đisalov List of Tables Table 1. Summarized LAMP primer mix preparation. ........................................................... 56 Table 2. Components of Real Time LAMP Reaction mixture. ............................................... 56 Table 3. Components of Colorimetric LAMP Reaction mixture. ........................................... 56 Table 4. Components of Real Time PCR Reaction mixture. .................................................. 60 Table 5. Real Time PCR program ........................................................................................... 61 Table 6. Compost and casing soil samples from the organic mushroom production nursery collected in different stages of Agaricus bisporus cultivation. ................................................ 65 Table 7. PCR primers for Trichoderma spp. detection form the literature ............................. 72 Table 8. LAMP Primer set for E. coli detection. ..................................................................... 80 Table 9. Concentration and purity of gDNA from bacterial species used to verify the specificity of the PC2 LAMP primer set for Klebsiella aerogenes. .......................................................... 82 Table 10. Concentration and purity of gDNA from bacterial cultures microbiologically cultivated from vegetable samples. .......................................................................................... 83 Table 11. Concentration and purity of gDNA isolated by Chelex 100 method and using Plant/Fungi DNA Isolation Kit from vegetable samples after inoculation with bacterial suspension. ............................................................................................................................... 84 Table 12. Concentration and purity of gDNA isolated from bacterial cultures from microbiologically cultivated meat samples. ............................................................................. 85 Table 13. Concentration and purity of gDNA isolated using Chelex 100 method and DNeasy PowerFood Microbial Kit from meat samples, after inoculation with bacterial suspension. .. 86 Table 14. LAMP primers for K. aerogenes designed de novo ................................................ 88 Table 15. Results of the statistical analysis of the differences in Tt values recorded for all tested food DNA samples obtained using the Chelex 100 approach. .............................................. 116 Table 16. Results of the statistical analysis of the differences in Tt values recorded for vegetable DNA samples obtained using the Plant/Fungi DNA Isolation kit. ........................ 125 Table 17. Results of the statistical analysis of the differences in Tt values recorded for meat DNA samples obtained using the DNeasy PowerFood Microbial Kit. ................................. 131 Table 18. Comparison of efficiency of K. aerogenes detection between Real Time LAMP and Real Time PCR for tested food samples.. .............................................................................. 146 Table 19. Concentration and purity of gDNA from different fungal cultures. ..................... 148 Table 20. Concentration and purity of eDNA isolated from compost/casing soil samples using Chelex 100 method and GenElute™ Soil DNA Isolation kit. ............................................... 148 Table 21. Concentration and purity of eDNA isolated for experiments with inoculated compost/casing soil samples using Chelex 100 method and GenElute™ Soil DNA Isolation kit. .......................................................................................................................................... 150 Table 22. LAMP primers for Trichoderma spp. tef1 gene designed de novo. ...................... 152 Table 23. Results of the statistical analysis of the differences in Tt values recorded for compost and casing soil eDNA samples obtained using the Chelex 100 approach. ............................ 174 Table 24. Results of the statistical analysis of the differences in Tt values recorded for compost and casing soil eDNA extracts obtained using the GenElute™ Soil DNA Isolation Kit. ..... 180 Table 25. Presence of Trichoderma spp. in compost and casing soil samples determined based on sequencing results and traditional cultivation methods.. .................................................. 194
Doctoral dissertation Mila Đisalov Table 26. LAMP detection success (number of positive reaction/total number of reactions) for compost and casing soil eDNA samples isolated by GenElute™ Soil DNA Isolation Kit and Chelex 100 method. ............................................................................................................... 203 Table 27. Concentration and purity of gDNA isolated from E. coli culture. ........................ 209 Table 28. Concentration and purity of eDNA from highly polluted water samples. ............ 210
Doctoral dissertation Mila Đisalov Table of Content Abstract ................................................................................................................................ 1 Резиме .................................................................................................................................. 4 1. Introduction ..................................................................................................................... 8 1.1 Foodborne and waterborne pathogens ........................................................................................ 9 1.1.1 Klebsiella aerogenes as a model of foodborne bacteria ......................................... 10 1.1.2 Trichoderma spp. – pathogenic fungus in edible mushroom production ............... 11 1.1.3 Escherichia coli as a model of waterborne bacteria ............................................... 15 1.2 Overview of methods for foodborne and waterborne pathogen detection ................................. 15 1.2.1 Microbiological methods for pathogen detection ................................................... 16 1.2.2 Molecular methods in microbiological diagnostics ................................................ 18 1.3.1 LAMP primers ........................................................................................................ 21 1.3.2 LAMP reaction mechanism .................................................................................... 24 1.3.3 Detection of LAMP products ................................................................................. 28 2. Hypothesis and aims ..................................................................................................... 36 3. Materials and methods.................................................................................................. 40 3.1 Development of a LAMP-based assay for K. aerogenes detection in food matrices ................. 41 3.1.1 Biological material ................................................................................................. 42 3.1.2 DNA extraction....................................................................................................... 45 3.1.3 Targeted, controlled contamination of food material ............................................. 53 3.1.4 Concentration and purity of DNA .......................................................................... 54 3.1.5 LAMP primer design for K. aerogenes .................................................................. 54 3.1.6 LAMP assay ........................................................................................................... 55 3.1.7 Optimization of LAMP assay for K. aerogenes detection ...................................... 58 3.1.8 K. aerogenes detection in spiked food samples ...................................................... 58 3.1.9 K. aerogenes detection in inoculated food samples ............................................... 59 3.1.10 Real Time PCR assay ........................................................................................... 60
Doctoral dissertation Mila Đisalov 3.1.11 Agarose gel electrophoresis .................................................................................. 62 3.2 Development of a LAMP-based assay for Trichoderma spp. detection in champignon production.................................................................................................................................... 63 3.2.1 Biological material ................................................................................................. 64 3.2.2 DNA extraction....................................................................................................... 66 3.2.3 Targeted, controlled contamination of compost and casing soil ............................ 69 3.2.4 Concentration and purity of DNA .......................................................................... 69 3.2.5 LAMP primer design for Trichoderma spp. ........................................................... 69 3.2.6 LAMP assay ........................................................................................................... 70 3.2.7 Optimization of LAMP assay for Trichoderma spp. detection .............................. 70 3.2.8 Trichoderma spp. detection in spiked compost and casing soil samples ............... 71 3.2.9 Trichoderma spp. detection in inoculated compost and casing soil samples ......... 72 3.2.10 Real Time PCR assay ........................................................................................... 72 3.2.11 Agarose gel electrophoresis .................................................................................. 73 3.2.12 LAMP assay coupled with Gold Nanoparticles for Colorimetric Detection of Trichoderma spp. ...................................................................................................... 73 3.3 LAMP-based assay for E. coli detection in highly polluted water samples ............................... 75 3.3.1 Biological material ................................................................................................. 75 3.3.2 Microbiological confirmation of E. coli presence in water samples ...................... 77 3.3.3 DNA extraction....................................................................................................... 77 3.3.4 Concentration and purity of DNA .......................................................................... 79 3.3.5 LAMP primers for E. coli detection ....................................................................... 80 3.3.6 LAMP assay ........................................................................................................... 80 3.3.7 Real Time PCR assay ............................................................................................. 80 4. Results ............................................................................................................................ 81 4.1 Development of a LAMP-based assay for K. aerogenes detection in food matrices ................. 82 4.1.1 Concentration and purity of DNA .......................................................................... 82 4.1.2 LAMP primers for K. aerogenes ............................................................................ 87
Doctoral dissertation Mila Đisalov 4.1.3 Optimization of LAMP assay for K. aerogenes detection ...................................... 89 4.1.4 K. aerogenes detection in spiked food samples ...................................................... 99 4.1.5 K. aerogenes detection in inoculated samples ...................................................... 132 4.1.6 Real Time PCR assay ........................................................................................... 140 4.2 Development of a LAMP-based detection of Trichoderma spp. detection in champignon production.................................................................................................................................. 147 4.2.1 Concentration and purity of DNA ........................................................................ 147 4.2.2 LAMP primers for Trichoderma spp. ................................................................... 151 4.2.3 Optimization of LAMP assay for Trichoderma spp. detection ............................ 153 4.2.4 Trichoderma detection in spiked compost and casing soil samples ..................... 164 4.2.5 Trichoderma spp. detection in inoculated samples .............................................. 181 4.2.6 Real Time PCR assay ........................................................................................... 189 4.2.7 The detection of Trichoderma spp. using LAMP assay in real samples .............. 193 4.2.8 LAMP assay coupled with Gold Nanoparticles for Colorimetric Detection of Trichoderma spp. .................................................................................................... 204 4.3 LAMP-based assay for E. coli detection in highly polluted water samples ............................. 209 4.3.1 Concentration and purity of DNA ........................................................................ 209 4.3.2 Microbiological confirmation of E. coli presence in water samples .................... 210 4.3.3 LAMP assay ......................................................................................................... 211 4.3.4 Real Time PCR assay ........................................................................................... 214 5. Discussion ..................................................................................................................... 216 5.1 Challenges posed by foodborne and waterborne pathogens ................................................... 217 5.2 Advancement of diagnostic tools for pathogen detection ........................................................ 218 5.3 Development of a LAMP-based assay for K. aerogenes detection in food matrices ............... 220 5.3.4 K. aerogenes detection in spiked food samples .................................................... 222 5.3.5 Detection of K. aerogenes in inoculated food samples - comparative analysis: Real Time LAMP vs. Real Time PCR ............................................................................ 226 5.4 Development of a LAMP-based assay for Trichoderma spp. detection in champignon production.................................................................................................................................. 227
Doctoral dissertation Mila Đisalov 5.4.4 Trichoderma spp. detection in spiked compost and casing soil samples ............. 229 5.4.5 Trichoderma detection in real samples ................................................................. 232 5.4.6 Comparative Analysis: Real Time LAMP vs. Real Time PCR ............................ 233 5.4.7 LAMP assay coupled with Gold Nanoparticles for Colorimetric Detection of Trichoderma spp. .................................................................................................... 234 5.5 LAMP-based assay for E. coli detection in highly polluted water samples ............................. 235 5.5.1 Optimization of syringe filter-based DNA extraction method ............................. 236 5.5.2 E. coli detection in real samples ........................................................................... 237 6. Conclusions .................................................................................................................. 240 7. Literature ..................................................................................................................... 243 8. Supplementary materials ............................................................................................ 262 9. Extended abstract in Serbian ..................................................................................... 277
Doctoral dissertation Mila Đisalov 7 Кључне речи: LAMP; изотермална метода; нуклеинске киселине; детекција микробиолошких патогена; сигурност хране; безбедност хране; теренска детецкија
Doctoral dissertation Mila Đisalov 8 1. Introduction
Doctoral dissertation Mila Đisalov 9 1.1 Foodborne and waterborne pathogens The World Food and Agriculture Organization (FAO) estimates that by 2050, there will be close to 10 billion people on Earth. The key goal is to ensure that everyone has access to adequate food and water supplies while also maintaining sustainable production methods (FAO, 2023). However, foodand waterborne pathogens consistently pose a challenge toward achieving this goal, given their annual increase and direct correlation with both human health and significant economic loss (Law et al., 2015). Foodand waterborne pathogens can be found in a variety of foods that are consumed on a daily basis. Namely, food provide an excellent environment for the growth and development of microorganisms, which depends on factors such as the food's structure, pH, moisture content and availability of nutrients. External factors like temperature, relative humidity and gas availability (CO2, O2) also play an important role in the development of microorganisms. The emergence of food scandals over the last 20 years, coupled with the rising number of food poisoning cases at the international level, has led to an increasing demand for safer products that do not pose a threat to consumers (Quintela Baluja et al., 2014; Baraketi et al., 2018). It should be emphasized that water, essential for many food system activities including agriculture and food processing, can serve as a medium for microbiological hazards, necessitating the joint consideration of food and water pathogen risks. Efficient pathogen detection in both food and water is crucial for preventing contamination and ensuring public health within the “One Health” framework (FAO, 2023). Furthermore, for a sustainable food production system, it is also essential to ensure the absence of pathogens which are known to have a negative impact on the yield and quality in the production process of agricultural crops. There are over 250 different foodborne diseases known to affect approximately one-third of the World's population annually (Stein and Chirilã, 2017). However, the incidence of these diseases has been underreported and underestimated. The process of globalization, the transportation of food products over longer distances from their original locations, and the numerous stages where contamination can occur have collectively heightened the difficulty of investigating foodborne and waterborne outbreaks (Stein and Chirilã, 2017). Specifically, it is recognized that foodborne pathogens can enter, transmit, and potentially (cross)contaminate at any stage of the food chain (Stein and Chirilã, 2017; Sahoo et al., 2022). Another significant threat posed by pathogenic bacteria in food and water is their increasing resistance to antibiotics (White et al., 2002; Taviani et al., 2022). In 2017, the World Health
Doctoral dissertation Mila Đisalov 10 Organization published a "list of bacteria in urgent need of new antibiotics" (Tacconelli and Magrini, 2017). This list was further updated by WHO in May 2024 to guide and encourage the research and development (R&D) of new antibiotics and tools to combat growing global antimicrobial resistance (WHO, 2024). The list includes bacteria known to be transmitted through food and water, which pose a particular threat in hospitals, nursing homes, and among patients using devices such as ventilators and blood catheters. In this doctoral dissertiation, Klebsiella spp., and Escherichia coli are used as models for general food and waterborne pathogens, respectively. The model pathogen bacteria are used for e.g. novel primer design (K. aerogenes), DNA extraction protocol from different matrices, comparison of different LAMP approaches, and comparison to Real Time PCR as a standard method. In addition, Klebsiella spp. and E. coli, are among the highlighted species on the WHO list of bacteria in urgent need of new antibiotics, rendering obtained data on model bacteria relevant as novel findings as well. Given the acknowledged necessity of enhancing food production through the development of tools for detecting pathogens detrimental to agricultural crops, this doctoral dissertation focuses on development of a LAMP assay for detection of the significant pathogen in agrifood sector, the Trichoderma fungus. Importantly, the assay development comprises steps that increase the technology readiness level (TRL) for real-life application of the developed LAMP assay. Further elaboration on the importance of detecting this fungus will be provided in subsequent sections. 1.1.1 Klebsiella aerogenes as a model of foodborne bacteria Klebsiella aerogenes is a facultatively anaerobic gram-negative bacterium belonging to the Enterobacteriaceae family, which comprises over 30 genera. Bacteria from this family are known for their respiratory and fermentative metabolism i.e. their ability to adapt to aerobic and anaerobic metabolism (Gundogan, 2014; Buckle, 2015). They are commonly found in soil, water, plants and in the gastrointestinal tract of various animals, ranging from worms and insects to humans (Gundogan, 2014). Many enterobacteria are human pathogens, while K. aerogenes belongs to the group of opportunistic pathogens, which typically cause infections under specific conditions as is the case e.g. in nosocomial (healthcare related) infections. Instances commonly arise in patients with compromised immune systems or individuals with impaired intestinal mucosal barrier of the intestine. From there, this bacterium can lead to infections of the respiratory, circulatory, or urinary systems.
Doctoral dissertation Mila Đisalov 11 Compared to other enterobacteria, K. aerogenes is the leading cause of sepsis and even patient mortality (Gu et al., 2022). Statistics indicate that this species is a prevalent cause of gastrointestinal infections (Kamio and Espinoza, 2022). Additionally, Klebsiella rapidly develops resistance to antibiotics, making treatment complicated and time-consuming, although still feasible (Miró et al., 1995; Uzeh and Imafidon, 2022; Kamio and Espinoza, 2022). Given all these considerations, the development of tools for early and specific detection of this bacterium in different types of samples is of great importance. In this thesis, K. aerogenes is used as a model for foodborne pathogens, based on the fact that it can survive the wastewater treatment process, potentially contributing to water contamination, and consequently to the food contamination since contaminated water can enter the food production pipeline via irrigation systems (El-Sayed et al., 2015). For K. aerogenes, novel primers were designed, tested, and validated. DNA extraction protocols from various matrices (vegetables and meat) were optimized for intended use in the field. Subsequently, the formulated DNA extraction protocols were tested for both Real Time LAMP and Real Time PCR (as standard method) to evaluate the effectiveness of the developed LAMP assay. 1.1.2 Trichoderma spp. – pathogenic fungus in edible mushroom production It has been previously emphasized that one of the main problems facing society today is how to provide enough food for everyone in the future. This challenge has led to a growing interest in sustainable food sources and urban agriculture. One crop that has emerged as a popular choice for urban farms are edible mushrooms (Okuda, 2022; FAO, 2023). Cultivated edible mushrooms represent a significant nutritional source and hold economic importance in various regions across the world (Marshall, 2009; Shamugam and Kertesz, 2023). Apart from their nutritional value, mushrooms are appealing due to their antioxidant activity and therapeutic properties. Additionally, their distinctive taste and unique texture make them an attractive choice for inclusion as a food ingredient or as a substitute for food additives (Okuda, 2022; FAO, 2023) both in traditional food products and in the emerging field of alternative proteins. In addition to their positive nutritional characteristics, mushrooms are already a sustainable food source that can be grown using organic waste products and minimal resources. As a result, many urban farms are choosing to grow and sell mushrooms to promote sustainable agriculture and provide fresh, local food to their communities (Dorr et al., 2021; Prajapati et al., 2023).
Doctoral dissertation Mila Đisalov 12 Modern mushroom farming carries various environmental impacts (Chang and Wasser, 2020). However, these impacts can be mitigated through the application of circular economy principles, particularly by upcycling organic waste in the cultivation process. Specifically, the cultivation of Agaricus bisporus (champignon), one of the most commonly grown and consumed mushroom species (Zicari et al., 2012; Singh et al., 2020), involves using compost, an organic substrate produced through a thermophilic microbial process that includes crop residues, underutilized wood, nitrogen-containing additives (such as poultry or horse manure) (Figure 1A), seed meal, or synthetic nitrogen sources like urea or ammonium nitrate, along with gypsum. Compost serves as both a growing medium for mushroom mycelium and a source of nutrition, as the mycelium degrades organic material to release essential nutrients (Kertesz and Thai, 2018; McGee 2018). In addition, during the fruit-bearing phase, adding a layer of peat, known as casing soil (Figure 1A), to the composted substrate is essential for optimal mushroom growth (Šašić Zorić et al., 2023; Djisalov et al., 2024). Finally, casing soil induces the growth of mushroom fruiting bodies and maintains the environmental conditions in the compost (McGee 2018). In champignon production, the emergence of green mold in the nursery is a prominent issue. This disease, caused by the rapid invasion of fungi from the genus Trichoderma spp. in cultivation bags, significantly impedes mushroom fructification (Figure 1B). When compost or casing are infected with aggressive species such as Trichoderma harzianum, the production of mushrooms is suspended in the affected areas. Trichoderma, known for its voracious consumption of various fungi and its high capability for nutrient uptake, monopolizes the available nutrients, preventing mushroom growth (Castle et al., 1998; Zicari et al., 2012). Trichoderma spores infiltrate mushroom-growing facilities through contaminated spawn, compost, casing soil and wood. The spread of green mold is further facilitated by contaminated tools, substrate, and clothing of mushroom growers. Additionally, transmission can occur through contaminated air and insect vectors, such as sciarid mushroom flies (Maeda et. al., 2011; Šašić Zorić et al., 2023; Djisalov et al., 2024). Early detection of Trichoderma spp. on the substrate for growing edible mushrooms is crucial since the infection becomes visible only after the formation of dark green spores, when it is already too late to intervene (Figure 1B). more compact. This doctoral dissertation aims to develop a molecular tool for early and specific detection of this fungal pathogen to enhance organic mushroom production, as green mold disease in A. bisporus can lead to yield losses of
Doctoral dissertation Mila Đisalov 13 60% to 100%, significantly impacting producers' profits (Šašić Zorić et al., 2023). Since some species of Trichoderma can adversely affect human health (Chouaki et al., 2002; Sal et al., 2022), the development of this molecular tool is beneficial for ensuring health and safety.
Doctoral dissertation Mila Đisalov 14 Figure 1. A) Illustration of main stages in mushroom cultivation process; B) Images of mushroomgrowing substrate contaminated with Trichoderma harzianum. (Adapted from Djisalov et. al., 2024).
Doctoral dissertation Mila Đisalov 15 1.1.3 Escherichia coli as a model of waterborne bacteria Contamination of water (and food) with fecal bacteria persists as a significant problem with profound implications for public health and the economy (Walker et al., 2019). Escherichia coli is considered as the best biological indicator for water contamination (Edberg et al., 2000). Depending on environmental conditions such as temperature and microflora, this rod-shaped, facultatively anaerobic, Gram-negative bacterium can survive in drinking water during 4 to 12 weeks (Edberg et al., 2000). E. coli, a member of the fecal coliform subgroup, is commonly found in the intestines of both humans and animals. While the majority of E. coli strains are non-pathogenic, some can cause serious gastrointestinal and urinary illnesses, including fatalities (Kirschner et al., 2009). Globally, there is a crucial need for a rapid and sensitive detection of microbial contamination in water samples to control waterborne diseases. Addressing this challenge requires the use of innovative molecular methods to reliably identify harmful bacteria known to be present in very complex and difficult-to-manipulate water samples, such as highly polluted river water samples near city sewage outfalls. In this thesis, E. coli is used as a model for waterborne pathogens, found in complex and difficult-to-manipulate water samples based on the fact that it is the best biological indicator for water contamination with fecal bacteria. For E. coli, primers from literature were tested and validated. DNA extraction protocol from raw water samples (Danube river) was modified for time and cost effitiancy. Subsequently, the formulated DNA extraction protocol was validated by both Real Time LAMP and Real Time PCR (as standard method). 1.2 Overview of methods for foodborne and waterborne pathogen detection Development and integration of sensitive and efficient methods for detecting the presence of pathogens are crucial for food safety control and the establishment of a sustainable food production system (Zhang, 2013). Ideally, a method for detecting pathogens should align with the World Health Organization’s ASSURED criteria (Land et. al., 2019): • A – Affordable to end-users and the health system; • S – Sensitive; • S – Specific; • U – User-friendly;
Doctoral dissertation Mila Đisalov 16 • R – Rapid and robust; • E – Equipment free or simple; • D – Deliverable to end-users. 1.2.1 Microbiological methods for pathogen detection The standard approach for detecting pathogens in food involves microbiological cultivation on a nutrient medium. This method comprises three basic steps for its execution (Figure 2): 1) sample preparation which involves homogenization of the sample; 2) cultivation of microbes on a nutrient medium – which consists of cultivating the samples firstly in enrichment broth (in order to increase a small number of desired organisms to detectable levels), then on selective medium (required for different bacterial strains to grow), and finally on isolation medium, and 3) biochemical identification – which implies conducting a large number of biochemical tests to confirm the presence of certain types of microorganisms (Cai et al., 2007; Wang and Duncan, 2017; Vidic et al., 2019).
Doctoral dissertation Mila Đisalov 23 Figure 4. Schematic representation of LAMP primers (Djisalov et al., 2021). 1.3.1.1 LAMP primer design Designing LAMP primers is a complex process considering both the number of primers and the number of regions in the target sequence to which the primers bind. To ensure a successful reaction, it is necessary to meet several conditions when initiating LAMP primers design, described in following. 1. Appropriate melting temperatures (Tm): a. ~ 65 °C (64–66 °C) for F1c and B1c regions (of FIP and BIP primers); b. ~ 60 °C (59–61 °C) for F2, B2 regions (of FIP and BIP primers) and F3 and B3 primers; c. ~ 65 °C (64–66 °C) for loop primers (LF and LB). 2. The ends of the primers should exhibit a specific degree of stability. This is important as a reduction in the Gibbs free energy -∆G (less than -4 kcal/mol) for the 3' ends of the primers enhances their binding rate to the target sequence. 3. The content of GC base pairs should be around 50–60%. 4. Designed primers, especially internal ones, should not form any secondary structures, such as primer dimers or hairpins, which can be prevented by designing them without complementary 3' ends and avoiding excessively high GC base pair content. 5. The distance between the end of the F2 and the B2 regions of FIP and BIP primers (the sequence that will be amplified) should be approximately 120–180 base pairs (bp). Additionally, the distance between the 5' end of the F2 and the 5' end of the F1 (the part that forms the loop) should be in the range of 40–60 bp. Meanwhile, the distances
Doctoral dissertation Mila Đisalov 24 between the binding sites of the F2 region of the FIP primer and the F3 primer, as well as between the binding sites of the B2 region of the BIP primer and the B3 primer, should be within 0–20 bp (Eiken Chemical Co. Ltd., 2005). 1.3.2 LAMP reaction mechanism The LAMP reaction requires the following conditions: 1. a thermostable DNA polymerase with strand displacement activity (Bst DNA polymerase); 2. free deoxyribonucleoside triphosphates, i.e., nucleotides (dNTPs); 3. a specific set of primers; 4. target DNA sequence to be amplified; 5. a constant reaction temperature within the range of 60-65℃ for 30-60 minutes. The mechanism of the LAMP reaction involves three main steps: 1. Initial amplification; 2. Cyclic amplification; 3. Elongation and recycling. Unlike PCR, LAMP employs a DNA polymerase with high strand displacement activity. This characteristic allows the polymerase to synthesize, displace, and release single-stranded DNA during the amplification process (Notomi et al., 2000; Park, 2022). The first step involves the use of two inner primers (FIP and BIP) and two outer primers (F3 and B3) to form a stem-loop structure, i.e. dumbbell-like structure (Figure 5). The LAMP reaction initiates with the binding of the F2 region of the FIP primer to the 3' complementary region of the DNA template stand (F2c), leading to the subsequent release of the template strand and the synthesis of a new strand facilitated by the presence of Bst DNA polymerase (Figure 5.1). In the next step, the F3 primer binds to the F3c location on the template, upstream of the target region, inducing strand displacement DNA synthesis and the release of FIP-linked complementary single-stranded DNA (Figure 5.2).
