1 RNA:DNA hybrids survive digestion in mRNA vaccine manufacturing Kevin McKernan*, Charles Rixey, Jessica Rose *Medicinal Genomics, Beverly Mass:
[email protected] Running Title: RNA:DNA hybrids resist DNaseI in mRNA vaccines Keywords: mRNA vaccines, residual DNA, RNA:DNA hybrids, DNase resistance, quality control, qPCR Abstract The process of mRNA vaccine manufacturing relies on proper DNA digestion following an in-vitro transcription reaction to remove residual contaminating DNA from the plasmid backbone from the process. To assess the quality and quantity of potential DNA impurities in mRNA vaccines, we analyzed unopened, cold-chain compliant vaccine lots for residual DNA contamination using quantitative PCR (qPCR), RNase A/Qubit fluorometry, and Oxford Nanopore sequencing from two Pfizer and three Moderna vials. We compared spike-region amplicons and plasmid-vector amplicons to distinguish between DNA contaminant as double stranded DNA (dsDNA) versus RNA:DNA hybrids. qPCR assays revealed more than a 100fold discrepancy in quantitation between dsDNA with RNA:DNA hybrids consistent with uneven DNase I digestion efficiency during mRNA vaccine manufacturing. Indeed, treatment of vaccines with DNase I-XT resulted in 100-1000X higher degradation of spike DNA, particularly in plasmid regions that form RNA:DNA hybrids. Together these results indicate that residual DNA testing which relies on a single qPCR for dsDNA fails to accurately quantify impurities, and that treating vaccine preparations with DNase I-XT during the manufacturing process may improve the quality by reducing contamination due to RNA:DNA hybrids. Summary/Impact Statement: Regulatory filings indicate that residual DNA testing typically relies on a single qPCR assay targeting the kanamycin (KAN) resistance gene within the plasmid backbone. Because this region resides in a DNase-sensitive portion of the vector, such testing underestimates residual DNA in sequences that remain RNA hybridized and DNase Iresistant, including the spike insert.
2 Introduction Several independent studies have raised concerns regarding residual DNA contamination in mRNA vaccines (1-6). Konig et al. used fluorometric quantification to estimate residual DNA levels but did not include RNase A controls, leaving open the possibility of intercalating dye cross-reactivity with RNA (2). Kammerer et al. addressed this limitation by incorporating RNase A digestion and multiple intercalating dyes, while also demonstrating that SV40 promoter sequences from vaccine DNA persisted through several cell passages following transfection with the vaccines (4). Wang et al. also detected substantial DNA contamination but dismissed its biological significance based solely on fragment size, without considering that lipid nanoparticles (LNPs) can alter the uptake and persistence of such fragments (5). In contrast, Kaiser et al. attempted to refute these results, but their use of ethanol precipitation and phenol-chloroform extraction likely removed low-molecular-weight DNA, biasing the results toward apparent purity (6). Regulatory agencies have largely accepted sponsor-supplied data or, when performing independent analyses, relied on a single qPCR assay targeting the KAN resistance gene within the plasmid backbone (7,8). This approach is problematic. Moderna's own patents acknowledge that qPCR cannot capture the full spectrum of plasmid DNA species (9). Fragments shorter than the amplicon or lacking primer-binding sites, such as background E. coli-sourced DNA, remain undetected. Because these assays amplify only a 100-200 bp region, total DNA content is inferred from one locus under the assumption that all plasmid regions persist at equivalent copy number. This assumption does not hold following DNase I treatment. DNase I digestion is inherently non-uniform (Figure 1). Lenk et al. and Sutton et al. demonstrated that RNA:DNA hybrids generated during in vitro transcription (IVT) resist DNase I digestion, as the specific activity of DNase I for RNA:DNA hybrids is at least 100-fold below that for dsDNA (10,11). Based on plasmid annotations, approximately 55% of the DNA template used for mRNA transcription corresponds to the T7 polymerase transcription product (the 4,284 bp spike insert of a 7,810 bp plasmid). These transcribed regions are expected to form RNA:DNA hybrids that are protected from DNase I cleavage, whereas fully double-stranded regions such as the KAN backbone are more readily digested. This protection may be further stabilized by the more than 800 N1-methyl-pseudouridine modifications in each mRNA transcript (11), which promote RNA:DNA hybrid stability.
