scieee AI-readable full text Open interactive document viewer

Identification of molecular markers of Plasmodium falciparum resistance to antifolates by PCR and sequencing in the Republic of Guinea

Kolié, Fassou René; Makanéra, Abdoulaye; Camara, Taliby Dos; Camara, Bienvenu Salim; Loua, Jonas; Peerapan, Tan-Aaria; Wangchuk, Kinley; Usmani, Asmatullah; Kolié, Albert; Dramou, Antoine Gbilengbe

Abstract

Introduction: Malaria remains one of the leading causes of medical consultations in the tropics. Objective: The aim of this study was to determine the types of mutations responsible for Plasmodium falciparum resistance to antifolates in Guinea. Material and Methods: This is a prospective study lasting eight (8) months, from October 1, 2022, to May 30, 2023. RESULTS: The diagnosis of Plasmodium falciparum was positive in 5.85% of cases (255/4352) by thick blood smear (SBS) and and the thin blood smear. The molecular method (PCR) applied to the 255 SBS-positive samples showed the presence of Plasmodium falciparum DNA was positive in 96.47% of the SBS-positive samples (246/255). In individuals over 5 years of age, mutations were higher in the Pfdhfr gene at codons 51Ile, 59Arg and 108Asn with a prevalence of 28.57% for each. On the contrary, in the Pfdhps gene, the highest mutation was in codon 540Glu (5.71%) followed by mutations 436Ala, 437Gly and 613Ser with 2.85% for each. In children under 5 years of age, mutations were more common in the pfdhfr gene codons: 51Ile (42.85%), 59Arg (42.85) and 108Asn (42.85), while in the Pfdhps gene, mutations were common in codon 540Glu (5.71%), followed by codons 436Ala, 437Gly and 613Ser with 2.85% each. Thus, mutations were more common in the Pfdhfr gene than in the Pfdhps gene. After sequencing, only 14.22% (35/246) Plasmodium falciparum samples had mutations in both Pfdhfr and Pfdhps. Conclusion: These results showed generally that mutations in Plasmodium falciparum resistance genes, were more common in dhfr gene than dhps gene and the mutation prevalence of these two genes were different i individuals over 5 yeares and those of under 5 years.

Full text

 Corresponding author: Abdoulaye Makanéra Copyright © 2025 Author(s) retain the copyright of this article. This article is published under the terms of the Creative Commons Attribution Liscense 4.0. Identification of molecular markers of Plasmodium falciparum resistance to antifolates by PCR and sequencing in the Republic of Guinea Fassou René Kolié 1, 2, Abdoulaye Makanéra 3, 4, *, Taliby Dos Camara 1, 2, Bienvenu Salim Camara 5, Jonas Loua 5, Peerapan Tan-Aaria 6, Kinley Wangchuk 7, Asmatullah Usmani 8, Albert Kolié 1 and Antoine Gbilengbe Dramou 1 1 Microbiology Laboratory, Department of Biology, Faculty of Science, Gamal Abdel Nasser University, Conakry, Republic of Guinea. 2Biomedical Analysis Laboratory of Mahatma Gandhi University, 030BP:499 Conakry, Republic of Guinea. 3 Laboratory of the Faculty of Health Sciences and Techniques, Gamal Abdel Nasser University of Conakry, Republic of Guinea. 4 Biomedical Laboratory of China-Guinea Friendship Hospital, Kipé, Cité des Médecins, Commune of Ratoma 30 BP: 710 Conakry, Republic of Guinea. 5Project Access/Seasonal Malaria Chemoprevention/LSHTM /Gamal Abdel Nasser University, Conakry, Republic of Guinea. 6 Department of Microbiology, Faculty of Science, parasitology laboratory, Mahidol University Bangkok, Thailand. 7 Microbiologist Clinical microbiology Laboratory, JDW national referral hospital, Bhutan 8 Department of Biology, Education Faculty, Kandahar University, Kandahar, Afghanistan GSC Advanced Research and Reviews, 2025, 25(02), 155-169 Publication history: Received on 17 September 2025; revised on 01 November 2025; accepted on 03 November 2025 Article DOI: https://doi.org/10.30574/gscarr.2025.25.2.0311 Abstract Introduction: Malaria remains one of the leading causes of medical consultations in the tropics. Objective: The aim of this study was to determine the types of mutations responsible for Plasmodium falciparum resistance to antifolates in Guinea. Material and Methods: This is a prospective study lasting eight (8) months, from October 1, 2022, to May 30, 2023. RESULTS: The diagnosis of Plasmodium falciparum was positive in 5.85% of cases (255/4352) by thick blood smear (SBS) and and the thin blood smear. The molecular method (PCR) applied to the 255 SBS-positive samples showed the presence of Plasmodium falciparum DNA was positive in 96.47% of the SBS-positive samples (246/255). In individuals over 5 years of age, mutations were higher in the Pfdhfr gene at codons 51Ile, 59Arg and 108Asn with a prevalence of 28.57% for each. On the contrary, in the Pfdhps gene, the highest mutation was in codon 