Doctoral dissertation Mila Đisalov 25 Figure 5. Mechanism of LAMP reaction: schematic representation of the generation of primary LAMP products (dumbbell-like structure) (Djisalov et al., 2021). The released single strand forms a stem-loop structure at the 5' end, driven by the complementarity between F1c and F1 regions (Figure 5.3 and 5.4). The released single-stranded DNA (ssDNA), serving as a template for BIP and B3, respectively, contributes to the synthesis of a new strand (Figure 5.4). This new strand contains self-complementarity regions between B1c and B1, forming a stem-loop structure, i.e. dumbbell-like structure. The formed dumbbell structure (Figure 5.5) serves as the starting material for the subsequent amplification of the target DNA molecule (LAMP cycling). This structure contains numerous LAMP replication initiation regions at the 3′ ends of the loops, along with regions for binding internal primers, FIP and BIP. The F2 region of FIP
Doctoral dissertation Mila Đisalov 26 primer (Figure 6.5) and the B2 region of BIP primer (Figure 6.7) anneal to the ssDNA regions within the stem loop structures, facilitating the synthesis of new strands while simultaneously releasing the previously synthesized strands (Figures 6.6. and 6.8). At the 3' ends, the single strands that have been freed form stem loop structures and extend new strands through selfpriming activity (Figures 6.9 and 6.10). This enables the creation of concatemeric structures with an increasing number of synthesis initiation regions (Figures 6.11 and 6.12). When used in the reaction, the loop primers (LF and LB), featuring sequences complementary to the single loop (between F1c and F2c regions, and the B1 and B2 regions, respectively), contribute to wider range of starting points for the synthesis of a new DNA strand through the LAMP method (Deng and Gao, 2015; Djisalov et al., 2021). As a result of this process, diverse structures with varying sizes, composed of alternately inverted repeats of the target sequence, are formed. The combination of the non-requirement of a denaturation step and the self-priming activity at the 3’-end of the dumbbell structure leads to the generation of a substantial quantity of LAMP-amplified products, reaching up to 109 copies of the target within an hour (Notomi et al., 2000).
Doctoral dissertation Mila Đisalov 27 Figure 6. Further mechanism of the LAMP reaction: formation of secondary structures of various sizes (Djisalov et al., 2021).
Doctoral dissertation Mila Đisalov 28 1.3.3 Detection of LAMP products The LAMP reaction results in rapid accumulation of double-stranded DNA (dsDNA) products (LAMP amplicons) and a substantial amount of detectable by-products (such as magnesium pyrophosphate, pyrophosphate ions, hydrogen ions), which can be identified using various endpoint or real time detection technologies (Mori et al., 2001; Zhang et al., 2014; Becherer et al., 2020). Furthermore, LAMP stands out for its isothermal and energy-efficient amplification requirements, making it an ideal choice for affordable diagnostics and in-field analysis. Over the last decade, various sequence-specific methods for detection of LAMP amplicons have emerged, employing a diverse array of sensing techniques, including optical, magnetic, piezoelectric, electrochemical and magnetoresistive sensing (Becherer et al., 2020). This doctoral dissertation will focus on the description of the most commonly used detection approaches i.e. visual detection, turbidity, and real time detection using DNA intercalating dyes for real time fluorescence (Figure 7).
Doctoral dissertation Mila Đisalov 29 Figure 7. Overview of the most commonly used approaches for detection of LAMP products.
Doctoral dissertation Mila Đisalov 30 1.3.3.1 Visual detection of LAMP products To visually detect LAMP products, common choices include metal indicators, DNA intercalary dyes, or pH sensitive indicators. In all three cases, distinguishing a positive from a negative LAMP reaction is based on observing a color in visible spectrum where change of the color in the reaction mixture means positive reactions, while the unchanged color means negative reactions. This straightforward and cost-effective method of visual detection is the simplest way to identify LAMP products. Endpoint detection with metal indicators When using metal indicators for visual detection, change in the color in a positive LAMP reaction is directly influenced by the type of metal indicators employed, commonly including calcein, hydroxy naphthol blue, and malachite green. Calcein is a metal indicator dye that combines with manganese ions (Mn2+) from MnCl2 before amplification, causing the reaction solution to turn orange (Figure 8A, left) (Xie et al., 2014). Subsequently, during the amplification process, pyrophosphate ions (PPi−) are released, which can displace the Mn2+ from calcein, leading to the emission of fluorescence from calcein, causing the assay turns to light green under natural light (Figure 8A-right) (Pang et al., 2019). Manganese ions form an insoluble salt with the pyrophosphates generated during reaction, while the free calcein interact with magnesium ions (Mg2+) from the reaction mixture, resulting in stronger fluorescence emission (Tomita et al., 2008). On the other hand, hydroxy naphthol blue and malachite green operate on the same principle for indicating a positive LAMP reaction. In both cases, the color change is triggered by a decrease in Mg2+ ions during the LAMP process. This change causes hydroxy naphthol blue to shift from purple to blue (Figure 8B) (Goto et al., 2009) and malachite green to transition from colorless to blue (Figure 8C) (Lucchi et al., 2016). However, employing metal indicators has several disadvantages. One of them is certainly the difficulty of analyzing the color change. Furthermore, it has been observed that adding indicators to the reaction mixture can adversely affect the efficiency of the LAMP reaction, thereby reducing the sensitivity of the reaction to 100–1000 copies of the target (Tanner et al., 2015).
Doctoral dissertation Mila Đisalov 31 Figure 8. Monitoring LAMP reaction by visual detection using metal indicators: calcein (A), hydroxy naphthol blue (B) and malachite green (C) (Adapted in accordance with: Britton et al. (2015), Li et al. (2017) and Tavakoli-Koopaei et al. (2023)). Endpoint detection with DNA intercalary dyes Another approach for the visual detection of LAMP products involves the application of intercalating DNA dyes, which bind to dsDNA, and trigger higher fluorescence. After amplification, the amount of double-stranded LAMP products is increased, and therefore more intercalating dyes can bind to DNA and emit their fluorescence (van der Velden et al., 2001; Gard, 2002; Dragan et al., 2010). In contrast to metal indicators, these dyes are added to the solution after the completion of the reaction. In a positive reaction, a color change is observed under ambient light, transitioning from orange to green (SYBR Green I, PicoGreen) (Figures 9A and 9B) or orange to light pink (Propidium Iodide) (Figure 9C) (Parida et al., 2006; Hill et al., 2008; El-Kholy et al., 2014; Zhang et al., 2014). Using DNA dyes for colorimetric detection is as simple as metal indicators, without the need for optical detection integration. Furthermore, distinguishing between negative and positive reactions is more evident, compared to using metal indicators (Figure 9). The sensitivity of color change detection using DNA dyes is comparable to real time LAMP detection and gel electrophoresis (Quyen et al., 2019b). However, adding the intercalating dye after completing the reaction increases the risk of contamination (Goto et al., 2009).
Doctoral dissertation Mila Đisalov 32 Figure 9. Monitoring LAMP reaction by visual detection using DNA intercalary dyes: SYBR Green I (A), PicoGreen (B) and Propidium Iodide (C) (Adapted in accordance with: Parida et al. (2006), Hill et al. (2008) and El-Kholy et al. (2014). Endpoint detection with pH-sensitive indicators Visualizing the LAMP products using pH-sensitive dyes has also been reported as a visual detection method with best visibility compared to the use of metal indicators and DNA dyes (Tanner et al., 2015). By using highly sensitive-pH indicators, the positive reactions could be identified by a change of color in positive LAMP reactions. As mentioned earlier, the outcome of the DNA polymerization reaction (i.e., LAMP reaction) is generation of not only amplified products or by-products (pyrophosphate ions) (Reaction 1 first line), but also hydrogen ions, which are formed as a result of pyrophosphate hydrolysis (Reaction 1 second line), thereby reducing the pH of the LAMP reaction mixture. (DNA)n−1+dNTP→(DNA)n+ P2O74- (1) P2O74−+H2O→2H3PO4+H+ (2) Reaction 1. DNA polymerization reaction (Mori et al., 2001). For instance, the color changes from red to yellow when using phenol red or cresol red, from light yellow to red when using the neutral red pH-sensitive indicator, or from purple to yellow when using the cresol purple pH-sensitive indicator (Figure 10) (Tanner et al., 2015; Poole et al., 2017).
Doctoral dissertation Mila Đisalov 39 Figure 13. Schematic representation of the research concept conducted in doctoral dissertation. TRL – technology readiness level; FIB – fecal indicator bacteria.
Doctoral dissertation Mila Đisalov 40 3. Materials and methods
Doctoral dissertation Mila Đisalov 41 3.1 Development of a LAMP-based assay for K. aerogenes detection in food matrices To develop a LAMP-based assay for K. aerogenes detection in food matrices, the following experimental setup, as presented in Figure 14, was performed. Figure 14. Experimental outline for optimization of LAMP based Klebisella aerogenes detection in food matrices. Image created with BioRender.com.
Doctoral dissertation Mila Đisalov 42 3.1.1 Biological material 3.1.1.1 Bacterial cultures All bacterial cultures used in this part of doctoral dissertation were prepared by cultivation on Tryptone Soya Agar medium (TSA) (Millipore, USA) and incubated at 37 °C for 24 hours (overnight). Used bacterial cultures included following Gram-positive and Gram-negative bacterial species: Gram-positive bacterial species: • Staphylococcus aureus, Bacillus subtilis, Alcaligenes faecalis. Gram-negative bacterial species: • Klebsiella aerogenes, Salmonella enterica, Escherichia coli. All bacterial species used in this dissertation originate from the BioSense Culture Collection of Bacteria (BSCCB), which can be accessed via the following link: https://zenodo.org/records/11385670. 3.1.1.2 Vegetable material Soil can be a source of contamination by Klebsiella spp., as this bacterium is commonly found in the soil. It can contaminate vegetables, especially those that are in direct contact with the soil. Accordingly, cucumber (Cucumis sativus L.) and lettuce (Lactuca sativa L.), whose edible parts are in direct contact with the soil, and carrots (Daucus carota L.), whose edible roots grow within it, these vegetables were specifically selected for all planned analyses (Gundogan, 2014; Tan and Karwe, 2021). This choice allows for a broader exploration within this experimental framework. All vegetables were purchased from local store in Novi Sad on March 10, 2023. For each vegetable two different DNA extraction methods were applied. DNA extraction was done from different plant parts using 125 mg of plant tissue as starting material (Figure 15).
Doctoral dissertation Mila Đisalov 43 Figure 15. Vegetable material used in this doctoral dissertation. A) lettuce; B) cucumber; C) carrot; D) vegetable samples in Petri dishes. Image created with BioRender.com. To ascertain the potential presence of the pathogen K. aerogenes in the plant cultures (vegetables) used for subsequent research, the following steps were employed: • A piece of vegetable (carrot, cucumber, lettuce) was washed with 3 mL of PCR water each and 1 mL of water was subsequently transferred to a TSA plate per sample type, followed by an incubation at 37 °C for 24 hours. • Bacterial cultures that had grown were then sampled from the plates and prepared for 1) DNA isolation using The GeneJET Genomic DNA Purification Kit (Thermo Scientific™, USA); and 2) sub-cultivation of individual colonies on TSA in order to obtain clean colonies that will be subjected to biochemical tests for microbial identification. • DNA isolation was performed by following the isolation procedure for the isolation of Gram-negative bacteria, considering that K. aerogenes is a Gram-negative bacterium. The isolation protocol is described in Section 3.1.2.1.
Doctoral dissertation Mila Đisalov 44 • After isolation, the Real Time LAMP analysis was performed in order to confirm the presence of K. aerogenes in the grown cultures. The detection of K. aerogenes was performed using the primer candidate 2 (PC2) primer set (for details see Section 4.1.2). 3.1.1.3 Meat and meat products As the literature attests, poultry meat is one of the most frequently contaminated with Klebsiella spp. Consequently, the meat material utilized in all planned analyses was sourced from: fresh chicken breasts and from chicken salami from local meat producer (Figure 16). Both type of meat products were purchased at local store in Novi Sad on July 18, 2023. DNA extraction from 250 mg of meat products was done using two different extraction methods. Figure 16. Meat and meat product samples used in this doctoral dissertation. A) chicken breasts; B) salamir; C) meat samples in Petri dishes. Image created with BioRender.com. To confirm the potential presence of K. aerogenes in the chicken breasts and salami the following experiment was conducted: • 250 mg of each meat samples (chicken breasts and salami) was incubated in 2 mL Tryptone Soya Broth (TSB) (Oxoid, UK) at 37 °C for 24 hours in thermostat incubator (Incubator IN55, Memmert, Germany).
Doctoral dissertation Mila Đisalov 45 • These samples were then used for the DNA extraction using the DNeasy PowerFood Microbial Kit (Qiagen, Germany) and the Chelex 100 method, as described in Section 3.1.2.3. • Extracted gDNA was used for the Real Time LAMP. The detection of K. aerogenes was performed using the PC2 primer set (for details see Section 4.1.2). • The confirmation of the presence of K. aerogenes in meat samples through biochemical tests was conducted in the same manner as outlined for vegetable material in Section 3.1.1.2. 3.1.2 DNA extraction DNA Extraction was performed using either the Chelex 100 method, suitable for in-field application, or commercially available spin-column-based kits for the isolation from bacteria, vegetable, and meat materials. 3.1.2.1 DNA extraction from bacterial cultures The GeneJET Genomic DNA Purification Kit (Thermo Scientific™, USA) was used for the isolation of gDNA from pure bacterial cultures (gram-positive and gram-negative bacteria). Isolation protocols are described below. A) DNA isolation from gram-positive bacteria Materials: • GeneJET Genomic DNA Purification Kit (Thermo Scientific™, USA) which includes: o Proteinase K Solution; o RNase A Solution; o Digestion Solution; o Lysis Solution; o Wash Buffer I; o Wash Buffer II; o Elution Buffer (10 mM Tris-Cl, pH 9.0, 0.1 mM EDTA); o GeneJET Genomic DNA Purification Columns pre-assembled with Collection Tubes; o Collection Tubes; • Gram-positive Bacteria Lysis Buffer (20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 1.2% Triton X-100, with added lysozyme to 20 mg/mL);
Doctoral dissertation Mila Đisalov 46 • Overnight bacterial culture on TSA; • Test tubes containing 5 mL of 0.9% sterile saline solution; • 50% ethanol (Sigma-Aldrich, USA); • Sterile 2 mL tubes. Procedure: 1. Overnight bacterial cultures were scraped from TSA and transferred into a tube containing 5 mL of 0.9% sterile saline solution; 2. The bacterial suspension was adjusted to 1.5 × 109 CFU/mL (5 McF) using a DEN1 densitometer (BioSan, Latvia); 3. 2 mL of the prepared bacterial suspension was then transferred into a new sterile 2 mL tube and centrifuged for 10 min at 5000g; 4. Supernatant was discarded, and the cell pellet was resuspended in 180 µL of Grampositive Bacteria Lysis Buffer and incubated for 30 min at 37 °C in thermostat incubator (Incubator IN55, Memmert, Germany); 5. 200 μL of Lysis Solution and 20 μL of Proteinase K were added. The tube was thoroughly mixed by vortexing and pipetting to achieve a uniform suspension; 6. The sample was incubated at 56 °C for 30 min with occasional vortexing; 7. 20 μL of RNase A Solution was added, and the content of the tube was mixed by vortexing. Afterwards, the tube was left for incubation for 10 min at room temperature; 8. 400 μL of 50% ethanol was added and mixed by vortexing; 9. The lysate was transferred to a GeneJET purification column placed on the collection tube. The column was centrifuged for 1 minute at 6000g. The collection tube with the contents (flow-through solution) was then discarded, and the GeneJET purification column was placed in the new 2 mL collection tube; 10. 500 µL of Wash Buffer I (with added ethanol) was added to the GeneJET column and centrifuged for 1 minute at 8000g. The flow-through contents were discarded, and the GeneJET column was then returned to the collection tube; 11. 500 µL of Wash Buffer II (with added ethanol) was added to the GeneJET column and centrifuged for 3 min at maximum speed (18000g);
Doctoral dissertation Mila Đisalov 47 12. 200 µL of Elution Buffer was added to the center of the membrane on the GeneJET purification column to precipitate the gDNA. The tube was finally incubated for 2 min at room temperature and centrifuged for 1 minute at 8000g. 13. gDNA was stored at -20 °C until further manipulation. B) DNA isolation from Gram-negative bacteria Materials: • GeneJET Genomic DNA Purification Kit (Thermo Scientific™, USA); • Overnight bacterial culture on TSA; • Test tubes containing 5 mL 0.9% sterile saline solution; • 50% ethanol (Sigma-Aldrich, USA); • Sterile 2 mL tubes. Procedure: 1. Overnight bacterial cultures were scraped from TSA and transferred into a tube containing 5 mL of 0.9% sterile saline solution; 2. The bacterial suspension was set to 1.5 × 109 CFU/mL (5 McF) using a DEN-1 densitometer (BioSan, Latvia); 3. 2 mL of the prepared bacterial suspension was then transferred into a new sterile 2 mL tube and centrifuged for 10 min at 5000g; 4. Supernatant was discarded and the bacterial pellet was resuspended in 180 µL of the Digestion solution. Subsequently, 20 µL of Proteinase K was added and vortexed thoroughly; 5. The sample was incubated for 30 min at 56 °C at TS-100C Thermo-Skaker (BioSan, Latvia) and occasionally vortexed; 6. 20 µL of RNase A solution was added to the sample, vortexed thoroughly, followed by incubation for 10 min at room temperature; 7. After incubation, 200 µL of Lysis solution was added to the sample, and the content of the tube was vortexed for 15 seconds until a homogeneous mixture was created; 8. 400 µL of 50% ethanol was added to the sample, and the contents of the tube were vortexed; 9. The lysate was transferred to a GeneJET purification column placed on a collection tube. The column was centrifuged for 1 minute at 6000g. Subsequently, the
Doctoral dissertation Mila Đisalov 48 collection tube with the flow-through solution was discarded, and the GeneJET purification column was transferred to the new 2 mL collection tube; 10. 500 µL of Wash Buffer I was added to the column, and the tube was centrifuged for 1 minute at 8000g. The filtrate was then discarded, and the GeneJET column was returned to the collection tube; 11. Next, 500 µL of Wash Buffer II was added to the GeneJET column, and the tube with the column was centrifuged for 3 min (18000g); 12. After centrifugation, 200 µL of Elution Buffer was added to the center of the membrane on the GeneJET purification column to elute the genomic DNA (gDNA). The tube was then incubated for 2 min at room temperature and centrifuged for 1 minute at 8000g. 13. gDNA was stored at -20 °C until further manipulation. 3.1.2.2 DNA extraction from vegetable material To extract DNA from vegetable material, two methods were employed: 1) the Chelex 100 method (suitable for in-field applications) (Gautam, 2022) and 2) the Plant/Fungi DNA Isolation Kit (Norgen Biotek, Canada). To enhance DNA extraction efficiency and its usability in the field, the standard Chelex 100 method was modified by introducing an alkaline-PEG buffer into the preparation process, using the recipe described in Tomlinson and Boonham (2015). For both methods, 125 mg of each plant sample was used as starting material. A) Chelex 100 - DNA extraction method applicable in the field Materials: • PEG lysis buffer: 60% of polyethylene glycol 200 (PEG 200) (Sigma-Aldrich Co. LLC, Germany), 20 mM NaOH (Sigma-Aldrich, USA), pH 13.3–13.5; • 0.4 g of Chelex® 100 sodium form (Sigma-Aldrich Co. LLC, Germany); • Tris-EDTA buffer (TE buffer), pH 7.4 (Supelco, USA); • Sterile 5 mL tubes; • 10 mm sterile metal balls; • Vegetable material (125 mg).
Doctoral dissertation Mila Đisalov 55 Before designing LAMP primers, the same gene was analysed using the online software Nucleotide Basic Local Alignment Search Tool (Nucleotide BLAST; https://blast.ncbi.nlm.nih.gov/Blast.cgi) to check if the chosen target gene (HDC) is highly conserved across other organisms. After conducting a thorough analysis of parameters for primer design (previously described within Section 1.3.1.1), three sets of highly promising primer candidates (PCs) that specifically target the HDC gene of K. aerogenes were identified. LAMP primers were designed and analysed using online version of Primer Explorer V5 software (http://primerexplorer.jp). The positioning of the LAMP primers along the targlet sequence is shown in Figure 18. Figure 18. Positioning of LAMP primers positioning within the target sequence: F3 – forward outer primer; B3 – backward outer primer; FIP – forward inner primer; BIP – backward inner primer; LF – loop forward primer; LB – loop backward primer. 3.1.6 LAMP assay In this doctoral dissertation, two types of LAMP assay were preformed: Real Time LAMP and Colorimetric LAMP. WarmStart® LAMP Kit (DNA & RNA) (New England BioLabs, France) was used for the Real Time LAMP assay, while WarmStart® Colorimetric LAMP 2x Master Mix (DNA & RNA) kit (New England BioLabs, France) was used for Colorimetric LAMP assay. All LAMP reactions were conducted at 65 °C according to the manufacturer's recommendation. The calculation for LAMP primer mixture preparation is summarized in Table 1. The reaction components and volumes for the of Real Time LAMP reaction are provided in Table 2, while those for the Colorimetric LAMP reaction are presented in Table 3. Each reaction was carried out in a total volume of 25 µL. In all the conducted reactions, K. aerogenes gDNA (with the concentration of 59.9 ng/µL) served as the positive control, while PCR-grade water was employed as the negative control (no template control, NTC).
Doctoral dissertation Mila Đisalov 56 Table 1. Summarized LAMP primer mix preparation. LAMP primer 10х concentration (stock) 1х concentration (final) FIP 16 µM 1.6 µM BIP 16 µM 1.6 µM F3 2 µM 0.2 µM B3 2 µM 0.2 µM Loop F 4 µM 0.4 µM Loop B 4 µM 0.4 µM Table 2. Components of Real Time LAMP Reaction mixture. Component Volume for one reaction [µL] WarmStart LAMP 2x Master Mix 12.5 LAMP Fluorescent Dye 0.5 Primer mix (10х concentration) 2.5 Sample (target DNA) 1.0 PCR H2O 8.5 Total volume per reaction Ʃ 25.0 Table 3. Components of Colorimetric LAMP Reaction mixture. Component Volume for one reaction [µL] WarmStart Colorimetric LAMP 2X Master Mix 12.5 Primer mix (10х concentration) 2.5 Sample (target DNA) 1.0 PCR H2O 9.0 Total volume per reaction Ʃ 25.0 The interpretation of the Real Time LAMP reaction results was based on graphical representations illustrating the dependence of the change of fluorescence intensity on the reaction time. The amount of product in the Real Time LAMP reaction was determined based on the Time to Threshold value (Tt), i.e., based on the time required to amplify the product in an amount sufficient to cross the threshold fluorescence (Figure 19).
Doctoral dissertation Mila Đisalov 57 Figure 19. Real Time LAMP reaction: amplification graph. The Colorimetric LAMP positive results were interpreted based on the change of the indicator color (phenol red) present in the LAMP reaction mixture from pink to yellow (or orange) (Figure 20). Figure 20. Change of indicator color in Colorimetric LAMP reaction. Image created with BioRender.com
Doctoral dissertation Mila Đisalov 58 3.1.7 Optimization of LAMP assay for K. aerogenes detection In order to optimize the LAMP reaction, the efficiency of different primer sets and reaction times were tested. 3.1.7.1 Evaluation of LAMP primer sets To identify suitable primer candidates, all three designed primer sets (Section 4.1.2) were tested under identical reaction conditions (65 °C for 45 min). Reactions were carried out on the Genie® III instrument (OptiGene, United Kingdom). All reactions were performed in triplicate. 3.1.7.2 Specificity evaluation of best performing primer set (PC2) The specificity of the chosen LAMP primer set (PC2) was further tested using gDNA originating from two different Gram-positive bacterial strains (S. aureus and B. subtilis) as well as from three Gram-negative bacterial strains (A. faecalis, S. enterica, E. coli). The primer specificity was assessed using both LAMP approaches: Colorimetric and Real Time which are performed at 65 °C for 30 min. All LAMP assays were performed in triplicate. Amplification products were analyzed by 2% w/v agarose gel electrophoresis. 3.1.7.3 LAMP assay sensitivity After identifying the PC2 primer set as optimal and confirming its specificity, the next step involved testing the detection limit for the LAMP reaction. For this purpose, serial dilutions of K. aerogenes gDNA (59.9 ng/µL) were prepared: 1:10 (5.99 ng/µL), 1:100 (0.599 ng/µL), 1:1000 (59.9 pg/µL), and 1:10000 (5.99 ng/µL). The sensitivity was assessed through both LAMP approaches: Colorimetric and Real Time, both conducted at 65 °C for 30 min. All LAMP assays were carried out in triplicate. 3.1.8 K. aerogenes detection in spiked food samples 3.1.8.1 Testing food for K. aerogenes contamination To evaluate the potential contamination of selected vegetable and meat samples with K. aerogenes before artificial contamination, gDNA isolates from bacterial cultures grown from the food samples were subjected to testing. This involved the Real Time LAMP assay with the PC2 primer set, as well as performing the most classical biochemical tests for identifying Klebsiella aerogenes. These tests include Gram staining, morphology, nitrate reductase test, catalase test, oxidase test, indole test, Voges-Proskauer test, and methyl-red test (Aryal, 2022).