3 Figure 1. Depiction of differential nuclease sensitivity with RNA:DNA hybrids. Consequently, when qPCR assays target DNase-labile regions such as KAN, they underestimate total DNA contamination by more than an order of magnitude. Pfizer's regulatory submissions to the EMA include a validated qPCR assay designed to confirm successful cloning of the spike insert into the pcDNA3.1-like plasmid, yet these results are not reported for quantitation. Instead, DNA measurements focus on the KAN locus, the region most susceptible to DNase I digestion. This methodological bias likely contributes to the discrepancy between regulatory measurements and independent reports describing persistent spike nucleic acids detected beyond 48 hours post-vaccination (1320). Table1. Summary of various studies. Limitations and Strengths are the subjective opinion of these authors. * Speicher Over Limits are Qubit measurements only.
4 Results Use of RNase A in fluorometric analysis revealed residual DNA levels 15-48 times higher than the FDA's recommended limit of 10 ng per dose (Figure 2) (23,24). Both 95°C heat treatment and 1% Triton X-100 increased measurable DNA for both vaccine brands. Fluorometry performed in the absence of RNase A produced apparent DNA concentrations approximately an order of magnitude higher. While cross-reactivity between RNA and DNA is a known artifact of minor-groove binding fluorescent dyes, manufacturers typically report this effect as being under 7% at 10ng/ul DNA and 100ng/ul RNA (2). However, these cross-reactivity studies were conducted using natural single-stranded RNA and did not account for the extensive secondary structure engineered into N1methyl-pseudouridine-modified mRNAs. Codon-optimization algorithms used in the modRNA field intentionally promote rod-like RNA folding and high double-stranded content, increasing the likelihood of minor-groove dye interaction (18). The manufacturer's stated cross-reactivity specifications may therefore require recalibration when applied to highly structured or chemically modified RNA molecules that exhibit elevated melting temperatures. Figure 2. Qubit fluorometry of 2 Pfizer lots (LN2588 & GK0936) and 3 Moderna lots (025G23A, AW4694B, AT0709B). Samples were tested directly (Neat), after TritonX-100 treatment, 95°C treatment and RNase A. qPCR analysis using DNase I and DNase I-XT on Triton X-100-treated vaccine preparations demonstrated a distinct DNase I-resistant region within the plasmid spike
5 insert (Figure 3). This region is expected to form RNA:DNA hybrids due to the abundance of complementary mRNA in each dose. Standard DNase I cannot efficiently digest DNA within RNA:DNA hybrids, whereas DNase I-XT is specifically engineered for this purpose. In all five vaccine lots tested, DNase I produced only marginal reductions in spike-region DNA, while consistently degrading DNA originating from the plasmid's origin of replication. In contrast, DNase I-XT achieved more complete digestion across both regions, supporting the interpretation that much of the residual spike DNA persists in RNA-hybridized form. This differential digestion significantly affects quantitative estimates of DNA contamination, making qPCR results highly dependent on the choice of assay target. Figure 3. DNaseI/DNaseI-XT qPCR demonstrate differential nuclease sensitivity at 2 different loci in the plasmid (Spike, Ori). RNaseA-qPCR was also performed in triplicate and at 3 different dilutions (1X, 1:10, 1:100) to record 9 datapoints for each channel across 2-3 different assays (Figure 4A &
6 B). These qPCR assays contained a final concentration of 0.5% TritonX-100 to enable dissolution of the LNPs and RNaseA activity prior to qPCR. In addition to heat killing the RT reaction we have also added RNaseA to ensure no interference with off-target nucleic acids. Figure 4A. qPCR performed in triplicate at 1X, 1:10 dilution and 1:100 dilution. 1:10 dilutions were used for further analysis. Figure 4B. Standard curve performed in triplicate across 5 Log scales for each assay with their respective efficiency, R^2, slope and equation. Qubit and qPCR results were compared with 1:10 dilution qPCR data versus the final RNaseA treated Qubit results. The Cq scores and nanogram quantitation for these more recent vials are more contaminated than was observed with Speicher et al. using the same
7 qPCR assay (1). Both Pfizer lots are over the limit in the context of both qPCR and Qubit methods. All 3 Moderna lots are over the limit via Qubit but Moderna 025G23A passed the Ori qPCR while exceeding the limit with the Spike qPCR assay (Figure 5). This demonstrates that qPCR is target dependent and highly influenced by the selection of the assay used and Qubit fluorometry, while not immune to RNA:DNA dye intercalation bias, provides more consistent quantitation across samples when compared to various qPCR assays (Figure 5). Figure 5. Comparison of Qubit versus qPCR quantitation. Qubit provides more consistent quantitation while qPCR is highly dependent on the assay used to quantitate the DNA. Oxford Nanopore (ONT) sequencing further revealed numerous fragments exceeding 200 bp, including one read 5,284 bp in length that encompassed a large portion of the spike gene. Although qPCR showed large differences in quantitation depending on which assay was used, sequencing confirmed that both spike and Ori DNA persists in the vaccines, and the presence of long DNA fragments highlights the limitations of inferring fragment lengths from Cq values alone (Figure 6). Long DNA fragments may be underestimated by qPCR if they are not efficiently amplified, yet such fragments are detectable by sequencing and may have greater biological relevance due to their potential for cellular uptake and genomic integration. These findings emphasize the importance of using complementary methods – RNaseA-Fluorometry, multi-loci qPCR for quantitative screening and sequencing for detailed characterization -- when assessing residual DNA in mRNA therapeutics.
