1 Autophagy maintains stemness by preventing senescence Laura García-Prat1, Marta Martínez-Vicente2^, Eusebio Perdiguero1, Laura Ortet1, Javier Rodríguez-Ubreva3, Elena Rebollo4, Vanessa Ruiz-Bonilla1, Susana Gutarra1, Esteban Ballestar3, Antonio L. Serrano1, Marco Sandri5^ and Pura Muñoz-Cánoves1,6* 1Cell Biology Group, Department of Experimental and Health Sciences, Pompeu Fabra University (UPF), CIBER on Neurodegenerative diseases (CIBERNED), E-08003 Barcelona, Spain; 2Neurodegenerative Diseases Research Group, Vall d'Hebron Research Institute-CIBERNED, E-08035 Barcelona, Spain; 3Chromatin and Disease Group, Cancer Epigenetics and Biology Programme (PEBC), Bellvitge Biomedical Research Institute (IDIBELL), E-08907 L'Hospitalet de Llobregat, Barcelona, Spain; 4Molecular Biology Institute of Barcelona (IBMB-CSIC), 08028 Barcelona, Spain; 5Department of Biomedical Science, University of Padova, 35100 Padova, Italy. Telethon Institute of Genetics and Medicine (TIGEM), 80131 Napoli, Italy; 6ICREA, Barcelona, Spain. ^Equal contribution *Corresponding author: Pura Muñoz-Cánoves (
[email protected] )
2 SUMMARY During aging, muscle stem cell regenerative function declines. At advanced geriatric age, this decline is maximal due to transition from a normal quiescence into an irreversible senescence state. How satellite cells maintain quiescence and avoid senescence during their long life remains largely unknown. Here we report that basal autophagy is indispensable to maintain the stem-cell quiescent state in mice. Failure of autophagy in physiologically aged satellite cells or its genetic impairment in young cells causes senescence entry by loss of proteostasis, increased mitochondrial dysfunction and oxidative stress, resulting in numerical and functional satellite cell decline. Autophagy reestablishment reverses senescence and restores regenerative functions in geriatric satellite cells. Since autophagy also declines in human geriatric satellite cells, these findings uncover autophagy as a decisive stem cell-fate regulator and have implications for fostering muscle regeneration in sarcopenia.
3 The regenerative capacity of skeletal muscle relies on long-lived Pax7-expressing muscle stem cells (called satellite cells), which are normally in quiescence (a G0 reversible arrest state). In response to tissue damage, these cells activate, enter the cell cycle and either expand and form new myofibers or self-renew to restore the quiescent satellite cell pool1-4. Quiescence therefore appears as a simple way of functionally maintaining the stem cell population throughout life in the absence of regenerative demand, particularly in tissues with little turnover, such as skeletal muscle. Sarcopenia, the age-related loss of skeletal muscle mass and function, is maximal at geriatric age. At this last stage of life, skeletal muscle shows a profound regenerative impairment that contributes to the individual’s physical incapacitation. Recent studies have demonstrated that aged skeletal muscles fail to retain stem cell quiescence5-7. Both the number and the functionality of muscle stem cells decline with aging5-10, with satellite cells switching from a quiescence to a pre-senescence state in sarcopenic muscle at geriatric age6. How satellite cells maintain quiescence during their long life and avoid acquisition of the senescence program until advanced age is largely unknown. Using physiologically aged mice, we show that quiescent muscle stem cells preserve their integrity over time through active maintenance of organelle and protein homeostasis (proteostasis) as cellular quality control mechanism. In particular, we demonstrate that these dormant stem cells display continuous basal macroautophagy (from now on ‘autophagy’; i.e. the process for degradation of long-lived proteins and damaged organelles in lysosomes11,12). With aging, this activity declines. Physiological decline of autophagy in old satellite cells, or its genetic impairment in young cells, results in toxic cellular waste accumulation, which provokes senescence entry. Our results indicate that muscle stem cells preserve their G0-reversible quiescence state from entering a G0-irreversible senescence state through autophagy. Importantly, genetic and pharmacological regimes that reinstall basal autophagy in geriatric mice reversed stem cell senescence and restored regeneration. These findings have implications for regenerative medicine in sarcopenia.
4 RESULTS Quiescent muscle stem cells basal autophagy is impaired in aging We interrogated the quiescent satellite cell transcriptome for changes in proteostasis genes (as compared to activated cells)13-15 and uncovered autophagy as the most prevalent pathway in the quiescent state (Extended Data Fig. 1a; Supplementary Table 1). K-means clustering analysis revealed an age-associated downregulation of autophagic genes in quiescence (Extended Data Fig. 1b; Supplementary Table 1). Autophagy is an evolutionary conserved process of self-degradation of cellular components (organelles, cytosol portions and misfolded proteins) by autophagosomes which are delivered to the lysosomal machinery, thus preventing waste accumulation11,12, and which has been implicated in aging of different model organisms11,12,16,17. To investigate the occurrence of autophagy in quiescent muscle stem cells we used GFPLC3 (a well-known marker of autophagosomes) transgenic mice18,19. Quiescent satellite cells were fluorescence-activated cell sorting (FACS)-isolated (Extended Data Fig. 1c) from resting muscle of young (3 months) and old GFP-LC3 mice (20-24 months). Punctate GFP-LC3-staining was found in young cells, being increased in old cells (Fig. 1a; Extended Data Fig. 1d; Supplementary Video 1-2). We next used the autophagy-flux inhibitor Bafilomycin (Baf), that prevents lysosome degradation, thus increasing punctate GFP-LC3 exclusively when autophagy is active20, as a proxy for autophagic activity. At variance with young cells, Baf treatment demonstrated the old satellite cells’ incapacity for further autophagosome formation, as shown by GFP-LC3 fluorescence levels (Fig. 1b). These results indicate, first, constitutive autophagic activity in young quiescent satellite cells; and, second, impaired activity during aging. Fluorescence, transmission-electron microscopy and Western-blotting analyses confirmed in old satellite cells the accumulation of autophagic vesicles (Extended Data Fig. 1e, 1f), p62 (a protein regulating autophagic clearance of dysfunctional organelles/aggregates)-containing aggregates, ubiquitin (Ub)- positive inclusions (Extended Data Fig. 1g), increased p62 levels and reduced LC3IIaccumulation after Baf treatment (Extended Data Fig. 1h, 1i) -common traits of deficient autophagy. Of note, 2-week-treatment with Rapamycin (or Spermidine), well-known autophagy-inducing regimes21,22, in old mice restored stem-cell basal autophagy (Fig. 1c; Extended Data Fig. 1j; Supplementary Video 3 and 4), reducing protein and organelle aggregates (Fig. 1d; Extended Data Fig. 1k). Autophagy reestablishment avoids senescence and restores regeneration in geriatric stem cells Satellite cells at geriatric age (over 28 months in mice) enter a senescent state6,23. We investigated whether dysregulated basal autophagy may underlie loss of bona-fide quiescence. Using a mRFP–GFP–LC3 construct24 (tandem-fluorescent-tagged LC3 reporter), transfected in young, old and geriatric satellite cells, in combination with Baf, we found a higher blockade of autophagic flux in geriatric than old cells, with respect to young cells. In the absence of Baf, red-color-labeled LC3 puncta (mature autolysosomes) were only abundant in young cells. Baf treatment induced yellow-color-labeled LC3 puncta (non-fused autophagosomes) accumulation in young cells, which was lower or blunted in old and geriatric cells (Fig. 2a). Geriatric satellite cells also showed increased colocalization of p62-ubiquitin aggregates in non-degraded autophagosomes (Fig. 2b). As p62 marks damaged organelles for degradation by selective autophagy, while Ub marks substrates for their degradation by both the ubiquitin-proteasome system (UPS) and