Doctoral dissertation Mila Đisalov 59 3.1.8.2 Testing the effect of DNA isolation on K. aerogenes detection using LAMP To assess ability to detect K. aerogenes gDNA in both vegetable and meat DNA isolates, the effect of DNA isolation methods was compared. For vegetable DNA isolates, the Chelex 100 method and the Plant/Fungi DNA Isolation Kit were employed, while for meat DNA isolates, the Chelex 100 method was compared with the DNeasy PowerFood Microbial Kit. In this experiment, both vegetable and meat DNA samples were artificially contaminated (spiked) by adding K. aerogenes gDNA at a concentration of 59.9 ng/µL (as described in Sections 3.1.3.1 A and 3.1.3.2 A), ensuring that the final concentration of K. aerogenes gDNA in all spiked food DNA extracts is 1 ng/µL. Vegetable and meat DNA isolates that were not artificially contaminated were used as an internal negative control. 3.1.8.3 LOD of LAMP assay for spiked DNA samples isolated by Chelex 100 method and a commercial DNA isolation kit To assess the LOD of LAMP assay for K. aerogenes detection in vegetable and meat DNA extracts obtained with the Chelex 100 method and the Plant/Fungi DNA Isolation Kit (for vegetables) or the DNeasy PowerFood Microbial Kit (for meat), spiked DNA isolates from each sample were used to prepare serial dilutions (1:10, 1:100, 1:1000, 1:10000). The testing process involved a Real Time LAMP reaction conducted in three replicates for both vegetable and meat DNA extracts. The significance of the differences in Tt values recorded for all tested food DNA samples (both vegetable and meat) obtained using the Chelex 100 approach and commercial kits for extraction, and spiked with K. aerogenes gDNA, was determined using a one-way analysis of variance (one-way ANOVA) and Tukey's multiple comparison test for a significance level of p < 0.05. GraphPad Prism 8 software was used for statistical data analysis. 3.1.9 K. aerogenes detection in inoculated food samples All food materials underwent artificial contamination by inoculating them with a K. aerogenes culture, as detailed in Sections 3.1.3.1 B and 3.1.3.2 B. The main goal was to evaluate the suitability of the proposed DNA extraction methods for subsequent K. aerogenes detection using Real Time LAMP. The Chelex 100 method was applied to all inoculated food samples, the Plant/Fungi DNA Isolation Kit was used for inoculated vegetables, and the DNeasy PowerFood Microbial Kit was employed for inoculated meat samples. Prior to analysis,
Doctoral dissertation Mila Đisalov 60 concentrations of isolated DNA were adjusted to 1 ng/µL, and the DNA isolates were then analyzed in Real Time LAMP reactions. All Real Time LAMP assays were carried out in triplicate for vegetables and dupliucate for meat samples. 3.1.10 Real Time PCR assay For Real Time PCR analysis, MyGo Mini S Real Time PCR Instrument (Azura Genomics Inc., USA) was used. The kit used in all Real Time PCR analyses was the Maxima SYBR Green/ROX qPCR Master Mix (2X) (Thermo Scientific, USA). 3.1.10.1 Comparative analysis of the impact of different DNA isolation methods on success of the Real Time PCR assay To compare Real Time LAMP with Real Time PCR, the same inoculated food DNA extracts obtained as described in the previous section were used for Real Time PCR. Real Time PCR reaction mixtures were prepared based on the calculations provided in Table 4. Each reaction was carried out in a total volume of 15 µL. In all of the conducted reactions, K. aerogenes gDNA (with the concentration of 59.9 ng/µL) served as the positive control, while PCR-grade water was employed as the negative control (no template control). Table 4. Components of Real Time PCR Reaction mixture. Component Volume for one reaction [µL] Maxima SYBR Green/ROX qPCR Master Mix (2X) 7.5 F3 primer 0.45 B3 primer 0.45 Sample (target DNA) 5.0 PCR H2O 1.6 Total volume per reaction Ʃ 15.0 The interpretation of the Real Time PCR reaction results was based on graphical representations illustrating the dependence of the change in fluorescence intensity on reaction time and the dependence of the change in fluorescence intensity related to the number of cycles. The amount of products in the Real Time PCR reaction was determined based on the Ct value (cycle threshold) (Figure 21), which shows the number of cycles required for the multiplication of a sufficient number of NA copies to cross the limit, i.e. fluorescence threshold.
Doctoral dissertation Mila Đisalov 61 Figure 21. Amplification graph in Real Time PCR reaction. 3.1.10.2 PCR primers For Real Time PCR analysis, F3 and B3 from the PC1 LAMP set were used (details in Section 4.1.2). Primers were prepared at a concentration of 10 µM (as recommended by the manufacturer of the mixture used for Real Time PCR). The program for Real Time PCR assay used in this experiment is shown in Table 5. Table 5. Real Time PCR program. Step Parameters T (°C) t (min:sec) Condition 1. Initial denaturation 95 10:00 Ø 2. DNA denaturation 95 0:30 Go back to step 2 and repeat 29 times 3. Annealing of primers 56 0:30 4. Elongation and detection 72 0:30 5. а) High Resolution Melting – initial phase 65 0:60 Temperature increase 1.5 °C/second 5. b) High Resolution Melting – final phase 95 0:01 Temperature increase 0.05 °C/second
Doctoral dissertation Mila Đisalov 62 The melting curve of the Real Time PCR reaction product was documented using the High Resolution Melting (HRM) technique. The specificity of the PCR reaction product was confirmed by the distinctive bell-shape of the melting curve. This curve is represented by the dependence of the change in fluorescence upon temperature change (dF/dT), contingent on the temperature of heating the mixture. 3.1.11 Agarose gel electrophoresis Products of the Real Time LAMP and Colorimetric LAMP reactions were analyzed on the agarose gel electrophoresis. 2% w/v gel was prepared by dissolving 0.6 g of agarose in 30 mL of TBE buffer (tris/borate/EDTA). For DNA visualization, 1.5 µL of ROTI®GelStain dye (Carl Roth Gmbh & Co., Germany) was added directly in the dissolved agarose. Next, 1 µL of 6X TriTrack DNA Loading Dye (ThermoScientific, USA) was mixed with 5 µL of the sample. 6 µL of such mixture was applied to the gel. 4 µL of GeneRuler DNA Ladder Mix (ThermoScientific, USA) was also applied to the gel. The voltage was setup to 140V and the run lasted 45 min.
Doctoral dissertation Mila Đisalov 63 3.2 Development of a LAMP-based assay for Trichoderma spp. detection in champignon production To develop a LAMP-based assay for Trichoderma spp. detection in champignon production, the following experimental setup, as presented in Figure 22, was performed. Figure 22. Experimental outline for optimization of LAMP based Trichoderma spp. detection in champignon production. Image created with BioRender.com
Doctoral dissertation Mila Đisalov 64 3.2.1 Biological material 3.2.1.1 Fungal cultures All fungal cultures used in this doctoral dissertation were prepared by cultivation on Malt Agar (MA) (Torlak, Serbia) and incubated at 26 °C for 5–7 days. Fungal cultures used in this research were: Trichoderma harzianum, Aspergillus carbonarius, Aspergillus fumigatus, Alternaria alternata, Penicillium halotolerans, Cladosporium allicinum. All fungal cultures used in this dissertation originate from the BioSense Culture Collection of Fungi (BSCCF), which can be accessed via the following link: https://zenodo.org/records/11385670. In all experiments, T. harzianum was used as a model for highly aggressive Trichoderma spp. 3.2.1.2 Compost and casing soil All compost and casing soil samples (Figure 23) used in this study were gathered from the organic mushroom production nursery of EKOFUNGI DOO Padinska Skela, Belgrade in the period June-July 2021, in different stages of Agaricus bisporus (button mushroom, champignon) cultivation (Table 6). Figure 23. Compost (left) and casing soil (right) samples used in this doctoral dissertation.
Doctoral dissertation Mila Đisalov 71 3.2.7.3 LAMP assay sensitivity After identifying an optimal primer set (PC2) and confirming its specificity, the next step involved testing the detection limit for the LAMP reaction. For this purpose, serial dilutions of T. harzianum gDNA (concentration 229.31 ng/µL) were prepared: 1:10 (22.931 ng/µL), 1:100 (2.2931 ng/µL), 1:1000 (229.31 pg/µL), and 1:10000 (22.931 pg/µL). The sensitivity was assessed for both LAMP approaches, Colorimetric and Real Time LAMP, conducted at 65 °C for 30 min. All LAMP assays were carried out in triplicate. 3.2.8 Trichoderma spp. detection in spiked compost and casing soil samples 3.2.8.1 Testing compost and casing soil extracts for Trichoderma spp. contamination The evaluation of potential Trichoderma spp. contamination in selected compost and casing soil samples, before artificial contamination, was conducted following the procedure outlined in Section 3.2.1.2. 3.2.8.2 Testing the effect of DNA isolation from compost and casing soil samples on Trichoderma spp. detection using LAMP To evaluate the detection capability of Trichoderma spp. gDNA in compost and casing soil isolates, we compared the effect of isolation methods. Specifically, the Chelex 100 method was compared with the GenElute™ Soil DNA Isolation Kit for this purpose. In this experiment, samples were artificially contaminated by adding T. harzianum gDNA (concentration 229.31 ng/µL) in eDNA extracted from compost and casing soil samples (as described in Section 3.2.3.1 A), ensuring that the final concentration of T. harzianum gDNA in all spiked eDNA extracts is 1 ng/µL. Compost and casing soil isolates that were not artificially contaminated were used as an internal negative control. 3.2.8.3 LOD of LAMP assay for spiked eDNA samples isolated by Chelex 100 method and a commercial DNA isolation kit To assess LOD of Trichoderma spp. detection in compost and casing soil eDNA extracts obtained through the Chelex 100 method and by using GenElute™ Soil DNA Isolation Kit, spiked eDNA extracts from each sample were utilized to prepare serial dilutions (1:10, 1:100, 1:1000, 1:10000). The LOD is assessed for Real Time LAMP reaction conducted in three replicates for all tested samples.
Doctoral dissertation Mila Đisalov 72 3.2.9 Trichoderma spp. detection in inoculated compost and casing soil samples All compost and casing soil materials were artificially contaminated by inoculating them with a T. harzianum pure culture, as outlined in Section 3.2.3 B. This was done to assess the effect of the applied DNA extraction methods for subsequent detection of Trichoderma spp. using Real Time LAMP. 3.2.10 Real Time PCR assay All Real Time PCR reactions in this experimental section of the dissertation were conducted in accordance with the procedure outlined in Section 3.1.10. For all the conducted reactions, T. harzianum gDNA (with a concentration of 229.31 ng/µL) served as the positive control, while PCR-grade water was employed as the NTC (no template control). 3.2.10.1 PCR primers For the Real Time PCR analysis, testing of F3 and B3 from both the PC1 and PC2 LAMP sets (from Table 22, Section 4.2.2) was performed. The primers were initially assessed for specificity using gDNA from other non-target fungal strains (Section 3.2.7.2) as a target. Furthermore, PCR primers from the literature (Lee et al., 2020) targeting conserved regions of ITS1 and ITS2 that are specific to Trichoderma spp. (Table 7) were also tested. Table 7. PCR primers for Trichoderma spp. detection form the literature (Lee et al., 2020). Primer name Sequence 5'-3' Tm (℃) Length (bp) TDP-F CGAGTTTACAACTCCCAAA 49.9 19 TDP-R GAAAGTTGGGTGTTTAACG 49.3 19 The primers were prepared at a concentration of 10 µM, as recommended by the manufacturer of the mixture used for Real Time PCR. The Real Time PCR assay program for F3 and B3 from the PC1 and PC2 sets is outlined in Table 5 in Section 3.1.10.2. For the TDP-F and TDP-R primers from the literature (Lee et al., 2020), the same PCR program was applied, with a modification in the annealing temperature to 50 ℃.
Doctoral dissertation Mila Đisalov 73 3.2.11 Agarose gel electrophoresis The products of the Real Time LAMP and Colorimetric LAMP reactions were examined through agarose gel electrophoresis, following the procedure outlined in Section 3.1.11. 3.2.12 LAMP assay coupled with Gold Nanoparticles for Colorimetric Detection of Trichoderma spp. One of the experimental goals of this doctoral dissertation was the development of innovative approaches for the visualization of positive LAMP reactions in the detection of Trichoderma spp. For these purposes, a LAMP assay coupled with gold nanoparticles (AuNPs) was developed. The assay is based on salt-induced aggregation of AuNPs that is being prevented by the amplicons produced in case of positive LAMP reaction. As the solution colour changes from red to violet upon nanoparticle aggregation, change in color can be observed with the naked eye (Figure 24), the developed LAMP-AuNPs assay can be easily operated to provide a simple initial screening for the rapid detection of Trichoderma during mushroom cultivation. Figure 24. The principle of LAMP-AuNP assay for Trichoderma detection. (Djisalov et. al., 2024). 3.2.12.1 LAMP assay In this experimental section of the dissertation, all LAMP reactions were carried out according to the procedure outlined in Section 3.1.6. The PC2 primer set, previously validated for specificity and sensitivity as described in Sections 3.2.7.2 and 3.2.7.3, was used.
Doctoral dissertation Mila Đisalov 74 3.2.12.2 AuNPs 20 nm AuNPs were synthesized and caracterized in the MicrobAdapt group's lab at Micalis Institute Institute (INRAe, Jouy-en-Josas, France) using the reduced citrate method explained in Braiek et al., 2016. 3.2.12.3 LAMP-AuNP assay optimization Optimization of salt concentration For the sensitive detection of LAMP products, it's crucial to ensure that AuNPs aggregate appropriately in response to a minimal amount of salt. When exposed to high salt conditions, citrate-capped AuNPs easily aggregate, and a considerable number of amplicon molecules are required to prevent this aggregation. In order to improve the sensitivity of the colorimetric detection, the concentration of MgCl2 using 1, 5, and 10 μL of MgCl2 with varying molarities (2 mM, 20 mM, and 2M) was tested. The impact of salt concentration on the aggregation of AuNPs was examined in a 150 µL volume containing 2 x 109 NPs. This volume was selected to align the assay with a multiplex 96-well microplate format. Optimization of incubation temperature and time Next, various temperatures and time conditions were tested to improve binding of the LAMP products to AuNPs. For this purpose, 2 µL of the obtained LAMP amplicons (with the concentration range from 2400 ng/μL to 2.4 fg/μL) were carefully transferred to the well containing 50 µL of AuNPs and 98 µL of MilliQ water. Next, the mixture was tested for different conditions: 1. without incubation; 2. incubation at 55 ℃ for 20 min; and 3. incubation at 65 ℃ for 10 min. Subsequently, 2.5 µL of 20 mM MgCl2 was added and the color change was observed by naked-eye or by measuring the absorption of solution using the SPARK multimode microplate reader (Tecan Global Headquarters, Männedorf, Switzerland). LAMP-AuNP assay specificity To assess the specificity of the LAMP-AuNP assay, AuNPs were incubated with a positive LAMP reaction obtained using gDNA of T. harzianum and negative LAMP reaction performed without DNA template, or with non-specific gDNA from B. subtilis (concentration 26.01 ng/µL) together with LAMP master mix (WarmStart LAMP Reagent containing deoxynucleotides dNTPs, Bst 2.0 WarmStart DNA Polymerase, isothermal amplification buffer, LAMP primers and PCR-grade water).
Doctoral dissertation Mila Đisalov 75 After addition of 2.5 µL of 20 mM MgCl2 the color change was observed by naked-eye or by measuring the absorption of solution using the SPARK multimode microplate reader (Tecan Global Headquarters, Männedorf, Switzerland). LAMP-AuNP assay sensitivity To ascertain the minimum detectable amount of the LAMP product by AuNPs, an investigation was carried out involving a 10-fold serial dilution of positive LAMP reaction products in the context of T. harzianum gDNA detection. In parallel, serial dilutions of the no-template reaction was also tested. Ten-fold serial dilutions of all products from the LAMP reaction were preformed using PCR-grade water, ranging from dilutions at 2400 ng/μL to 2.4 fg/μL. 3.3 LAMP-based assay for E. coli detection in highly polluted water samples 3.3.1 Biological material 3.3.1.1 Bacterial cultures The pure culture of E. coli used in this experimental section of the presented doctoral dissertation was prepared by cultivating on TSA (Millipore, USA) and incubated at 37 °C for 24 hours (overnight) in thermostat incubator (Incubator IN55, Memmert, Germany). 3.3.1.2 Water samples Water samples used in this part of doctoral dissertation were collected from the Danube River in Novi Sad, Vojvodina, Serbia from three different sampling sites near one of the sewage outfalls (Figures 25-26): • Sampling site 1 (S1) – upstream of the city sewage outfall (coordinates on Google maps: 45.2537700, 19.8555206) • Sampling site 2 (S2) – city sewage outfall (coordinates on Google maps: 45.2530608, 19.8558857) • Sampling site 3 (S3) upstream of S1 (coordinates on Google maps: 45.2561503, 19.8551548)
Doctoral dissertation Mila Đisalov 76 Figure 25. Google Earth satellite image of the study area – sampling points at Danube River in Novi Sad. S1 – sample point 1 upstream of the city sewage outfall; S2 – sample point 2 at the city sewage outfall; S3 – sample point 3 upstream of S1. Figure 26. City sewage outfall. (Coordinates on Google maps: 45.2530608, 19.8558857). Image taken by Mila Đisalov, on 22.05.2022. From each sampling site, 500 mL of river water was collected using a sampling stick and stored in sterile glass bottles at 4 ℃ until further analyses (up to 24h).
Doctoral dissertation Mila Đisalov 77 3.3.2 Microbiological confirmation of E. coli presence in water samples Microbiological confirmation of E. coli presence in tested river water samples - S1, S2 and S3 was done by spread plate seeding on Chromogenic Coliform Agar (CCA) (Merck KGaA, Darmstadt, Germany) plates, a selective media used for enumeration of E. coli and coliform bacteria. Dilutions of the raw water samples, ranging from 1/2 to 10−2, were applied and plates were cultivated at 37 °C for 24 h in thermostat incubator (Incubator IN55, Memmert, Germany). The quantification of E. coli in the samples was achieved by counting only the colonies that tested positive for both β-galactosidase and β-glucuronidase, enzymes contained in CCA, resulting in a dark blue to violet color of colonies. To calculate the final CFU per 1 mL i.e., per 100 mL, the test was performed in duplicate. 3.3.3 DNA extraction 3.3.3.1 DNA extraction from bacterial cultures The DNA extraction from pure bacterial cultures was done by using the protocol described in Section 3.1.2.1. 3.3.3.2. DNA extraction from highly polluted water sample The extraction of eDNA from environmental, water samples (S1, S2, and S3) was conducted using the modified protocol described by Kesberg and Schleheck (2013), taking a step forward towards its applicability in the field (see Figure 27).
Doctoral dissertation Mila Đisalov 78 Figure 27. Procedure for DNA extraction from highly polluted water samples. A) pre-filtration steps; B) syringe filter-based DNA extraction modified from Kesberg and Schleheck (2013). Materials: • Sterile 10 μm pore-size filter (WhatmanTM, United Kingdom); • Sterile 0.45 μm pore-size filter (Filtres Fioroni, France); • Sterile 0.22 μm pore-sized Vented Millex - GS syringe filters (Millipore, USA); • Sterile 1x TE buffer (10 mM Tris-HCl; 1 mM EDTA, pH 7.4); • Sterile TL buffer (10mM Tris/HCl pH 8.0, 10mM EDTA, 7.5 mg/mL lysozyme); • Sterile TPS buffer (10 mM Tris/HCl pH 8.0, 10 mM EDTA, 300 μg/mL proteinase K, 1% SDS (w/v)); • Sterile washing buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA pH 8.0, 70% ethanol); • 70% ethanol (Sigma-Aldrich, USA); • Water samples.
Doctoral dissertation Mila Đisalov 79 Procedure: 1. Water samples were pre-filtered through a 10 μm pore-size filter (WhatmanTM, United Kingdom), followed by filtration through a 0.45 μm pore-size sterile filter (Filtres Fioroni, France); 2. The 0.45 μm filter was placed into a sterile 15 mL Falcon tube containing 10 mL of TE buffer; 3. The tubes containing concentrated samples in TE buffer were further sonicated for 2 min to detach cells collected on the filter; 4. 10 mL of each sample was filtered through 0.22 μm pore-sized Vented Millex – GS syringe filters (Millipore, USA) and washed by filtering through 500 μL of TE buffer; 5. The syringe filter was then inverted to backwash in the direction opposite from filtration using 300 μL of lysis buffer - TL, with an additional 150 μL added to the flow-through; 6. The flow-through was mixed by pipetting; 7. 500 μL of TPS buffer was filtered in the same direction (backwash); 8. The flow-through was incubated at 65 °C for 15 min to increase eDNA yield; 9. An additional 500 μL of TPS buffer was filtered, and 500 μL was added to the flowthrough; 10. The flow-through was mixed by pipetting, and the filter was backflushed 3 times with air to ensure the complete drainage of the eDNA retentate; 11. The filter was discharged; 12. 500 μL of the washing buffer was added; 13. The sample was centrifuged for 2 min at 10000g; 14. The sample was washed twice with 70% ethanol; 15. After each wash, the sample was centrifuged for 2 min at 10000g; 16. The supernatant was discarded; 17. The eDNA was dissolved in 50 μL of the TE buffer; 18. The eDNA was stored at -20°C. 3.3.4 Concentration and purity of DNA The determination of concentration and evaluation of DNA purity were performed as described in Section 3.1.4.
Doctoral dissertation Mila Đisalov 80 3.3.5 LAMP primers for E. coli detection LAMP primers used in this study are taken from the literature (Table 8) (Song et al., 2019). The primers are targeting malB gene (maltose protein operon B), known to be conserved in several different strains of E. coli (including the tested strain, ATCC® 25922™). Table 8. LAMP Primer set for E. coli detection (Song et al., 2019). Primer ID Sequence (5′ - 3′) E. coli - F3 CACCTTCATGGATATCGAGATT E. coli - B3 TGGAGGATTTAAGCCATCTC E. coli - FIP(F1c+F2) CGAGCGTACAGCTGCAAAATGATATCTTTCGATACCACGACCT E. coli - BIP(B1c+B2) CCCTTCTCCCTTTGTAACAAGATGACGCATAGTCAGCCCAT E. coli - LF TAACGAAAGCCTGGGGCG E. coli - BF CCTGTCATCGACAGCAACATTCA 3.3.6 LAMP assay All LAMP reactions in this experimental section of the dissertation were conducted following the procedure outlined in Section 3.1.6. In all the conducted reactions, E. coli gDNA (concentration 50 ng/µL) served as the positive control, while PCR-grade water was employed as the NTC (no template control). 3.3.7 Real Time PCR assay All Real Time PCR reactions in this experimental section of the dissertation were conducted following the procedure outlined in Section 3.1.10. In all the conducted reactions, E. coli gDNA (concentration 50 ng/µL) served as the positive control, while PCR-grade water was employed as NTC (no template control). 3.2.7.1 PCR primers For Real Time PCR analysis, F3 and B3 from the LAMP set were used (Table 8 in Section 3.3.5). Primers were prepared at a concentration of 10 µM (as recommended by the manufacturer of the mixture used for Real Time PCR). The program for Real Time PCR assay used in this experiment is showed in Table 5, Section 3.1.10.2).
Doctoral dissertation Mila Đisalov 87 non-inoculated meat extract samples, the values of A260/A280 ratio were within the range of recommended reference values. The only exception was observed in the case of the noninoculated chicken salami gDNA extract, which exhibited an A260/A280 ratio value of 1.62.The A260/A230 absorbance ratio ranged from 0.10 to 1.63 (below the lower reference threshold). 4.1.2 LAMP primers for K. aerogenes The results of the LAMP primer design for the detection of K. aerogenes are described in the following section, as well as results of primer sets comparison leading to selection of the best performing primer candidate. The specificity of the selected primer set was further tested, and its limit of detection (LOD) was determined (see Section 4.1.3). The BLAST analysis results have indicated that the sequence of the HDC gene (Gene ID: 66602288), used for LAMP primer design, shows high similarity with all 76 HDC gene sequences from various K. aerogenes strains. These sequences exhibit a query coverage of 100%, with a percentage of identity ranging from 97.83% to 100%. The designed primer sequences, along with their respective positions on the K. aerogenes HDC gene, are presented in Table 14 and Figures 28–30, respectively.
Doctoral dissertation Mila Đisalov 88 Table 14. LAMP primers for K. aerogenes designed de novo Primer candidate (PC) Primer name Sequence 5'-3' Position Length (bp) PC1-HDC PC1-F3 ATTATCTACACGCGGATGCC 587-606 20 PC1-B3 GCGTGACCCTGAAATCGT 799-816 18 PC1-FIP (F2+F1c) TGTCCGGAAACGCCAATCGAATTGATCTTGCCTTTCGTGGAG N.A. 42 PC1-BIP (B2+B1c) TGGTAGCCAAGAAAGCCAACGTTATCGTGGGCGGAGATGT N.A. 40 PC1-LF GCGAAGGTAAACGGTTGTGGA 642-662 21 PC1-LB GACCGTATCAGCGTAGAGATCG 754-775 22 PC2-HDC PC2-F3 ACGGTCATACCCCTTTGATG 818-837 20 PC2-B3 CCAGGCAGTGTTTCTTCCAT 1005-1024 20 PC2-FIP (F2+F1c) CGGCGTATTTCGCCATGTTGAGGTTCGCAGCCATACCGAT N.A. 40 PC2-BIP (B2+B1c) AAGCAGCAGGTATTGACGCGCCCCATTCAGAAGGCTTCGG N.A. 40 PC2-LF GCTGTGACCAATGCGGC 881-897 17 PC2-LB CACAAAAACTCCATCACGGTGG 958-979 22 PC3-HDC PC3-F3 CTCAACATGGCGAAATACGC 989-917 20 PC3-B3 GCCAGGTCGGCAATTACG 1104-1121 18 PC3-FIP (F2+F1c) TCGGAAAGACCACCGTGATGGAATCGCTTTAAAGCAGCAGGT N.A. 42 PC3-BIP (B2+B1c) CGTAGCCCATCTGATCACCACCATCGATCAGCGCATCAATCC N.A. 42 PC3-LB TCACCACCTGGACAGTTCCC 1062-1081 20 Figure 28. Schematic illustration of HDC gene showing positions and directions of LAMP primer candidate 1 (PC1).