540Glu (5.71%) followed by mutations 436Ala, 437Gly and 613Ser with 2.85% for each. In children under 5 years of age, mutations were more common in the pfdhfr gene codons: 51Ile (42.85%), 59Arg (42.85) and 108Asn (42.85), while in the Pfdhps gene, mutations were common in codon 540Glu (5.71%), followed by codons 436Ala, 437Gly and 613Ser with 2.85% each. Thus, mutations were more common in the Pfdhfr gene than in the Pfdhps gene. After sequencing, only 14.22% (35/246) Plasmodium falciparum samples had mutations in both Pfdhfr and Pfdhps. Conclusion: These results showed generally that mutations in Plasmodium falciparum resistance genes, were more common in dhfr gene than dhps gene and the mutation prevalence of these two genes were different i individuals over 5 yeares and those of under 5 years. Keywords: Plasmodium falciparum; Antifolate Resistance; Mutations; Republic of Guinea GSC Advanced Research and Reviews, 2025, 25(02), 155-169 156 1. Introduction Malaria remains and continues to be one of the main causes of medical consultations, morbidity, and mortality, which has made it one of the major concerns of the World Health Organization (WHO) for more than half a century. It is a parasitic disease caused by five plasmodial species: Plasmodium falciparum, Plasmodium malariae, Plasmodium vivax, Plasmodium ovale and Plasmodium knowlesi, which is mainly prevalent in Southeast Asia [1-5]. Plasmodium falciparum is the most formidable and dangerous species of the genus Plasmodium, responsible for cases of morbidity and mortality in tropical and equatorial countries [2,3,5]. Thus, this species is often considered to be one of the Plasmodium species associated with the most formidable forms of malaria in the world. Moreover, this parasite has developed resistance to most antimalarial drugs, significantly complicating the treatment and control of the disease. Children under 5 years of age represented 76% of the fatalities [7]. The treatment and eradication of this parasitosis, therefore, require an accurate biological diagnosis. Nowadays, in Guinea, as elsewhere in the world, several techniques are used for the diagnosis of malaria. Thus, these different methods generally used in biomedical analysis laboratories for the diagnosis of malaria are rapid diagnostic tests (RDT), thick blood drop (BG) and blood smears. Molecular methods for diagnosing Plasmodium are not usually used routinely. In Guinea, the Ministry of Health, through its national malaria control program, and its development aid and public health partners have introduced antifolates such as sulfadoxine and pyrimethamine (SP) in combination with amodiaquine (AQ) into their malaria control policy. These antifolates are administered to children under five years of age and this operation is known as seasonal malaria chemoprevention (SMC). In pregnant women, antifolates are used as intermittent preventive therapy (ITP) [8]. Thus, in recent years, several studies have demonstrated the appearance of strains resistant to antifolates in endemic areas where CPS and ITP have occurred; hence the importance of using molecular diagnostic tests capable of rapidly and accurately detecting these resistant strains of Plasmodium falciparum. Malaria diagnosis remains a concern for all medical biology laboratories. On a daily basis, this diagnosis poses strategic problems: on the one hand, errors or delays in diagnosis can have dramatic consequences. Furthermore, the use of a single diagnostic method is not without consequences. In recent years, the commercialization of new immunochromatographic techniques known as “rapid diagnostic tests” (RDTs) has opened up new perspectives in malaria diagnosis [9]. After decades of dramatic reductions in malaria cases and deaths worldwide, progress towards malaria control and elimination had stalled before the COVID-19 pandemic and malaria cases and deaths increased in 2020 [10,11]. The World Malaria Report 2022 from the World Health Organization (WHO) states that while malaria cases and deaths remained relatively stable in 2021 after pandemic disruptions, the overall fight against the disease has stalled, and efforts are off track to meet 2030 targets [10]. Further erosion of recent progress in malaria control will lead to resurgences, at great cost to health, lives, and economies in the world's poorest countries [12]. Chemoprevention strategies, i.e. the use of antimalarial drugs for prophylactic and preventive purposes, can be effective tools to control and eliminate malaria, but the risks of resistance to antimalarial drugs used for prevention and treatment must be mitigated and managed to regain and maintain momentum. Chemoprevention strategies currently recommended by the