Diversity and molecular characterization of the virulence genes of antibiotic-resistant Salmonella strains isolated from bovine faeces in Abidjan district (Côte d'Ivoire)

 Corresponding author: YAO Kouamé René Copyright © 2025 Author(s) retain the copyright of this article. This article is published under the terms of the Creative Commons Attribution License 4.0. Diversity and molecular characterization of the virulence genes of antibiotic-resistant Salmonella strains isolated from bovine faeces in Abidjan district (Côte d'Ivoire) Kouamé René YAO 1, *, Kalpy Julien Coulibaly 3, Konan Bertin Tiékoura 3, Mireille DOSSO 3, Allico Joseph Djaman 2 and Houphouët Felix YAPI 2 1 Department of Biochemistry -Microbiology, faculty of Agroforestry, University of Jean LOROUGNON GUÉDÉ, Côte d’Ivoire. 2 Department of Pharmacodynamics-Biochemistry, faculty of Biosciences, University of Félix Houphouët-Boigny, Côte d’Ivoire. 3 Department of Food Microbiology, Pasteur Institute, Côte d’Ivoire. World Journal of Advanced Research and Reviews, 2025, 28(03), 497-509 Publication history: Received 27 October 2025; revised on 01 December 2025; accepted on 04 December 2025 Article DOI: https://doi.org/10.30574/wjarr.2025.28.3.4070 Abstract The emergence of potentially pathogenic and antibiotic-resistant Salmonella strains in livestock has become a public health concern and is the subject of increased scientific interest. The overall objective of this study is to determine the diversity and molecularly characterize the virulence of antibioticresistant Salmonella strains isolated from cattle faeces in the district of Abidjan (Côte d'Ivoire). Salmonella strains were isolated from various samples of fresh cattle faeces using conventional methodology in accordance with ISO 6579:2002 (E), and the identity of the strains was then confirmed by MALDI-TOF mass spectrometry, followed by the determination of the different serotypes. An antibiotic sensitivity test was used to determine the resistance profiles of the isolated strains. The search for different virulence genes was carried out using the PCR technique with specific primers (invA, spvC, iroN and pefA, etc.). Thus, out of a total of 420 faecal samples analysed, 84 Salmonella strains (20%) were isolated. Serotyping detected 50 different serotypes, with a predominance of Salmonella serotype II. The resistance profile of the Salmonella strains showed relatively high levels of resistance to tetracycline, minocycline and colistin, with rates ranging from 20.2% to 33.3%. However, low levels of resistance were observed to β-lactams, aminoglycosides, fluoroquinolones and trimethoprim/sulfamethoxazole. PCR testing for virulence genes showed that these strains possess at least one virulence gene. In Salmonella, the invA, spvC and iroN genes were detected in 100%, 3.9% and 53.9% of cases, respectively. Poor antibiotic use practices in livestock farming contribute to the spread of potentially pathogenic and antibioticresistant bacteria among the human population. Hence the need to collect data to develop strategies based on a One Health approach in order to protect public health in Côte d'Ivoire. Keywords: Salmonella; Virulence; Antibiotic Resistance; Cattle; Abidjan; Ivory Coast 1. Introduction The genus Salmonella, a ubiquitous bacterium [1] belonging to the Enterobacteriaceae family, is widespread and is a major cause of foodborne illness worldwide, causing approximately 180 million cases of diarrhoea each year [2] [3]. World Journal of Advanced Research and Reviews, 2025, 28(03), 497-509 498 Salmonella infections represent a major challenge for global public health, affecting both human and animal populations. Salmonella enterica is the species responsible for a variety of diseases [4], ranging from common gastroenteritis to potentially fatal typhoid and paratyphoid fever, as well as invasive infections that can lead to serious complications, particularly