Doctoral dissertation Mila Đisalov 89 Figure 29. Schematic illustration of HDC gene showing positions and directions of LAMP primer candidate 2 (PC2). Figure 30. Schematic illustration of HDC gene showing positions and directions of LAMP primer candidate 3 (PC3). 4.1.3 Optimization of LAMP assay for K. aerogenes detection Results from primer candidate evaluation revealed that a reaction time of 30 min consistently produced positive and stable outcomes. Reaction that last more than 30 min resulted in false positives. Thus, reaction time of 30 min was considered optimal and was applied across all subsequent LAMP assays. 4.1.3.1 Evaluation of LAMP primer sets The results of the LAMP primer candidates evaluation are depicted in Graphs 1–3.
Doctoral dissertation Mila Đisalov 90 Graph 1. Real Time LAMP amplification graph of primer candidates for K. aerogenes detection. Klebsiella aerogenes gDNA was used as a template for all primer set candidates. PCR-grade water was used instead of DNA for the non-template control (NTC) for each primer candidate (PC). Red curve – LAMP amplification with PC1, orange curve – LAMP amplification with PC2, yellow curve – LAMP amplification with PC3, light blue curve – non-templet control (NTC) for PC1, dark blue curve – NTC for PC2, pink curve – NTC for PC3. Graph 2. Tt values of different primer candidates for K. aerogenes detection-PC1, PC2 and PC3. The amplification curve for primer candidate PC1 (red curve) appears first, with a Tt of approximately 12 min (Graph 1 & 2). However, a false positive result was observed in the
Doctoral dissertation Mila Đisalov 91 control test, suggesting that this particular primer set may not be suitable for future analyses. Amplification with PC3 takes place after approximately 21 min (yellow curve), indicating a longer time compared to the amplification with PC2. Furthermore, a peak of amplification in the negative control is observed after about 38 min (purple curve). For candidate PC2, the Tt was approximately 16 min (green curve). Additionally, no amplification was observed in the negative control for candidate PC2. This primer candidate set has been chosen for further optimization of the LAMP based detection protocol for K. aerogenes. After the Real Time LAMP reaction for primer candidates performance evaluation, the melting curves depicted in Graph 3 were obtained. The lower peak values were observed for the NTCs of primer candidates PC1 and PC3 (dark blue and purple curves) compared to the positive reactions. suggest that the amplification results for these samples represents false positives. Graph 3. Real Time LAMP melting curve of amplification products produced with different primer candidates for K. aerogenes detection. Klebsiella aerogenes gDNA was used as a template for all primer set candidates. PCR-grade water was used instead of DNA for non-template controls (NTCs) for each primer candidate (PC). Red curve – LAMP amplification with PC1, orange curve – LAMP amplification with PC2, yellow curve – LAMP amplification with PC3, light blue curve – non-templet control (NTC) for PC1, dark blue curve – NTC for PC2, pink curve – NTC for PC3.
Doctoral dissertation Mila Đisalov 92 4.1.3.2 Specificity evaluation of best performed primer set (PC2) The results of the evaluation of PC2 specificity obtained by the Real Time and Colorimetric LAMP methods are shown in Graphs 4–5, and Figure 31 respectively. The results from Graph 4 indicate that a positive result was observed only for the species K. aerogenes (red curve in the Graph). Graph 4. Amplification graph for assessing the specificity of PC2 for K. aerogenes detection using the Real Time LAMP method with the following templates: K. aerogenes gDNA for specific reaction (red curve), A. faecalis gDNA for non-specific reaction (orange curve), E. coli gDNA for nonspecificreaction (yellow curve), S. enterica gDNA for non-specific reaction (light green curve), S. aureus gDNA for non-specific reaction (dark green curve), B. subtilis gDNA for non-specific reaction (blue curve), and non-template control (NTC) for PC2 (pink curve). Based on the results presented in Graph 5 and the characteristic shape of the melting curve in the sample where amplification occurred the specificity of the PC2 primer set has been validated.
Doctoral dissertation Mila Đisalov 93 Graph 5. Melting curve for checking the specificity of PC2 for K. aerogenes detection using the Real Time LAMP method with the following templates: K. aerogenes gDNA for specific reaction (red curve), A. faecalis gDNA for non-specific reaction (orange curve), E. coli gDNA for non-specific reaction (yellow curve), S. enterica gDNA for non-specific reaction (light green curve), S. aureus gDNA for non-specific reaction (dark green curve), B. subtilis gDNA for non-specific reaction (blue curve), and non-template control (NTC) for PC2 (pink curve). The assessment of the PC2 primer set's specificity was additionally conducted using the Colorimetric LAMP method. The results, as illustrated in Figure 31, indicated a positive reaction exclusively for the K. aerogenes sample after 30 min, visualized by the transition of the indicator colour from pink to yellow.
Doctoral dissertation Mila Đisalov 94 Figure 31. Confirmation of the specificity of the PC2 primer set for K. aerogenes using the Colorimetric LAMP method with the following templates: K. aerogenes gDNA for specific reaction (resulted in yellow solution), A. faecalis gDNA for non-specific reaction (resulted in pink solution), E. coli gDNA for non-specific reaction (resulted in pink solution), S. enterica gDNA for non-specific reaction (resulted in pink solution), S. aureus gDNA for non-specific reaction (resulted in pink solution), B. subtilis gDNA for non-specific reaction (resulted in pink solution), non-template control (NTC) for PC2 (resulted in pink solution). The specificity assays for the products of the PC2 primer set, obtained through both the Real Time LAMP and Colorimetric LAMP approaches, were subsequently confirmed using agarose gel electrophoresis (Figures 32–33).
Doctoral dissertation Mila Đisalov 95 Figure 32. Agarose gel electrophoresis of products from Real Time LAMP reaction for assessing the specificity of PC2 for K. aerogenes. Figure 33. Agarose gel electrophoresis of products from Colorimetric LAMP reaction for assessing the specificity of PC2 for K. aerogenes.
Doctoral dissertation Mila Đisalov 96 4.1.3.3 LAMP assay sensitivity The results indicating the detection limit of developed LAMP assay are presented in Graphs 68 for Real Time LAMP, and in Figure 34 for the Colorimetric LAMP method. Graph 6 illustrates the outcomes of the assessment of the Real Time LAMP limit of detection (LOD) for K. aerogenes, employing the PC2 primer set. Graph 6. Assessment of the Real Time LAMP limit of detection for K. aerogenes using primer set PC2. Used dilutions of K. aerogenes gDNA: 59.9 ng/µL (red curve), 59.9 × 10-1 ng/µL (orange curve), 59.9 × 10-2 ng/µL (yellow curve), 59.9 × 10-3 ng/µL (light green curve), 59.9 × 10-4 ng/µL (dark green curve), 59.9 × 10-5 ng/µL (light blue curve), 59.9 × 10-6 ng/µL (dark blue curve), NTC – non-template control (pink curve). The determined LOD corresponds to a dilution of 10-4 (dark green curve), equivalent to a K. aerogenes gDNA concentration of 59.9 x 10-4 ng/µL. Hence, at a concentration of 2.4 x 10-4 ng/µL in LAMP reaction (for reaction volume of 25 µL), the LOD for the PC2 primer candidate is determined to be 240 fg/µL. Additionally, in Graph 6 it is notable that the signals for the dilution series occur at regular time intervals. Additionally, the amount of product decreases towards the lowest concentration, aligning with the higher Tt values for these samples (Graph 7).
Doctoral dissertation Mila Đisalov 103 Graph 11. Real Time LAMP amplification graph: Results obtained using gDNA isolates derived from bacterial cultures cultivated form different meat samples. Red curve – positive control, i.e. K. aerogenes gDNA, yellow curve – gDNA isolate obtained from bacterial cultures grown from chicken breasts, green curve – gDNA isolate obtained from bacterial cultures grown from salami, dark blue curve – nontemplet control for PC2 (NTC).
Doctoral dissertation Mila Đisalov 104 Graph 12. Real Time LAMP melting curves for gDNA isolates derived from bacterial cultures cultivated form different meat samples. Red curve – positive control, i.e. K. aerogenes gDNA, yellow curve – gDNA isolate obtained from bacterial cultures grown from chicken breasts, green curve – gDNA isolate obtained from bacterial cultures grown from salami, dark blue curve – non-templet control for PC2 (NTC). The results of biochemical tests for microbial identification indicated that there was no K. aerogenes present in any of the tested food samples (Supplementary Table 1). 4.1.4.2 Testing the effect of DNA isolation on K. aerogenes detection using LAMP The results of K. aerogenes detection using Real Time LAMP reaction for samples isolated using the Chelex 100 method are illustrated in Graphs 13–23 and Table 13, while those obtained for samples isolated with the Plant/Fungi DNA Isolation Kit are presented in Graphs 24–30 and Table 14. Additionally, Graphs 31–35 and Table 15 showcase the results for samples isolated using the DNeasy PowerFood Microbial Kit. DNA samples obtained using the Chelex 100 method The Real Time LAMP reaction results indicate that the limit of detection (LOD) for K. aerogenes gDNA in food DNA extracts obtained using the Chelex 100 method and spiked with K. aerogenes gDNA (dilution 10-2, depicted by the light green curve in Graphs 13, 15, 17, 19, 21) was consistent across all three vegetable samples (carrot, cucumber, lettuce) and both tested
Doctoral dissertation Mila Đisalov 105 meat samples (chicken breasts and salami). This finding, equivalent to 0.4 pg/µL of , highlights the method's effectiveness. Graphs 14, 16, 18, 20 and 22 reveals that the melting curve values for all tested samples (orange, yellow, and green curves) where amplification occurred are within the range of positive control values (red curve), indicating specific amplification. Graph 13. Real Time LAMP amplification graph for the limit of detection determination for K. aerogenes using PC2 primer set in spiked carrot DNA extract samples obtained using the Chelex 100 method. Used templates: gDNA of K. aerogenes 59.9 ng/µL as a positive control (red curve), carrot DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), carrot DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), carrot DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), carrot gDNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), carrot DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure carrot DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 106 Graph 14. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked carrot DNA extract samples obtained through isolation using the Chelex 100 method and by using following templates: gDNA K. aerogenes 59.9 ng/µL as a positive control (red curve), carrot DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), carrot DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), carrot DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), carrot extract DNA spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), carrot DNA extract spiked with 1 × 104 ng/µL of K. aerogenes gDNA (light blue curve), pure carrot DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 107 Graph 15. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked cucumber DNA extract samples obtained using the Chelex 100 method and by using following templates: gDNA K. aerogenes 59.9 ng/µL as a positive control (red curve), cucumber DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), cucumber extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), cucumber DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), cucumber DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), cucumber DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure cucumber DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 108 Graph 16. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked cucumber DNA extract samples obtained through isolation using the Chelex 100 method and by using following templates gDNA K. aerogenes 59.9 ng/µL as a positive control (red curve), cucumber DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), cucumber DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), cucumber DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), cucumber DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), cucumber DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure cucumber DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 109 Graph 17. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked lettuce DNA extract samples obtained through isolation using the Chelex 100 method and by using following templates: gDNA K. aerogenes 59.9 ng/µL as a positive control (red curve), lettuce DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), lettuce DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), lettuce DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), lettuce DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), lettuce DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure lettuce DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 110 Graph 18. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked lettuce DNA extract samples obtained through isolation using the Chelex 100 method and by using following templates: gDNA K. aerogenes 59.9 ng/µL as a positive control (red curve), lettuce DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), lettuce extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), lettuce DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), lettuce DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), lettuce DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure lettuce DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 111 Graph 19. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked chicken breast DNA extract samples obtained through isolation using the Chelex 100 method and by using following templates: gDNA K. aerogenes 59.9 ng/µL as a positive control (red curve), chicken breast DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), chicken breast DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), chicken breast DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), chicken breast DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), chicken breast DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure chicken breast DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 112 Graph 20. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked chicken breast DNA extract samples obtained through isolation using the Chelex 100 method and by using following templates: gDNA K. aerogenes 59.9 ng/µL as a positive control (red curve), chicken breast DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), chicken breast DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), chicken breast DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), chicken breast DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), chicken breast DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure chicken breast DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 119 Graph 25. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in carrot DNA extract samples obtained through isolation using Plant/Fungi DNA Isolation Kit and by using following templates: gDNA K. aerogenes 59.9 ng/µL as a positive control (red curve), carrot DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), carrot DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), carrot DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), carrot DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), carrot DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure carrot DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve). For cucumber samples, the LAMP reaction results indicated that none of the extracts obtained through isolation with the Plant/Fungi DNA Isolation Kit, spiked with the lowest concentrations of K. aerogenes gDNA, were detectable. Graph 26 represents the only replicate where the 10-1 dilution was detected (yellow curve), although in this replicate there was no amplification for the cucumber extract containing 1 ng/µL of K. aerogenes gDNA. Considering all this, it is assumed that detection limit for K. aerogenes gDNA in the cucumber extract isolated by this kit ranges between 40-400 pg/µL. Specificity of the reaction was confirmed based on melting peak of amplified sample that overlap with melting peak of positive control (Graph 27).
Doctoral dissertation Mila Đisalov 120 Graph 26. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked cucumber DNA extract samples obtained using the Plant/Fungi DNA Isolation kit and by using following templates: gDNA of K. aerogenes 59.9 ng/µL as a positive control (red curve), cucumber DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), cucumber DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), cucumber DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), cucumber DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), cucumber DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure cucumber DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 121 Graph 27. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked cucumber DNA extract samples obtained through isolation using Plant/Fungi DNA Isolation Kit and by using following templates: gDNA of K. aerogenes 59.9 ng/µL as a positive control (red curve), cucumber DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), cucumber DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), cucumber DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), cucumber DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), cucumber DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure cucumber DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve). The detection limit of bacterial gDNA in the lettuce DNA extract isolated by Plant/Fungi DNA Isolation Kit is 40 pg/µL, as only a dilution of lettuce extract spiked with 1 ng/µL of K. aerogenes gDNA was detected (Graph 28). Specificity of the reaction was confirmed based on melting peak of amplified sample that overlap with melting peak of positive control (Graph 29).
Doctoral dissertation Mila Đisalov 122 Graph 28. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked lettuce DNA extract samples obtained through isolation using the Plant/Fungi DNA Isolation Kit and by using following templates: gDNA K. aerogenes 59.9 ng/µL as a positive control (red curve), lettuce DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), lettuce DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), lettuce DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), lettuce DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), lettuce DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure lettuce DNA extract (nonspiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 123 Graph 29. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked DNA lettuce extract samples obtained through isolation using Plant/Fungi DNA Isolation Kit and by using following templates: gDNA K. aerogenes 59.9 ng/µL as a positive control (red curve), lettuce DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), lettuce DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), lettuce DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), lettuce DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), lettuce DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure lettuce DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve). Graph 30 illustrates a comparison of the Tt values in the tested vegetable DNA extracts obtained using the Plant/Fungi DNA Isolation kit and spiked with K. aerogenes gDNA. Observations indicate that the Tt values for 1 ng/μL gDNA of K. aerogenes in carrot and lettuce DNA extracts were similar, showing no statistically significant differences (Table 16), with values ranging between 23 and 26 minutes. When testing the same concentration in cucumber extract, no amplification was observed. For cucumber, amplification was observed at a dilution of 10-1, with a Tt recorded at 29 minute, while no amplification was observed at this concentration for carrot and lettuce samples.
Doctoral dissertation Mila Đisalov 124 Graph 30. Comparison of Tt values for various vegetable DNA extracts extracted using Plant/Fungi DNA Isolation kit and spiked with K. aerogenes gDNA. The graph summarized only amplified dilutions: gDNA of K. aerogenes 59.9 ng/ µL as a positive control for various vegetable DNA extracts, vegetable extracts spiked with 1 ng/µL of K. aerogenes gDNA, vegetable extracts spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA, vegetable extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA.
Doctoral dissertation Mila Đisalov 125 Table 16. Results of the statistical analysis of the differences in Tt values recorded for vegetable DNA samples obtained using the Plant/Fungi DNA Isolation kit. Samples Mean Diff. 95.00% CI of diff. Significant? Summary P Value 59.9 ng/µL of K. aerogenes gDNA Carrot 59.9 vs. Cucumber 59.9 0.905 -5.083 to 6.893 No ns 0.8146 Carrot 59.9 vs. Lettuce 59.9 -1.425 -7.413 to 4.563 No ns 0.6287 Cucumber 59.9 vs. Lettuce 59.9 -2.33 -8.318 to 3.658 No ns 0.3624 vegetable DNA extracts spiked with 1 ng/µL of K. aerogenes gDNA Carrot 1 vs. Lettuce 1 0.075 -7.672 to 7.822 No ns 0.9991 ns – not significant
Doctoral dissertation Mila Đisalov 126 DNA samples obtained using DNeasy PowerFood Microbial Kit The Real Time LAMP reaction results indicate that the limit of detection (LOD) for K. aerogenes gDNA in DNA extracts obtained using the DNeasy PowerFood Microbial Kit was 10-2 dilution, (depicted by the green curve in Graphs 31 and 33) for both chicken breast and salami isolates, establishing the detection limit at 0.4 pg/µL. Graphs 32 and 34 reveal that the melting curve values for all amplified dilutions fall within the range of the positive control value (red curve), indicating specific amplification. Graph 31. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked chicken breast DNA extract samples obtained using the DNeasy PowerFood Microbial Kit. Following templates were used for Real Time LAMP reaction: gDNA of K. aerogenes 59.9 ng/µL as a positive control (red curve), chicken breast DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), chicken breast DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), chicken breast DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), chicken breast extract DNA spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), chicken breast extract DNA spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure chicken breast DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 127 Graph 32. Real Time LAMP melting curve graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked chicken breast DNA extract samples obtained using the DNeasy PowerFood Microbial Kit. Following templates were used for Real Time LAMP reaction: gDNA of K. aerogenes 59.9 ng/µL as a positive control (red curve), chicken breast DNA extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), chicken breast DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), chicken breast DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), chicken breast extract DNA spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), chicken breast extract DNA spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), pure chicken breast DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 128 Graph 33. Real Time LAMP amplification graph for determining of the limit of detection of K. aerogenes using PC2 primer set in spiked salami DNA extract samples obtained through isolation using the DNeasy PowerFood Microbial Kit. Following templates were used for Real Time LAMP reaction: gDNA K. aerogenes 59.9 ng/µL as a positive control (red curve), salami extract spiked with 1 ng/µL of K. aerogenes gDNA (orange curve), salami DNA extract spiked with 1 × 10-1 ng/µL of K. aerogenes gDNA (yellow curve), salami DNA extract spiked with 1 × 10-2 ng/µL of K. aerogenes gDNA (light green curve), salami DNA extract spiked with 1 × 10-3 ng/µL of K. aerogenes gDNA (dark green curve), salami DNA extract spiked with 1 × 10-4 ng/µL of K. aerogenes gDNA (light blue curve), salami DNA extract (non-spiked) as a negative control (dark blue curve), NTC – non-template control (pink curve).
Doctoral dissertation Mila Đisalov 231 the commercial kit – 0.4 pg/µL (Graph 67, Section 4.2.4.2), while the LOD for Chelex 100 method was 4 pg/µL (Graph 62, Section 4.2.4.2). The reduced efficiency of the LAMP reaction when using eDNA from compost samples extracted using the Chelex 100 extraction method can be attributed to the fact that this material contains a large number of different substances known to inhibit enzyme-based DNA analyses, with humic acids being the most dominant (Reuter et al., 2009; Wnuk et al., 2020). On the other hand, the commercial kit used to compare the isolation efficiency (GenElute™ Soil DNA Isolation Kit) is adapted for difficult soil samples like compost and, as such, should remove all traces of humic acid using the provided Humic Acid Removal Column and the Organic Substance Removal (OSR) Solution. The next objective was to examine and compare the efficiency of the mentioned eDNA isolation methods by assessing the success of the Real Time LAMP reaction, depending on the method applied for sample preparation after sample inoculation with pure Trichoderma culture. The particular focus was on the Chelex 100 extraction method, for which, according to my best knowledge, there are no published studies on application for soil-like samples such as compost and casing soil. Since the Chelex 100 method optimized within this doctoral dissertation has previously proven to be simple, fast, and efficient for various food matrices, we decided it to be our method of choice for testing the efficiency in this experimental part. As mentioned before, commercial kits are adapted to the types of samples for which they are used, and it was expected that their efficiency would be higher compared to the robust Chelex 100 method. This was experimentally proven, taking into account that all eDNA extracts from soil-like samples obtained with the chosen commercial kit showed higher concentration values. Results of evaluation of the effect of eDNA extraction approach on Real Time LAMP reaction showed that in the case of casing soil samples, both extraction methods resulted in a positive LAMP reaction (Graphs 74 and 78, Section 4.2.5.1). On the other hand, in the case of compost samples, the results of the Real Time LAMP reaction showed that extraction with the commercial kit was more efficient (Graph 76, Section 4.2.5.1), which can be attributed to the high percentage of humic acid and other inhibitors present in this type of sample (Reuter et al., 2009; Wnuk et al., 2020). As mentioned above, soil-like samples are generally considered challenging to manipulate for downstream DNA analyses, as the efficiency of DNA extraction depends on the type of soil and its properties (Wydro, 2022). Considering that, it can be said that the experimentally confirmed application of the optimized in-field extraction method for eDNA from casing soil
Doctoral dissertation Mila Đisalov 232 samples is indeed a significant scientific contribution. Although there were no positive LAMP results in the case of eDNA from compost samples inoculated with Trichoderma culture isolated using the Chelex 100 method (Graph 72, Section 4.2.5.1), this method is considered to have great potential for further optimization of protocol for in-field application. This consideration is supported by the positive results obtained in the case of spiking compost extracts obtained by the same method with T. harzianum gDNA. Further optimization could imply a different approach for sample homogenization and/or the inclusion of an additional step to remove humic acid, all aimed at adapting it for full field application. 5.4.5 Trichoderma detection in real samples Currently, the most promising diagnostic tools for the early detection of various types of Trichoderma spp. in mushroom farming facilities are believed to be based on molecular methods (Šašić Zorić et al., 2023). DNA metabarcoding is known to be one of the most potent molecular methods for detection, as it enables the confirmation of the presence of all microorganisms even in complex samples (Reuter et al., 2009). However, this approach has some drawbacks, such as high time consumption (12–72 hours), the need for sophisticated equipment for its performance, and high costs of the analysis. Within this doctoral dissertation, we tested the previously developed LAMP method for Trichoderma spp. detection using real compost and casing soil samples collected during one cycle of organic mushroom growth, which are represented in Table 6 (Section 3.2.1). The results of Real Time LAMP testing of eDNA extracted from these samples (eDNA isolation using GenElute™ Soil DNA Isolation Kit) were then compared with the results obtained using the DNA metabarcoding approach, as well as with macroand microscopic analysis (Table 25, Section 4.2.7). Regardless of the type of sample and the cultivation phase in which the samples were collected, it was observed that the results of the tested molecular methods were in positive correlation in almost all samples, except in the case of P10. The observed pattern suggests that the negative Real Time LAMP reaction in P10 can be due to the insufficient amount of Trichodermaderived DNA in this sample. This hypothesis can also be applied to samples K1, P3, and K7#, where a positive Real Time LAMP reaction was not achieved in all tested repetitions (Table 26, Section 4.2.7). On the other hand, the exceptional sensitivity of DNA metabarcoding enables the detection of extremely small amounts of DNA fragments (Kredics et al., 2018), so it is not surprising that the reaction was positive when this method was applied to the same
Doctoral dissertation Mila Đisalov 233 samples. Additionally, the differing results of the Real Time LAMP reaction in the K7 and K7# samples suggest that as the quantity of Trichoderma spores increases within the same cultivation bag during champignon cultivation, the likelihood of detecting this pathogenic fungus also rises. Finally, in the case of K10# sample where Trichoderma spp. presence was confirmed by macroand microscopic analysis, molecular methods did not give positive results. This could be attributed to the fact that both tested molecular methods (DNA barcoding and Real Time LAMP) utilized the same eDNA samples for analysis, whereas a separate subsample was employed for microbiological cultivation, and to the assumption that Trichoderma spp. spores were not evenly distributed in the sample. Moreover, potential cross-contamination from handling during microbiological cultivation, along with the ease of spore spread, could also contribute to the observed patterns in the results for the K10# sample. When it comes to the samples tested using the Chelex 100 extraction method, there was no positive amplification (Graphs 88 and 90, Section 4.2.7), despite positive results obtained with casing soil samples spiked with Trichoderma culture. The lack of amplification might be due to using a different sub-sample for eDNA extraction than the one used for extraction with the kit. This further confirms the suggested hypothesis that the reason for variation between replicates, as well as for negative Real Time LAMP reactions in samples where sequencing showed the presence of Trichoderma, is an insufficient amount of Trichoderma-derived DNA, likely caused by the uneven distribution of Trichoderma spores. Despite the results obtained with real samples, we cannot reject the potency of the developed LAMP assay that is proven on spiked samples (Section 4.2.4). Additionally, results described in this doctoral dissertation represent only a proof of concept that requires further optimization. The next experimental steps would involve further work on sampling of compost and casing soil samples in nurseries to ensure a more representative analysis. Additionally, the Chelex 100 extraction method will be optimized, particularly for the more complex compost samples. 5.4.6 Comparative Analysis: Real Time LAMP vs. Real Time PCR Unfortunately, a comparative analysis of Real Time LAMP with Real Time PCR was not possible due to the unavailability of specific primers for Trichoderma spp. in the literature. Namely, when testing the PCR primers (TDF/TDR) described in the Lee et al., 2020, there was no amplification in the positive controls. Additionally, the F3 and B3 primers from the PC1 and PC2 primer sets were tested as PCR primer candidates. However, none of the candidates
Doctoral dissertation Mila Đisalov 234 showed adequate specificity, as amplification also occurred when testing other non-Trichoderma fungal species (Graphs 80-83, Section 4.2.6). 5.4.7 LAMP assay coupled with Gold Nanoparticles for Colorimetric Detection of Trichoderma spp. One of the goals of this doctoral dissertation was to explore innovative solutions for the detection of LAMP products. For these purposes, an assay based on the LAMP method in combination with gold nanoparticles (AuNPs) was developed. The assay principle relies on the strong tendency of oligonucleotides to adsorb onto the surface of AuNPs through electrostatic interactions, as described by Marin et al.(2021). Precisely, the adsorption of amplicons on AuNPs protects nanoparticles from salt-induced aggregation. Therefore, it was expected that with the addition of MgCl2, there would be no color change in the solution containing LAMP products (positive reactions). Conversely, AuNPs incubated with negative LAMP reaction (no amplicons) were expected to change color from red to violet, as a result of AuNP aggregation. The results of the assay specificity showed that only AuNPs incubated with positive LAMP reactions were not aggregated upon MgCl2 addition, in comparison with all tested negative controls (Figure 44, Section 4.2.8.1). This outcome was a result of the binding between LAMP amplicons and AuNPs. Furthermore, the results of the determination of the minimum amount of LAMP products detectable by the developed assay indicated that in the case of a positive LAMP reaction, the limit of detection (LOD) was 24 ng/µL, which can be observed by the naked eye (Figure 45, Section 4.2.8.1). At this amplicon dilution, there was a clear difference in absorption intensity at 630 nm between the positive LAMP reaction and all tested negative controls. The comparison of signal intensities at A630 revealed that distinguishing between positive and negative LAMP reactions directly in crude samples is not feasible and requires a tenfold dilution. This phenomenon can be attributed to the high concentration of reactants and primers in the LAMP reaction and master mix, which prevent salt-induced AuNPs aggregation. In diluted samples, the concentration of reagents and primers decreases, and AuNPs aggregation is solely controlled by the presence of amplicons. The results also indicate that the LAMPAuNPs assay was sensitive in solutions containing amplicons at concentrations ranging from 240 ng/µL to 24 ng/µL. However, additional dilution of samples significantly decreased the number of amplicons, making it impossible to suppress AuNP aggregation at the given salt concentration.