5 selective autophagy, the increased signal of both proteins and their colocalization demonstrates that the defect on autophagy in these cells is due, at least in part, to a block in autophagosomes/lysosomes clearance. To investigate if restoring autophagy could rescue the cell-intrinsic irreversible cellcycle and regenerative block of geriatric cells, we engrafted freshly-isolated GFP-labeled young and geriatric satellite cells (pre-treated with Rapamycin or control-vehicle) into preinjured muscles of young-recipient mice. Autophagy reactivation significantly restored expansion of geriatric cells (expressing Pax7, Ki67, MyoD or Mgn) after 4-day engraftment (Fig. 2c; Extended Data Fig. 2a-c) and prevented senescence (geroconversion), as shown by p16INK4a and H2AX reduction (Extended Data Fig. 2d). Rapamycin (or Spermidine) treatment also decreased geriatric senescent cells (β-galactosidase-positive, SA-β-gal+) (Extended Data Fig. 2e, 2f) and re-established proliferation (Extended Data Fig. 2e). More importantly, genetic-autophagy refueling, by overexpressing Atg7 (crucial for autophagosome formation) (Fig. 2c; Extended Data Fig. 2g, 2h) rescued the proliferative defect, while reducing senescence (Extended Data Fig. 2e). Furthermore, satellite cell transplantation and whole-muscle graft experiments demonstrated that the sole Atg7 introduction in geriatric satellite cells rescued their intrinsic regenerative capacity, allowing new muscle-fiber formation (Fig. 2c; Extended Data Fig. 2i, 2j). Genetic autophagy inhibition in young quiescent satellite cells causes senescence entry To investigate if basal autophagy dysruption causally breaks quiescence, we intercrossed Atg7-floxed mice with Pax7-Cre and Pax7-CreER mice, to impair autophagy constitutively (Atg7ΔPax7) or inducibly (Atg7ΔPax7ER) after tamoxifen administration). Intercrossing Atg7ΔPax7 with GFP-LC3 mice (Atg7ΔPax7:GFP-LC3) confirmed loss of autophagosomes in quiescent Atg7-null satellite cells (Extended Data Fig. 3a, 3b). Importantly, the satellite cell pool was severely reduced in Atg7ΔPax7 mice (Fig. 3a; Extended Data Fig. 3c). Tamoxifen administration to 3-month-old Atg7ΔPax7ER mice led to satellite cell loss after 30 days (Fig. 3b), indicating that basal autophagy is required for both establishment and maintenance of the adult quiescent stem cell population. Remaining Atg7ΔPax7ER satellite cells showed unexpected induction of p16INK4a, p21CIP1 and p15INK4b, and DNA damage (H2AX+ cells) –signs of premature aging (Fig. 3c, 3d; Extended Data Fig. 3d). Of note, Atg7ΔPax7 satellite cells did not undertake mitotic or myogenic differentiation pathways (Extended Data Fig. 3e). Thus, loss of autophagy with aging may causally underlie the age-associated muscle stem cell numerical decline5,6,810,25. In response to muscle injury, Pax7+ cells from young Atg7ΔPax7 mice showed reduced activation and expansion capacity (Fig. 3e; Extended Data Fig. 3f), and accelerated entry into deep senescence23,26 (geroconversion27) in vivo and in vitro, as demonstrated by: SA-β-gal+-staining (Fig. 3f), H2AX+, p16INK4a+ and phosphorylated-S6+ cells, and regenerative failure, shown by reduced cell proliferation and size of regenerating fibers (Fig. 3g; Extended Data Fig. 3g-l). Confirming the cell-intrinsic regenerative failure, fewer GFP+ fibers derived from Atg7-null satellite cells were found in transplantation experiments (Extended Data Fig. 3m, 3n), and this failure could not be rescued by Rapamycin (nor Spermidine) (Extended Data Fig. 3m-o).
6 Mitophagy failure and ROS-induction drive senescence in autophagy-deficient satellite cells How could loss of autophagy in young quiescent satellite cells induce premature aging? Genetic autophagy impairment in satellite cells caused rapid accumulation of p62/Ub-positive aggregates, and mitochondria and lysosomes (mitotracker, and lysotracker and Lamp1), as in aged cells (Fig. 4a, 4b; Extended Data Fig. 4a). There was also a lower proportion of healthy mitochondria in old (and Atg7 ΔPax7ER ) satellite cells, as revealed by reduced membrane potential (lower ratio TMRM/MitoTrackerGreen MFI) (Fig. 4a, 4b). Furthermore, mitophagy (cellular capacity to clear by autophagy damaged mitochondria) was defective in geriatric satellite cells, as indicated by mitochondria accumulation inside autophagosomes/lysosomes (through mitochondria/lysosomes (TOM20/Lamp1) colocalization) (Extended Data Fig. 4b). In vivo Rapamycin (or Spermidine) treatment of geriatric mice restored mitophagy in satellite cells (Extended Data Fig. 4b-f). Consistent with age-impaired mitophagy, young, but not geriatric, cells, were capable of eliminating CCCP-damaged mitochondria (Extended Data Fig. 4d, 4e). How does altered mitophagy lead to satellite cell senescence with aging? We detected higher levels of reactive-oxygen species (ROS), Parkin (marking damaged mitochondria for degradation by mitophagy), and DNA-damage markers in Atg7-deficient satellite cells (Extended Data Fig. 5a, 5b; Fig. 3d, 3g; Extended Data Fig. 3h), associated to p16INK4a and pS6 induction (Fig. 3g; Extended Data Fig. 3g; Extended Data Fig. 4h). Higher ROS and ROS-mitochondria colocalization were also observed in geriatric satellite cells, correlating with impaired mitophagic flux (Fig. 5a; Extended Data Fig. 4g). Of note, Baf-induced autophagy block caused greater mitochondria accumulation in young cells, compared to geriatric and Atg7ΔPax7ER cells, paralleling ROS increase (Fig. 5b). To address their role, ROS were inhibited with Trolox (vitamin E analog) (Extended Data Fig. 5c). Trolox treatment of old GFP-LC3 mice increased GFP-LC3 puncta (after Baf-treatment) and reduced p62/Ub aggregates and mitochondria-ROS colocalization in GFP-LC3 satellite cells (Extended Data Fig. 4g; Extended Data Fig. 5d). Attenuation of autophagic block by ROS inhibition was further confirmed in Baf-treated aged cells through LC3-II accumulation (Extended Data Fig. 5e, 5f) and mRFP-GFP-LC3 tandem-reporter, which detected reduced autophagosomes (RFP+/GFP+ puncta) and rescued autophagic flux (Extended Data Fig. 5g). Importantly, Trolox treatment prevented appearance of senescence markers (Fig. 5d, 5e), restored expansion (Fig. 5d), and rescued the cellintrinsic proliferative/regenerative defect of geriatric satellite cells after transplantation (Fig. 5f; Extended Data Fig. 5h). Thus, increased ROS, resulting from impaired autophagy, drive satellite cell senescence in aged cells. Loss of the polycomb repressive complex-1 (PRC1)-mediated H2A monoubiquitination of lysine119 (H2Aub) at INK4a locus drives p16INK4a induction in geriatric satellite cells6 (Extended Data Fig. 5i). We found that Trolox treatment restored INK4a locus H2Aub modification in geriatric and Atg7-deficient satellite cells (Fig. 6a, 6b), resulting in p16INK4a repression, and this reduced senescence while promoting proliferation (Fig. 5c-e; Extended Data Fig. 5j; Fig. 6c). Notably, p16INK4a genetic-silencing with shorthairpin-RNA restored proliferation in Atg7ΔPax7 satellite cells while reducing senescenceassociated genes and SA-β-gal+ cells, and augmenting their regenerative capacity (Extended Data Fig 5k; Extended Data Fig. 6a, 6b). Thus, the ROS-induced p16INK4a axis links impaired autophagy and senescence in aging satellite cells. Human geriatric satellite cells exhibit autophagy defects that promote senescence
7 Skeletal muscles from geriatric individuals show sarcopenia and presence of senescent satellite cells (Extended Data Fig. 6c, 6d)6. As in mice, human satellite cells from geriatric individuals showed defective proteinand organelle-clearance, as evidenced by p62 and mitochondrial accumulation (Extended Data Fig. 6e, 6f) compared to young cells, which was tightly-associated with increased ROS levels (Extended Data Fig. 6f, 6g) and SA-β-gal+ cells (Extended Data Fig. 6h), consistent with reduced proliferative potential (Extended Data Fig. 6i). The causal role of impaired autophagy on the geroconversion of aging human satellite cells under proliferative pressure was sustained by the capacity of Rapamycin to revert the abnormal mitochondrial content, protein aggregates and ROS (Extended Data Fig. 6e, 6f), and senescence phenotype (Extended Data Fig. 6h-k). Thus, restoration of autophagy and organelle homeostasis in aged human satellite cells suffices to rescue senescence, as in murine satellite cells.
