Macrobiotus hupingensis, a New Tardigrade Species in the Macrobiotus pallarii Complex from China

© 2022 Academia Sinica, Taiwan Open Access Macrobiotus hupingensis, a New Tardigrade Species in the Macrobiotus pallarii Complex from China Zhimin Yuan1,*, Yan Wang1, Qiuju Liu1, Lijie Liu1, and Xiaochen Li1 1College of Life Sciences, Shaanxi Normal University, Xi’an, 710100, P. R. China. *Correspondence: E-mail: [email protected] (Yuan). E-mail: 195751[email protected] (Wang); liuqj1[email protected] (Liu); [email protected] (Liu); [email protected] (Li) Received 3 March 2021 / Accepted 17 October 2022 / Published 26 December 2022 Communicated by Benny K.K. Chan In this paper we describe Macrobiotus hupingensis, a new tardigrade species of the Macrobiotus pallarii complex from southern China. We used the traditional morphology-based taxonomic analysis, supported by detailed morphometrics, light microscopy imaging, scanning electron microscopy, and analysis of four genetic markers (18S rRNA, 28S rRNA, COI and ITS-2). Macrobiotus hupingensis sp. nov. is characterized by eggs with large, conical processes, each surrounded by six (only sometimes five) hexagonal areolae. Based on the morphological characters of the animals (two macroplacoids, one microplacoid, porous curicle, Y-shaped claws) as well as genetic data, we demonstrate the new species to be a member of the M. pallarii complex. However, it differs specifically from M. pallarii, M. pseudopallarii, and M. ripperi mainly by the absence of sparse granulation between legs III and IV. It also differs from M. margoae mostly by the presence of meshes within the entire egg process wall. Finally, the new species can be easily distinguished from M. caymanensis by the presence of granulation visible in light microscopy in all legs. Key words: China, DNA barcoding, Macrobiotus hupingensis sp. nov., Species delimitation. BACKGROUND Before this study, 234 tardigrade species had been recorded in China (Gao et al. 2012; Sun 2014; Yang 2015; Zawierucha et al. 2018; Bi 2019; Sun et al. 2020; Guo 2020) and more than 1,300 had been found and described worldwide (Guidetti and Bertolani 2005; Degma and Guidetti 2007; Degma et al. 2009–2021). The genus Macrobiotus C.A.S. Schultze, 1834, is the most speciose and diverse in the family Macrobiotidae and was the first described tardigrade genus (Greven 2018). The genus currently comprises 119 species and 2 subspecies (Stec et al. 2020a b 2021a b 2022; Degma et al. 2009–2021; Vecchi et al. 2022; Cesari et al. 2022) (Table S1), 27 of which are doubtful because of insufficient descriptions (they often lack information on key traits that are currently used to differentiate the species, such as leg granulation, lunule morphology, oral cavity armature, morphometric characters, and egg ornamentation). At present, 27 species of the genus Macrobiotus have been recorded in China (Table 1) (Gao et al. 2012; Sun 2014; Yang 2015; Bi 2019; Guo 2020; Wang 2021). Macrobiotus is characterised by porous cuticle, mouth opening surrounded by ten peribuccal lamellae, a rigid buccal tube strengthened with the ventral lamina lacking a ventral hook, two macroplacoids and one microplacoid in the pharynx, double Y-shaped claws on each leg and by laying ornamented eggs freely in the environment. Animals in the Macrobiotus pallarii complex have the very typical morphology of Macrobiotus. However, this group is characterized by egg ornamentation composed of large conical processes separated by a single row of areolation (such ornamented eggs are also known in Citation: Yuan Z, Wang Y, Liu Q, Liu L, Li X. 2022. Macrobiotus hupingensis, a new