Doctoral dissertation Mila Đisalov 235 It is important to highlight that the suggested assay depends strongly on the size and shape of the AuNPs used, as it is based on salt-induced AuNPs aggregation (Marin et. al., 2021). Changing the type of AuNPs will require new optimization of salt concentration and reaction time to enable naked-eye detection. All in all, the developed LAMP-AuNP assay, resulting in a colorimetric signal, provides a simple and rapid mean of acquiring results independent of the number of samples present on the plate. The portability and naked-eye visualization of results may aid in the future development of a high-throughput, sensitive Trichoderma spp. detection directly at the farm. The test can be easily adapted for smartphone-based colorimetric analysis, as many phone applications are available that can image and analyze 96-well plates (such as the free app MyLight). 5.5 LAMP-based assay for E. coli detection in highly polluted water samples Contamination of water and food with fecal bacteria is a persistent problem with serious impacts on public health and the economy (Walker et al., 2019). Escherichia coli, a member of the fecal coliform subgroup, is commonly found in the intestines of both humans and animals, serving as a recognized indicator of fecal contamination. Early detection of such contamination remains a critical challenge in maintaining water quality globally. This is especially significant in countries like Serbia, which fall under the category of mediumdeveloped countries in terms of sewage infrastructure. In such countries, where wastewater facilities are lacking, it is crucial to address the issue of untreated wastewater flowing directly into rivers. This untreated wastewater can further serve as a contamination source in the food production chain (Baklan Green Energz news, 2022; Čista Srbija, 2022). The widely accepted standard for detecting fecal indicator bacteria (FIB) involves the use of conventional culture-based methods due to their cost-effectiveness and ease of use. However, these methods are time-consuming and can take several days for analysis. Molecular methods, primarily PCR and Real Time PCR techniques, have revolutionized microbiological analyses by reducing analysis time and increasing sensitivity and specificity. Furthermore, PCR methods have drawbacks including sensitivity to reaction contaminants common in water samples, which can interfere with the reaction, and their limited application for pathogen detection beyond laboratory settings. LAMP, on the other hand, has significantly decreased the reaction's
Doctoral dissertation Mila Đisalov 236 susceptibility to inhibitors commonly found in environmental samples and holds potential for further optimization for PoN applications (Moehling et al., 2021). As timely assessment of water quality is imperative in waterborne pathogen control, the focus of this doctoral dissertation was to demonstrate the feasibility of detecting E. coli using the LAMP assay, even in highly polluted water samples. 5.5.1 Optimization of syringe filter-based DNA extraction method The detection of pathogens using described molecular methods relies on eDNA extracted from environmental samples and is contingent upon the efficiency of the extraction process. Extracting eDNA from environmental water samples can pose significant challenges, primarily attributed to filter clogging during the filtration step (Takasaki et al., 2021). Moreover, the presence of various substances in environmental samples can lead to low purity and extremely low DNA yields, thereby impeding the molecular detection of pathogens in water samples. This is documented by numerous references in the scientific literature (Goldberg et al., 2016; Hunter et al., 2019; Tsuji et al., 2019; Bairoliya et al., 2022). Multiple commercially available DNA extraction kits have been utilized for collecting eDNA from water samples, and according to available studies, the most commonly employed method involves a filtration-based approach, followed by extraction and purification using either the DNeasy Blood and Tissue DNA Extraction Kit (Qiagen, Hilden, Germany) or the PowerWater DNA Extraction Kit (Qiagen) (Tsuji et al., 2019). However, the use of these kits can be limited by their high cost and the need for sterile laboratory conditions. To achieve a cost-effective and rapid application, optimizing traditional syringe-based eDNA extraction methodologies is a viable option. Acknowledging all the challenges encountered during extraction, and with the aim of developing a fast and simple methodology that could be further optimized for field application, the primary focus of this doctoral dissertation was the modification of the protocol outlined in Kesberg and Schleheck (2013) for sample preparation, purification, and DNA extraction taking a step forward towards its applicability in the field. Results showed that introduction of the modification in the pre-filtration step prevented significant impurities in the final extract using 10 μm pore size filters, followed by filtration through 0.45 μm pore size filters to concentrate bacterial cells. Additionally, in comparison with the original protocol described by Kesberg and Schleheck (2013) and the modified one by
Doctoral dissertation Mila Đisalov 237 Lee et al., (2019) extraction flow described within this doctoral theses includes only one incubation step at 65°C after the addition of TPS buffer, significantly contributing to a shortened overall analysis time (Figure 27, Section 3.3.3.2). Specifically, the protocol developed in this research requires approximately 45 minutes for all DNA extraction steps, including pre-filtration. In the protocol delineated by Kesberg and Schleheck (2013), the DNA extraction process requires 4 hours for completion, with a hands-on time of approximately 2 hours. On the other hand, in the modified protocol described by Lee et al. (2019), reaction time was reduced by up to 30 minutes. However, this research group conducted LAMP detection of target bacteria using artificially contaminated water samples, which neglects any potential influence of bacteria already present in the water on the measured concentration of isolated eDNA. This makes it challenging to establish a direct correlation between colony-forming units (CFU) and the concentration of the targeted bacterial DNA. Furthermore, to ensure the purity of the DNA samples, three additional washing steps were introduced into the extraction process. The DNA yield obtained in this study (ranging from 17.36 to 22.12 ng/μL) (Table 28, Section 4.3.1.2) falls within the range reported in Kesberg and Schleheck (2013) (10–80 ng/μL) and Lee et. al. (2019) (~20 ng/μL), while the purity, as measured by optical density ratios (OD260/280), was only slightly lower. However, this minor variance may be attributed to the utilization of highly polluted water samples in our study. 5.5.2 E. coli detection in real samples Numerous studies have explored the use of LAMP for detecting bacterial DNA in water samples (Martzy et al., 2017; Lee et al., 2019; Fu et al., 2021; Khodaparast et al., 2022). For instance, Lee et al. (2019) described their use of LAMP to detect target bacteria in artificially contaminated water samples. Nevertheless, using spiked samples disregards potential influences of bacteria already present in the water on the measured concentration of isolated DNA, thus complicating the establishment of a direct correlation between colony forming units (CFU) and the concentration of the targeted bacterial DNA. Conversely, various studies have described the application of LAMP with real, non-spiked water samples. However, the majority of these studies rely on expensive commercial DNA extraction kits, which are highly dependent on laboratory working conditions (Martzy et al., 2017; Fu et al., 2021). In the research conducted within this doctoral dissertation, raw, highly polluted water samples directly collected from the Danube River were used for all types of analyses. The samples were collected from three sampling points at and upstream of the place where the wastewater
Doctoral dissertation Mila Đisalov 238 (sewage) is being discharged to the Danube River in Novi Sad, Serbia. While the number of samples utilized was adequate for evaluation at a proof-of-principle level, optimizing for a point-of-need (PoN) application would require conducting measurements on a larger number of samples and various sample/water types with differing levels of contamination. Further, culture plating on selective media confirmed the presence of coliform bacteria, including E. coli, in the analyzed samples (Figure 46, Section 4.3.3). The results revealed that E. coli was present in samples from all three sites at concentrations high enough to be detected by conventional microbiological techniques. As predicted, the samples taken upstream of the S2 point exhibited a notably lower count of contaminating bacteria, providing an optimal setting for comparing the sensitivities of the three molecular techniques: Real Time LAMP, Colorimetric LAMP and Real Time PCR. After microbiological confirmation of the E. coli presence in tested water samples, the next step included comparison of E. coli detection using Real Time PCR with two different LAMP approaches, Real Time and Colorimetric which yielded positive applications in S1 and S2 samples (Graphs 92–93 and Figure 47, Section 4.3.3). In the case of Real Time PCR, the results indicated that the only positive reaction originated from testing the control sample, which comprised purified DNA from the reference E. coli culture (Graph 94, Section 4.3.4). The lack of amplification in the tested environmental samples may potentially be attributed to the presence of common inhibitors such as fulvic acids, humic acids, humic material, metal ions, and polyphenols, which are prevalent in highly polluted environmental water samples (Ijzerman et al., 1997). Specifically, measurements of OD260/280 in all tested samples was around 1.25, which possibly can be related to high level of polyphenols present in environmental water samples (Schrader et al., 2012). As mentioned before, E. coli is the most frequently used indicator among fecal coliforms and is the dominant fecal coliform species isolated from water, accounting for over 95% of FIB in the samples (Bartram et al., 1996; Li et al., 2021). However, fecal coliforms are just part of a total bacterial diversity present in environmental water samples, therefore the proportion of extracted DNA that originated from E. coli in total eDNA isolate might be considerably lower than the overall eDNA amount detected. Such small amounts of DNA could be below the Real Time PCR detection limit. On the other hand, numerous publications have demonstrated that the LAMP assay is resistant to PCR inhibitors commonly present in complex samples like blood and environmental samples (Lin et al., 2012; Mori et al., 2013b; Wang et al., 2013). The results obtained from testing both
Doctoral dissertation Mila Đisalov 239 LAMP approaches (Colorimetric and Real Time) provide additional evidence supporting this conclusion, since they clearly demonstrated the presence of E. coli in samples S1 and S2. However, no amplification was observed in sample S3. Although the eDNA concentration of all three samples used in this study was in the similar range (17.36 ng/µL for S1, 17.67 ng/µL for S2, and 22.12 ng/µL for S3), the previous microbiological analysis revealed a significant difference in E. coli CFU/mL in these samples. The S3 sample exhibited the highest concentration of DNA, however, microbiological analysis revealed a lower presence of E. coli in comparison to other coliforms. This implies that the DNA present in the S3 sample might have come from other bacterial species, which could account for the negative LAMP reactions. Nevertheless, LAMP successfully amplified the S1 and S2 samples, which Real Time PCR failed to amplify. The importance of monitoring water quality to prevent the transmission of waterborne pathogens and identifying potential sources of contamination to protect public health is underscored by the findings from this doctoral dissertation. The dissertation also highlights the limitations of standard Real Time PCR-based protocols for FIB detection, which are highly sensitive to reaction inhibitors often present in eDNA from highly polluted water samples, indicating the need for alternative approaches. Given its effectiveness in overcoming PCR inhibitors in highly polluted water samples, and based on the results obtained, LAMP-based FIB detection should be considered the preferred method for samples where the presence of inhibitors could influence the results. The samples utilized in this study exemplify this situation well. The direct discharge of sewage water into the Danube leads to significant pollution of the river water and a high probability of PCR inhibitors, which are challenging to completely remove during DNA extraction. If FIB detection will be conducted using Real Time PCR, additional optimizations of eDNA extraction are advised. Alternatively, the application of the LAMP methodology and the design of LAMP primers for various bacterial targets should be taken into consideration.
Doctoral dissertation Mila Đisalov 240 6. Conclusions
Doctoral dissertation Mila Đisalov 247 Djisalov, M., Knežić T., Janjušević Lj., Popović Ž., Kosijer P., Gadjanski I., 2021. Trendovi u molekularnoj biologiji: Izotermalna amplifikacija posredovana petljom (LAMP) kao metoda za terensku detekciju SARS-CoV-2 virusa. Institut za molekularnu genetiku I genetičko inženjerstvo, Beograd, Srbija. 21-31. Djisalov, M., Janjušević, Lj., Léguillier, V., Šašić Zorić, Lj., Farre, C., Anba-Mondoloni, J., Vidic, J., Gadjanski, I., 2024. Loop-mediated isothermal amplification (LAMP) assay coupled with gold nanoparticles for colorimetric detection of Trichoderma spp. in Agaricus bisporus cultivation substrates. Sci Rep 14, 15539. https://doi.org/10.1038/s41598-024-65971-9. Dong, D., Liu, W., Li, H., Wang, Y., Li, X., Zou, D., Yang, Z., Huang, S., Zhou, D., Huang, L., Yuan, J. 2015. Survey and rapid detection of Klebsiella pneumoniae in clinical samples targeting the rcsA gene in Beijing, China. Front. Microbiol. 6:519. https://doi.org/10.3389/fmicb.2015.00519. Dorr, E., Koegler, M., Gabrielle, B., Aubry, C., 2021. Life cycle assessment of a circular, urban mushroom farm. J. Clean. Prod. 288, 125668. https://doi.org/10.1016/j.jclepro.2020.125668 Dragan, A.I., Casas-Finet, J.R., Bishop, E.S., Strouse, R.J., Schenerman, M.A., Geddes, C.D., 2010. Characterization of PicoGreen Interaction with dsDNA and the Origin of Its Fluorescence Enhancement upon Binding. Biophys. J. 99, 3010–3019. https://doi.org/10.1016/j.bpj.2010.09.012 Edberg, S.C., Rice, E.W., Karlin, R.J., Allen, M.J., 2000. Escherichia coli: the best biological drinking water indicator for public health protection. Symp. Ser. Soc. Appl. Microbiol. 106S-116S. https://doi.org/10.1111/j.1365-2672.2000.tb05338.x Eiken Chemical Co. Ltd., 2005. The principle of LAMP method [WWW Document]. URL http://loopamp.eiken.co.jp/e/lamp/primer.html (accessed 6.8.24). El-Kholy, A., Abdelrahman, K., Soliman, H., 2014. Rapid detection of BoHV-1 genomic DNA by Loop-Mediated Isothermal Amplification assay. J. Virol. Methods 204. https://doi.org/10.1016/j.jviromet.2014.04.011 El-Sayed, W.S., Ouf, S.A., Mohamed, A.-A.H., 2015. Deterioration to extinction of wastewater bacteria by non-thermal atmospheric pressure air plasma as assessed by 16S rDNADGGE fingerprinting. Front. Microbiol. 6, 1098. https://doi.org/10.3389/fmicb.2015.01098
Doctoral dissertation Mila Đisalov 248 Filion, M., St-Arnaud, M., Jabaji-Hare, S.H., 2003. Direct quantification of fungal DNA from soil substrate using real-time PCR. J. Microbiol. Methods 53, 67–76. https://doi.org/10.1016/S0167-7012(02)00225-7 Fischbach, J., Xander, N.C., Frohme, M., Glökler, J.F., 2015. Shining a light on LAMP assays- -a comparison of LAMP visualization methods including the novel use of berberine. BioTechniques 58, 189–194. https://doi.org/10.2144/000114275 Food and Agriculture Organization of the United Nation, World Health Organization, 2019. Safety and Quality of Water Used in Food Production and Processing. FAO and WHO. https://doi.org/10.4060/CA6062EN Food and Agriculture Organization of the United Nations, 2023. One Health [WWW Document]. One Health. URL https://www.fao.org/one-health/en (accessed 6.5.24). Food Safety and Inspection Service US Department of Agriculture, n.d. E. coli O103 Outbreak Linked to Ground Beef - Outbreak Investigation After-Action Review, Report 201907. Fu, J., Chiang, E.L.C., Medriano, C.A.D., Li, L., Bae, S., 2021. Rapid quantification of fecal indicator bacteria in water using the most probable number - loop-mediated isothermal amplification (MPN-LAMP) approach on a polymethyl methacrylate (PMMA) microchip. Water Res. 199, 117172. https://doi.org/10.1016/j.watres.2021.117172 Fung, F., Wang, H.-S., Menon, S., 2018. Food safety in the 21st century. Biomed. J. 41, 88– 95. https://doi.org/10.1016/j.bj.2018.03.003 Gabor, E.M., de Vries, E.J., Janssen, D.B., 2003. Efficient recovery of environmental DNA for expression cloning by indirect extraction methods. FEMS Microbiol. Ecol. 44, 153– 163. https://doi.org/10.1016/S0168-6496(02)00462-2 Gao, R., Liao, X., Zhao, X., Liu, D., Ding, T., 2021. The diagnostic tools for viable but nonculturable pathogens in the food industry: Current status and future prospects. Compr. Rev. Food Sci. Food Saf. 20, 2146–2175. https://doi.org/10.1111/15414337.12695 Gard, D.L., 2002. Chapter 10 - Confocal Fluorescence Microscopy of the Cytoskeleton of Amphibian Oocytes and Embryos, in: Matsumoto, B. (Ed.), Methods in Cell Biology, Cell Biological Applications of Confocal Microscopy. Academic Press, pp. 379–416. https://doi.org/10.1016/S0091-679X(02)70011-3 Gautam, A., 2022. DNA Isolation by Chelex Method, in: Gautam, A. (Ed.), DNA and RNA Isolation Techniques for Non-Experts. Springer International Publishing, Cham, pp. 79–84. https://doi.org/10.1007/978-3-030-94230-4_10
Doctoral dissertation Mila Đisalov 249 Ghasemian, M., Gharavi, M.J., Akhlaghi, L., Mohebali, M., Meamar, A.R., Aryan, E., Oormazdi, H., 2014. Development and Assessment of Loop-Mediated Isothermal Amplification (LAMP) Assay for the Diagnosis of Human Visceral Leishmaniasis in Iran. Iran. J. Parasitol. 9, 50–59. Ghiaie Asl, I., Motamedi, M., Shokuhi, G., Jalalizand, N., Farhang, A., Mirhendi, H., 2017. Molecular characterization of environmental Cladosporium species isolated from Iran. Curr. Med. Mycol. 3, 1–5. https://doi.org/10.29252/cmm.3.1.1 Goldberg, C.S., Turner, C.R., Deiner, K., Klymus, K.E., Thomsen, P.F., Murphy, M.A., Spear, S.F., McKee, A., Oyler‐McCance, S.J., Cornman, R.S., Laramie, M.B., Mahon, A.R., Lance, R.F., Pilliod, D.S., Strickler, K.M., Waits, L.P., Fremier, A.K., Takahara, T., Herder, J.E., Taberlet, P., 2016. Critical considerations for the application of environmental DNA methods to detect aquatic species. https://doi.org/10.25607/OBP199 Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K.-I., 2009. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques 46, 167–172. https://doi.org/10.2144/000113072 Gu, H., Cai, Q., Dai, X., Wang, H., Xu, W., Cao, X., Ye, Y., 2022. A case report of Klebsiella aerogenes-caused lumbar spine infection identified by metagenome next-generation sequencing. BMC Infect. Dis. 22, 616. https://doi.org/10.1186/s12879-022-07583-0 Gundogan, N., 2014. Klebsiella, in: Batt, C.A., Tortorello, M.L. (Eds.), Encyclopedia of Food Microbiology (Second Edition). Academic Press, Oxford, pp. 383–388. https://doi.org/10.1016/B978-0-12-384730-0.00172-5 Hill, J., Beriwal, S., Chandra, I., Paul, V., Kapil, A., Singh, T., Wadowsky, R., Singh, V., Goyal, A., Jahnukainen, T., Johnson, J., Tarr, P., Vats, A., 2008. Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Common Strains of Escherichia coli. J. Clin. Microbiol. 46, 2800–4. https://doi.org/10.1128/JCM.00152-08 Hunter, M.E., Ferrante, J.A., Meigs-Friend, G., Ulmer, A., 2019. Improving eDNA yield and inhibitor reduction through increased water volumes and multi-filter isolation techniques. Sci. Rep. 9, 5259. https://doi.org/10.1038/s41598-019-40977-w Ijzerman, M.M., Dahling, D.R., Fout, G.S., 1997. A method to remove environmental inhibitors prior to the detection of waterborne enteric viruses by reverse transcriptionpolymerase chain reaction. J. Virol. Methods 63, 145–153. https://doi.org/10.1016/s0166-0934(96)02123-4
Doctoral dissertation Mila Đisalov 250 Iqbal, B.N., Arunasalam, S., Divarathna, M.V.M., Jabeer, A., Sirisena, P., Senaratne, T., Muthugala, R., Noordeen, F., 2022. Diagnostic utility and validation of a newly developed real time loop mediated isothermal amplification method for the detection of SARS CoV-2 infection. J. Clin. Virol. Plus 2, 100081. https://doi.org/10.1016/j.jcvp.2022.100081 Jindo, K., Evenhuis, A., Kempenaar, C., Pombo Sudré, C., Zhan, X., Goitom Teklu, M., Kessel, G., 2021. Review: Holistic pest management against early blight disease towards sustainable agriculture. Pest Manag. Sci. 77, 3871–3880. https://doi.org/10.1002/ps.6320 Jung, J., Schaffner, D.W., 2021. Quantification of Survival and Transfer of Salmonella on Fresh Cucumbers during Waxing. J. Food Prot. 84, 456–462. https://doi.org/10.4315/JFP-20-375 Kamio, K., Espinoza, J.L., 2022. The Predominance of Klebsiella aerogenes among Carbapenem-Resistant Enterobacteriaceae Infections in Japan. Pathogens 11, 722. https://doi.org/10.3390/pathogens11070722 Kertesz, M.A., Thai, M., 2018. Compost bacteria and fungi that influence growth and development of Agaricus bisporus and other commercial mushrooms. Appl. Microbiol. Biotechnol. 102, 1639–1650. https://doi.org/10.1007/s00253-018-8777-z Kesberg, A.I., Schleheck, D., 2013. Improved protocol for recovery of bacterial DNA from water filters: Sonication and backflushing of commercial syringe filters. J. Microbiol. Methods 93, 55–57. https://doi.org/10.1016/j.mimet.2013.02.001 Khodaparast, M., Sharley, D., Best, N., Marshall, S., Beddoe, T., 2022. In-field LAMP assay for rapid detection of human faecal contamination in environmental water. Environ. Sci. Water Res. Technol. 8, 2641–2651. https://doi.org/10.1039/D2EW00433J Kirschner, A.K.T., Kavka, G.G., Velimirov, B., Mach, R.L., Sommer, R., Farnleitner, A.H., 2009. Microbiological water quality along the Danube River: integrating data from two whole-river surveys and a transnational monitoring network. Water Res. 43, 3673– 3684. https://doi.org/10.1016/j.watres.2009.05.034 Kralik, P., Ricchi, M., 2017. A Basic Guide to Real Time PCR in Microbial Diagnostics: Definitions, Parameters, and Everything. Front. Microbiol. 8. Kredics, L., Chen, L., Kedves, O., Büchner, R., Hatvani, L., Allaga, H., Nagy, V.D., Khaled, J.M., Alharbi, N.S., Vágvölgyi, C., 2018. Molecular Tools for Monitoring Trichoderma in Agricultural Environments. Front. Microbiol. 9. https://doi.org/10.3389/fmicb.2018.01599