8 DISCUSSION In tissues with little turnover, reversible quiescence is the normal stem-cell state throughout life. However, quiescence is known to be progressively lost with aging due to systemic/nicheand intrinsic-factor alterations2,5. Recent studies showed that at geriatric age, the normal stem-cell quiescent state is substituted by an irreversible senescence state, which results in numerical and functional stem cell decline6. The mechanisms accounting for maintenance of quiescence, preservation of the stem cell pool and prevention of senescence during an individual’s life remain largely unknown. Our results demonstrate that quiescent satellite cells are equipped with cytoprotective and cellular quality control mechanisms that actively repress the senescence program, thereby preserving cells’ integrity and fitness. We provide evidence of loss of autophagy in satellite cells with aging, resulting in accumulation of damaged proteins and organelles, leading to senescence and stem cell exhaustion. Consistent with this, genetic inhibition of autophagy specifically in satellite cells of young mice caused rapid senescence entry, resulting in stem-cell numerical and functional exhaustion, and defective muscle regeneration. These findings came as a double-surprise considering that basal-autophagy decline in quiescent stem cells of physiologically aged mammalian organisms was not described before, and that autophagy was normally considered an effector pathway, rather than a cause, of senescence, particularly in oncogene-induced senescence28-31. How can autophagy balance quiescence and senescence in muscle stem cells? Here we show that in adult resting muscle, quiescent stem cells attenuate proteotoxicity by maintaining high basal autophagy flux, constituting a homeostatic “clean up” process. This function is particularly critical in a non-dividing stem cell, where mitotic dilution of intracellular toxic debris does not take place17,32. Autophagy failure in aged resting stem cells leads to accumulation of damaged proteins and dysfunctional organelles, specially mitochondria, which generates enhanced ROS levels that cause DNA damage and senescence entry, consistent with previous studies33-39. Indeed, we uncover ROS as a key epigenetic regulator of the senescence-promoting gene p16INK4a in aging stem cells, by impeding PRC1-mediated lysine119 H2A-ubiquitination, the required epigenetic mark for INK4a locus silencing. Consistent with this, treatment of geriatric mice (and mice with satellite cell-specific Atg7 deficiency) with antioxidants not only restored PRC1-mediated INK4a locus repression and prevented satellite cell senescence, but also restored regenerative capacity. Importantly, signs of impaired autophagy and loss of proteostasis, correlating with senescence and defective myogenic functions, were also observed in human satellite cells from geriatric individuals. At variance with our findings, a recent elegant study demonstrated that, upon in vitro stress, autophagy does not decline, but is even induced in hematopoietic stem cells (HSCs) with aging, consistent with maintenance of HSC number40. Thus, we propose that long-lived quiescent stem cells within low turn-over tissues primarily rely on autophagy to preserve fitness and avoid senescence, and that stem cells of skeletal muscle particularly lose this protection during aging (Extended Data Fig. 6f). Of interest, a recent study also reported the need of autophagy for activation of young satellite cells41. Our studies thus demonstrate that autophagy is a decisive factor between the quiescence and senescence fate of muscle stem cells (Extended Data Fig. 6l). Although aging-induced senescence is often viewed as an inescapable and irremediable process, we provide evidence that in vivo restoration of constitutive autophagy (or neutralization of excessive ROS) averts intracellular damage accumulation, and prevents satellite cell
9 senescence and functional decline in old mice, as well as in aged human stem cells, reinforcing the notion that the intrinsic-aging clock in stem cells can be pharmacologically manipulated.
16 intensity of each event (in average) of the selected cell population, in the chosen fluorescence channel. Whole transcriptome analysis of FACS sorted satellite cells FACS sorted satellite cells were collected in lysis buffer and RNA extraction was performed using RNeasy Micro kit (Qiagen). cDNA was used on a transcriptome analysis by Agilent SurePrint G3 Mouse GE 8x60K high density microarray slides, performed at the microarray Unit of CRG (Barcelona, Spain). Microarray analysis was performed with 3 animals each. Data was normalized using cyclic loess, and differentially expressed genes were identified using AFM 4.044 for all pairwise comparisons. Raw data was taken from the Feature Extraction output files and was corrected for background noise using the normexp method. To assure comparability across samples quantile normalization was used. Differential expression analysis was carried out on non control probes with an empirical Bayes approach on linear models (limma). Results were corrected for multiple testing according to the False Discovery Rate (FDR) method. Statistical analysis was performed with the Bioconductor project (http://www.bioconductor.org/) in the R statistical environment. Venn diagrams were generated using BioVenn45. In vivo treatments Autophagy of aged C57BL/6 and GFP-LC3 mice was induced as follows: one group of mice was i.p. injected with 4mg/kg BW Rapamycin (LC Laboratories) or vehicle (DMSO) every other day for 2 weeks; a second group was i.p. injected with 30mg/kg BW Trolox (6hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid, Sigma) or vehicle (DMSO) daily for 2 weeks; and the third group of mice was treated with 3mM Spermidine (S2626 Sigma) in drinking water for 2 weeks. Satellite cell engraftment Satellite cell transplants were performed as in Sousa-Victor et al., 20146, following an adapted protocol46. Basically, quiescent FACS-isolated satellite cells were collected, resuspended in 20% FBS HAM’S F10 medium and injected into muscles of recipient mice previously injured with CTX the day before. Recipient mice were SCID mice. For each mouse, 10,000 cells were injected. At 4 days (for proliferation, senescence analyses) or 1 month (muscle regeneration) after cell injections, engrafted muscles were collected and processed for muscle histology. Results are expressed as % of GFP+ cells counted per muscle section (being 100% the young cells control data). In vitro treatments Experiments for in vitro rescue of defective autophagy in satellite cells were performed in 20% FBS-containing HAM’S F10 medium (Growth medium), and adding either Rapamycin (100ng/ml, LC Laboratories), Trolox (25μl/ml, Sigma), Spermidine (5μM, Sigma) or vehicle (DMSO) for 48 h. Mitochondrial, lysosomal, and ROS analyses or ChIP experiment were performed right after treatments, while proliferation assay (BrdU staining) and senescence analysis (SA-β-gal assay and determination of RNA, protein expression of senescence markers), were performed 96 h after treatments. Satellite cell treatments for in vivo engraftment in injured muscles: Freshly FACS isolated satellite cells from resting muscle of young and geriatric mice were treated for 48 h with Rapamycin (100ng/ml, LC Laboratories), Trolox (25μl/ml, Sigma) or vehicle (DMSO) prior to engraftment into pre-injured muscles of recipient mice. For each mouse, 10,000 cells
17 were injected. At 4 days after cell injections, engrafted muscles were collected and processed for muscle histology. Bafilomycin (10nM Sigma B1793) was used to block autophagy for 4 h at 37ºC and to analyze autophagosome accumulation by FACS, immunostaining and Western blotting. CCCP (Carbonyl cyanide 3-chlorophenylhydrazone) (10μM Sigma C2759), which abolishes the link between the respiratory chain and the phosphorylation system in intact mitochondria, causes mitochondria uncoupling and was used to treat satellite cells in vitro for 1 h to induce the selective autophagy of CCCP-damaged mitochondria (mitophagy). Plasmid transfection Freshly isolated cells were transfected with mRFP-GFP-LC320 plasmid using Lipofectamine 3000 (Invitrogene), and further treated for 48h with Trolox (25μl/ml, Sigma) or vehicle (DMSO) for analysis on glass slides (Thermo Scientific 177402). Cells were fixed with 4% paraformaldehyde (PFA) in PBS for 10 minutes and nuclei were stained with DAPI (Invitrogen). After washing, glass slides were mounted with Mowiol. Measuring autophagy flux through this method is based on the concept of lysosomal quenching of GFP. GFP is a stably folded protein and relatively resistant to lysosomal proteases. However, the low pH inside the lysosome quenches the fluorescent signal of GFP, which makes it difficult to trace the delivery of GFP-LC3 to lysosomes. In contrast, RFP exhibits more stable fluorescence in acidic compartments, and mRFP-LC3 can readily be detected in autolysosomes. By exploiting the difference in the nature of these two fluorescent proteins (i.e., lysosomal quenching of GFP fluorescence versus lysosomal stability of RFP fluorescence), autophagic flux can be morphologically traced with an mRFP-GFP-LC3 tandem construct20. With this tandem construct, autophagosomes and autolysosomes are labeled with yellow (i.e., mRFP and GFP) and red (i.e., mRFP only) signals, respectively. Proliferation assay Satellite cells were labeled with BrdU (1.5 μg ml−1; Sigma) for 1 h. BrdU-labeled cells were detected by immunostaining using rat anti-BrdU antibody (Oxford Biotechnology; 1:500) and a specific secondary biotinylated goat anti-rat antibody (Jackson Inmunoresearch; 1:250). Antibody binding was visualized using Vectastain Elite ABC reagent (Vector Laboratories) and DAB. BrdU-positive cells were quantified as percentage of the total number of cells analyzed. Senescence-associated β-galactosidase activity Senescence-associated β-galactosidase (SA-β-gal) activity was detected in satellite cells using the Senescence β-Galactosidase Staining kit (Cell signaling), according to the manufacturer’s instructions. SA-β-gal-positive cells were quantified as percentage of the total number of cells analyzed. Lentivirus infection Freshly isolated satellite cells were ex vivo infected with distinct lentivirus for 12 h. Medium was replaced and cells were transplanted into injured muscle of recipient mice for in vivo analysis, or subjected to in vitro assays. LV-Atg7, used for Atg7 overexpression in satellite cells, was kindly provided by Eliezer Masliah’s laboratory47. LV-sh p16INK4a, used to silence p16INK4a, and LV-sh Scramble (used as control), were previously described in Sousa-Victor et al, 20145.