in at-risk individuals such as children, the elderly and immunocompromised individuals [5] [6] [7] [8]. Domestic and wild animals are the main reservoirs of infection in humans, and contamination occurs through direct contact or consumption of contaminated food or water [9]. Salmonellosis in cattle is widespread throughout the world and is now considered the most important animal zoonosis [10] due to the significant role of cattle in the spread of Salmonella and their impact on the contamination of the food chain and the environment [11] [12]. The virulence of Salmonella is a complex process governed by a multiplicity and variability of factors involving adhesion to host cells, invasion of host cells, multiplication within these cells and resistance to the body's immune defences [13] [14]. The genes responsible for Salmonella virulence, such as invA, spvC, pefA and iroN, are often grouped into pathogenicity islands [15] [16]. Indeed, cattle can carry Salmonella in their intestines without necessarily showing clinical symptoms, thus becoming a silent reservoir. The excretion of the bacterium in faeces contaminates the environment, slaughter surfaces, raw milk and meat, thereby promoting the spread of potentially pathogenic strains [17]. The increase in antibiotic resistance rates in Salmonella is a growing threat, particularly in developing countries where the unregulated and indiscriminate use of antibiotics in livestock farming is common [18]. This practice significantly reduces the effectiveness of antibiotic treatments in humans and animals and further increases the spread of multiresistant strains in the bacterial environment [19]. These resistances, often carried by plasmids that can be transmitted between bacteria, contribute to the rapid spread of resistance genes in various ecosystems [20]. Thus, the detection of resistance carriers associated with virulence carriers provides a better understanding of the pathogenicity of these circulating Salmonella strains. In cattle, the presence of antibiotic-resistant Salmonella poses a public health risk because these strains can be transmitted to humans through the consumption of contaminated products or through direct contact with these animals. In Côte d'Ivoire, although research has been conducted on the prevalence, phenotypic and molecular characterization of antibiotic resistance in Salmonella spp. strains in cattle farms [21] [22], data on the molecular characterization of virulence and resistance factors in bovine strains remain limited. In the district of Abidjan, where agri-food activity is intense, it is therefore essential to characterize the Salmonella strains present in cattle in order to assess the risks to public and animal health and to implement appropriate control measures. The overall objective of this study is to determine the diversity and molecularly characterize the virulence of antibioticresistant Salmonella strains isolated from bovine faeces in the Abidjan district (Côte d'Ivoire). 2. Materials and Methods 2.1. Collection of Salmonella strains from bovine faeces Over a six-month period, between April and September 2016, a study was conducted on the prevalence and characterization of Salmonella strains in cattle faeces in the district of Abidjan (Côte d'Ivoire). This study isolated and identified a total of 84 Salmonella spp strains from 420 fresh bovine faecal samples collected during this period. Specifically, sixty (60) faecal samples were collected in each municipality, except in the municipality of Port-Bouët (3 sites) where 180 samples were collected. Two hundred (200) grams of fresh faeces were randomly selected from the various sites. Initial detection of Salmonella spp. was carried out using the conventional methodology in accordance with ISO 6579:2002 (E) as described by Yao et al., [20] and Julien et al, [21]. The identity of the strains was then confirmed by MALDI-TOF mass spectrometry (BioMérieux, France), thus ensuring rigorous identification. More specifically, the study identified 5 strains from Abobo, 30 strains from Adjamé, 4 from Yopougon, 4 from Bingerville and, finally, 41 strains from Port-Bouët. 