World Health Organization (WHO) include intermittent preventive treatment in pregnancy (IPT), intermittent preventive treatment in infants (IPTNI), seasonal malaria chemoprevention (SMC), and mass drug administration (MDA) to reduce disease burden in emergency settings [13]. Since the time these chemoprevention strategies were first conceived, concerns have been raised both about their potential impact on the development and spread of drug resistance that could compromise the treatment effectiveness of the drug classes, and about the impact of drug resistance on the effectiveness of different chemoprevention strategies [13].The increase in Plasmodium falciparum (P. falciparum) infections associated with severe and complicated malaria and drug resistance have made malaria control challenging. Significant genetic polymorphism in P. falciparum has been reported in several regions of the world, which affects the efficacy of subunit vaccines. Knowledge of parasite genotypes in a geographical region is therefore important for effective management and control [6]. Having an effective treatment for malaria is key to achieving the goals set by the WHO through the Global Technical Strategy for Malaria 2016– 2030. Artemisinin-based combination treatment associates short-acting artemisinin with a longer-acting partner drug to reduce the emergence of resistance [14]. Malaria, which occurs mainly in tropical and subtropical areas, is the leading cause of consultation in sub-Saharan Africa, including Guinea, where this disease is endemic and remains one of the leading causes of consultations in health facilities. The awareness campaigns, screening, and mass treatment organized by the Ministry of Health and Public Hygiene of Guinea through the national malaria control program supported by development partners including the World Health Organization (WHO), USAID, the United Nations Development Program (UNDP), etc., illustrate its endemicity. The objective of this research is to determine the types of mutations responsible for the resistance of Plasmodium falciparum to antifolates (SP) in the Republic of Guinea. GSC Advanced Research and Reviews, 2025, 25(02), 155-169 157 2. Materials and Working Methods This study was conducted in the Republic of Guinea. The Microbiology laboratories of the Faculty of Sciences and the Faculty of Health Sciences and Technology of Gamal Abdel Nasser University in Conakry, and the biomedical laboratory of the Sino-Guinean Friendship Hospital in Kipé, served as the framework for this study. This is a prospective study lasting eight months, from October 1, 2022, to May 30, 2023. The sampling was simple random, and the sample size (n=4352). All children aged 3 to 59 months were included in this study on the one hand and people aged over 5 years on the other. All these people were residents in the seasonal malaria chemoprevention (SMC) zones in the Republic of Guinea. 3. Variables under study 3.1. Biological variables: Thick blood smear, Blood smear, Mutations 3.1.1. Epidemiological variables: Age, Sex II-4 Biomaterial Our biomaterial consisted of blood samples, three drops collected on filter paper or confetti (Whitman 3MM), with a total volume of 50 µL each. The number of participants in our study was 4,352, including 4,152 in the seasonal malaria chemoprevention zone of Siguiri Prefecture, which is densely populated due to mining and is one of the first prefectures to benefit from the SMC since 2015. In addition, 200 samples were collected from health centers in other prefectures benefiting from the SMC. 3.1.2. Working Method II-5-1 Type and Duration of Study: This is a prospective study lasting eight (8) months, from October 5, 2022, to March 30, 2023. 3.1.3. Study Population Our research involved a total sample of 4,352 individuals, including children aged 3 to 59 months and individuals aged over 5 years, distributed as follows: 4.152 samples collected in the community and 200 samples collected in health facilities. 3.1.4. Sampling In communities and health facilities, sampling was simple random, and the sample size (n=4352) was obtained using the Schwartz formula (2016) based on the prevalence of malaria in the Republic of Guinea P=15%). The sample size collected in the study was calculated using the formula. • n= t2 x p (1-p)/m2 • t= 95% risk of error (1.96) • P= national malaria prevalence (15%) • m= margin of error (5%) • n= 1.962 x 0.15(1-0.15)/0.052 = 196 Our sample size (n=4352) is well above the minimum accepted sample size, making our sample highly representative. 3.2. Selection Criteria 3.2.1. Inclusion Criteria This study included all children aged 3 to 59 months, as well as individuals aged over 5 years and residing in seasonal malaria chemoprevention (SMC) areas in the Republic of Guinea. 