8 Figure 6. 5,283 base pair Oxford Nanopore read (blue highlight) from Pfizer lot. Methods RNase-Qubit Fluorometric DNA Quantification DNA quantification was performed using the AccuGreen High Sensitivity DNA Quantitation Reagent (Biotium) following the manufacturer's protocol, with modifications to assess RNase sensitivity and detergent-mediated lipid nanoparticle disruption. For each sample, 1 µL of vaccine material was added to 199 µL of AccuGreen® reagent. In parallel, a 1% Triton X-100 treatment was prepared by mixing 10 µL of 10% Triton X100 with 90 µL of vaccine prior to dilution in the AccuGreen® reagent. The mixture was vortexed and immediately measured using a Qubit fluorometer (ThermoFisher Scientific). To evaluate heat and RNase sensitivity, the vaccine-reagent mixture was heated to 95°C for 1 minute, cooled immediately on ice, vortexed, and measured again using the Qubit fluorometer. Following the heat step, 1 µL of RNase A (20 mg/mL, New England Biolabs) was added to the same sample, incubated at 37°C for 10 minutes, and fluorescence was measured a final time.
9 RNase-qPCR Assay Quantitative PCR (qPCR) assays were performed using a modified RNase pretreatment protocol to distinguish DNA-derived signals from potential RNA contamination. All polymerase mixtures were heat treated at 95°C for 5 minutes to deactivate RT activity prior to sample addition. Following heat treatment, each vial 420 µL polymerase vial received 42 µL of 50 µM primer (targeting either Spike/Ori or SV40 in Table 2), 42 µL of 10% Triton X-100 (final in PCR is 0.5% TritonX-100), 235 µL of nuclease-free water, and 10.5 µL of RNase A (20 mg/mL). The samples were mixed by gentle pipetting. Polymerase reagents used are sourced from Medicinal Genomics PathoSEEK amplification mix (MGC part#420207). Primers and Probes were previously published by Speicher et al.(1). Spike and Ori are multiplexed in FAM and HEX respectively and SV40 is singleplex in Texas Red. Samples were cycled at 95°C for 1 minute followed by 39 more cycles of 95°C for 10 seconds and 65°C for 40 seconds on a BioRad CFX for 3 channel detection. Table 2. qPCR Primer and Probe Sequences Assay Primer/Probe Sequence (5' to 3') Part Number Spike Forward AGATGGCCTACCGGTTCA MGC #100030 Reverse TCAGGCTGTCCTGGATCTT Probe /56-FAM/CGAGAACCA/ZEN/GAAGCTGATCGCCAA/3IABkFQ/ Vector Origin Forward CTACATACCTCGCTCTGCTAATC MGC #10030 Reverse GCGCCTTATCCGGTAACTATC Probe /5HEX/AAGACACGA/ZEN/CTTATCGCCACTGGC/3IABkFQ/ SV40 Enhancer/Promoter Forward GTCAGTTAGGGTGTGGAAAGT MGC #100032 Reverse GGTTGCTGACTAATTGAGATGC Probe /5TEX615/CCAGCAGGCAGAAGTATGCAAAGC/3IAbRQSp/ DNase I and DNase I-XT qPCR Assay To evaluate the impact of DNase treatment on nucleic acid detection, DNase I and DNase I-XT (New England Biolabs, NEB #M0303S, NEB #M0570) were each diluted 1:50 in their respective reaction buffers and added to vaccine preparations pretreated with 1% Triton X-100. For each reaction, 1 µL of diluted DNase I or DNase I-XT was added directly to the 17 µL qPCR master mix containing primers and probes targeting the vaccine Spike and bacterial origin of replication (Ori) loci. Reactions were incubated for 10 minutes at 37°C to allow nuclease activity, followed by heat inactivation at 75°C for 10 minutes.