Doctoral dissertation Mila Đisalov 251 Lakshmi, B.A., Kim, S., 2021. Recent trends in the utilization of LAMP for the diagnosis of viruses, bacteria, and allergens in food. Recent Dev. Appl. Microbiol. Biochem. 291– 297. https://doi.org/10.1016/B978-0-12-821406-0.00027-8 Land, K. J., Boeras, D. I., Chen, X. S., Ramsay, A. R., Peeling, R. W., 2019. REASSURED diagnostics to inform disease control strategies, strengthen health systems and improve patient outcomes. Nat Microbiol 4, 46–54. https://doi.org/10.1038/s41564-018-0295-3 Latgé, J.-P., Chamilos, G., 2019. Aspergillus fumigatus and Aspergillosis in 2019. Clin. Microbiol. Rev. https://doi.org/10.1128/cmr.00140-18 Law, J.W.-F., Ab Mutalib, N.-S., Chan, K.-G., Lee, L.-H., 2015. Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations. Front. Microbiol. 5. Lee, S., Khoo, V.S.L., Medriano, C.A.D., Lee, T., Park, S.-Y., Bae, S., 2019. Rapid and in-situ detection of fecal indicator bacteria in water using simple DNA extraction and portable loop-mediated isothermal amplification (LAMP) PCR methods. Water Res. 160, 371– 379. https://doi.org/10.1016/j.watres.2019.05.049 Lee, S.H., Jung, H.J., Hong, S.-B., Choi, J.I., Ryu, J.-S., 2020. Molecular Markers for Detecting a Wide Range of Trichoderma spp. that Might Potentially Cause Green Mold in Pleurotus eryngii. Mycobiology 48, 313–320. https://doi.org/10.1080/12298093.2020.1785754 Li, B., Du, J., Lan, C., Liu, P., Weng, Q., Chen, Q., 2013. Development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of Fusarium oxysporum f. sp. cubense race 4. Eur. J. Plant Pathol. 135, 903–911. https://doi.org/10.1007/s10658-012-0136-9 Li, E., Saleem, F., Edge, T.A., Schellhorn, H.E., 2021. Biological Indicators for Fecal Pollution Detection and Source Tracking: A Review. Processes 9, 2058. https://doi.org/10.3390/pr9112058 Li, P., A.A., A., Kalendar, R., Abeldenov, S., Khassenov, B., 2017. Cloning and purification of large fragment of DNA polymerase I from Geobacillus stearothermophilus and it’s application in isothermal DNA amplification. Biotechnol. Theory Pract. https://doi.org/10.11134/btp.1.2017.6 Li, X., Zhang, X., Shi, X., Shi, H., Wang, Z., Peng, C., 2022. Review in isothermal amplification technology in food microbiological detection. Food Sci. Biotechnol. 31, 1501–1511. https://doi.org/10.1007/s10068-022-01160-6
Doctoral dissertation Mila Đisalov 252 Lin, Z., Zhang, Y., Zhang, H., Zhou, Y., Cao, J., Zhou, J., 2012. Comparison of loop-mediated isothermal amplification (LAMP) and real-time PCR method targeting a 529-bp repeat element for diagnosis of toxoplasmosis. Vet. Parasitol. 185, 296–300. https://doi.org/10.1016/j.vetpar.2011.10.016 Linderhof, V., de Lange, T., Reinhard, S., 2021. The Dilemmas of Water Quality and Food Security Interactions in Lowand Middle-Income Countries. Front. Water 3. https://doi.org/10.3389/frwa.2021.736760 Lucchi, N.W., Ljolje, D., Silva-Flannery, L., Udhayakumar, V., 2016. Use of Malachite GreenLoop Mediated Isothermal Amplification for Detection of Plasmodium spp. Parasites. PLOS ONE 11, e0151437. https://doi.org/10.1371/journal.pone.0151437 Maeda, K., Hanajima, D., Toyoda, S., Yoshida, N., Morioka, R., Osada, T., 2011. Microbiology of nitrogen cycle in animal manure compost. Microb Biotechnol. 4(6):700-9. https://doi.org/10.1111/j.1751-7915.2010.00236.x Marin, M., Nikolic, M.V., Vidic, J., 2021. Rapid point-of-need detection of bacteria and their toxins in food using gold nanoparticles. Compr. Rev. Food Sci. Food Saf. 20, 5880– 5900. https://doi.org/10.1111/1541-4337.12839 Marshall, E., 2009. Make Money by Growing Mushrooms. Food and Agriculture Organisation. Livelihood Diversification Booklet, No 7. (2009). Martín-Ramírez, A., Lanza, M., Hisam, S., Perez-Ayala, A., Rubio, J.M., 2022. Usefulness of a commercial LAMP assay for detection of malaria infection, including Plasmodium knowlesi cases, in returning travelers in Spain. BMC Res. Notes 15, 147. https://doi.org/10.1186/s13104-022-06037-9 Martínez, F.N., Federici, F., 2022. Colorimetric LAMP/RT-LAMP Protocol. Martzy, R., Kolm, C., Brunner, K., Mach, R.L., Krska, R., Šinkovec, H., Sommer, R., Farnleitner, A.H., Reischer, G.H., 2017. A loop-mediated isothermal amplification (LAMP) assay for the rapid detection of Enterococcus spp. in water. Water Res. 122, 62–69. https://doi.org/10.1016/j.watres.2017.05.023 Mazziotti, M., Henry, S., Laval-Gilly, P., Bonnefoy, A., Falla, J., 2018. Comparison of two bacterial DNA extraction methods from non-polluted and polluted soils. Folia Microbiol. (Praha) 63, 85–92. https://doi.org/10.1007/s12223-017-0530-y McGee, C.F., 2018. Microbial ecology of the Agaricus bisporus mushroom cropping process. Appl. Microbiol. Biotechnol. 102, 1075–1083. https://doi.org/10.1007/s00253-0178683-9
Doctoral dissertation Mila Đisalov 253 Meyer, W., Irinyi, L., Hoang, M. T. V., Robert, V., Garcia-Hermoso, D., Desnos-Ollivier, M., Yurayart, C., Tsang, C. C., Lee, C. Y., Woo, P. C. Y., Pchelin, I. M., Uhrlaß, S., Nenoff, P., Chindamporn, A., Chen, S., Hebert, P. D. N., Sorrell, T. C., 2019. Database establishment for the secondary fungal DNA barcode translational elongation factor 1α (TEF1α). Genome. 62(3):160-169. https://doi.org/10.1139/gen-2018-0083 Miró, E., Alonso, C., Navarro, F., Mirelis, B., Prats, G., 1995. [Resistance to imipenem in Enterobacter aerogenes]. Enferm. Infecc. Microbiol. Clin. 13, 278–282. Miyazaki, K., Tsuchiya, Y., Okuda, T., 2009. Specific PCR assays for the detection of Trichoderma harzianum causing green mold disease during mushroom cultivation. Mycoscience 50, 94–99. https://doi.org/10.1007/S10267-008-0460-2 Moehling, T.J., Choi, G., Dugan, L.C., Salit, M., Meagher, R.J., 2021. LAMP Diagnostics at the Point-of-Care: Emerging Trends and Perspectives for the Developer Community. Expert Rev. Mol. Diagn. 21, 43–61. https://doi.org/10.1080/14737159.2021.1873769 Moreno, I., Cicinelli, E., Garcia-Grau, I., Gonzalez-Monfort, M., Bau, D., Vilella, F., De Ziegler, D., Resta, L., Valbuena, D., Simon, C., 2018. The diagnosis of chronic endometritis in infertile asymptomatic women: a comparative study of histology, microbial cultures, hysteroscopy, and molecular microbiology. Am. J. Obstet. Gynecol. 218, 602.e1-602.e16. https://doi.org/10.1016/j.ajog.2018.02.012 Mori, Y., Kanda, H., Notomi, T., 2013a. Loop-mediated isothermal amplification (LAMP): recent progress in research and development. J. Infect. Chemother. 19, 404–411. https://doi.org/10.1007/s10156-013-0590-0 Mori, Y., Kanda, H., Notomi, T., 2013b. Loop-mediated isothermal amplification (LAMP): recent progress in research and development. J. Infect. Chemother. Off. J. Jpn. Soc. Chemother. 19, 404–411. https://doi.org/10.1007/s10156-013-0590-0 Mori, Y., Kitao, M., Tomita, N., Notomi, T., 2004. Real-time turbidimetry of LAMP reaction for quantifying template DNA. J. Biochem. Biophys. Methods 59, 145–157. https://doi.org/10.1016/j.jbbm.2003.12.005 Mori, Y., Nagamine, K., Tomita, N., Notomi, T., 2001. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res. Commun. 289, 150–154. https://doi.org/10.1006/bbrc.2001.5921 National Institute of Justice, 2023. DNA Extraction and Quantitation for Forensic Analysts [WWW Document]. URL https://nij.ojp.gov/nij-hosted-online-training-courses/dna-
Doctoral dissertation Mila Đisalov 254 extraction-and-quantitation-forensic-analysts/chelexr-100-extraction/chelexr-100extraction-process (accessed 6.7.24). Nazar, R.N., Robb, E.J., Volossiouk, T., 1996. Direct extraction of fungal DNA from soil, in: Akkermans, A.D.L., Van Elsas, J.D., De Bruijn, F.J. (Eds.), Molecular Microbial Ecology Manual. Springer Netherlands, Dordrecht, pp. 1–8. https://doi.org/10.1007/978-94-009-0215-2_1 Nehra, M., Kumar, V., Kumar, R., Dilbaghi, N., Kumar, S., 2022. Current Scenario of Pathogen Detection Techniques in Agro-Food Sector. Biosensors 12, 489. https://doi.org/10.3390/bios12070489 Niessen, L., Vogel, R.F., 2010. Detection of Fusarium graminearum DNA using a loopmediated isothermal amplification (LAMP) assay. Int. J. Food Microbiol. 140, 183– 191. https://doi.org/10.1016/j.ijfoodmicro.2010.03.036 Niu, L., Zhao, F., Chen, J., Nong, J., Wang, C., Wang, J., Gao, N., Zhu, X., Wu, L., Hu, S., 2018. Isothermal amplification and rapid detection of Klebsiella pneumoniae based on the multiple cross displacement amplification (MCDA) and gold nanoparticle lateral flow biosensor (LFB). PLOS ONE 13, e0204332. https://doi.org/10.1371/journal.pone.0204332 Nnachi, R.C., Sui, N., Ke, B., Luo, Z., Bhalla, N., He, D., Yang, Z., 2022. Biosensors for rapid detection of bacterial pathogens in water, food and environment. Environ. Int. 166, 107357. https://doi.org/10.1016/j.envint.2022.107357 Node, J., Scherer, E., Millon, L., Bellanger, A.P., 2024. Commercial loop-mediated isothermal amplification (LAMP) assay for rapid diagnosis of Pneumocystis pneumonia: An alternative to immunofluorescence assays. J. Med. Mycol. 34, 101508. https://doi.org/10.1016/j.mycmed.2024.101508 Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, e63. https://doi.org/10.1093/nar/28.12.e63 Okuda, Y., 2022. Sustainability perspectives for future continuity of mushroom production: The bright and dark sides. Front. Sustain. Food Syst. 6. https://doi.org/10.3389/fsufs.2022.1026508 Oliver, J.D., 2010. Recent findings on the viable but nonculturable state in pathogenic bacteria. FEMS Microbiol. Rev. 34, 415–425. https://doi.org/10.1111/j.15746976.2009.00200.x
Doctoral dissertation Mila Đisalov 255 Pang, B., Yao, S., Xu, K., Wang, J., Song, X., Mu, Y., Zhao, C., Li, J., 2019. A novel visualmixed-dye for LAMP and its application in the detection of foodborne pathogens. Anal. Biochem. 574, 1–6. https://doi.org/10.1016/j.ab.2019.03.002 Panno, S., Matić, S., Tiberini, A., Caruso, A.G., Bella, P., Torta, L., Stassi, R., Davino, S., 2020. Loop Mediated Isothermal Amplification: Principles and Applications in Plant Virology. Plants 9, 461. https://doi.org/10.3390/plants9040461 Parida, M., S R, S., Dash, P., Tripathi, N., Saxena, P., Shrivastava, A., Sahni, A., Rao, P.V.L., Morita, K., 2006. Development and Evaluation of Reverse Transcription-LoopMediated Isothermal Amplification Assay for Rapid and Real-Time Detection of Japanese Encephalitis Virus. J. Clin. Microbiol. 44, 4172–8. https://doi.org/10.1128/JCM.01487-06 Park, J.-W., 2022. Principles and Applications of Loop-Mediated Isothermal Amplification to Point-of-Care Tests. Biosensors 12, 857. https://doi.org/10.3390/bios12100857 Park, M.S., Lee, J.W., Kim, S.H., Park, J.-H., You, Y.-H., Lim, Y.W., n.d. Penicillium from Rhizosphere Soil in Terrestrial and Coastal Environments in South Korea. Mycobiology 48, 431–442. https://doi.org/10.1080/12298093.2020.1823611 Pavlíková, D., Zemanová, V., Pavlík, M., 2023. Health Risk and Quality Assessment of Vegetables Cultivated on Soils from a Heavily Polluted Old Mining Area. Toxics.,11(7):583. https://doi.org/10.3390/toxics11070583. Perrone, G., Susca, A., Cozzi, G., Ehrlich, K., Varga, J., Frisvad, J.C., Meijer, M., Noonim, P., Mahakarnchanakul, W., Samson, R.A., 2007. Biodiversity of Aspergillus species in some important agricultural products. Stud. Mycol. 59, 53–66. https://doi.org/10.3114/sim.2007.59.07 Poirier, A.C., Kuang, D., Siedler, B.S., Borah, K., Mehat, J.W., Liu, J., Tai, C., Wang, X., van Vliet, A.H.M., Ma, W., Jenkins, D.R., Clark, J., La Ragione, R.M., Qu, J., McFadden, J., 2021. Development of Loop-Mediated Isothermal Amplification Rapid Diagnostic Assays for the Detection of Klebsiella pneumoniae and Carbapenemase Genes in Clinical Samples. Front. Mol. Biosci. 8, 794961. https://doi.org/10.3389/fmolb.2021.794961 Poole, C.B., Li, Z., Alhassan, A., Guelig, D., Diesburg, S., Tanner, N.A., Zhang, Y., Jr, T.C.E., LaBarre, P., Wanji, S., Burton, R.A., Carlow, C.K.S., 2017. Colorimetric tests for diagnosis of filarial infection and vector surveillance using non-instrumented nucleic acid loop-mediated isothermal amplification (NINA-LAMP). PLOS ONE 12, e0169011. https://doi.org/10.1371/journal.pone.0169011
Doctoral dissertation Mila Đisalov 256 Prajapati, S., Kumar, V., Rawat, D., Singh, S., Saroj, D., Ravikant, Verma, S., 2023. Mushroom Cultivation: A Sustainable Approach to Future Agriculture to Ensure Quality Food and Nutritional Security of the Current Population in India. Int. J. Multidiscip. Res. Growth Eval. 4, 697–705. Quintela Baluja, M., Böhme, K., Fernández-No, I., Alnakip, M., Caamaño, Barros-Velázquez, J., Calo-Mata, P., 2014. MALDI-TOF Mass Spectrometry, a Rapid and Reliable Method for the Identification of Bacterial Species in Food-Microbiology Laboratories. pp. 353–385. https://doi.org/10.13140/2.1.2605.9041 Quoc, N.B., Phuong, N.D.N., Chau, N.N.B., Linh, D.T.P., 2018. Closed tube loop-mediated isothermal amplification assay for rapid detection of hepatitis B virus in human blood. Heliyon 4. https://doi.org/10.1016/j.heliyon.2018.e00561 Quyen, T.L., Ngo, T.A., Bang, D.D., Madsen, M., Wolff, A., 2019a. Classification of Multiple DNA Dyes Based on Inhibition Effects on Real-Time Loop-Mediated Isothermal Amplification (LAMP): Prospect for Point of Care Setting. Front. Microbiol. 10, 2234. https://doi.org/10.3389/fmicb.2019.02234 Quyen, T.L., Nordentoft, S., Vinayaka, A.C., Ngo, T.A., Engelsmenn, P., Sun, Y., Madsen, M., Bang, D.D., Wolff, A., 2019b. A Sensitive, Specific and Simple Loop Mediated Isothermal Amplification Method for Rapid Detection of Campylobacter spp. in Broiler Production. Front. Microbiol. 10. Reeleder, R.D., Capell, B.B., Tomlinson, L.D., Hickey, W.J., 2003. The extraction of fungal DNA from multiple large soil samples. Can. J. Plant Pathol. 25, 182–191. https://doi.org/10.1080/07060660309507067 Reuter, T., Xu, W., Alexander, T.W., Stanford, K., Xu, Y., McAllister, T.A., 2009. Purification of polymerase chain reaction (PCR)-amplifiable DNA from compost piles containing bovine mortalities. Bioresour. Technol. 100, 3343–3349. https://doi.org/10.1016/j.biortech.2009.01.069 Rouger, A., Tresse, O., Zagorec, M., 2017. Bacterial Contaminants of Poultry Meat: Sources, Species, and Dynamics. Microorganisms 5, 50. https://doi.org/10.3390/microorganisms5030050 Sahoo, M., Panigrahi, C., Aradwad, P., 2022. Management strategies emphasizing advanced food processing approaches to mitigate food borne zoonotic pathogens in food system. Food Front. 3, 641–665. https://doi.org/10.1002/fft2.153 Sal, E., Stemler, J., Salmanton-García, J., Falces-Romero, I., Kredics, L., Meyer, E., Würstl, B., Lass-Flörl, C., Racil, Z., Klimko, N., Cesaro, S., Kindo, A.J., Wisplinghoff, H.,
Doctoral dissertation Mila Đisalov 263 a)
Doctoral dissertation Mila Đisalov 264
Doctoral dissertation Mila Đisalov 265
Doctoral dissertation Mila Đisalov 266 b)
Doctoral dissertation Mila Đisalov 267
Doctoral dissertation Mila Đisalov 268
Doctoral dissertation Mila Đisalov 269
Doctoral dissertation Mila Đisalov 270 c)
Doctoral dissertation Mila Đisalov 271
Doctoral dissertation Mila Đisalov 272
Doctoral dissertation Mila Đisalov 279 Još jedna značajna činjenica u vezi sa patogenima u hrani i vodi je njihova sve veća otpornost na antibiotike (White i sar., 2002; Taviani i sar., 2022). WHO je 2017. godine objavila „listu bakterija koje hitno zahtevaju nove antibiotikeˮ kako bi se suzbila rastuća globalna antimikrobna rezistencija (Tacconelli i Magrini, 2017). Maja 2024, ova lista je ažurirana kako bi usmerila i podstakla istraživanje i razvoj novih antibiotika i alata za borbu protiv rastuće globalne otpornosti na antimikrobne lekove (WHO, 2024). Pomenuta lista uključuje bakterije koje se prenose putem hrane i vode, tako da se i Klebsiella spp. i Escherichia coli, čija je detekcija u hrani i vodi, respektivno, u fokusu ove doktorske disertacije, nalaze među ovim istaknutim vrstama. Dodatno, kroz razvoj alata za otkrivanje patogena štetnih za poljoprivredne useve, ova doktorska disertacija se bavi još jednim značajnim patogenom: gljivicom Trichoderma spp. za koju je poznato da ima negativan uticaj na prinos i kvalitet šampinjona, jedne od najčešće kultivisanih vrsta jestivih gljiva. Osetljive i efikasne metode za otkrivanje patogena su od vitalnog značaja za bezbednu i održivu proizvodnju hrane. Idealne metode korišćene u ove svrhe bi trebalo da budu brze, pristupačne i jednostavne za korišćenje, uz minimalnu potrebu za obukom osoblja (Zhang, 2013). Standardni pristup detekciji mikrobioloških patogena obuhvata mikrobiološku kultivaciju na hranljivom medijumu, što podrazumeva pripremu uzorka, mikrobiološku kultivaciju u fazama (bujon za obogaćivanje, selektivni medijum, medijum za izolaciju) i biohemijsku identifikaciju kroz brojne testove za potvrdu specifičnih mikroorganizama (Cai i sar., 2007; Wang i Duncan, 2017; Vidic i sar., 2019). Međutim, ove klasične metode su zahtevne u pogledu vremena i resursa, obično traju 3–4 dana, nekad i duže (do sedam dana) kada je mala brojnost bakterija u uzorku koji se testira (Vidic i sar., 2019; Nehra i sar., 2022). Sem toga, ove metode ne mogu otkriti bakterije koje su vijabline, ali se ne mogu kultivisati (engl. viable but non-culturable, VBNC), jer one ne formiraju vidljive kolonije, što ograničava efikasnost i primenljivost mikrobioloških metoda kultivacije (Oliver, 2010; Gao i sar., 2021). Molekularno-dijagnostičke tehnike, posebno PCR metode, revolucionalizovale su detekciju mikroorganizama omogućavajući njihovu bržu i precizniju identifikaciju uz visoku specifičnost. Ove metode se fokusiraju na detekciju genetičkog materijala (DNK ili RNK), što omogućava kako kvalitativnu, tako i kvantitativnu analizu (Moreno i sar., 2018). PCR metode su široko prihvaćene zbog sposobnosti da brzo umnože segmente DNK iz male količine uzorka, prevazilazeći ograničenja klasičnih mikrobioloških metoda (Law i sar., 2015; Nehra i sar., 2022). Ove karakteristike olakšavaju rano otkrivanje patogena, čak i pri niskim koncentracijama, uključujući i one iz VBNC grupe. Real Time PCR dodatno unapređuje ovaj
Doctoral dissertation Mila Đisalov 280 proces omogućavajući direktno kvantitativno praćenje umnoženog genetičkog materijala korišćenjem fluorescentnih boja (Kralik i Ricchi, 2017). Međutim, PCR metode zahtevaju specijalizovanu opremu i izuzetne higijenske uslove za rad, osetljive su na inhibitore prisutne u kompleksnim uzorcima i mogu proizvesti lažno pozitivne ili lažno negativne rezultate, najčešće zbog primene nespecifičnih početnica ili zbog nemogućnosti razlikovanja nukleinskih kiselina poreklom iz živih (aktivnih) i mrtvih (inaktivnih) ćelija patogena (Cangelosi i Meschke, 2014). Petljom-posredovana metoda izotermalnog umnožavanja nukleinskih kiselina (engl. Loop-mediated isothermal amplification, LAMP), koju je 2000. godine razvila grupa japanskih naučnika (Notomi i sar., 2000), pruža značajne prednosti u detekciji patogena u odnosu i na PCR i na klasične mikrobiološke metode. LAMP se ističe zbog svoje brzine, jednostavnosti i pouzdanosti u umnožavanju nukleinskih kiselina, što ga čini veoma pogodnim za kompleksne uzorke poput kliničkih uzoraka, uzoraka hrane, vode i zemlje, gde PCR može biti otežan zbog prisustva inhibitora reakcije (Becherer i sar., 2020). Za razliku od PCR-a, koji zahteva kontrolisane ponavljajuće promene temperature (što se postiže posebnom aparaturom), LAMP radi na konstantnoj temperaturi koristeći Bst DNA polimerazu iz Bacillus stearothermophilus, osiguravajući visoku specifičnost uz minimalnu potrebnu opremu (Soroka i sar., 2021). Dodatno, LAMP, zajedno sa reverznom transkripcijom, omogućava umnožavanje RNK sekvenci direktno u jednom reakcionom sudu, što unapređuje njegovu efikasnost u detekciji RNK virusa (Li i sar., 2022). Sve ove karakteristike čine LAMP metodom od izbora za dijagnostiku na mestu potrebe (engl. point of need, PoN) tj. na terenu, omogućavajući praćenje u realnom vremenu, čime se pojednostavljuje i ubrzava proces detekcije u poređenju sa PCR-om i mikrobiološkim metodama. Hipoteza i ciljevi istraživanja: Zagađenje hrane i vode patogenima predstavlja ozbiljan izazov za bezbednost hrane, što rezultira tegobama ljudi i životinja, povećanim brojem smrtnih slučajeva, kao i velikim ekonomskim opterećenjima za sistem javnog zdravlja. S obzirom na porast globalne populacije, postaje neophodno preduzeti korake kako bi se osiguralo snabdevanje bezbednom hranom u dovoljnim količinama za sve. Postizanje ovog cilja je moguće, između ostalog, i razvojem inovativnih dijagnostičkih alata za brzo i efikasno otkrivanje patogena duž celokupnog lanca vrednosti hrane (engl. food value chain), uključujući njihovo otkrivanje i u terenskim uslovima. U skladu sa svim navedenim aspektima, ova disertacija se koncentriše na razvoj, unapređivanje i primenu LAMP metode, koja omogućava
Doctoral dissertation Mila Đisalov 281 brzu, jednostavnu i pouzdanu detekciju na terenu. Hipoteze ove disertacije su da je 1) detekcija zasnovana na LAMP-u je adekvatna za detekciju mikrobioloških patogena u hrani životinjskog i biljnog porekla, kao i u životnoj sredini, što odgovara paradigmi „Jedno zdravlje“ koju preporučuje FAO i 2) LAMP pogodnija i efikasnija metoda u odnosu na najčešće korišćene metode za detekciju patogena poput mikrobioloških i PCR metoda. Kako bi se evaluirale postavljene hipoteze, ova doktorska disertacija ima nekoliko ključnih ciljeva: 1) unapređenje LAMP-a za detekciju patogena u kompleksnim matricama poput hrane (životinjskog i biljnog porekla), visokozagađene rečne vode i uzoraka nalik zemljištu, uz evaluaciju performansi LAMP-a u poređenju sa kultivacionim metodama i PCR-om kao zlatnim standardom za umnožavanje nukleinskih kiselina. U okviru cilja 1) se nalaze 1.1. koji obuhvata: uspostavljanje jasnih protokola za LAMP detekciju bakterijskih patogena u različitim matricama hrane koristeći bakteriju K. aerogenes kao model sistem i 1.2 uspostavljanje jasnih LAMP protokola za rano otkrivanje patogenih gljiva Trichoderma spp. u matriksu nalik zemljištu (MnZ), odnosno kompostu i pokrivci korišćenim za gajenje pečuraka. Važno je naglasiti da se u disertaciji koristi de novo dizajn specifičnih početnica i za K. aerogenes, i za Trichoderma spp. budući da ne postoje u literaturi. Finalni protokol obuhvata implementaciju kolorimetrijske detekcije LAMP proizvoda pomoću zlatnih nanočestica, čime se povećava nivo tehnološke spremnosti (engl. technology readiness level, TRL) za realnu primenu razvijenog protokola; 2) evaluacija potencijalne primene LAMP-a u detekciji bakterija indikatora fekalnog zagađenja (engl. fecal indicator bacteria, FIB), poput E. coli, za procenu kvaliteta vode; i 3) unapređenje protokola za brzu izolaciju nukleinskih kiselina iz uzoraka hrane i visokozagađene vode, sa mogućnošću primene u terenskim uslovima. Radi preglednosti, u okviru cilja 3) se razmatraju 3.1.1 i 3.1.2 koji se bave protokolima izolacije DNK iz hrane i iz MnZ, respektivno, kao i 3.2 za izolaciju DNK iz visokozagađene rečne vode. Cilj 4) se bavi izvođenjem konačnih zaključaka o primenljivosti razvijenih LAMP protokola u svrhe rane detekcije patogena bakterijskog i fungalnog porekla, u terenskim uslovima. Materijal i metode 1 : Za potrebe istraživanja u ovoj disertaciji izvedene su tri eksperimentalne postavke (EP) u okviru kojih je rađeno sledeće: EP1) razvoj i optimizacija LAMP protokola za detekciju K. aerogenes u uzorcima hrane; EP2) razvoj i optimizacija LAMP protokola za 1 Napomena: za sve korišćene hemikalije i aparaturu detaljni podaci su navedeni u disertaciji, dok se u proširenom apstraktu, radi uštede prostora, navode samo nazivi npr. TSB medijum, bez navođenja proizvođača i zemlje porekla npr. TSB medijum (Oxoid, UK).