3.2.2. Exclusion Criteria All individuals who did not meet our inclusion criteria were excluded from our study. GSC Advanced Research and Reviews, 2025, 25(02), 155-169 158 3.3. Study Variables 3.3.1. Biological Variables The biological variables in our research are: Goutte épaisse, Frottis sanguins, and mutations in Pfdhfr and Pfdhps. 3.3.2. Epidemiological Variables The epidemiological variables in this research are: Age, Sex 4. Operational Variables 4.1. Sampling The samples were taken from the third or fourth finger of the left hand on the side, which is less sensitive than the fingertip. The punctured areas were first disinfected using a cotton swab soaked in 70° alcohol, followed by a dry swab to remove all traces of alcohol. After a quick prick with a vaccinostyle, the first drop of blood was wiped off with a dry cotton swab. The following drops of blood were spread thickly in the middle of a slide. This drop of blood was spread with the corner of a clean slide until uniformly thickened. On a second slide, a second drop of blood was gently placed at one end of the slide. Holding the slide in one hand, the edge of the ground slide was placed just in front of the blood drop with the other hand, then slid until it touched the blood drop. The blood was then spread all along the edge of the ground slide. With a gentle, even movement, the ground slide was pushed to the end of the smear slide. The sample smears were then dried at room temperature, before being stored in storage boxes for Giemsa staining and reading under a microscope. Rapid diagnostic tests were performed on all samples. From each RDT-positive sample, three drops of 50µL of blood each were collected on filter papers or confetti for the search for molecular markers. Each sample collected on confetti filter paper was packed in a plastic bag with silica gel to protect it from moisture. 4.2. DNA Extraction from Blood Samples Collected on Filter Papers Using a DNA Extraction Machine Blood samples collected on filter papers (confetti) are first scanned on a computer in barcode order and in batches of 96 samples according to the test plates containing 96 reaction wells. 4.2.1. DNA extraction procedure The filter papers containing the blood sample drops were cut using a scissor punch previously treated with 70% methanol and flamed with a Bunsen burner for each sample. The filter papers containing the blood samples were cut into circles with a diameter of 2 mm. Each sample (small circle) was collected in a well of a reaction microplate containing 96 samples. A volume of 180 µL of DNA extraction buffer solution and 20 µL of protein kinase K enzyme were added to each well corresponding to a sample. The microplate was then placed in a thermo-mixer for 15 min at 56°C and 900 rpm. The reaction microplate was then transferred to the DNA extraction room. The reagents were placed in the DNA extraction machine. The reagent and consumables boxes were opened successively. The reagents and consumables were placed in the corresponding boxes. The operation was validated by pressing the scan button. The eluent box was opened, along with a new 96-well reaction microplate intended to collect the DNA from the samples after extraction. The wash solution collection reservoir was checked and emptied, if necessary, then scanned. DNA extraction was performed in the 96-well microplates for 4 hours after the introduction of all the necessary process elements. The DNA extraction products were then collected in a new microplate before being brought to the PCR room. 4.2.2. Study Design The workflow of this research was designed. The starting point of this work was the collection of blood samples in the CPS areas of Guinea, according to the approval of the Ethics Committee for Science and Research in Guinea. A total of 4352 blood samples were collected in the community and health centers. All participants underwent the rapid diagnostic test (RDT). Subsequently, these RDT-positive samples were analyzed by microscopy (thick drop and blood smear), this allowed us to establish the parasite density and to know the plasmodial species involved. Molecular methods were applied to the RDT-positive samples. Then we collected three drops of 50µL of blood each from the same RDT-positive samples on filter papers or confetti for the search for molecular markers. From the blood drops collected GSC Advanced Research and Reviews, 2025, 25(02), 155-169 159 on filter paper we extracted genomic DNA for each sample using Unclasping Blood mini kit. Then all samples were subjected to a DNA amplification technique, PfSNP-LAMP-LFD (detection of single nucleotide polymorphism