18 Heterografting experiments Extensor digitorum longus (EDL) muscles from geriatric WT mice were infected with Lentivirus (LV-Atg7 or LV-GFP, as well as LV-shp16INK4a or LV-sh Scramble) and grafted immediately onto the tibialis anterior (TA) muscle of young WT recipient mice, and regeneration (formation of new myofibers derived from EDL-associated satellite cells) in the transplanted EDL muscles was analyzed after 6 or 8 days. Fiber size of eMHC+ myofiber was analyzed using Fiji program. RT–qPCR: RNA extraction, cDNA synthesis and PCR Total RNA was isolated from either FACS-isolated satellite cells of mouse muscle tissue or human myoblasts obtained from human muscle biopsies, using Tripure reagent (Roche Diagnostic Corporation) or RNeasy Micro kit (Qiagen), and analysed by RT–qPCR. For qPCR experiments, DNase digestion of 10 mg of RNA was performed using 2 U DNase (Turbo DNA-free, Ambion). Complementary DNA (cDNA) was synthesized from total RNA using the First-Strand cDNA Synthesis kit (Amersham Biosciences). Real-time PCR reactions were performed on a LightCycler 480 System using Light Cycler 480 SYBR Green I Master reaction mix (Roche Diagnostic Corporation) and specific primers. Thermocycling conditions were as follows: initial step of 10 min at 95 °C, then 50 cycles of 15 s denaturation at 94 °C, 10 s annealing at 60 °C and 15 s extension at 72 °C. Reactions were run in triplicate, and automatically detected threshold cycle (Ct) values were compared between samples. Transcript of the ribosomal protein L7 housekeeping gene was used as endogenous control, with each unknown sample normalized to L7 content. The following primers were used: Gene Forward primer Reverse primer p16INK4a CATCTGGAGCAGCATGGAGTC GGGTACGACCGAAAGAGTTCG p21CIP1 CCAGGCCAAGATGGTGTCTT TGAGAAAGGATCAGCCATTGC MyoD GCCGCCTGAGCAAAGTGAATG CAGCGGTCCAGGTGCGTAGAAG Mgn GGTGTGTAAGAGGAAGTCTGTG TAGGCGCTCAATGTACTGGAT Ki67 ACCGTGGAGTAGTTTATCTGGG TGTTTCCAGTCCGCTTACTTCT p15INK4b TCTTGCATCTCCACCAGCTG CTCCAGGTTTCCCATTTAGC Atg7 TCTGGGAAGCCATAAAGTCAGG GCGAAGGTCAGGAGCAGAA Electron microscopy images For electron microscopy images, tibialis anterior (TA) muscles from 3 and 24 month-old WT mice were fixed with 2% paraformaldehyde/2,5% glutaraldehyde in phosphate buffer (0.1M-pH7.4). Samples were processed by the CCit Microscopy Facility at the University of Barcelona. Images were acquired using a Jeol 1010 microscope, working at 80 kv and equipped with a CCD Megaview III camera. Identification of satellite cells in skeletal muscle by electron microscopy was based on cell size, content of heterochromatin and
19 position with respect to basal lamina. Western blotting Preparation of mouse and human satellite cell lysates and Western blotting was performed as described previously by Perdiguero et al. 200748. Antibodies used were: anti-p62/SQSTM1 antibody produced in rabbit (Sigma P0067), rabbit anti-LC3 (Novus Biologicals NB100-2331), phospho-S6 ribosomal protein (Ser240/244) XPTM Rabbit mAb (Cell Signaling 5364), rabbit anti-p16 (Santa Cruz Biotechnology sc-1207), rabbit antiParkin (Abcam ab15954), S6 ribosomal protein (54D2) mouse (Cell Signaling 2317), γH2AX Ser 139 (Cell Signaling 2577S), rabbit anti-53BP1 (Abcam ab21083) and Tubulin (Sigma T-6199). Chromatin Immunoprecipitation (ChIP) Briefly, freshly isolated satellite cells were cultured with Trolox or vehicle (DMSO) for 48 h and cross-linked with 1% formaldehyde for 15 min at room temperature. For each ChIP, 300,000 cells were lysed in 130 L of Lysis Buffer B (Low Cell ChIP Kit, Diagenode) and chromatin was sonicated for 10 min in a M220 Focused-ultrasonicator™, Covaris (Duty cycle 5%, Peak incident power 75 Watts and 200 cycles per burst). Sonicated chromatin was then diluted and subjected to immunoprecipitation with 3 L of antibody against Ubiquityl-Histone H2A (Lys119) (D27C4) (Cell Signaling, 8240) or 3 L of IgG. Bound fraction and input were analyzed by qPCR using specific primer sets for the INK4a locus. Gene INK4a_RD INK4a_exon1 INK4a_exon2 Forward primer GGTCTCCCCTAGCAGGA TTC CCGGAGCCACCCATTAA ACTA CCCAACACCCACTTGAG GAA Reverse primer GCCTGTCATTAAACAGGGTGA CAAGACTTCTCAAAAATAAGACACT GAAA CAGAGGTCACAGGCATCGAA Histology and immunohistochemistry in muscle cryosections Tibialis anterior (TA) and extensor digitorum longus (EDL) muscles were frozen in isopentane cooled with liquid nitrogen, and stored at −80 °C until analysis. 10 μm sections were collected from muscles and were either stained with hematoxylin/eosin (HE) or immunostained. Labelling of cryosections with mouse monoclonal primary antibodies was performed using the peroxidase or fluorescein M.O.M kit staining (Vector Laboratories) according to the manufacturer’s instructions. Double immunostaining was performed by sequential addition of each primary and secondary antibody using appropriate positive and negative controls. Sections were air dried, fixed on PFA 2–4%, washed on PBS and incubated with primary antibodies according to manufacturer’s instructions after blocking for 1 h at room temperature with a high protein-containing solution on PBS (Vector Laboratories). Subsequently, the slides were washed on PBS and incubated with appropriate secondary antibodies and labelling dyes. For immunofluorescence, secondary antibodies were coupled to Alexa-488, Alexa-568 or Alexa-647 fluorochromes, and nuclei were stained with DAPI (Invitrogen). After washing, tissue sections were mounted with
20 Mowiol. Antibodies used for immunohistochemistry Immunohistochemistry on muscle cryosections or isolated satellite cells was performed with the following antibodies: GFP (Invitrogen A6455 and Aves labs GFP-1020), antieMHC (F1.652), anti-Pax7 (DSHB), p16 (Santa Cruz sc-1207), γH2AX Ser 139 (2577S), rabbit polyclonal anti-MyoD (Santa Cruz Biotechnology sc-760), anti-myogenin (DSHB F5D), poly ubiquitinylated proteins, multi ubiquitin chains, mouse mAb (Enzo life sciences PW8805), anti-p62/SQSTM1 antibody produced in rabbit (Sigma P0067), mouse monoclonal antibody to LC3 (NanoTools 5F10), LAMP-1 (Santa cruz Biotechnology sc-19992), phospho-S6 ribosomal protein (Ser240/244) XPTM Rabbit mAb (Cell Signaling 5364), anti-CD56 (BD Pharmingen 556325), anti-TOM20 (ab56783). Human muscle samples Muscle biopsies from eight adults and ten geriatric (28 ± 7 and 83 ± 7 years old, respectively) human subjects were obtained via the Tissue Banks for Research from Vall d’Hebron and Sant Joan de Deu Hospitals and especially via the EU/FP7 Myoage Consortium. Muscle biopsies were taken from the vastus lateralis muscle under local anaesthesia (2% lidocaine). A portion of the muscle tissue was directly frozen in melting isopentane and stored at −80 °C until analysis. Human primary myoblasts from 5 young/adult (25 ± 4 years old) and 5 geriatric (75 ± 4 years old) subjects were obtained from the EU/FP7 Myoage Consortium or purchased from Cook Myosite and cultured following the provided instructions. Digital image acquisition and processing Digital images were acquired using: (1) an upright microscope DMR6000B (Leica) equipped with a DFC300FX camera for immunohistochemical color pictures and a Hamamatsu ORCA-ER camera for immunofluorescence pictures; (2) confocal images of muscle sections or isolated satellite cells were taken using either a Zeiss LSM-780 confocal system with a Plan-Apochromat 63x/1.4 oil objective or a Leica SPE confocal laser scanning microscope system with HCX PL Fluotar 10×/0.30, 20×/0.50 and 40×/0.75 objectives. The different fluorophores (3 to 4) were excited by using the 405, 488, 568 and 633 excitation lines. Acquisition was performed using Zeiss LSM software Zen Black or Leica Application or LAS AF software (Leica). Images were composed and edited in Photoshop CS5 (Adobe), where background was reduced using brightness and contrast adjustments applied to the whole image. To assess myofiber size, individual fibers were manually outlined and their cross-sectional area (CSA) was determined with the public domain image analysis software Fiji. Fluorescence intensity of selected proteins for each cell was quantified using Fiji software and the average of relative fluorescence was expressed as MFI. The number and percentage of cellular area occupied by GFP-LC3 puncta were determined on digital images with Fiji and the cell image analysis software CellProfiler49. Colocalization of RFP-LC3 and GFP-LC3 puncta was determined on the maximum projection of three Z-sections using a Fiji automated macro pipeline calculating single and double-positive autophagosomes. Colocalization of p62/Ub was determined on digital images Fiji, according to50, with respect to the total cellular area. The Pearson’s coefficient (r) was used to analyze the correlation of the intensity values of green and red pixels in
21 dual-channel images. This coefficient measures the strength of the linear relationship between the intensities in two images calculated by linear regression and ranges from 1 to −1, with 1 standing for complete positive correlation and −1 for a negative correlation, with zero standing for no correlation49. Video reconstructions of autophagosomes were generated in Imaris software using full confocal z-stacks (around 20) of each cell. Z-stacks were previously imported to Fiji software for background adjustments and then deconvolved using the blind-deconvolution wizard of Huygens software. Statistical analysis For mouse experiments, no specific blinding method was used but mice in each sample group were selected randomly. The sample size (n) of each experimental group is described in each corresponding figure legend, and all experiments were repeated at least with three biological replicates. GraphPad Prism software was used for all statistical analyses. Quantitative data displayed as histograms are expressed as means ± standard error of the mean (represented as error bars). Results from each group were averaged and used to calculate descriptive statistics. Mann–Whitney U-test (independent samples, two-sided) was used for pairwise comparisons among groups at each time point. Statistical significance was set at a P value <0.05.
22 42 Masiero, E. et al. Autophagy is required to maintain muscle mass. Cell Metab 10, 507-515, (2009). 43 Suelves, M. et al. uPA deficiency exacerbates muscular dystrophy in MDX mice. The Journal of cell biology 178, 1039-1051, (2007). 44 Breitkreutz, B. J., Jorgensen, P., Breitkreutz, A. & Tyers, M. AFM 4.0: a toolbox for DNA microarray analysis. Genome biology 2, SOFTWARE0001 (2001). 45 Hulsen, T., de Vlieg, J. & Alkema, W. BioVenn - a web application for the comparison and visualization of biological lists using area-proportional Venn diagrams. BMC Genomics 9, 488, (2008). 46 Sacco, A. et al. Short telomeres and stem cell exhaustion model Duchenne muscular dystrophy in mdx/mTR mice. Cell 143, 1059-1071, (2010). 47 Crews, L. et al. Selective molecular alterations in the autophagy pathway in patients with Lewy body disease and in models of alpha-synucleinopathy. PLoS One 5, e9313, (2010). 48 Perdiguero, E. et al. Genetic analysis of p38 MAP kinases in myogenesis: fundamental role of p38alpha in abrogating myoblast proliferation. The EMBO journal 7, 1245-1256. (2007). 49 Kamentsky, L. et al. Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software. Bioinformatics 27, 1179-1180, (2011). 50 Bolte, S. & Cordelieres, F. P. A guided tour into subcellular colocalization analysis in light microscopy. Journal of microscopy 224, 213-232, (2006).
23 EXTENDED DATA Extended Data 1. The reduced autophagy flux in quiescent satellite cells can be pharmacologically refueled in vivo. a, Venn diagrams of overlapping genes between a proteostasis gene set (See Supplementary Table 1) and genes significantly upregulated in quiescent satellite cells from the indicated publications or from our gene expression microarray data comparing freshly FACS isolated satellite cells from resting muscle, or muscle injured with cardiotoxin (CTX) for 72 h, from young WT mice. b, K-means clustering analysis (performed with Gene-E, Broad Institute) of the gene expression of the autophagy-related genes during aging. Clusters are shown with heat maps of the normalized raw data. Each column represents a different sample and each row a different gene probe. Red, increased expression; white, neutral expression; blue, decreased expression. c, Representative example of the FACS strategy and gating scheme to isolate satellite cells from mice in resting conditions. d, Pax7 and GFP immunostaining of freshly isolated satellite cells from resting muscles of young and old GFP-LC3 mice. Scale bar, 5 μm. e, Electron microscopy images of young and old satellite cells on sections of resting tibialis anterior (TA) muscle of WT mice. Arrowheads indicate autophagic vesicles. Scale bar, 1 and 0.5 μm (right and left, respectively). f, Pax7 and GFP immunostaining on tissue sections from resting TA muscles of young and old GFP-LC3 mice. Arrowheads indicate autophagic vesicles. Scale bar, 5 μm. g, p62/ubiquitin (Ub) MFI. Arrowheads: p62/Ub-aggregates colocalization. h, LC3 Western blot of freshly isolated satellite cells from