16 References 1. Speicher DJ, Rose J, McKernan K. Quantification of residual plasmid DNA and SV40 promoter-enhancer sequences in Pfizer/BioNTech and Moderna modRNA COVID-19 vaccines from Ontario, Canada. Autoimmunity. 2025;58(1):2551517. doi: 10.1080/08916934.2025.2551517 2. Konig B, Kirchner JO. Methodological Considerations Regarding the Quantification of DNA Impurities in the COVID-19 mRNA Vaccine Comirnaty. Methods Protoc. 2024;7(3):41. doi: 10.3390/mps7030041 3. Konig B, Kirchner JO, Buttinger G, Westphal K. Synthetic mRNA and LNP platforms for SARS-CoV-2 vaccines [Preprint]. 2024. Available from: https://www.preprints.org/manuscript/202411.1912/v2 4. Kammerer U, Schulz V, Steger K. BioNTech RNA-Based COVID-19 Injections Contain Large Amounts Of Residual DNA Including An SV40 Promoter/Enhancer Sequence. Science, Public Health Policy and the Law. 2024;5:1-22. Available from: https://publichealthpolicyjournal.com/biontech-rnabased-covid-19-injections-contain-large-amounts-of-residual-dna-including-ansv40-promoter-enhancer-sequence/ 5. Wang TJ, Kim A, Kim K. A rapid detection method of replication-competent plasmid DNA from COVID-19 mRNA vaccines for quality control. J High School Sci. 2024;8(4):427-439. doi: 10.64336/001c.127890 6. Kaiser S, Kaiser S, Reis J, Marschalek R. Quantification of objective concentrations of DNA impurities in mRNA vaccines. Vaccine. 2025;55:127022. doi: 10.1016/j.vaccine.2025.127022 7. European Medicines Agency. Rapporteur's Rolling Review Report Quality - COVID19 mRNA Vaccine BioNTech. 2021. Page 81. Available from: https://www.covidtruths.co.uk/2021/04/ema-leaked-papers/ 8. Therapeutic Goods Administration. FOI 5286 - TGA KAN PCR documents. 2024. Page 5. Available from: https://www.tga.gov.au/sites/default/files/202409/FOI%205286.PDF 9. Moderna patent US10898574B2. Methods and compositions for treatment of disease. Available from: https://pubmed.ncbi.nlm.nih.gov/40120438/ 10. Lenk R, Kleindienst W, Szabó GT, Baiersdörfer M, Boros G, Keller JM, Mahiny AJ, Vlatkovic I. Understanding the impact of in vitro transcription byproducts and
17 contaminants. Front Mol Biosci. 2024;11:1426129. doi: 10.3389/fmolb.2024.1426129 11. Sutton RE, Boothroyd JC. Evidence for trans splicing in trypanosomes. Cell. 1986;47(4):527-535. doi: 10.1016/0092-8674(86)90617-3 12. Parr CJC, Wada S, Kotake K, Kameda S, Matsuura S, Sakashita S, et al. N(1)- Methylpseudouridine substitution enhances the performance of synthetic mRNA switches in cells. Nucleic Acids Res. 2020;48(6):e35. doi: 10.1093/nar/gkaa070 13. Ota M, Ishikawa T, Hatori T, Yoshida A, Saito A, Nakayama T, et al. Detection of immunoglobulin G against SARS-CoV-2 nucleocapsid protein in blood samples from naive donors 28 days after vaccination. J Infect. 2021;83(3):363-364. doi: 10.1016/j.jinf.2021.07.014 14. Castruita JAS, Schneider UV, Mollerup S, Leineweber TD, Weis N, Bukh J, et al. SARS-CoV-2 spike mRNA vaccine sequences circulate in blood up to 28 days after COVID-19 vaccination. APMIS. 2023;131(3):128-132. doi: 10.1111/apm.13294 15. Krauson AJ, Casimero FVC, Siddiquee Z, Stone JR. Duration of SARS-CoV-2 mRNA vaccine persistence and factors associated with cardiac involvement in recently vaccinated patients. NPJ Vaccines. 