of Plasmodium falciparum by Loop-mediated isothermal amplification combined with detection by lateral flow strip) followed by conventional PCR. 4.2.3. Primer sequence and reaction conditions for PCR and nested PCR for Pfdhfr and Pfdhps genes. For the Pfdhfr gene, the primers used for the detection of SNPs in codons 50, 51, 59, 108, and 164 were: forward primer (5’-TTTATGATGGAACAAGTCTGC-3’) and reverse primer (5’-CTAGTATATACATCGCTAACA-3’); the PCR product size was 650 bp. The amplification conditions used were: 95°C for 5min, 94°C for 30s, (54°C for 60s, 65°C for 60s) x 41 cycles; 65°C for 5min, 15°C for 5min. Nested F (5’-CTGGAAAAAATACATCACATTCATATG-3’) and Nested R (5’- TGATGGAACAAGTCTGCGACGTT-3’) and the amplification product size was 594bp. The amplification conditions: 95°C for min, (93°C for 30s, 68°C for 75s) x 30 cycles, 75°C for 5min. For the Pfdhfr gene amplified for the detection of SNPs in codons 50, 51, 59, 108 and 164, the primers used were Forward primer (5’-GATTCTTTTTCAGATGGAGG-3’) and Reverse primer (5’-TTCCTCATGTAATTCATCTGA-3’) for an amplified product size of 770 bp. The amplification conditions were: 93°C for 5min, (93°C for 20 seconds, 55°C for 30 seconds, 68°C for 75 seconds) x 40 cycles; 68°C for 5min, 15°C for 5min; Nested F primer (5’- AACCTAAACGTGCTGTTCAA-3’), Nested R (5’-AATTGTGTTGATTTGTCCACAA-3’). The amplified sequence size was 711bp with the amplification conditions were 93°C for 5min, (93°C for 30 seconds, 56°C for 30 seconds, 68°C for 75 seconds) x 30 cycles, 72°C for 5min, 15°C for 5 min. In these techniques we used plasmids like, Puc-18-Pfdhfr-TM/8.2 containing wild type Plasmodium falciparum as negative control and Puc-18-Pfdhps-V1/S containing mutant type Plasmodium falciparum as positive control. The DNA samples amplified by LAMP technique and by conventional PCR were subjected to electrophoresis on agarose gel and the amplified DNA fragments were visualized under ultraviolet rays after staining the gel with an ethidium bromide solution. Finally, all the positive samples were purified and subjected to sequencing and the chromatograms obtained after sequencing were processed by BioEdit and then by Nucleotide Blast to compare the sequences of the samples to the non-mutated sequence of Plasmodium falciparum to detect the different mutations and their positions. Detection of the Pfdhfr-ts gene by LAMP-LFD Many attempts have been made to design SNP-LAMP primers to selectively determine the S108N point mutation, but in an AT-rich and highly repetitive polynucleotide sequence, it was not possible to obtain a specific primer to distinguish between wild-type S108 and the mutant-type N108. Therefore, another point mutation conferring resistance to the antifolate pyrimethamine, N51I, was selected for primer design. Parasites with the highest resistance to pyrimethamine were analyzed by LAMP using specific primers and showed a general N51I mutation. Expression of a mutation in the Pfdhfr gene was detected by RT-LAMP-LFD. The Pfdhfr gene primer sets were designed against the mutated Pfdhfr sequence of chromosome 4 of Plasmodium falciparum 3D7 (GenBank accession number NC_004318, version NC_004318.2). The LAMP primer set contains four individual primers, one of which is biotin-labeled (FIP). The primer and probe set used for the detection and amplification of the SNP in the Pfdhfr-ts gene at nucleotide position 152 (Asn51), associated with pyrimethamine resistance, by LAMP-LFD. The bold and underlined nucleotide 5' of the forward Pf-SNP-FIP and the reverse Pf-SNP-BIP correspond to the SNP associated with antifolate resistance, an SNP substitution of an adenine (A) to thymine (T) at position 152. The bold nucleotide represents the changes in the oligonucleotides that were modified to optimize the thermodynamic properties of the primer. The primers used for the Pfdhfr-ts gene were (Sequence primers 5’-3’) Pf-SNP-F3 (GATGGAACAAGTCTGCGACG), Pf-SNP B3 (GCTTTCCCAGCTTGTTCTTCC), Pf-SNP FIP (F1C-F2 (ATACATTTCCATGGTAATACTCTTTTTCTACACATTTAGAGGTC), and TTTCCCTAGATACGACATATTTTTCAATTTTCCATATTTCGATTCATTC). The probe used was Pf-FITC probe (GTGCAGTTACAACATATGTGAATG). 