young and old WT mice, treated with Bafilomycin (+Baf) or vehicle for 4 h prior to collection. Graph shows LC3II quantification, after normalization with Tubulin levels. i, p62 Western blotting of freshly isolated satellite cells from young and old WT mice. Graph shows p62 quantification, after normalization with Tubulin levels. j, Quiescent satellite cells were freshly isolated from old WT mice subjected to 2-week Rapamycin, Spermidine or vehicle (control) treatment. Cells were treated or not with Bafilomycin 4 h prior analysis by immunostaining of LC3 marker. Z projections of representative fluorescence microscopy images are shown. Scale bar, 5 μm. k, Representative fluorescent microscopy images from Fig. 1d. Scale bar, 5 μm. Data show mean ± s.e.m. Comparisons by two-side Mann-Whitney U-test. P values are indicated. Number of samples, a,b) n=3 animals/group; g) n=35 (Young) and 66 (Old), 3 animals; h,i) n=3 animals/group. Extended Data 2. Reinduction of autophagy rescues proliferation and reduces senescence in geriatric satellite, thus restoring regenerative capacity. a, Transplanted muscles from Fig. 2c were immunostained for GFP and for Ki67/Pax7/MyoD/Mgn (to decipher the distinct possible myogenic states of satellite cells in the regenerating muscle). Scale bar, 50 μm. b, Autophagy flux analyzed by flow cytometry in freshly isolated satellite cells from resting muscle of GFP-LC3 mice, treated for 48 h with Rapamycin or vehicle (control). Satellite cells were treated with Bafilomycin (+Baf) or vehicle for 4 h prior to analysis. Results are expressed as a relative variation of GFP–LC3 MFI in -Baf compared to +Baf conditions. c, Western blot analysis of phospho-S6 (pS6) protein levels in young and geriatric satellite cells from WT mice, treated for 48 h with Rapamycin or vehicle (control). Graph shows pS6 quantification, normalized to Tubulin. d, As in Fig. 2c, percentage H2AX+/GFP+ or p16INK4a+/GFP+ cells from total-GFP+ cells are quantified. Scale bar, 10 μm. e, Quantification BrdU+ and SA-β-gal+ satellite cells, pretreated as in Fig. 2c and analysed after 96h. f, Quantification of senescent (SA-β-gal+)
24 satellite cells, isolated from young and geriatric WT mice, pre-treated for 48 h with Spermidine or vehicle (control) and cultured for 96 h. g, Quantitative real-time PCR (RTqPCR) analysis of Atg7 expression on satellite cells infected with LV-Atg7 or LV-control (LV-Co), and cultured for 96 h. h, GFP-LC3 satellite cells were infected with LV-Atg7 or LV-Co and treated with Bafilomycin (+Baf) or vehicle for 4 h prior to analysis. Autophagy flux was analyzed by flow cytometry and represented as in (b). Representative images are shown. Scale bar, 10 μm. i, Muscle regeneration experiment by satellite cell transplantation: Equal number of satellite cells from young and geriatric mice infected with a lentivirus overexpressing Atg7 gene (LV-Atg7) or a lentivirus control (LV-Co), which also expressed GFP, were transplanted into injured muscle of young immunodeficient mice, and collected 28 days later. GFP expression in muscles was analyzed by immunostaining. Quantification of GFP+ cells (fibers) per muscle field vs. transplanted control-treated satellite cells and representative images are shown. Scale bar, 75 μm. j, EDL geriatric muscles, infected with LV-Atg7 or LV-Co, and grafted on recipient mouse-muscle, and regeneration analyzed 8-days-later. Frequency distribution of regenerating fibers by size. Scale bar, 25 μm. Data as mean ± s.e.m. Comparisons by two-side Mann-Whitney U-test. P values are indicated. Number of samples, b) n=20.000 cells/animal, 3 animals; c) n=3 animals/group; d) n=5 engraftments/group; e-g) n=3 animals/group; h) n=20.000 cells/animal, 3 animals; i) n=3 engraftments/group; j) n=4 engraftments/group. Extended Data 3. Genetic impairment of autophagy in young quiescent satellite cells leads to premature senescence and impaired muscle regeneration. a, RT–qPCR analysis of Atg7 expression and Western blot analysis of LC3, p62 and Tubulin of satellite cells isolated from Atg7WT and Atg7ΔPax7 mice. Graph shows the quantification of p62 normalized to Tubulin. b, Quiescent satellite cells were freshly isolated from Atg7WT and Atg7ΔPax7 mice which had been subjected to 2-week Rapamycin or vehicle (control) treatment in vivo. Cells were treated or not with Bafilomycin 4 h prior analysis by fluorescence microscopy. Z projections of representative fluorescence microscopy images are shown. Scale bar, 5 μm. c, Quantification of satellite cells in resting muscle of 3 month-old Atg7WT and Atg7ΔPax7 mice by flow cytometry analysis (α7integrin+ CD34+ cells per gram of muscle tissue). d, Representative fluorescent microscopy images from Fig. 3d. Scale bar, 10 μm. e, RT-qPCR analysis of MyoD, Myogenin (Mgn), and Ki67 expression in freshly isolated quiescent satellite cells from resting muscle of Atg7WT and Atg7ΔPax7ER mice, 7 days after tamoxifen treatment. f, Percentage of activated-satellite cells (Pax7+/MyoD+) from total-Pax7+ cells (FACSisolated 14-h post-injury from (a)). Scale bar, 50 μm. g, pS6/Lamp1-immunostaining of cells from (a). Scale bar, 10 μm. h, H2AX protein levels per nucleus on Pax7+ satellite cells in TA muscles of Atg7WT and Atg7ΔPax7ER mice, 15 days post-injury. Representative images are shown. Scale bar, 25 μm. i, Pax7+ satellite cells were quantified following immunostaining on regenerating muscles of Atg7WT and Atg7ΔPax7ER mice 7 and 15 days post cardiotoxin (CTX) injury. j, Representative images of hematoxilin/eosin staining of muscles at 7 days post-injury on muscles of Atg7WT and Atg7ΔPax7ER mice. Fiber size of central-nucleated myofibers at 7 and 28 days post-injury is quantified. Scale bar, 50 μm. k, TA muscles of Atg7WT and Atg7ΔPax7 mice were injured by CTX injection and, 21 days after, these muscles were reinjured and analyzed 21 days later (21+21 days post-injury). The size of central-nucleated myofibers was quantified. Representative images are shown. Scale bar, 50 μm. l, Pax7+/Ki67+ satellite cells were quantified following immunostaining on regenerating muscles of Atg7WT and Atg7ΔPax7ER mice 7 days post