Doctoral dissertation Mila Đisalov 282 detekciju Trichoderma spp. u proizvodnji šampinjona; EP3) testiranje LAMP-a za detekciju E. coli u visokozagađenoj rečnoj vodi. U okviru EP1 korišćeni su uzorci različitog povrća: krastavac (Cucumis sativus L.), zelena salata (Lactuca sativa L.) i šargarepa (Daucus carota L.). Ovi uzorci su odabrani zbog njihovog direktnog kontakta sa zemljom tokom uzgoja, s obzirom da je zemljište jedan od glavnih izvora K. aerogenes u povrću. Svo povrće korišćeno u eksperimentalnom radu kupljeno je u lokalnom supermarketu u Novom Sadu, 10.03.2023. U EP1 korišćeni su i mesni uzorci – sveže pileće grudi i pileća salama lokalnog proizvođača, kupljena u lokalnom supermarketu u Novom Sadu 18.07.2023. Najpre je sprovedeno testiranje prisustva K. aerogenes u opisanim uzorcima. U slučaju uzoraka povrća, testiranje je podrazumevalo ispiranje komadića povrća sa 3 mL PCR vode, od čega je 1 mL potom prebačeno na TSA ploču i inkubirano u toku 24 h. Bakterijske kulture izrasle nakon inkubacije su potom korisćene za: 1) sub-kultivaciju pojedinačnih kolonija (morfološki različitih) na TSA podlogama, kako bi se dobile čiste kolonije, koje su potom podvrgnute biohemijskim testovima za identifikaciju mikroorganizama; 2) izolaciju DNK korišćenjem komercijalnog kompleta (KK) specijalizovanog za ovakav tip uzorka - GeneJET Genomic DNA Purification komplet [videti Sekciju (S) 3.1.2.1, A], praćenu Real Time LAMP reakcijom. U slučaju uzoraka mesa, testiranje je podrazumevalo inkubaciju 250 mg svakog tipa mesnog uzorka u TSB medijumu na 37 °C u toku 24 h. Nakon inkubacije, ovakvi uzorci su potom korišćeni za izolaciju DNK korišćenjem KK specijalizovanog za ovakav tip uzorka - DNeasy PowerFood Microbial komplet i Chelex 100 metode (C100m) (na način opisan u S 3.1.2.3). Bakterijske kulture korišćene u EP1 (Staphylococcus aureus, Bacillus subtilis, Alcaligenes faecalis, Klebsiella aerogenes, Salmonella enterica i Escherichia coli) pripremane su 24 h inkubacijom (preko noći) na 37 °C na TSA podlogama. Izolacija DNK iz razlilitih tipova uzoraka sprovedena je: 1) primenom KK specijalizovanih za svaki tip uzorka, prema uputstvima proizvođača i 2) primenom C100m za primenu u terenskim uslovima. Detaljnije, DNK izolacija iz bakterijskih kultura rađena je primenom GeneJET Genomic DNA Purification kompleta (videti S 3.1.2.1), za izolaciju iz uzoraka povrća korićen je Plant/Fungi DNA Isolation komplet kao i C100m protokol prilagođen za ovaj tip uzorka (videti S 3.1.2.2), dok je za izolaciju DNK iz uzoraka mesa korišćen DNeasy PowerFood Microbial komplet, kao i C100m protokol prilagođen za ovaj tip uzorka (videti S 3.2.1.3).
Doctoral dissertation Mila Đisalov 283 Merenje koncentracije i čistoće dobijenih DNK određivano je spektrofotometrijski na BioSpecnano spektrofotometru merenjem apsorbance uzoraka DNK od 2 µL na 260, 280 i 230 nm. Ciljano, kontrolisano zagađenje uzoraka (tzv. „spajkovanje” od engl. spiking) hrane rađeno je na dva načina: 1) direktnim dodavanjem K. aerogenes gDNK ekstraktima povrća/mesa (videti S 3.1.3.1 A i S 3.1.3.2 A) i 2) inokulacijom povrća/mesa sa bakterijskom suspenzijom K. aerogenes (v. S 3.1.3.1 B i S 3.1.3.2 B). Za dizajn LAMP početnica za detekciju K. aerogenes odabran je gen koji kodira histidin dekarboksilazu – HDC (Gene ID: 66602288). LAMP početnice za ovaj gen dizajnirane su primenom onlajn softvera Primer Explorer V5 software (http://primerexplorer.jp). Provera efikasnosti i specifičnosti novih LAMP početnica rađena je testiranjem tri seta početnica (PC, od engl. primer candidates) prvobitno odabranih na osnovu najboljih performansi) na 65 °C u toku 45 min. Nakon toga, testiranje specifičnosti odabranog PC seta rađeno je uz pomoć Real Time i Colorimetric LAMP-a na 65 °C u toku 30 min., čiji su produkti potom proveravani na 2% agaroznom gelu. Za Real Time i Colorimetric LAMP korišćeni su komercijalno dostupni kompleti proizvođača New England BioLabs, konkretno WarmStart® LAMP komplet (DNA & RNA) i Colorimetric LAMP 2x Master Mix (DNA & RNA). Osetljivost LAMP metode utvrđena je testiranjem serije razblaženja gDNK K. aerogenes (1:1, 1:10, 1:100, 1:1000 i 1:10000). Dalja provera mogućnosti detekcije K. aerogenes gDNK korišćenjem LAMP-a sprovedena je testiranjem ekstrakata hrane spajkovanih sa gDNK i određivanjem granice detekcije (engl. Limit Of Detection, LOD) K. aerogenes gDNK u ovakvim uzorcima. Ovakvi DNK ekstrakti su dobijeni izolacijom DNK iz uzoraka pomoću KK i C100m, nakon čega su spajkovani sa K. aerogenes gDNK. Statistički značajne razlike u Tt vrednostima zabeleženim za sve testirane uzorke hrane utvrđena je jednosmernom analizom varijanse (engl. one-way analysis of variance, ANOVA) i post-hoc Tuckey-evim testom za nivo značajnosti p < 0.05, primenom softvera GraphPad Prism 8. Uporedna analiza efikasnosti različitih metoda izolacije DNK, kao i njihovog uticaja na ishod Real Time LAMP-a, rađena je testiranjem uzoraka hrane inokulisanih sa K. aerogenes suspenzijom, koji su potom bili podvrgnuti izolaciji DNK korišćenjem KK i C100m. U cilju upoređivanja efikasnosti LAMP metode sa PCR-om, isti ovi uzorci su potom testirani Real Time PCR-om primenom Maxima SYBR Green/ROX qPCR Master Mix (2X) kompleta.
Doctoral dissertation Mila Đisalov 284 U okviru EP2 rađeno je na razvoju i optimizaciji LAMP protokola za detekciju Trichoderma spp. koji bi mogao da se koristi za kontrolu proizvodnje šampinjona. Ova faza podrazumevala je najpre prikupljanje uzoraka komposta i pokrivke sa gajilišta za organsku proizvodnju šampinjona kompanije EKOFUNGI DOO u Padinskoj Skeli, tokom juna i jula 2021. godine, u različitim fazama uzgoja Agaricus bisporus (šampinjona) (videti Tabelu 6). Prvo je izvršeno testiranje prisustva Trichoderma spp. u ovim uzorcima na tri različita načina: 1) posmatranjem „golim okom“ vreća za uzgoj iz kojih su prikupljani uzorci, kako bi se ustanovilo da li je došlo do pojave zelene plesni koju uzrokuje Trichoderma spp.; 2) izolacijom čistih fungalnih kultura kroz proces kultivacije i ko-kultivacije iz prikupljenih uzoraka i 3) molekularnom identifikacijom – metabarkodiranjem. Nakon primene ovih različitih metoda za potvrdu prisustva Trichoderma spp., odabrano je nekoliko uzoraka (ukupno 9) za dalju analizu uz pomoć Real Time LAMP-a (Tabela 25). Fungalne kulture korišćene u EP2 tj. Trichoderma harzianum, Aspergillus carbonarius, Aspergillus fumigatus, Alternaria alternata, Penicillium halotolerans i Cladosporium allicinum pripremane su kultivacijom na sladnom agaru (engl. malt agar, MA) i inkubacijom na 26 °C u toku 5–7 dana. DNK izolacija iz uzoraka komposta i pokrivke rađena je: 1) primenom KK specijalizovanog za zemljišni tip uzoraka, konkretno GenElute™ Soil DNA Isolation kompleta prema uputstvu proizvođača (v. S 3.2.2.2 B) i 2) primenom C100m prilagođene za primenu u terenskim uslovima (v. S 3.1.2.2 A). DNK izolacija iz fungalnih kultura rađena je primenom Plant/Fungi DNA Isolation kompleta (v. S 3.1.2.1). Merenje koncentracije i procena čistoće dobijenih izolata DNK urađena je spektrofotometrijski na isti način već opisan u delu o detekciji K. aerogenes. Ciljano, kontrolisano zagađenje tj. spajkovanje uzoraka komposta/pokrivke rađeno je na dva načina: 1) direktnim dodavanjem genomske DNK T. harzianum ekstraktima komposta/pokrivke (v. Sekciju 3.2.3 A i 2) inokulacijom uzoraka komposta/pokrivke fungalnom kulturom T. harzianum (v. Sekciju 3.2.3 B). Za dizajn LAMP početnica za detekciju Trichoderma spp. odabran je gen koji kodira translacioni elongacioni faktor 1 alfa – tef1 (GenBank accession no.: OL435125), koji je dobro poznat kao sekundarni DNK barkod kod gljiva uključujući vrste roda Trichoderma. LAMP početnice za ovaj gen dizajnirane su primenom onlajn softvera Primer Explorer V5 software (http://primerexplorer.jp).
Doctoral dissertation Mila Đisalov 285 Provera efikasnosti i specifičnosti novih LAMP početnica rađena je testiranjem dva seta početnica (prvobitno odabranih na osnovu najboljih performansi) na 65 °C u toku 60 min. Nakon toga, testiranje specifičnosti odabranog PC seta rađeno je testiranjem uz pomoć Real Time i Colorimetric LAMP eseja na 65 °C u toku 30 min., čiji su produkti potom proveravani na 2% agaroznom gelu. Osetljivost LAMP metode utvrđena je testiranjem serije razblaženja gDNK T. harzianum (1:1, 1:10, 1:100, 1:1000 i 1:10000). Dalja provera mogućnosti detekcije gDNK Trichoderma spp. korišćenjem LAMP-a sprovedena je testiranjem eDNA ekstrakata komposta/pokrivke spajkovanih sa gDNK i LOD-a T. harzianum gDNK (kao modela Trichoderma spp.) u ovim uzorcima. Ovi ekstrakti su dobijeni izolacijom DNK pomoću KK i C100m, nakon čega su spajkovani sa gDNK T. harzianum. Statistički značajne razlike u Tt vrednostima zabeležene za sve testirane uzorke hrane utvrđene su putem ANOVA analize i post-hoc Tuckey-evim testom, na način opisan za detekciju K. aerogenes. Uporedna analiza efikasnosti različitih metoda izolacije DNK, kao i njihovog uticaja na ishod Real Time LAMP reakcije rađena je testiranjem uzoraka komposta/pokrivke inokulisanih sa T. harzianum kulturom, koji su potom bili podvrgnuti izolaciji DNK pomoću KK i C100m. U cilju upoređivanja efikasnosti LAMP-a sa PCR-om, isti ovi uzorci su potom testirani Real Time PCR-om primenom F3 i B3 LAMP početnica, kao i primenom PCR početnica iz literature. U cilju razvoja LAMP eseja kuplovanog sa zlatnim nanočesticama za kolorimetrijsku detekciju Trichoderma spp. najpre je urađena sinteza i karakterizacija 20 nm zlatnih nanočestica (engl. gold nanoparticles, AuNPs) primenom protokola opisanog u Braiek i sar. (2016). Nakon toga je rađeno ispitivanje uticaja koncentracije soli koja dovodi do agregacije AuNPs – testiranjem koncentracija 1, 5 i 10 µL MgCl2 različitih molariteta (2 mM, 20 mM i 2M). Potom su testirani različiti temperaturni i vremenski uslovi neophodni za vezivanje LAMP produkata za AuNPs: 1) bez inkubacije; 2) inkubacija na 55 ℃ u toku 20 min i 3) inkubacija na 60 ℃ u toku 10 min. Na kraju su odabrani sledeći uslovi za dalje testiranje LAMP-AuNP eseja: 2.5 µL LAMP produkata (koncentracija 32 ng/µL) inkubirano je sa 50 µL AuNP-a i 98 µL PCR vode na 65 °C tokom 10 minuta. Nakon toga, dodato je 2,5 µL 20 mM MgCl2, a promena boje je posmatrana golim okom ili merenjem apsorbance rastvora, korišćenjem SPARK multimo čitača mikroploča. U svrhe procene specifičnosti LAMP-AuNP eseja, AuNPs su inkubirane sa: 1) LAMP produktima tj. LAMP umnošcima dobijenim umnožavanjem T. harzianum gDNK (produkti
Doctoral dissertation Mila Đisalov 286 pozitivne LAMP reakcije); 2) mešavinom LAMP reakcije koja ne sadrži ciljnu DNK (negativna LAMP reakcija) i 3) LAMP produktima dobijenim dodavanjem nespecifične gDNK (izolovane iz Bacillus subtilis) u LAMP reakciju (nespecifična LAMP reakcija). Da bi se odredila minimalna količina LAMP proizvoda koja se može detektovati pomoću AuNPs, sprovedeno je istraživanje koje je uključivalo testiranje serije razblaženja pozitivnih LAMP proizvoda u detekciji T. harzianum DNK. Paralelno, testirana su serijska razblaženja bez prisustva ciljne T. harzianum DNK. Korišćena su desetostruka razblaženja u opsegu od 2400 ng/mL do 2.4 fg/mL. U okviru EP3 rađeno je testiranje LAMP metode za detekciju prisustva E. coli u uzorcima visokozagađene rečne vode sakupljenim tokom maja 2022. godine. Uzorci su prikupljeni iz reke Dunav u Novom Sadu (Vojvodina, Srbija) sa tri različite lokacije za uzorkovanje u blizini ispusta za kanalizaciju (Slike 25-26). Mikrobiološka potvrda prisustva E. coli u ispitivanim uzorcima rečne vode rađena je zasejavanjem uzoraka na selektivne ploče sa hromogenim koliformnim agarom (engl. Chromogenic Coliform Agar, CCA). Testirana su razblaženja uzoraka netretirane vode u rasponu od 1/2 do 10-2 i ploče su kultivisane na 37 °C tokom 24 h. Kvantifikacija E. coli u uzorcima je postignuta brojanjem samo E. coli tj. kolonija koje su bile pozitivne na βgalaktozidazu i β-glukuronidazu, enzime sadržane u CCA. DNK izolacija iz bakterijske kulture E. coli rađena je primenom GeneJET Genomic DNA Purification kompleta (v. S 3.1.2.1), dok je izolacija iz uzoraka vode rađena primenom prilagođenog protokola koji koristi špric filtere za ekstrakciju, opisanog od strane Kesberg i Schleheck (2013) (v. S 3.3.3.2., Slika 27). Merenje koncentracije i procena čistoće dobijenih izolata DNK urađena je spektrofotometrijski na BioSpec-nano spektrofotometru na isti način već opisan za K. aerogenes. Procena mogućnosti detekcije E. coli gDNK u visokozagađenim uzorcima rečne vode primenom LAMP-a, rađena je testiranjem ekstrakata dobijenih na prethodno opisan način. U ove svrhe korišćene su početnice iz literature opisane u Song i sar. (2019), koje ciljaju malB gen, poznat kao prisutan u različitim sojevima E. coli. LAMP reakcije za sve testirane uzorke izvođene su na 65 °C u toku 30 min.
Doctoral dissertation Mila Đisalov 287 U cilju upoređivanja efikasnosti LAMP metode sa klasičnom Real Time PCR metodom, isti ovi uzorci su potom testirani Real Time PCR metodom primenom F3 i B3 LAMP početnica, kao i primenom PCR početnica iz literature. Rezultati: Rezultati proizišli iz ove doktorske disertacije mogu se podeliti na sledeći način: 1) rezultati proizišli iz prve eksperimentalne postavke (EP1); 2) rezultati proizišli iz EP2 i 3) rezultati proizišli iz EP3. Rezultati proizišli iz EP1Мerenje koncentracije i čistoće DNK izolata ukazalo je na to da su vrednosti koncentracije DNK svih uzoraka povrća (inokulisanih i neinokulisanih), izolovane Chelex 100 metodom (C100m), bile značajno više (od 70.20 do 273 ng/µL) u poređenju sa uzorcima izolovanim pomoću Plant/Fungi kompleta (od 5.31 do 28.35 ng/µL) (Tabela 11). U uzorcima dobijenim C100m, odnos apsorpcije A260/A280 konzistentno je bio ispod 1.7, što ukazuje na vrednosti niže od donje referentne vrednosti (RV), osim u jednom uzorku neinokulisanog ekstrakta šargarepe koji je pokazao odnos iznad 1.9. Odnosi apsorpcije A260/A230 za ove uzorke kretali su se od 0.29 do 0.75, čime su sve vrednosti bile ispod 2.0, tj. niži od donje RV. Nasuprot tome, uzorci dobijeni pomoću Plant/Fungi kompleta imali su značajnu varijabilnost u odnosima apsorpcije A260/A280, pri čemu su DNK uzorci ekstrakta salate, kako inokulisani tako i neinokulisani, konzistentno imali odnose ispod donje RV. Za sve ostale uzorke dobijene ovim kompletom, odnos A260/A280 bio je iznad gornje RV. Odnosi apsorpcije A260/A230 za uzorke dobijene pomoću kompleta kretali su se od 0.21 do 0.92 (ispod donje RV). S druge strane, kada su u pitanju uzorci mesa, merenje koncentracije i čistoće DNK ekstrakata ukazalo je na to da su vrednosti koncentracija DNK uzoraka (inokulisanih i neinokulisanih) izolovane putem C100m bile u rasponu od 10.08 do 59.42 ng/µL (Tabela 13). Slično tome, uzorci izolovani pomoću DNeasy PowerFood Microbial kompleta kretali su se u rasponu od 10.18 do 17.69 ng/µL, što je unutar koncentracionog opsega C100m. Uzorci dobijeni putem C100m imali su konzistentan odnos A260/A280 ispod 1.7 za oba tipa DNK ekstrakata, sa izuzetkom spajkovanog uzorka pilećih grudi za koji je ovaj odnos iznosio 2.17. Odnos A260/A230 za mesne uzorke kretao se od 0.36 do 0.54 (svi ispod RV od 2.0). Dalje, uzorci izolovani pomoću DNeasy PowerFood Microbial kompleta imali su konzistentne odnose A260/A280 unutar referentnog opsega, kako za inokulisane, tako i za neinokulisane DNK ekstrakte mesa, osim za neinokulisani DNK ekstrakt pileće salame koji je imao odnos od 1.62. Odnosi A260/A230 za ove uzorke kretali su se od 0.10 do 1.63, što je takođe ispod donje RV.