4.2.4. PfSNP-LAMP-LFD Conditions The PfSNP-LAMP reaction for mutation detection in Pfdhfr-ts was performed in a total reaction volume of 25 μL containing the following components: 2 μM each for Pf-SNP FIP and Pf-SNP BIP primers, 0.2 μM each for Pf-SNP-F3 and Pf-SNP-B3 primers, 1X reaction buffer provided by Thermopol (20 Mm Tris-HCl, 10 Mm (NH4)2SO4, 10 Mm KCl, 2 Mm MgSO4, 0.1% TritonX-100, pH 8.8), 0.4 M betaine (USB Corporation, Cleveland, OH-USA), 8 mM MgSO4 (Sigma Aldrich, St. Louis, MO, USA), 1.4 mM sorbitol (Sigma Aldrich, St. Louis, MO, USA), and 0.5 mM sorbitol (Sigma Aldrich, St. Louis, GSC Advanced Research and Reviews, 2025, 25(02), 155-169 160 MO, USA). of dNTP (Promega, Madison, WI, USA), 8 U of Bst 2.0 Hot Start DNA Polymerase (New England Biolabs, Ipswich, MA, USA), and sterile distilled water. A mixture of all reagents and primers was freshly prepared and aliquoted to 23 µL per reaction to perform the LAMP reaction. Then, 2 µL of sample was added to the 23 µL reagent mixture solution to obtain a final volume of 25 µL per reaction. The reaction was incubated at a constant temperature of 65°C for 60 minutes. The negative control (NC) water was performed under the same conditions without the addition of sample or DNA template, and the final volume was adjusted to 25 µL by adding 2 µL of distilled water. Our tests included the wild-type pfdhfr gene as well as nonPlasmodium falciparum control genes.. The positive control was performed under the same conditions using 2µl of Pfdhfr mutant gDNA or plasmid DNA containing the Pfdhfr mutant type (pUC18-Pfdhfr-V1/S). The reactions were incubated in a real-time turbidimeter (Turbidimeter Loop AMP Real-time LA-200TERAMECS) and also in the heating or thermal block (SHB200D Stuart) at a constant temperature of 60°C, 61°C, 62°C and 63°C, for 60 minutes, 70 minutes, 80 minutes and 90 minutes. Table 1 Components of the PfSNP-LAMP reaction LAMP reaction components Sample components (µL) SDW 10.9µL 10 µM F3 0.05µL (0.2µM) 10 µM B3 0.05µL (0.2µM) 100 µM FIP 0.5µL (2.0µM) 100 µM BIP 0.5µL (2.0µM) 10X Thermopolis Buffer 2.5 µL (1X) 10 Mm dNTPs 3.5µL (1.4mM) 100 mM MgSO4 2µL (8.0mM) 5 M Betaine 2µL (0.4M) 8 U/µM Bst polymerase 1µL (1U) DNA template 2µL Total volume 25.0µL 4.2.5. Mutation Detection in PfSNP-LAMP-Amplified Samples Using the Lateral Flow Strip (LFD) Hybridization and visualization of PfSNP-LAMP-amplified samples using the lateral flow strip were performed as follows: A custom-synthesized FITC-labeled probe (Pf-FITC probe) was used. This probe was further used for specific hybridization with the loop region of LAMP-amplified products. Lateral flow strips (LFD) and HybriDetect assay buffer were purchased from Milenia® GenLine, HybriDetect, GieBen, Germany. The LFD strip is embedded with biotin ligand on the test line and anti-rabbit antibodies on the control line. The assay buffer contains a polyclonal rabbit anti-FITC antibody conjugated to the gold particle. The LFD strip and a microfuge tube should be labeled for each sample to be tested. Then, 120µL of HybriDetect assay buffer were aliquoted into individual microcentrifuge tubes and kept at room temperature. For hybridization of LAMP-amplified samples, 20 pmol of Pf-FITC probe was mixed with 8µL of LAMP product, followed by adding 120µL of assay buffer to the appropriate LAMP reaction tube and allowing hybridization at the single temperature 62°C for 5 min. For detection of LAMP-amplified samples containing the mutation on the lateral flow strip (LFD), we had aliquoted 8µL of the hybridized products (FITC probe and biotin-labeled LAMP amplicons) into the appropriate microcentrifuge tube containing the prepared hybridization assay buffer. Immerse the LFD strip's "sample pad" in the appropriate sample solution for 5 minutes. The sample solution migrates by capillary action through the test line and the control line. Finally, we removed the strip from the sample solution and interpreted the results by observing the bands that appeared on the test line and/or the control line. GSC Advanced Research and Reviews, 2025, 25(02), 155-169 161 4.3. Amplification of Pfdhfr (partial gene) by conventional PCR for DNA sequencing 4.3.1. Components and conditions of the conventional PCR reaction The presence of SNPs in P. falciparum Pfdhfr-ts was detected using a conventional PRC T100 thermocycler, Biorad, USA. The amplification condition was performed in a 25 µL reaction volume consisting of 12.5 µL GoTag Green Master Mix solution (Promega, Medison, USA) which contains Taq DNA polymerase, 400 µM dATP, 400 µM dGTP, 400 µM dCTP, 400 µM dNTP and 3 pM MgCl2, 0.5 µL forward primer, 0.5 µL reverse primer, 1 µL DNA template and 10.5 µL distilled water, as shown in Table 3.4. The thermal cycle was programmed for 2 min at 95°C for initial denaturation, followed by 35 cycles of 1 min for denaturation at 95°C, 1 min at 51.4°C for primer binding to the template and its amplification, and 1 min at 72°C for extension, followed by 5 min at 72°C for final extension and maintained at 12°C. The primers and amplification conditions for the Pfdhfr gene are listed below: the sequence GAT GGA ACA AGT CTG CGACGT TTT CG served as the Forward primer (5’-3’) and the sequence CCC AAG TAA AAC GAT TAGATC TTC AAC TTT served as the Reverse primer (5’3’). PCR reactions