25 cardiotoxin (CTX) injury. m, Equal number of quiescent satellite cells from Atg7WT:GFPLC3 and Atg7ΔPax7:GFP-LC3 mice (2-weeks -/+Rapamycin-pre-treated), transplanted as in Fig. 2c, and immunostained with indicated-antibodies 4-days-later. Quantification GFP+cells/muscle field vs. transplanted young WT satellite cells. Representative images are shown. Scale bar, 75 μm. n, Percentage of GFP+/Ki67+ from total GFP+ cells in muscles from (m). o, Quantification of proliferating (BrdU+) and senescent (SA-β-gal+) satellite cells, isolated from Atg7WT and Atg7ΔPax7, pre-treated for 48 h with Spermidine or Rapamycin (or control vehicle) and cultured for 96 h. Data show mean ± s.e.m. Comparisons by two-side Mann-Whitney U-test. P values are indicated. Number of samples, a) n=3 animals/group; c) n=7 animals/group; e-l) n=3 animals/group; m,n) n=4 engraftments/group; o) n=3 animals/group. Extended Data 4. Autophagy loss in satellite cells causes dysfunctional mitophagy and mitochondria accumulation, leading to increased ROS and senescence. a, p62 and ubiquitin (Ub) immunostaining on freshly isolated satellite cells from resting muscle of 3 month-old Atg7WT and Atg7ΔPax7ER mice, 1-month-after tamoxifen-treatment. Arrowheads indicate colocalization of p62 and Ub aggregates. Representative images are shown. Scale bar, 5 μm. b, TOM20 and Lamp1 immunostaining on quiescent satellite cells isolated from young and geriatric WT mice. Mice were subjected to 2-week Rapamycin, Spermidine or Trolox (or vehicle) treatment prior to analysis. Colocalization was calculated as the area occupied by the immunofluorescence co-localizing staining on pictures with respect to the total cellular area. The Pearson’s coefficient (r) was used to analyze the correlation of the intensity values of green and red pixels in dual-channel images. Z projections of representative fluorescence microscopy images are shown. Scale bar, 5 μm. c, Mitochondria quantification by MitoTracker in quiescent satellite cells of old mice, treated with Rapamycin or vehicle for two weeks. d, Mitochondria (MitoTracker) in young/geriatric cells. Satellite cells, pre-treated with CCCP for 1h (see Methods), and -/+Rapamycin for 24h. Percentage of MitoTracker MFI reduction +/-Rapamycin. e, Mitochondrial membrane potential (MP) analysis: Satellite cells were freshly isolated from young WT mice and treated for 1h with CCCP or DMSO (Control). Membrane potential (TMRM MFI/MitoTrackerGreen MFI ratio) of cells was calculated by flow cytometry analysis at 1h and 24h after CCCP treatment (being 100% the MP value of control satellite cells). f, Mitochondria content was quantified by MitoTracker staining of satellite cells from young and geriatric WT mice and treated with Rapamycin or vehicle (control) for 48 h. Z projections of representative fluorescence microscopy images are shown. Scale bar, 5 μm. g, Mitochondria and ROS detection by MitoTracker and CellROX staining, respectively. Colocalization was calculated as in (b). Z projections of representative fluorescence microscopy images are shown. Scale bar, 5 μm. h, Representative images of freshly isolated satellite cells from resting muscle of 3 month-old Atg7WT and Atg7ΔPax7 mice stained with CellROX fluorescent dye and p16INK4a antibody. Scale bar, 5 μm. Data show mean ± s.e.m. Comparisons by two-side Mann-Whitney U-test. P values are indicated. Number of samples, a) n=36 (Atg7WT) and n=38 (Atg7ΔPax7ER), 3 animals; b) n=23 (Young), 24 (Control), 42 (Rapamycin); 28 (Spermidine) and 21 (Trolox), 3 animals; c) n=20000 cells/animal, 3 animals; d) n=10000 cells/animal, 4 animals; e,f) n=10000 cells/animal, 3 animals; g) n=18 (Young), 21 (Control), 15 (Rapamycin) and 13 (Trolox), 3 animals. Extended Data 5. ROS in autophagy-impaired aged and Atg7-null satellite cells
p<0.05 a Pax7+ cells/100 Fibers Atg7WT Atg7Pa 0 2 4 6 8 10 p<0.05 Brdu+ cells (%) Atg7WT Atg7Pa 0 10 20 30 40 50 p<0.003 Atg7WT Atg7Pa SA-ß-gal+ cells (%) 0 2 4 6 8 10 d e f Figure 3 0 2 4 6 8 Pax7+ cells/100 Fibers Atg7WT Atg7Pa p<0.008 bTmx 7 days 30 days Atg7WT Atg7∆Pa Analysis 0 20 40 60 %2+ cells Atg7WT Atg7Pa p<0.02 pS6 S6 Tubulin 2 0.0 0.5 1.0 1.5 Atg7WT Atg7Pa 2b a p<0.05 0 100 200 300 400 500p<0.05 p66 a Atg7WT Atg7Pa Tubulin g cp16INK4a p21CIP1 p<0.04 p<0.04 p15INK4b Atg7WT Atg7Pa a p p<0.05 0.0 0.5 1.0 1.5 2.0 2.5 0.0 0.5 1.0 1.5 2.0 2.5 0.0 0.5 1.0 1.5 2.0
Young Old a 0 p<0.01 Lamp1 MFI Young Old 2 4 6 MitoTracker 0 2000 4000 6000 8000 p<0.04 LysoTracker LysoTracker MFI Young Old MitoTracker Atg7WT Atg7 Atg7WT Atg7 MitoTracker p<0.04 MitoTracker MFI Atg7WT Atg7 0 20000 40000 60000 LysoTracker Atg7WT Atg7 p<0.05 LysoTracker MFI Atg7WT Atg7 0 5000 10000 15000 20000 Atg7WT Atg7 b Figure 4 Young Old p<0.0001 2 4 6 8 0 Lamp1 MFI Dapi Lamp1 Dapi MitoTracker Dapi Lamp1 Dapi Membrane potential (%) Membrane potential (%) Young Old 0 50 100 150p<0.05 0 50 100 150p<0.05 Young Old MitoTracker MFI 0 20000 40000 60000 80000p<0.02
e p<0.04 p<0.0002 mRNA Relative expression p16INK4a p21CIP1 b 0 10 20 30 40 50 p<0.04 0 5 10 15 p<0.04 Brdu+ cells (%) SA-ß-gal+ cells (%) % GFP+ cells/ section p<0.02 a c Figure 5 0 100 200 300 400 500 Trolox Control Geriatric Trolox Control Geriatric 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 Trolox Control GFP Dapi Merge 0.0 0.2 0.4 0.6 0.8 1.0 p<0.02 p<0.03 p16INK4a/Tubulin Ratio 0.0 0.5 1.0 1.5 pS6/Tubulin Ratio p<0.03 p<0.03 Control Young Geriatric Trolox f d Tubulin pS6 p16INK4a Young Control Trolox Geriatric p<0.04 CellROX MFI Young Old 0 200 400 600 800 Young Old Young Old CellROX MitoTracker Young + Baf ∆ Ma MFI (±Baf) 0 5000 10000 15000p<0.05 p<0.02 0 2000 4000 6000 8000 ∆ C MFI (±Baf) Young Geriatric Atg7Pa p<0.03 NS
c Figure 6 pS6/Tubulin Ratio Trolox Control Atg7∆Pa p16INK4a/Tubulin Ratio p16INK4a pS6 S6 Tubulin Atg7WT Atg7∆Pa Control Trolox 0.0 0.5 1.0 1.5 p<0.05 p<0.05 0 1 2 3Atg7WT p<0.05 a H2Aub relative enrichment (bound/input) Trolox Control Geriatric b p<0.041 0 5 10 p<0.002 0 1 2 p<0.002 0 1 2 Exon 1aRD Exon 2 INK4a // 1.5 0.5 1.5 0.5 p<0.001 p<0.009 0 1 2 3 p<0.002 p<0.005 0 5 10 p<0.009 p<0.018 0 1 2 3 4 5 Exon 1aRD Exon 2 INK4a // H2Aub relative enrichment (bound/input) Trolox Control Atg7∆Pa Atg7WT
Lin- (Sca1-, CD31-, CD11bcells) α7-integrin CD34 ba c LC3I LC3II Tubulin Young Old Baf +- + + +- - - Young Old Young Old d LC3II/Tubulin Ratio (±Baf) p<0.05 0 1 2 3 4 p62 Tubulin Young Old p<0.03 p62/Tubulin Ratio Young Old 0 5 10 15 gh Pax7 GFP-LC3 Dapi Merge GFP-LC3Pax7 Young Old MergeDapi Young Old Young Old e Extended Data 1 - + Baf + Baf+ Baf + Baf RapamycinControl SpermidineControl Quiescence genes implicated in proteostasis: 236 1185 444 48 Proteostasis Fukada et al 1186 481 47 Proteostasis Pallafacchina et al 1155 714 78 Proteostasis Liu et al 1064 1820 169 Proteostasis This study Liu (Freshly isolated WT vs freshly isolated BaCl2 injured) Method: VCAM1+ CD31-/CD45-/Sca1Fukada et al (Freshly isolated WT vs cultured) Method: SM/C-2.6+ CD45Pallafacchina et al (Freshly isolated WT vs freshly isolated mdx) Method: Pax3GFP+ This study (Freshly isolated WT vs freshly isolated CTX injured) Method: 7integrin+CD34+ CD31-/CD45-/Sca10 40 80 120 160 Autophagy Ubiquitin-proteasome Antioxidant-response Heat shock response UPR Number of genes Young Old min max Cluster 0 Young Old Young Old Cluster 1 Cluster 2 K means clustering analysis of gene expression of autophagy-related genes (621) in old cells Cluster 2: Genes with reduced expression in old cells (386) Significantly downregulated genes in old cells belonging to Cluster 2 (236) f i Old LC3 Dapi LC3 Dapi j p62 Ub Dapi Merge ControlRapamycin GFP-LC3 Ub Young Old p62 MergeDapi 0 p<0.0001 p<0.01 p62 MFI Ub MFI 2 4 6Young Old Young Old 0 2 4 6 8 k