Doctoral dissertation Mila Đisalov 288 Prilikom dizajna LAMP početnica, rezultati BLAST analize su pokazali da sve sekvence HDC gena (76) različitih sojeva K. aerogenes pokazuju veliku sličnost. Na osnovu najboljih performansi (v. S 1.3.1.1), inicijalno su odabrana tri seta LAMP PC kandidata – PC1, PC2 i PC3 za dalje testiranje i odabir najboljeg seta početnica, koji će potom biti korišćen za dalju optimizaciju i istraživanje (Tabela 14, Slike 28–30). Rezultati testiranja početnica su pokazali da vreme reakcije od 30 min konzistentno dovodi do pozitivnih i stabilnih rezultata. Kao optimalan set LAMP početnica odabran je PC2, jer se pokazalo da omogućava brzu detekciju sa visokom pouzdanošću, bez rizika od pojave lažno pozitivnih rezultata (Grafici 1–3). Dodatno, i Real Time i Colorimetric LAMP su pokazali da PC2 set ima visoku specifičnost prilikom testiranja sa drugim bakterijskim vrstama (Grafici 4–5, Slike 31–33). Rezultati testiranja osetljivosti LAMP metode primenom Real Time LAMP pristupa dali su LOD od 240 fg/µL, dok je za Colorimetric LAMP iznosio 24 pg/µL. Rezultati ispitivanja uzoraka hrane na kontaminaciju K. aerogenes potvrdili su odsustvo ove bakterijske vrste u svim ispitivanim uzorcima (Grafici 9–12, Dodatna Tabela 1). Rezultati Real Time LAMP-a pokazuju da je LOD za K. aerogenes gDNK u DNK ekstraktima hrane dobijenim korišćenjem putem C100m i spajkovanih sa K. aerogenes gDNK bio konzistentan u svim testiranim uzorcima hrane. Ovaj nalaz, ekvivalentan 0.4 pg/µL, ističe efikasnost metode (Grafici 13, 15, 17, 19 i 21). Pored toga, analizom Grafika 23 može se uočiti da su uzorci zelene salate, krastavca, šargarepe i salame imali slične Tt vrednosti pri svim testiranim koncentracijama. Najmanje koncentrovani uzorci su detektovani za otprilike 23–28 minuta. Nasuprot tome, uzorci pilećih grudi su imali duže Tt vrednosti, sa najrazblaženijim uzorkom koji je za detekciju zahtevao više od 29 minuta. Značajne statističke razlike primećene su između najrazblaženijih uzoraka zelene salate i pilećih grudi, kao i između najrazblaženijih uzoraka pilećih grudi i salame (p < 0,05) (Tabela 15). Uzorci dobijeni izolacijom korišćenjem Plant/Fungi kompleta imali su različite granice detekcije bakterijske gDNKu različitim DNK ekstraktima povrća. Za DNK ekstrakt šargarepe, detekcija je bila pouzdana do 0.04 ng/µL (što je ekvivalentno 40 pg/µL), kako pokazuju rezultati Real Time LAMP reakcije (Grafici 24 i 25). Uzorci krastavca su imali procenjenu granicu detekcije između 40–400 pg/µL, sa uspešnom detekcijom na razblaženju od 10-1 (Grafici 26 i 27). Slično tome, uzorak gDNK zelene salate imao je granicu detekcije od 0.04 ng/µL (Grafici 28 i 29). Tt vrednosti za DNK ekstrakte šargarepe i zelene salate spajkovanih sa K. aerogenes gDNK su bile slične, sa vrednostima koje su se kretale između 23 i 26 minuta, dok su za DNK ekstrakt krastavca primećene značajne razlike, posebno pri većim koncentracijama gde nije bilo pojavljivanja krive umnožavanja sve
Doctoral dissertation Mila Đisalov 295 Rezultati ove doktorske disertacije potvrđuju da je LAMP metoda razvijena za detekciju K. aerogenes efikasna i pogodna za primenu u nelaboratorijskim uslovima, dok su istovremeno ukazali na potrebu za daljom optimizacijom metoda izolacije DNК za određene vrste uzoraka, poput krastavca, koji zahtevaju specifičniji pristup, što je detaljnije objašnjeno u samoj disertaciji. Poređenje Real Time LAMP i Real Time PCR metoda za detekciju K. aerogenes u inokulisanim uzorcima hrane pokazuje da su rezultati Real Time LAMP bili u skladu sa tipom biljnog materijala, dobro korelirajući sa razlikama u anatomiji delova biljaka koji su korišćeni za izolaciju DNK, kao i da je Real Time LAMP bio superiorniji u odnosu na Real Time PCR. Dalje, uzorci gDNK izolovanih iz povrća putem C100m, imali su drugačiji redosled amplifikacionih krivi u Real Time PCR reakciji u odnosu na Real Time LAMP (Grafici 44–45). Real Time LAMP je dao pozitivne rezultate za manje od 30 min, dok je istovremeno za dobijanje pozitivne reakcije pomoću Real Time PCR-a trebalo 2 puta, pa čak i više vremena. Za DNК ekstrakte povrća izolovane primenom KK, Real Time LAMP je uspešno detektovao K. aerogenes za manje od 30 min., dok je detekcija Real Time PCR-om bila neuspešna (Grafici 46–47). Kod uzoraka mesa, prisustvo K. aerogenes pokazano je samo u uzorcima gDNK izolovanih pomoću KK, za šta je bilo potrebno oko 45 minuta, dok je Real Time LAMP-u trebalo manje od 20 minuta za pojavu pozitivnih rezultata (Grafik 42; Grafik 49). Manja efikasnost Real Time PCR može se pripisati nečistoćama u izolovanoj DNК, koje potiču iz alkalnog-PEG pufera korišćenog u C100m za lizu ćelija. Ovaj reagens poboljšava prinos DNК, ali umanjuje njenu čistoću. S obzirom na to da je LAMP metoda otpornija na inhibitore i nečistoće, ove nepravilnosti nisu uticale na njen rad. Generalno posmatrano, ova studija ističe potrebu za daljom optimizacijom metoda izolacije DNК i uslova reakcije za obe tehnike, ukazujući na potencijal Real Time LAMP-a za terensku primenu (Vashishtha i Konigsberg, 2016). U ovoj doktorskoj disertaciji uspešno je razvijena, optimizovana i validirana LAMP metoda za brzu, efikasnu i specifičnu detekciju patogenih gljiva Trichoderma spp. u uzorcima nalik zemljišnim (kompostu i pokrivci) koji se koriste za organsku proizvodnju šampinjona. Trichoderma spp. je odabrana zbog značajnih negativnih efekata na proizvodnju pečuraka, koji se manifestuju tek kada se formiraju tamnozelene spore, čime se otežava kontrola njihove dalje propagacije u gajilištima (Šašić Zorić i sar., 2023). Takođe, LAMP metoda testirana je na
Doctoral dissertation Mila Đisalov 296 uzorcima komposta i pokrivke, uz optimizaciju izolacije eDNK primenljive na terenu. Izolacija eDNK je ključna za određivanje mikrobiološke raznovrsnosti zemljišnih uzoraka (Wydro, 2022), za koje je poznato da su jedni od od najizazovnijih okruženja zbog prisustva različitih vrsta i enzimskih inhibitora (Salonen i sar., 2010; Zielińska i sar., 2017). U literaturi je većina istraživanja fokusirana na upotrebu KK za izolaciju eDNK iz zemljišnih uzoraka, dok nedostaju rešenja za ekstrakciju i detekciju Trichoderma spp. u terenskim uslovima. (Nazar i sar., 1996; Filion i sar., 2003; Reeleder i sar., 2003; Park i sar., 2020). U okviru ove disertacije je urađen i de novo dizajn LAMP početnica (PC) za T. harzianum, budući da u literaturi nisu pronađene odgovarajuće. Pokazano je da je set broj 2 (PC2) imao najpovoljnije karakteristike za specifičnu detekciju T. harzianum gDNK, sa kraćim vremenom neophodnim za pojavu pozitivnih rezultata (17 min) u poređenju sa PC1 (30 min) (Grafik 50). PC2 set je pokazao visoku specifičnost kada je testiran na drugim gljivama neretko prisutnim u sličnim uzorcima zemlje (Perrone i sar., 2007; Ghiaie Asl i sar., 2017; Latgé i Chamilos, 2019; Park i sar., 2020.; Jindo i sar., 2021). Real Time LAMP metoda je omogućila detekciju T. harzianum sa LOD od 917 fg/µL (0.92 pg/µL) (Grafici 55–57), dok je Colorimetric LAMP pristup dao LOD od 91.7 ng/µL (Slika 40). Ove vrednosti LOD-a mogu se uporediti sa granicama detekcije za Fusarium graminearum i F. oxysporum iz literature, gde su korišćene LAMP metode (Niessen i Vogel, 2010; Li i sar., 2013). Upoređivanje sa PCR metodama pokazuje da je LAMP metoda za detekciju Trichoderma spp. efikasna i nudi konkurentnu granicu detekcije, u opsegu drugih molekularnih metoda (Miyazaki i sar., 2009; Lee i sar., 2020). LOD postignuta u okviru ove doktorske disertacije za specifičnu detekciju roda Trichoderma pomoću LAMP metode može se uporediti sa LOD-om za PCR opisanom u radu Lee i sar. (2020), koji iznosi 500 fg/µL za detekciju T. harzianum. Međutim, tokom eksperimentalnog testiranja početnica iz pomenutog rada (sprovedenog u okviru ove doktorske disertacije) došlo je do izostanka reakcija u pozitivnim kontrolama. Ovakav rezultat dodatno naglašava značaj razvoja LAMP metode kao molekularnog alata za detekciju Trichoderma spp. U još jednoj studiji koju su objavili Miyazaki i sar. (2009) prikazana je detekcija DNK T. harzianum pomoću Nested PCR-a sa LOD-om od 50 fg/µL. Ovo dodatno potvrđuje da je LOD LAMP metode za detekciju Trichoderma razvijene u ovoj disertaciji, u opsegu poređenja sa drugim molekularnim metodama prisutnim u naučnoj literaturi.
Doctoral dissertation Mila Đisalov 297 Na osnovu optimizacije LAMP reakcije, istraživanje je prošireno na procenu osetljivosti detekcije Trichoderma spp. u realnim uzorcima supstrata za organsku proizvodnju šampinjona, kao što su kompost i pokrivka. Ovi supstrati često sadrže spore Trichoderma koje se mogu brzo širiti unutar proizvodnih tunela. Stoga je rano otkrivanje ovih patogenih gljiva ključno za pravovremeno uklanjanje kontaminiranih vreća i sprečavanje daljeg širenja. Za izolaciju DNK korišćene su dve metode: C100m za rad na terenu i KKGenElute™ Soil DNA za rad u laboratorijskim uslovima. Rezultati su pokazali da je DNK izolacija bila efikasnija primenom KK, posebno za uzorke komposta, koji su kompleksniji za manipulaciju u poređenju sa uzorcima pokrivke. Uprkos tome, utvrđeno je da je LAMP reakcija dala pozitivne rezultate za obe metode izolacije u slučaju oba tipa uzorka (komposta i pokrivke), što potvrđuje efikasnost razvijenog LAMP protokola. Naime, LOD za T. harzianum je 0.4 pg/µL za eDNK uzorke pokrivke dobijene korišćenjem C100m, dok je za eDNK komposta LOD bio 4 pg/µL. Nasuprot tome, u uzorcima kod kojih je eDNK izolovana pomoću KK dobijene su vrednosti LOD od 0.4 pg/µL za kompost i 4 pg/µL za pokrivku. Niža efikasnost LAMP reakcije u kombinaciji sa C100m ekstrakcijom za kompost može se pripisati prisustvu huminskih kiselina koje inhibiraju analize DNK (Reuter i sar., 2009; Wnuk i sar., 2020). Istraživanje je pokazalo da su KK efikasniji za kompost, dok C100m pokazuje veliki potencijal za dalju optimizaciju u terenskim uslovima, posebno za uzorke pokrivke. Dalja optimizacija mogla bi uključivati promene u procesu homogenizacije uzoraka i dodatne korake za uklanjanje huminskih kiselina kako bi se metoda bolje prilagodila za terenske uslove (Wydro, 2022). Ova doktorska disertacija bavila se i proučavanjem efikasnosti Real Time LAMP metode za detekciju Trichoderma spp. u realnim uzorcima supstrata za uzgoj pečuraka. Studija je pokazala da, iako je Real Time LAMP metoda generalno dobro korelirala sa rezultatima DNK metabarkodinga, imala je poteškoća sa uzorcima koji su sadržali nedovoljne količine DNK poreklom od Trichoderma spp. (npr. uzorak P10). S druge strane, DNK metabarkoding se, očekivano, pokazao kao osetljiviji, detektujući i vrlo male količine DNK koje su ispod granice detektibilnosti putem LAMP-a (Kredics i sar., 2018). Ovakav rezultat može biti posledica neravnomerne raspoređenosti spora poreklom od Trichoderma spp. u testiranim uzorcima. Ova hipoteza se takođe može primeniti na uzorke K1, P3 i K7#, gde pozitivna Real Time LAMP reakcija nije postignuta u svim testiranim ponavljanjima. Ovi nalazi naglašavaju izuzetan
Doctoral dissertation Mila Đisalov 298 potencijal LAMP metode, ali takođe ukazuju na potrebu za daljom optimizacijom i sveobuhvatnijim uzorkovanjem kako bi se poboljšala njena praktična primena. Uporedna analiza između Real Time LAMP i Real Time PCR metoda nije sprovedena zbog nepostojanja specifičnih PCR početnica za Trichoderma spp. u literaturi. Naime, kao što je prethodno rečeno, PCR početnice opisane u radu Lee i sar. (2020) nisu dale pozitivne reakcije u kontrolnim uzorcima. Takođe, testirane su F3 i B3 početnice iz PC1 i PC2 setova kao potencijalne PCR početnice, ali nijedna od njih nije pokazala dovoljnu specifičnost, budući da su umnožavale gDNK i druge, ne-Trichoderma vrste gljiva (Grafici 80–83). U okviru ove doktorske disertacije razvijen je novi esej koji kombinuje LAMP metodu sa zlatnim nanočesticama (AuNPs) za kolorimetrijsku detekciju LAMP proizvoda (Djisalov i sar., 2024). Esej koristi sposobnost oligonukleotida (LAMP produkata tj. umnožaka) da se adsorbuju na površinu AuNPs, sprečavajući njihovu agregaciju izazvanu MgCl2 u pozitivnim LAMP reakcijama (Marin i sar., 2021). Kao rezultat, kod pozitivnih reakcija nije došlo do promene boje, dok su negativne reakcije izazvale promenu boje iz crvene u ljubičastu. Rezultati specifičnosti ovog eseja su pokazali da su samo AuNPs u prisustvu pozitivnih LAMP reakcija zadržali stabilnost nakon dodavanja MgCl2, dok su svi negativni kontrolni uzorci rezultovali agregacijom (Slika 44). Test je postigao LOD od 24 ng/µL za pozitivne LAMP proizvode, što je bilo vidljivo golim okom (Slika 45). Međutim, zbog visoke koncentracije reagenasa i početnica koja sprečava agregaciju AuNPs, bilo je potrebno razblažiti uzorke deset puta da bi se mogli razlikovati pozitivni od negativnih rezultata (Reuter i sar., 2009). Test je bio osetljiv na koncentracije umnožaka u rasponu od 240 ng/µL do 2.4 ng/µL. U razblaženim uzorcima, smanjeni nivo umnožaka doveo je do agregacije AuNPs, koju nije bilo moguće efikasno suprimirati (Kredics i sar., 2018). Efikasnost testa zavisi od veličine i oblika AuNPs, što znači da bi promene u vrsti AuNPs zahtevale ponovnu optimizaciju koncentracije soli i vremena reakcije. Ukratko, razvijeni LAMP-AuNP test je jednostavan, brz i prenosiv metod za detekciju LAMP proizvoda, što može značajno pojednostaviti trenutno važeće procedure za detekciju Trichoderma na farmama. Osim toga, ovaj test se može prilagoditi za analizu boje putem pametnih telefona, koristeći aplikacije poput besplatne MyLight aplikacije, koja omogućava slikanje i analizu rezultata (Reuter i sar., 2009; Kredics i sar., 2018; Marin i sar., 2021).
Doctoral dissertation Mila Đisalov 299 Zagađenje vode i hrane fekalnim bakterijama predstavlja značajan problem za javno zdravlje i ekonomiju, pri čemu Escherichia coli služi kao ključna fekalna indikatorska bakterija (FIB) (Walker i sar., 2019). Ovaj problem je posebno izražen u zemljama poput Srbije, gde nedostatak infrastrukture za prečišćavanje otpadnih voda dovodi do toga da se neprečišćene otpadne vode ulivaju direktno u reke, čime se dalje kontaminira lanac proizvodnje hrane (Baklan Green Energz news, 2022; Čista Srbija, 2022). Tradicionalne metode zasnovane na kultivaciji u cilju detekcije FIB su ekonomične i široko korišćene, ali su vremenski zahtevne i često zahtevaju nekoliko dana za potvrdne rezultate. Molekularne metode kao što su PCR i Real Time PCR nude prednosti u pogledu brzine, osetljivosti i specifičnosti (u odnosu na mikrobiološke metode), ali su izuzetno osetljive na kontaminante i nepraktične za terensku upotrebu (Moehling i sar., 2021). LAMP metoda predstavlja obećavajuću alternativu. LAMP je značajno manje osetljiva metoda na uticaj inhibitora prisutnih u sredinskim uzorcima, čineći je jednostavnom i robusnom metodom za detekciju patogena u zagađenoj vodi. Ova doktorska disertacija ističe izvodljivost primene LAMP-a za brzu i efikasnu detekciju E. coli u visokozagađenim uzorcima vode, odgovarajući na ključnu potrebu za pravovremenom procenom kvaliteta vode i kontrolom patogena, a u skladu sa konceptom „Jedno zdravlje“. Detekcija patogena korišćenjem molekularnih metoda u velikoj meri zavisi od efikasnosti izolacije eDNK iz realnih, sredinskih uzoraka. Izolacija eDNK iz vodenih uzoraka je posebno izazovna, prvenstveno zbog začepljenja filtera do kojeg dolazi tokom filtracije uzoraka (Takasaki i sar., 2021). Pored toga, prisustvo različitih supstanci u sredinskim uzorcima može rezultirati niskom stopom čistoće i izuzetno malim prinosom ukupn eDNK, što dalje otežava molekularnu detekciju patogena (Goldberg i sar., 2016; Hunter i sar., 2019; Tsuji i sar., 2019; Bairoliya i sar., 2022). Komercijalno dostupni kompleti za izolaciju DNK, kao što su DNeasy Blood and Tissue DNA Extraction komplet i PowerWater DNA Extraction komplet, obično koriste pristup zasnovan na filtraciji. Međutim, visoka cena ovih kompleta i potreba za visokohigijenskim laboratorijskim uslovima za rad mogu biti ograničavajući faktori za terensku primenu. Stoga optimizacija tradicionalnih metoda izolacije eDNK pomoću šprica predstavlja isplativiju i bržu alternativu i način za postizanje ASSURED kriterijuma. Deo istraživanja sprovedenog u ovoj doktorskoj disertaciji bio je posvećen prilagođavanju protokola za pripremu uzoraka i izolaciju eDNK prethodno opisanog u radu Kesberg i Schleheck (2013) kako bi se unapredila njegova primena na terenu. Izmene su uključivale
Doctoral dissertation Mila Đisalov 300 promene u koraku prefiltracije, korišćenjem 10 μm filtera, a zatim filtraciju kroz 0.45 μm filtere za koncentrovanje bakterijskih ćelija. Novi protokol takođe je uključivao jednu inkubaciju na 65°C nakon dodavanja TPS pufera, čime je značajno smanjeno ukupno vreme analize na otprilike 45 minuta, u poređenju sa Kesberg i Schleheck protokolom koji je trajao oko 4 sata (Kesberg i Schleheck, 2013). S druge strane, u prilagođenom protokolu koji su opisali Lee et al. (2019), vreme reakcije je smanjeno do 30 minuta. Međutim, ova istraživačka grupa je sprovela LAMP detekciju ciljnih bakterija koristeći veštački kontaminirane uzorke vode, čime se zanemaruje svaki potencijalni uticaj bakterija koje su već prisutne u vodi na izmerenu koncentraciju ukupne izolovane eDNK. U protokolu razvijenom u ovoj disertaciji su uvedena tri dodatna koraka ispiranja kako bi se poboljšala čistoća eDNK. Prinos eDNK po tom protokolu kretao se od 17.36 do 22.12 ng/μL, što je u skladu sa rasponom prijavljenim od strane Kesberg i Schleheck (2013) i Lee i sar. (2019) (~20 ng/μL), ali sa nešto nižom čistoćom, verovatno zbog korišćenja veoma zagađenih vodenih uzoraka u ovoj studiji. Postoje brojne studije u literaturi koje su istraživale upotrebu LAMP metode za detekciju bakterijske DNK u uzorcima vode (Martzy i sar., 2017; Lee i sar., 2019; Fu i sar., 2021; Khodaparast i sar., 2022;), ali većina koristi skupe KK za izolaciju DNK koji zahtevaju laboratorijske uslove (Martzy i sar., 2017; Fu i sar., 2021), dok neke koriste spajkovane uzorke vode (Lee i sar. 2019), što ne daje realnu sliku o koncentracijama ukupne eDNK koja bi se mogla očekivati u netretiranim uzorcima. U okviru ove doktorske disertacije analizirani su realni, netretirani, visokozagađeni uzorci vode iz reke Dunav kod Novog Sada (uzorci S1–S3). Kultivacija na selektivnoj podlozi potvrdila je prisustvo koliformnih bakterija (uključujući E. coli) u svim uzorcima. Zatim je izvedeno poređenje rezultata analize putem Real Time PCR-a i dva LAMP metodološka pristupa (Real Time i Colorimetric). Do pozitivne LAMP reakcije došlo je samo u slučaju testiranja S1 i S2 uzoraka, dok je Real Time PCR detektovao samo kontrolni uzorak sa prečišćenom DNK (Grafici 92-93 i Slika 47). Izostanak pozitivne reakcije tj. krive umnožavanja u PCR reakciji u sredinskim uzorcima može biti posledica inhibitora poput fulvičnih i huminskih kiselina, metalnih jona i polifenola, koji su uobičajeni u visokozagađenoj vodi (Ijzerman i sar., 1997). Takođe, s obzirom da je E. coli samo jedna od mnogih koliformnih bakterijskih vrsta u ovakvim uzorcima, E. coli DNK može činiti mali deo ukupne eDNK, usled čega se može naći ispod granice detekcije Real Time PCR-a (Bartram i sar., 1996; Li i sar., 2021). Nasuprot tome, LAMP, poznat po svojoj otpornosti na PCR inhibitore, uspešno je
Doctoral dissertation Mila Đisalov 301 detektovao E. coli u uzorcima S1 i S2, ali ne i u uzorku S3, verovatno zbog manjeg prisustva E. coli u ovom uzorku (Lin i sar., 2012; Mori i sar., 2013b; Wang i sar., 2013). Ovi rezultati pokazuju ograničenja Real Time PCR-a za detekciju FIB-a u visokozagađenim uzorcima i takođe prikazuju LAMP kao alternativu koja bi se mogla koristiti za efikasniji monitoring bakteriološkog kvaliteta vode. Zaključci: Na osnovu predložene hipoteze, definisanih ciljeva i dobijenih rezultata, mogu se izvesti sledeći glavni zaključci: 1) LAMP metoda razvijena i validirana u okviru disertacije, primenjena za specifičnu detekciju patogenih bakterija i gljivica, pokazala se optimalnijom u odnosu na PCR i tradicionalne mikrobiološke metode kultivacije za iste patogene i 2) detekcija bazirana na LAMP protokolima iz disertacije je adekvatna za detekciju patogenih bakterija u realnim uzorcima hrane biljnog i životinjskog porekla, i visokozagađene rečne vode, kao i za detekciju patogenih gljivica u realnim uzorcima matriksa nalik zemljištu, čime je pokazano da je LAMP kompatibilan sa pristupom „Jedno zdravljeˮ. Konkretno za LAMP detekciju patogene bakterije Klebsiella aerogenes u hrani biljnog i životinjskog porekla dobijeni su niski detekcioni limiti (LOD) primenom Real Time LAMP-a, što potvrđuje veliki potencijal ove tehnike kao dijagnostičkog alata. U disertaciji je takođe pokazano da je terenska detekcija patogena u hrani biljnog i životinjskog porekla primenom LAMP-a moguća u kombinaciji sa terenskim metodama za izolaciju DNA, kao što je metoda Chelex 100 (C100m) optimizovana u okviru ove doktorske disertacije. Dalje, LAMP je uspešno optimizovan za specifično otkrivanje zelene plesni tj. patogene gljivice Trichoderma spp. u supstratima koji se koriste za organski uzgoj šampinjona. Dobijen je nizak LOD za Trichoderma spp. primenom Real Time LAMP-a što još jednom potvrđuje veliki potencijal LAMP-a kao alata za dijagnostiku. Dodatno, LAMP se pokazao kao pogodan dijagnostički alat kako u laboratoriji, tako i na terenu budući da je pokazano i da je terenska detekcija Trichoderma spp. u pokrivci primenom LAMP-a moguća u kombinaciji sa terenskim metodama za izolaciju DNK, kao što je C100m optimizovana u okviru ove doktorske disertacije. Daljom adaptacijom i optimizacijom, LAMP metoda može postati prvi izbor za ranu i osetljivu detekciju patogena koji negativno utiču na proizvodnju hrane. Sličan zaključak se može izvesti i za primenu LAMP metode za detekciju bakterijskog zagađenja u vodi, na osnovu rezultata detekcije E. coli u visokozagađenoj dunavskoj vodi, s tim da je neophodna i dodatna optimizacija metode izolacije eDNK pomoću šprica koja se koristi za ove uzorke.
Doctoral dissertation Mila Đisalov 302 Prema saznanjima autora disertacije, ova doktorska disertacija prvi put opisuje LAMP protokol za detekciju K. aerogenes i Trichoderma spp. patogena, uz korišćenje novodizajniranih početnica i za bakterijski i za gljivični patogen. Važno je naglasiti i da je u disertaciji adaptirana Chelex 100 metoda za terensku izolaciju DNK iz uzoraka mesa i uzoraka nalik zemljištu, što se takođe ne može naći u dostupnoj publikovanoj naučnoj literaturi. Uzimajući u obzir ove činjenice, kao i sveukupne rezultate, može se reći da ova doktorska disertacija daje značajan doprinos polju molekularne dijagnostike i njene primene u okviru koncepta „Jedno zdravljeˮ, pre svega za detekciju bakterijskih patogena u realnim uzorcima hrane i vode, kao i za detekciju patogenih plesni u realnim uzorcima zemljišnog supstrata (komposta i pokrivke). Disertacija takođe jasno prikazuje i napredne korake ka optimizaciji LAMP metode za krajnju primenu u terenskim uslovima.
Doctoral dissertation Mila Đisalov 303 Author biography Mila Đisalov was born on August 13th, 1993, in Zrenjanin. She completed her Bachelor academic studies in Biochemistry at the Faculty of Sciences in Novi Sad, Department of Chemistry, Biochemistry and Environmental Protection. She completed her graduation work under the mentorship of Prof. Jelena Purać, Ph.D and graduated in 2017 by defending her final thesis titled "In Vitro Cultivation of Honey bee Midgut and the Effect of Acute Paraquat Exposure". Immediately after attaining her B.Sc., she enrolled in Master’s academic studies in Molecular Biology at the Department of Biology and Ecology, where she worked in the Laboratory for Biochemistry and Molecular Biology under the supervision of Prof. Jelena Purać, Ph.D. Under her supervision, Mila wrote her Master’s thesis entitled "Effects of Dietary Cadmium and Zinc on Catalase Activity and Protein Thiol Content in Ostrinia nubilalis (Hbn.) Larvae", which she defended in 2018. She enrolled in Doctoral academic studies in Biochemistry in 2018 at the Faculty of Science in Novi Sad under the mentorship of Prof. Marija Lesjak, Ph.D and Ivana Gađanski, Ph.D, Senior Research Associate at the BioSense Institute. She completed her Ph.D. research in the Biochemistry and Molecular Biology Laboratory at the BioSense Institute, where she has been employed as a young researcher since April 2019. During her doctoral studies, Mila was involved in preparing proposals for several provincial, national and international project grants. At the BioSense, she was also involved in the implementation of 7 national and 8 international scientific research projects, where she worked in the field of biosensor development, molecular tools for pathogen detection, cellular agriculture, and the development of lab-on-a-chip platforms. During her career, she expressed affinity for working in the field of the promotion and popularization of science. Concretely, she was one of the co-founders of the student group "The BioSense Alt. Protein Project" established in 2020 at the BioSense, which was supported by The Good Food Institute (USA). Additionally, in 2021, she received the KOMUNALT project grant (full name: Improvement of Knowledge and Communication Skills of Scientists in the Field of Alternative Proteins), funded by the Center for the Promotion of Science. Within this
Doctoral dissertation Mila Đisalov 304 project, the first multidisciplinary conference dedicated to alternative proteins in Serbia was held. She has co-authored 2 papers published in international journals of exceptional value (M21a category), one of which was as one of the first authors with equal contribution; 5 papers in top international journals (M21 category), two of which were as the first author; 2 papers in prominent international journals (M22 category); 16 papers presented at international conferences (M34 category); and 5 papers presented at national conferences (M64 category). She also published work in a thematic collection of national importance (M45) as the first author and launched one new technical solution (method) applied at the national level (M82). In May 2024, she received, with other co-authors, the Tanner Award for the most cited paper in 2021, published in the journal Comprehensive Reviews in Food Science and Food Safety.