were carried out in a 25µl reaction volume. The thermal cycle was: -Initial denaturation: 95°C for 2 min whith 35 cycles of Denaturation at 95°C for 1minute, Annealing: 51.4°C for 1minute, Extension: 72°C for 1-minute, Final extension: 72°C for 5 minutes. Holding 12°C for; The expected PCR product size was equal to 460bp. 4.3.2. Detection of PCR Products by Agarose Gel Electrophoresis A 1.5% agarose gel was prepared by dissolving 1.5 g of agarose powder (Vivantis Bhd, Malaysia) in 1XTAE buffer (40 mM Tris-HCl, 40 mM acetic acid, 25 mM EDTA, pH 8.0). The PCR products were then examined by electrophoresis at 75 volts for 40 minutes in a 1.5% agarose gel (Vivantis, Bhd, Malaysia) in 1X TAE buffer (Tris-acetate + EDTA). The DNA marker used in this study was the Ruler 100 bp plus gene supplied by Thermo Scientific. The gel electrophoresis was soaked in ethidium bromide for 10 minutes, and then the DNA bands were visualized under ultraviolet (UV) light (Clarechemical.com DR-46B transilluminator; 12VDC, 0.75A, 9W, serial number 13005-1) to detect the size and density of DNA bands. A DNA marker, a positive control, and a negative control were included in each run. 4.4. Pfdhfr Amplification by Gradient PCR for Sequencing 4.4.1. Gradient PCR Primer Design The Pfdhfr forward and Pfdhfr reverse primers were designed for amplification of the entire Pfdhfr gene using gradient PCR. To amplify the intact dhfr gene, the forward primer 5' upstream of the start codon (ATG) and 3' downstream of the stop codons (TAA) were designed. As the Pfdhfr sequence is an A-T-rich sequence, the forward and reverse primers were manually designed based on the possible primer region. Conventional PCR and PfSNP-LAMP-LFD revealed a single point mutation at position 152 in codon 51 for each sample tested. Therefore, gradient PCR and DNA sequencing were performed using the same samples previously subjected to PfSNP-LAMP-LFD and DNA sequencing to verify whether other point mutations could be found alongside the mutation in codon 51 at nucleotide position 152. 4.4.2. Components and Conditions of the Gradient PCR Reaction The entire Pfdhfr-ts gene was amplified by gradient PCR using (Thermocycler T100, by Thera Trading No. 186-1096 Biorad, USA). PCR reactions were performed in 25 µL of the mixture containing 12.5 µL of GoTag Green Master Mix solution (Promega, Medison, USA) which contains Taq DNA polymerase, 400 µM dATP, 400 µM dGTP, 400 µM dCTP, 400 µM dNTP and 3 µM MgCl2), 1.25 µL of forward primer volume, 1.25 µL of reverse primer volume, 1.1 µL of DNA template and 9.0 µL of distilled water, as shown in Table 3.7. All PCR reactions were performed in 25 µL with 35 cycles, initial denaturation at 95°C for 2 minutes and 95°C for 1 minute. The primer-template annealing temperature was 51.2°C at the back and 45°C at the front of the amplifier for 1 minute, extension at 72°C for 2.15 minutes, then a final extension at 72°C for 5 minutes, followed by holding at 12°C for. For this PCR, the expected product size was 1972 bp when using the forward and reverse primer 1 and using the forward and reverse primers 2. The probable size of our amplicon after PCR was 1972 bp when using the forward and reverse primer 1 and using the forward and reverse primer 2, the PCR product size was 869 bp. Detection of Gradient PCR-Amplified DNA Samples by Agarose Gel Electrophoresis In this study, agarose gel electrophoresis was used to analyze gradient PCR-amplified products. A 1.5% agarose gel was prepared by dissolving agarose powder (1.5 g) weighed using a Precisa 205ACS SWISS (ISO 9001 grade) in 1XTAE (40 mM Tris-HCl, 40 mM acetic acid, 25 mM EDTA, pH 8.0) with heating. The amplified PCR products were electrophoresed at 75 volts for 40 minutes in a 1.5% agarose gel (Vivantis, Bhd, Malaysia) in 1X TAE (Tris-acetate + EDTA) buffer. DNA GSC Advanced Research and Reviews, 2025, 25(02), 155-169 162 bands in the gel were stained with SYBR safe green, a DNA intercalating agent that acts as a fluorescent marker. Amplicon bands were visualized under ultraviolet (UV) light using (Clarechemical.com trans illuminator DR-46B; 12Vdc, 0.75A, 9W, serial number 13005-1) to detect the size and density of DNA bands. One DNA marker, one positive control, and one negative control were combined in each run. Gradient PCR amplified products were purified using the FavorPrep gel extraction and PCR product purification protocol. In addition, to increase the sample DNA concentration for sequencing, DNA from each sample was precipitated using the MRC-Holland (MLPA°) protocol (ethanol precipitation of DNA, description version 01; 24-12-2008). 