2.2. Serotyping test of isolated strains The serotypes of the strains isolated from cattle faeces and confirmed by MALDI-TOF were determined by slide agglutination tests with O, H and Vi antisera (Bio Mérieux, France) [20]. The results were read according to the Kauffmann-White scheme (1934). World Journal of Advanced Research and Reviews, 2025, 28(03), 497-509 499 2.3. Antibiotic susceptibility testing of isolated strains Antibiotic sensitivity testing was performed on all Salmonella strains using the agar disc diffusion method, and the results were interpreted according to the standards of the Antibiogram Committee of the French Society for Microbiology (EUCAST/CA-SFM, 2016). The reference strain E. coli ATCC 25922 was used for internal quality control. The following antibiotic discs (Bio-Rad France) were used: ampicillin (10 μg), amoxicillin + clavulanic acid (30 μg), cefalotin (30 μg), cefepime (30 μg), aztreonam (30 μg), cefoxitin (30 μg), ceftriaxone (30 μg), ceftazidime (30 μg), cefuroxime (30 μg), imipenem (10 μg), tetracycline (30 μg), minocycline (30 μg), gentamicin (10 μg), tobramycin (10 μg), amikacin (30 μg), nalidixic acid (30 μg), norfloxacin (5 μg), ciprofloxacin (5 μg), chloramphenicol (30 μg), colistin (50 μg) and trimethoprim/sulfamethoxazole (25 μg). 2.4. Detection of virulence genes by PCR Molecular detection of virulence genes was performed by PCR on all Salmonella strains exhibiting phenotypic resistance to at least one antibiotic. Bacterial DNA was extracted from 500 µL of Salmonella isolate suspension using nuclease-free water (pure water) and total DNA extraction was performed by heat shock [23] [21]. The various DNA extracts obtained were then used as a template for PCR reactions using specific primers listed in Table 1. Genomic amplification was performed in a final volume of 50 µl of reaction mixture, containing 5X coloured buffer (Promega, USA), 5X uncoloured buffer (Promega, USA), 25 mM MgCl2(Promega, USA), 10 mM of each dNTP (Biorad, France), 10 µM specific primers (Reverse and Forward), 5U of Taq polymerase (Go taq ® G2 Flexi DNA Polymerase) (Promega, USA), and 5 µL of DNA. Reference strains provided by the National Food Institute (DTU Food) collection were used as positive controls for PCR (Table 2) and a reaction mixture without DNA extract was used as a negative control. The amplification conditions are shown in Table 3. The PCR products were analysed by agarose gel electrophoresis. The gels, prepared with 10X TAE (Tri-Acetate-EDTA) buffer and 5 μL of EZ-vision® solution (Inqaba biotec, West Africa), had a concentration of 2%. Electrophoresis was conducted at 120 V/cm for 1 hour. A 100 bp molecular weight marker was used to approximately determine the size of the fragments to be analysed. After migration, the DNA was observed under UV light (λ = 312 nm) using the Gel Doc EZ Imager automated system (BioRad, USA). Table 1 Specific primer for the detection of resistance genes Gene Primer Sequence (5'-3') Hybridisation temperature Fragment size (bp) References invA INVA-1 INVA-2 ACAGTGCTCGTTTACGACCTGAAT AGACGACTGGTACTGATCGATAAT 56 244 [24] spvC SPVC-1 SPVC-2 ACTCCTTGCACAACCAAATGCGGA TGTCTTCTGCATTTCGCCACCATCA 56 571 [24] iroN iroN-F iroN-R ACTGGCACGGCTCGCTGTCGCTCTAT CGCTTTACCGCCGTTCTGCCACTGC 66.5 1205 [25] pefA pefA-r pefA-f AGGGAATTCTTCTTGCTTCCATTCCATTATTGCACTGGG TCTGTCGACGGGGGATTATTTGTAAGCCACT 50 157 [25] World Journal of Advanced Research and Reviews, 2025, 28(03), 497-509 500 Table 2 Reference strains Species Usage References/Origin E. coli ATCC25922 Controls for culture media and antibiograms DTU Food (Denmark) Salmonella P5002212 DT104 Positive control for detection of invA, spvC, pefA and iroN genes DTU Food (Denmark) Table 3 PCR programmes Amplification step Temperature condition/duration invA, spvC iroN, pefA Initial denaturation 94°C/2 min 34°C/2 min Cyclic denaturation 94°C/30 sec 94°C/30 s Hybridisation 56°C/30 s 65°C/30 s Cyclic elongation 72°C/2 min 72°C/1 min Final elongation 72°C/10 min 72°C/10 min Number of cycles 35 35 3. Results 3.1. Frequency of isolation and distribution of Salmonella serotypes isolated from bovine faeces in the district of Abidjan After isolation and confirmation by MALDI-TOF mass spectrometry, 84 Salmonella strains were identified in a total of 420 bovine faecal samples collected in the Abidjan district, indicating an overall prevalence of 20% in the bovine faeces sampled. In addition, the geographical distribution of the isolated Salmonella strains varied considerably between municipalities. The municipality of Port-Bouët had the highest number of isolates with 41 strains, followed by the municipality of Adjamé with 30 strains. The municipalities of Abobo, Yopougon and Bingerville had the lowest numbers of isolates with 5 strains, 4 strains and 4 strains respectively (Table 1). In addition, serological analysis revealed a diversity of Salmonella serotypes in the bovine faeces sampled (Table 4). A total of 50 different serotypes were identified among the 84 Salmonella strains isolated from bovine faeces. The most frequently identified serotypes were Salmonella enterica subsp. enterica serotype II (11 strains, 13.1%), Salmonella enterica subsp. enterica serotype Agbeni (7 strains, 8.3%) and Salmonella enterica subsp. enterica serotype Hohentwiel (7 strains, 8.3%). Other serotypes were identified with lower frequencies ranging from 1.2% to 3.6%. Table 4 Distribution of samples and number of Salmonella strains isolated in faeces Salmonella ssp Common/ Number of samples Number of strains isolated Abobo (n= 60) 5 Adjamé (n= 60) 30 Yopougon (n= 60) 4 Bingerville (n= 60) 4 Port-Bouët (n= 180) 41 Total (N=420) 84 World Journal of Advanced Research and Reviews, 2025, 28(03), 497-509 501 Table 5 Salmonella serotypes isolated from cattle faeces Number Serotypes Number Frequency (%) 1 Salmonella Virchow 2 2.4 2 Salmonella Muguga 2 2.4 3 Salmonella IIIa 1 1.2 4 Salmonella Agbeni 7 8.3 5 Salmonella Enteritidis 1 1.2% 6 Salmonella Neumenster 1 1.2% 7 Salmonella II 11 13.1 8 Salmonella Othmerschen 1 1.2 9 Salmonella Brikama 1 1.2% 10 Salmonella Durcham 2 2.4 11 Salmonella Catanzaro 1 1.2 12 Salmonella Parkroyal 1 1.2% 13 Salmonella Senftenberg 2 2.4% 14 Salmonella Schwarzengrund 1 1.2 15 Salmonella Kambole 1 1.2% 16 Salmonella Umbadah 1 1.2% 17 Salmonella Dessau 1 1.2% 18 Salmonella Tudu 1 1.2 19 Salmonella Gustavia 2 2.4 20 Salmonella Canton 1 1.2% 21 Salmonella Muenster 1 1.2% 22 Salmonella Salford 1 1.2% 23 Salmonella Potsdam 2 2.4% 24 Salmonella Fufu 1 1.2 25 Salmonella Budapest 1 1.2% 26 Salmonella Urbana 1 1.2% 27 Salmonella Wichita 1 1.2% 28 Salmonella Torhout 1 1.2% 29 Salmonella Baguirmi 2 2.4% 30 Salmonella Africana 1 1.2% 31 Salmonella Kedougou 1 1.2% 32 Salmonella Dublin 3 3.6% 33 Salmonella Alfort 1 1.2% 34 Salmonella Hohentwiel 7 8.3% 35 Salmonella Clerkenwell 2 2.4 World Journal of Advanced Research and Reviews, 2025, 28(03), 497-509 502 36 Salmonella Kisangani 1 1.2 37 Salmonella Bradford 1 1.2% 38 Salmonella Shubra 2 2.4% 39 Salmonella Chicago 1 1.2 40 Salmonella Erfurt 1 1.2% 41 Salmonella Scarborough 1 1.2% 42 Salmonella Schleissheim 1 1.2% 43 Salmonella Langensalza 2 2.4 44 Salmonella Preston 1 1.2 45 Salmonella Wuiti 1 1.2% 46 Salmonella Bron 1 1.2% 47 Salmonella Typhi 1 1.2% 48 Salmonella Bochum 1 1.2% 49 Salmonella Atakpame 1 1.2% 50 Salmonella Chomedey 1 1.2 Total 84 100% 3.2. Resistance profile of Salmonella strains Analysis of antibiotic resistance in the 84 Salmonella spp strains showed that 26 strains were resistant to at least one antibiotic. The rate of resistance to beta-lactams and quinolones was generally low (1.2% to 