2023;8(1):141. doi: 10.1038/s41541023-00742-7 16. Gonzalez R, Velez E, Andrews J. Biodistribution and persistence of BNT162b2 mRNA in mouse tissues. bioRxiv [Preprint]. 2022. doi: 10.1101/2022.03.11.484066 17. Hanna N, Hossain I, Nimeri N, Freitag A, Rahman S, McCoy C, et al. Detection of messenger RNA COVID-19 vaccines in human breast milk. JAMA Pediatr. 2022;176(12):1268-1270. doi: 10.1001/jamapediatrics.2022.3581 18. Roltgen K, Nielsen SCA, Silva O, Younes SF, Zaslavsky M, Costales C, et al. Immune imprinting, breadth of variant recognition, and germinal center response in human SARS-CoV-2 infection and vaccination. Cell. 2022;185(6):10251040.e14. doi: 10.1016/j.cell.2022.01.018 19. Mordechay L, Baum G, Gabbay-Benziv R, Weinberger H, Morgenstern MF. Detection of Pfizer BioNTech Messenger RNA COVID-19 Vaccine in Human Blood, Placenta and Semen. Ann Case Rep. 2025;10:2428. doi: 10.29011/25747754.102428
18 20. Fertig TE, Chitoiu L, Marta DS, Ionescu VS, Cismasiu VB, et al. Vaccine mRNA Can Be Detected in Blood at 15 Days Post-Vaccination. Biomedicines. 2022;10(7):1538. doi: 10.3390/biomedicines10071538 21. Zhang H, Zhang L, Lin A, Xu C, Li Z, Liu K, et al. Algorithm for optimized mRNA design improves stability and immunogenicity. Nature. 2023;621(7978):396-403. doi: 10.1038/s41586-023-06127-z 22. Murchie AI, Carter, WA, Portugal J, The tertiary structure of the four-way DNA junction affords protection against DNaseI . Nucleic Acids Research. 1990;18(9):2599-2606. doi:10.1093/nar/18.9.2599 23. US Food and Drug Administration. Guidance for Industry: Characterization and Qualification of Cell Substrates and Other Biological Materials Used in the Production of Viral Vaccines for Infectious Disease Indications. 2010. Available from: https://www.fda.gov/regulatory-information/search-fda-guidancedocuments/characterization-and-qualification-cell-substrates-and-otherbiological-materials-used-production 24. World Health Organization. Recommendations for the evaluation of animal cell cultures as substrates for the manufacture of biological medicinal products and for the characterization of cell banks. WHO Technical Report Series No. 978, Annex 3. 2010. Available from: https://www.who.int/publications/m/item/animal-cellcultures-trs-978-annex-3 25. Guetzkow P, Palmer M. Reason for Concern: BNT162b2 (COVID-19 Vaccine) Manufacturing Process Evaluation. BMJ [Rapid Response]. 2022. Available from: https://www.bmj.com/content/378/bmj.o1731/rr-2 26. European Directorate for the Quality of Medicines & HealthCare (EDQM). European Pharmacopoeia Chapter 2.7.1: Fluorimetric Determination of Nucleic Acids. Available from: https://www.edqm.eu 27. Jones L, Yue ST, Cheung CY, Singer VL. RNA quantitation by fluorescence-based solution assay: RiboGreen reagent characterization. Anal Biochem. 1998;265(2):368-374. doi: 10.1006/abio.1998.2914 28. Georgiou CD, Papapostolou I, Grintzalis K. Protocol for the quantitative assessment of DNA concentration and damage (fragmentation and nicks). Nat Protoc. 2009;4(2):125-131. doi: 10.1038/nprot.2008.222
19 29. Roncati L, Ghaleb N, Ghaleb J, Kfoury K. pDNA Impurities in mRNA Vaccines. Microorganisms. 2025;13(9):1975. doi: 10.3390/microorganisms13091975