Geriatric Rapamycin Control pS6 Tubulin Rapamycin Control pS6/Tubulin Ratio Geriatric 0 2 4 6 8 10 Extended Data 2 fd g LV-CoLV-Atg7 p<0.05 0 1 2 4 5 LV-Atg7 LV-Co p<0.05 0 50 100 150 Atg7 0 50 100 150 200 mRNA Relative expression GFP-LC3 Dapi 0 2 4 6 8 10 LV-Atg7 LV-Co SA-ß-gal+ Spermidine Control Spermidine Geriatric Control Young h p<0.05 p<0.001 Rapamycin Control Geriatric + LV-Co LV-Atg7 Geriatric LV-Atg7 GFP Dapi p<0.05 0 200 400 600 800 Geriatric NS GFP DapiPax7 MyoD Ki67 Mgn GFP Dapi Merge Merge 4 days transplant LV-Co a b c 25m GFP Dapi Merge GFP Dapi Merge p16INK4a γH2AX Geriatric ControlRapamycin Geriatric ControlRapamycin ij 0 100 200 300 400 0 50 100 150 200 250 300 350 400 450 500 550 600 650 700 0 5 10 15 20 25 LV-Co LV-Atg7 Fiber size (µm2) Fiber size (µm2) p<0.03 Geriatric LV-Co or LV-Atg7 Infection Geriatric WT mice (donor) Young mice (host) Muscle grafting EDL muscle Geriatric LV-Co LV-Atg7 Relative frequency (%) 0 5 10 15 20 0 20 40 60 Control Rapamycin Geriatric % p16INK4a+/GFP+ cells 2AX+/GFP+ cells p<0.03 p<0.05 BrdU+ cells (%) SA-ß-gal+ cells (%) e 0 2 4 6 8 10 Young Control Rapamycin Geriatric LV-Atg7 p<0.001 p<0.001 p<0.001 0 10 20 30 40 p<0.005 p<0.05 p<0.05 eMHC
d f Pax7 MergeDapi Atg7WT Atg7 2 4 6 8 Atg7WT Atg7 e c g Atg7WT Atg7 5 1 1 5 5 1 1 5 5 1 1 5 2 Atg7WT Atg7 Atg7WT Atg7 + b aAtg7WT Atg7 Atg7WT Atg7 5 1 15 2 25 5 1 1 5 Atg7WT Atg7 Atg7WT Atg7 ++ Atg7 2 4 6 + Atg7WT Atg7 2 4 6 8 1 + Baf + Baf Atg7WT Atg7 LC3 Dapi + Baf + Baf 7+1 1 2 3 4 5 7 15 Atg7WT Atg7 Atg7WT Atg7 2 h Atg7WT Atg7 Atg7WT Atg7 Atg7WT Atg7 7 28 i 2 Atg7WT Atg7Pax7 Pax7γH2AX Dapi Merge pS6 Lamp1 Merge Atg7WT Atg7Pax7 Dapi 0 5 10 15 p<0.03 Atg7WT Atg7Pax7ER Pax7+/Ki67+ cells/ 100 Fibers 7 days post-injury 0 5 10 15 20 Atg7WT Atg7 GFP+/Ki67+ cells p<0.04 4 days post-transplantation j k l m o n GFP MyoD Mgn Dapi Atg7WT Control Atg7Pax7Control Atg7WT Rapamycin Atg7Pax7 Rapamycin GFP+ cells/ section 0 50 100 150p<0.05 NS NS GFP Atg7WT Atg7Pax7 Control Rapamycin MyoD Mgn Dapi Atg7WT:GFP-LC3 Atg7Pax7: GFP-LC3 Cell Transplantation 4d Analysis SCID mice 14h post-injury Pax7 MyoD Dapi p<0.04 Pax7+/MyoD+ cells Atg7WT Atg7Pax7 0 20 40 60 Atg7WT Atg7Pax7
a b c d g CellROX p16INK4a Dapi Merge Atg7WT Atg7 0 50 100 150 200 -100 0 100 200 300 MitoTracker h MitoTracker CellRox Dapi MergeMitoTracker CellRox TYoung 0 20 40 60 80 Young p<0.0001 Young e f -60 -40 -20 0 20 40 (MitoTracker) Young Geriatric Young Geriatric Control NS p<0.05 p<0.05 (reduction in total Analysis MitoTracker Control MitoTracker MFI Control Old 0 500 1000 1500 2000p<0.04 YoungControl Lamp1 TOM20 0 20 40 60 % of colocalization (Lamp1/TOM20) Young Control Spermidine Geriatric 0.0 0.2 0.4 0.6 0.8 p<0.005 p<0.0001 p<0.0001 p<0.0001 p<0.0001 p<0.0001 p<0.0001 p<0.0001 Dapi Merge Geriatric Trolox Ub p62 MergeDapi Atg7WT Atg7 p<0.0005 Ub MFI 8 6 4 2 0 p<0.002 Atg7WT Atg7 p62 MFI 0 6 9 12 3 % of colocalization (MitoTracker/CellROX)
Baf +- + + +- - - Trolox - + + + + + + - - - + + ++ LC3I LC3II Tubulin 0 1 2 3 4 5 LC3II/Tubulin Ratio (±Baf) Trolox Control p<0.03 Trolox Control 0 50 100 150 200 250 Control Trolox ROS p<0.05 Geriatric MFI (Geriatric vs Young) c d e h g Extended Data 5 Geriatric Trolox Control p62 Ub Dapi Merge GFP-LC3 p<0.002 0 1 2 3 4p<0.001 0 0.5 1 1.5 2 Trolox Control Ub MFI p62 MFI Old 0 5 10 15 20 25 0 10 20 30 40 50 Atg7WT LV-sh Scramble Atg7Pax7LV-sh Scramble Brdu+ cells () SA--gal+ cells () Atg7WT LV-sh p16INK4a Atg7Pax7 LV-sh p16INK4a p<0.006 p<0.0001 p<0.03 p<0.04 0 2 4 6 8 10 SA--gal+ cells () p<0.03 p0.0007 0 20 40 60 80 p<0.05 p<0.05 Brdu+ cells () Atg7WT Control Atg7Pax7Control Atg7WT Trolox Atg7Pax7 Trolox p<0.01 0 5 p<0.003 0 1 2 3p<0.008 0 1 2 3 4 Exon 1aRD Exon 2 INK4a // 10 2Aub relative enrichment (bound/input) Geriatric Young i Geriatric Young +Baf Trolox 0 20 40 60 80 100 0 20 40 60 80 100 + Baf + Baf + Baf + Baf Trolox +Baf TroloxControl YoungGeriatric p<0.0001 p<0.0001 NS p<0.0001 RFP+ GFP+ puncta RFP+ GFP+ puncta Control Control MgnMyoD GFP Dapi Merge ControlTrolox Geriatric j k MitoTracker 0 500 1000 1500 2000 MitoTracker MFI p<0.05 a CellROX Atg7WT Atg7Pax7 p<0.04 Atg7WT Atg7Pax7 Atg7WT Atg7Pax7 0 5000 10000 15000 CellRX MFI f 53BP1 Tubulin Atg7WT Atg7Pax7 0 200 400 600 800 1000p<0.02 53BP1/Tubulin Ratio Atg7WT Atg7Pax7 Tubulin Parkin 0.0 0.1 0.2 0.3 0.4 p<0.05 Parkin/Tubulin Ratio b Trolox GFP-LC3 Control +Baf +Baf Trolox Control Old 0 50 100 150 200 GFP-LC3 MFI (±Baf) p<0.05
Young Geriatric c Young Geriatric H/E e YoungGeriatric Extended Data 6 Human CD56 p16INK4a Dapi Merge p<0.02 15 20 25 30 35 40 45 BrdU+ cells (%) Young Geriatric d f pS6 Dapi Young Geriatric ControlRapamycin Human 0 2 4 6 pS6 Tubulin S6 Young Geriatric Geriatric Geriatric Geriatric Control Rapamycin Geriatric Geriatric Young Control Rapamycin pS6/Tubulin Ratio p<0.03 p<0.03 g l Quiescence Senescence Autophagy / Mitophagy Aging ↑p16INK4a Accumulation of damaged organelles & mitochondria ↑ROS INK4a locus derepression p62 Tubulin Young Geriatric Geriatric Young Geriatric Geriatric RapamycinControl MitoTracker Young Geriatric CellROX Young Geriatric -100 0 100 200 CellROX 0 500 1000 1500 MitoTracker Control Rapamycin MFI (Geriatric vs Young) MFI (Geriatric vs Young) p<0.05 p<0.04 Young Geriatric MitoTracker ControlRapamycin p<0.001 p<0.001 SA-ß-gal+ cells (%) Rapamycin Control Young Geriatric 0 20 40 60 RapamycinControl h Control Rapamycin Rapamycin Control Human 0.0 0.5 1.0 1.5 2.0 Young Geriatric Geriatric Control Rapamycin p62/Tubulin Ratio p<0.03 p<0.03 i Young Geriatric j CellROX k Young Human a pS6/Tubulin Ratio LV-sh Scramble LV-sh p16INK4a Atg7Pax7 p16INK4a/Tubulin Ratio 0.0 0.2 0.4 0.6 0.8 p<0.05 0.0 0.5 1.0 1.5 p<0.05 Tubulin S6 pS6 Atg7∆Pax7 LV-scramble LV-shp16 p16INK4a 0 50 100 150 200 p<0.0006 Fiber sie (m2) LV-sh Scramble LV-sh p16INK4a Atg7Pax7 LV-sh Scramble LV-sh p16INK4a b HE eMHC