6% and 3.6%, respectively). The highest resistance was observed for colistin (33.3%), followed by tetracycline and minocycline (20.2% each). Gentamicin (1.2%), tobramycin (3.6%) and trimethoprim/sulfamethoxazole (6%) showed low levels of resistance, while no resistance was observed with cefoxitin, imipenem, amikacin and chloramphenicol (Table 6). Table 6 Antibiotic resistance profil Antibiotic families Resistance frequency (%) R(n=84) Betalactams Ampicillin (AMP) 2.4 Amoxicillin/clavulanic acid (AMC) 1.2 Cefalotin (CEF) 6 Cefuroxine (CXM) 2.4 Cefoxitin (FOX) 0 Ceftriaxone (CRO) 1.2 Ceftazidime (CAZ) 1.2 Cefepime (FEP) 1.2 Aztreonam (ATM) 1.2 Imipenem (IMP) 0 Quinolones World Journal of Advanced Research and Reviews, 2025, 28(03), 497-509 503 Nalidixic acid (NAL) 3.6 Ciprofloxacin (CIP) 3.6 Norfloxacin (NOR) 3.6 Cyclines Tetracycline (TET) 20.2 Minocycline (MNO) 20.2 Aminoglycosides Amikacin (AKN) 0 Tobramycin (TMN) 3.6 Gentamicin (GEN) 1.2 Others Colistin (CST) 33.3 Chloramphenicol (CHL) 0 Trimethoprim/Sulfamethoxazole (SXT) 6 3.3. Detection of virulence genes The search for genes linked to the virulence of Salmonella strains was carried out using single-plex PCR (iroN and pefA) and multiplex PCR (invA and spvC). The presence of the genes was confirmed by the size of the amplicons obtained (157 bp for pefA, 244 bp for invA, 571 bp for spvC and 1205 bp for iroN) (Figure 1). Thus, no pefA gene was detected in the strains analysed. However, all 26 resistant strains possessed at least one of the virulence genes sought. The invA gene was present in all strains with a frequency of 100%. The spvC gene showed a relatively low frequency (3.8%). The iroN gene was detected with a frequency of 53.8% (Table 7). Overall, all Salmonella serotypes possessed at least one virulence gene. Some serotypes carried only the invA gene (12 serotypes), while others carried both the invA and spvC genes (13 serotypes). Only the Schwarzengrund serotype had a combination of three (3) virulence genes (invA + spvC+ iroN) (Table 8). Figure 1 Electrophoretic profiles of virulence genes detected in Salmonella A: detection of the invA (244bp) and spvC (571bp) genes by multiplex PCR; B: detection of the iroN gene (1205) by simplex PCR ; M: molecular weight marker (100 to 2000 bp) ;P: positive control (Salmonella DT104 strain);N: negative control (contains ppi water instead of bacterial DNA). Numbers 1 to 6: bacterial strains M. P. 1. 2. 3. 4. 5. 6. N World Journal of Advanced Research and Reviews, 2025, 28(03), 497-509 504 Table 7 Detection of virulence genes Strains Number of genes detected Total invA spvC iroN pefA Salmonella 26 1 14 0 26 Frequency (%) 100 3.8 53.8 0 100 Table 8 Association between virulence genes and serotypes Salmonella Strains Genes Serotypes Strains Genes Serotypes E32S invA Virchow E93S invA Muenster E38S invA IIIa E108S invA,iroN Fufu E44S invA,iroN Enteritidis E28ADS invA,iroN Africana E46S invA,iroN Neumenster E31ADS/A invA,iroN Dublin E60S invA,iroN Brikama E31ADS/C invA,iroN Alfort E61S invA Agbeni E32ADS/C invA,iroN hohentwiel E64S invA II E35ADS/A invA,iroN Kisangani E67S/B invA Senftenberg E35ADS/C invA,iroN Shubra E68S invA,spvC,iron schwarzengrund E45ADS/A invA,iroN hohentwiel E73S invA Umbadah DCE28AB/C invA,iroN Agbeni E74S invA Dessau DCE29PB/B invA,iroN Agbeni E88S invA II E32BIS invA chomedey E89S invA Gustavia E66S invA II 4. Discussion In this study, Salmonella strains were isolated from bovine faeces using the method based on standard NF EN ISO 6579 (ISO-6579, 2002E). The process included pre-enrichment, selective enrichment, selective isolation and identification via MALDI-TOF [21] [22]. The isolation results showed a prevalence of 20% in the sampled cattle faeces. This average prevalence of 20% is higher than that reported in several studies in Ethiopia (2.3%) and Nairobi (2.6%) [26] [27]. However, much lower carriage rates have been reported in cattle in Japan and