4.4.3. DNA Sequencing All samples confirmed positive, i.e., containing Plasmodium falciparum DNA using our various techniques mentioned above, were subjected to sequencing (direct Pfdhfr and Pfdhps genotyping using BigDye Terminator v3.1 cycle sequencing kits and ABI 3730 sequencer from Thermo Fisher Scientific, and the data were analyzed using Geneious v10.1.3 (Biomatters, San Diego, CA, USA). Finally, all positive samples by PfSNP-LAMP-LFD were confirmed by DNA sequencing. And finally, we compared the results obtained by the PfSNP-LAMP-LFD method and the DNA sequencing of the analyzed samples and then aligned them with the non-mutated sequence to see the mutation points. 5. Results Amongst the 4352 subjects included in this study, 255 samples were positive for Plasmodium falciparum by thick drop. Then all the 255 samples positive for Plasmodium falciparum were submitted to PCR. The results showed that that after PCR in 255 samples positive by thick drop, 246 were found to be positive for Plasmodium falciparum DNA (246/255 or 96.47%). Thus, extrapolation of the PCR results to all 4352 subjects included in the study shows that 5.65% of the subjects were found to be positive for Plasmodium falciparum DNA. Table 2 Distribution of Plasmodium falciparum mutant genotypes in children under 5 years of age versus individuals over 5 years Mutant genotypes of Plasmodium falciparum genotypes mutant Children under 5years Individuals over 5 years Total Number (%) Number (%) Number (%) dhfr 51Ile 15 (42.85) 10 (28.57) 25(71.42) dhfr 59Arg dhfr 108 Asn dhps 436 Ala 1 (2.85) 1 (2.85) 2 (5.71) dhps 437Gly 1(2.85) 1 (2.85) 2 (5.71) dhps 540 Glu 2 (5.71) 2 (5.71) 4 (11.42) dhps 613Ser 1 (2.85) 1 (2.85) 2 (5.71) Total 20 (57.14) 15 (42.85) 35 (100) In table 2, we observed that in children under 5 years of age, mutations occurred in the Plasmodium falciparum pfdhfr gene: 51Ile (42.85%), 59Arg (42.85%), and 108Asn (42.85%). While in the Pfdhps gene, we successively observed the following mutations: 436Ala (2.85%), 437Gly (2.85%), 540Glu (5.71%), and 613Ser (2.85%). Therefore, mutations occurred in the Pfdhfr gene more than in the Pfdhps gene. In individuals over 5 years old, mutations are higher in Pfdhfr at codons 51Ile, 59Arg and 108Asn with 28.57% prevalence for each. On the contrary, in Pfdhps the highest mutation was observed in codon 540Glu (5.71%) followed by mutations 436Ala, 437Gly and 613Ser with 2.85% for each. GSC Advanced Research and Reviews, 2025, 25(02), 155-169 163 Table 3 Distribution of Plasmodium falciparum mutant genotypes according to age groups N° Age groups Number Percentage 1 Under 5 years 20 57.14 2 Over 5 years 15 42.85 Total 35 100 In Table 3, we see the presence of Plasmodium falciparum mutations in children under 5 years old and in people over 5 years old. This Table 9 shows us that 20 children under 5 years old presented a mutant genotype, i.e. 57.14%, compared to 15 individuals aged over 5 years old, i.e. 42.85%. Table 4 Prevalence of Plasmodium falciparum mutant genotypes relative to the number of Plasmodium falciparum positive samples N° Age groups (years) Number Positive cases Percentage 1 < 5 yars 246 35 14.22 2 More than 5 After sequencing, only 35 samples out of 246 Plasmodium falciparum samples showed mutations in Pfdhfr and Pfdhps, giving a total prevalence of 14.22%, as summarized in the table opposite. Table 5 Distribution of Plasmodium falciparum resistance markers to Sulfoxide and Pyrimethamine Resistance markers Number Percentage IC à 95% Pyrimethamine: Pfdhfr 51I 59R 108N (Haplotype IRN) 25 71.42 [69.60-77.60] Sulfoxide: Phips 436Ala 437Gly 540Glu 613Ser (Haplotype AGES) 10 28.57 [26.88-33.59] Pyrimethamine + Sulfoxide (SP) (Haplotype IRN -GE) 5 14.28 [13.4-15.98] In table 5 we note that mutations in codons 51I, 59R and 108N appeared in 71.42% of the samples analyzed after sequencing in the Pfdhfr gene (Haplotype IRN: Triple mutation). While in the Pfdhps gene the mutations occurred in codons 436Ala, 437Gly, 540Glu and 613Ser (Haplotype AGES: Quadruple mutation) with a prevalence of 28.57%. Finally, 5 samples presented mutations in both Pfdhfr and Pfdhps genes (Haplotypes IRN–GE: Quintuple mutation), with 14.28%. Table 6 Distribution of the prevalence of mutations associated with resistance to Pyrimethamine and Sulfoxide according to CPS areas in relation to the number of positive cases after sequencing (n=35) Zones CPS Pyrimethamine resistance (Haplotype: IRN) Number (%) Resistance Sulfadoxine (Haplotype: AGES) Number (%) Resistance to S+P (Haplotype: (IRNGE) Numer (%) Siguiri 4(11.42) 3(8.57) 1 (2.85) Madiana 2 (5.71) 0 0 Kankan 2 (5.71) 0 0 Kouroussa 1 (2.85) 1 (2.85) 1 (2.85) Faranah 1 (2.85) 0 0 Dabola 1 (2.85) 0 0 Dinguiraye 3 (8.57) 1 (2.85) 0 Mamou 1 (2.85) 2 (2.85) 1 (2.85) Tougué 1(2.85) 0 0 Dalaba 1 (2.85) 0 0