Great Britain, with prevalences of 0.5% and 1.4% respectively [28] [29]. On the other hand, this prevalence is relatively comparable to that reported by Akoachere et al. [30] in Cameroon, which is 28.7%. A study conducted in Burkina Faso revealed a much higher carriage rate of Salmonella (52%) in bovine faeces [31]. The prevalence observed in this study may be related to the geographical location and hygiene conditions on farms. The prevalence observed in this study may be related to the geographical location and hygiene conditions on our farms. Farms and livestock parks are located close to human populations, and excrement and food waste are not regularly disposed of. These conditions can provide sufficient nutrients in moist soils for Salmonella to remain viable [32]. Serotyping of the 84 Salmonella strains isolated revealed 50 different serotypes. Previous studies have reported that the serotypes most frequently observed in cattle are S. Typhimurium, S. Dublin, S. Agona, S. Orion, S. Aintpul, S. Braenderup, S. Muenchen, S. Croſt, S. Kentucky, S. Telaviv, S. Montevideo, S. Kpeme, S. Infantis, S. Abadina, S. Cerro, S. Mismarhaenek, S. Enteritidis, S. Guildford, S. Anatum, S. Gozo, S. Mbandaka, S. Senſtenberg, S. Newport, S. Give, and S. Muenster [33] [34] [35] [36] [37]. Research conducted by [26] on cattle faeces in Ethiopia reported several serotypes, World Journal of Advanced Research and Reviews, 2025, 28(03), 497-509 505 among which S. Typhimurium, S. Saint-paul, S. Kentucky, and S. Virchow were the most common. However, in this study, serotype II was the most dominant. The Typhi serotype was observed with a frequency of 1.19%. Although present in low proportions, the presence of S. Typhi explains the failure of hygiene measures, but also the presence of livestock in urban areas. Indeed, S. Typhi is a strictly human pathogen that causes invasive fever (typhoid fever), whereas most other Salmonella serotypes mainly cause gastrointestinal symptoms without systemic invasion [38]. The growing resistance of Salmonella to antibiotics commonly used in veterinary and human medicine is a growing public health concern. This is often attributed to poor management practices in livestock farming, which lead to the emergence of resistant bacteria, as observed in this study. Isolated bovine faecal samples showed a high rate of antibiotic-resistant Salmonella strains, confirming the hypothesis that bovine faeces can serve as reservoirs for resistant bacteria, thereby increasing the likelihood of transmission to humans [39]. Salmonella strains showed low resistance to beta-lactams. Resistance to this molecule could be attributed to its misuse in livestock farming. Resistance to betalactams, particularly thirdand fourth-generation cephalosporins (C3G/C4G), is less common in animal Salmonella strains, suggesting that this bacterium is not a major reservoir of resistance genes [40]. Moreover, cumulative data from Salmonella strain surveillance networks in France confirm this very low proportion of C3G/C4G-resistant Salmonella strains of animal origin. Several authors have also reported similar resistance rates [41]. Variable rates of resistance to third-generation cephalosporins have been reported in China (1.6%), Romania (11.4%) and the United States (16%) [42] [43] [44]. All Salmonella strains in this study were susceptible to imipenem, probably due to its efficacy, good stability, and high bactericidal activity, making it an antibiotic of choice for the treatment of infections caused by resistant bacteria [45] [46]. Salmonella strains remained largely susceptible to quinolones, with average resistance rates of 3.6% observed for nalidixic acid, ciprofloxacin and norfloxacin. Similar quinolone resistance rates have been reported in the Republic of Ireland (2.6% for nalidixic acid) and India (5.7% for ciprofloxacin) [47] [41]. However, higher rates of resistance to nalidixic acid have been reported in Kenya (12%) [27] and Romania (65.1%) [43]. Even higher resistance rates for ciprofloxacin (25.8% to 42.95%) have been reported in China [43] [44]. High resistance rates for nalidixic acid (75%) and ciprofloxacin (75%) have been reported in Nigeria [39]. The emergence of fluoroquinolone resistance is concerning because these antibiotics are commonly used to treat invasive salmonellosis in veterinary medicine. The low rate observed in this study may be due to the fact that fluoroquinolones are not widely used in cattle farming in Côte d'Ivoire. The isolated Salmonella strains showed high resistance to cyclines (20.2% tetracycline, 20.2% minocycline). This increase in cycline resistance has also been observed in the United States [48], with a reported resistance rate of 20.9%. Higher resistance rates have been observed in Nigeria [39], Ethiopia [26] and the United States [49]. High resistance rates to tetracycline (62.2%) and minocycline (46.3%) were observed in South Africa [50]. Lower rates of resistance to tetracycline have been reported in other studies [51] [52]. In addition, resistance to colistin was quite high in this study, affecting 33.3% of Salmonella strains. The rates obtained in this study are worrying because they are much higher than those reported in several studies [53] [54] [55]. This high prevalence of colistin resistance may be due to the increased use of colistin in livestock farming. In addition to the resistance profiles observed, all resistant Salmonella strains studied possessed at least one virulence gene. The invA, spvC and iroN genes were detected with frequencies of 100%, 3.8% and 53.8%, respectively. Only the pefA gene was not detected. The high detection rate of the invA gene obtained in this study was also reported by Abouzeed et al. [56] in Iceland. The results obtained are similar to those of [57], with 98.8% of Salmonella carrying the invA gene originating from cattle. Indeed, the invA virulence gene is common to all Salmonella and is used as a PCR target gene for the detection of Salmonella [58]. The invA gene is essential for the full virulence of Salmonella and is important in the invasion of phagocytic epithelial cells and entry into the intestinal mucosa. As for the spvC gene, its detection frequency in this study is similar to that reported by Chuanchuen et al. [57], which is 1.3%. The spvC gene is one of the virulence genes that play a role in controlling the immune response and regulating host cell interaction. The spvC gene also controls the growth rate of Salmonella in the host cell [59]. Thus, the very low prevalence of spvC genes observed in our study could be explained by the integration of the virulence plasmid into the chromosome [56]. The pefA gene, which codes for the fimbriae adhesin necessary for Salmonella adaptation to the host, was not detected in this study. However, Chuanchuen et al. [57] reported a detection frequency of 0.6% in their work. Other studies on Salmonella strains from sick birds [60] and pigs [61] showed high detection frequencies of 68.2% (15/22) and 92% (23/25) respectively. The pefA virulence genes are associated with the plasmid. The iroN gene, detected in 53.9% of cases, plays an important role in the survival of the bacterium in hostile environments [62]. It enables Salmonella to acquire iron and distinguishes Salmonella from other bacteria. Iron is an essential element for many bacterial species. Thus, the high rate of the iroN gene observed in this study may be linked to the bioavailability of iron [62] [63] in bovine faecal matter. PCR profiles of Salmonella strains revealed genotypic variations in virulence depending on serotype. Salmonella serotype Schwarzengrund, for example, presented a more diverse range of virulence genes, including the invA, spvC and iroN genes. This study shows that certain antibiotic-resistant Salmonella serotypes are also capable of expressing