tardigrade species in the Macrobiotus pallarii complex from China. Zool Stud 61:86. doi:10.6620/ZS.2022.61-86 Zoological Studies 61:86 (2022) doi:10.6620/ZS.2022.61-86 1 © 2022 Academia Sinica, Taiwan other genera, e.g., Paramacrobiotus Guidetti et al. 2009 or Mesobiotus Vecchi et al. 2016). The Wuling Mountains are in southern Central China. The entire area is covered by folded mountains, with elevations generally above 1000 m asl, an average temperature of about 13.4℃, and average precipitation reaching 1100–1600 millimetres. The district has a transitional climate from subtropical to warm temperate zones, forest coverage rate is as high as 53%, and the vegetation is mixed broadleaf evergreen and deciduous forest (Liu et al. 2020). The mountains run from northeast to southwest and stretch across Chongqing, Hunan, Hubei, and Guizhou Provinces (Chen and Li 2003). Until now, no tardigrade fauna was reported from Wuling Mountains. However, in the summer of 2019, we made a field trip to the Wuling Mountains and identified a new species from the genus Macrobiotus, which we describe here. Our research applied an integrative approach to taxonomy involving detailed morphological, morphometric, and molecular analyses. Such an integrated approach let us accurately test a new species hypothesis. MATERIALS AND METHODS Sample and specimens Moss was collected from the surface of a rock located at Hupingshan, Wuling Mountains, Hunan Province, China (29°50'–30°09'N, 110°29'–110°59'E; 1000–2000 m asl) in August 2019. Samples were examined for tardigrades using the protocol by Dastych (1980) with modifications described in detail in Stec et al. (2015). A total of 236 individuals and 46 eggs of the new species were extracted from the sample and split into three groups: morphological analysis with phase and differential contrast light microscopy (PCM), morphological analysis with scanning electron microscopy (SEM), and DNA sequencing. Microscopy and imaging Specimens were fixed on permanent microscope slides in Hoyer’s medium for observations and morphometry using phase contrast light microscopy (PCM). Images were captured with a Nikon DS-Fil Table 1. A list of species of Macrobiotus formally described from China before (valid and doubtful taxa) State Species formally recorded in China References valid Macrobiotus alvaroi Pilato & Kaczmarek, 2007 Guo 2020 Macrobiotus ariekammensis Węglarska, 1965 [Macrobiotus adelges Dastych, 1977] Gao et al. 2012 Macrobiotus crenulatus Richters, 1904 [Macrobiotus dentatus Binda, 1974] Sun 2014 Macrobiotus diversus Biserov, 1990 Sun 2014 Macrobiotus drakensbergi Dastych, 1993 Guo 2020 Macrobiotus echinogenitus Richters, 1903 Gao et al. 2012 Macrobiotus hufelandi C.A.S. Schultze, 1834 [Macrobiotus schultzei Greeff, 1866 according to Marcus 1928] Gao et al. 2012 Macrobiotus mandalaae Pilato, 1974 Gao et al. 2012 Macrobiotus nelsonae Guidetti, 1998 Guo 2020 Macrobiotus occidentalis occidentalis Murray, 1910 Gao et al. 2012 Macrobiotus pallarii Maucci, 1954 [Macrobiotus aviglianae Robotti, 1970] Sun 2014 Macrobiotus patagonicus Maucci, 1988 Bi 2019 Macrobiotus paulinae Stec, Smolak, Kaczmarek & Michalczyk, 2015 Guo 2020 Macrobiotus persimilis Binda & Pilato, 1972 Gao et al. 2012 Macrobiotus polyopus Marcus, 1928 Guo 2020 Macrobiotus ragonesei Binda, Pilato, Moncada & Napolitano, 2001 Gao et al. 2012 Macrobiotus ramoli Dastych, 2005 Guo 2020 Macrobiotus recens Cuénot, 1932 Gao et al. 2012 Macrobiotus shonaicus Stec, Arakawa & Michalczyk, 2018 Guo 2020; Wang 2021 doubtful Macrobiotus annae Richters, 1908 Sun 2014 Macrobiotus gemmatus Bartoš, 1963 Gao et al. 2012 Macrobiotus hibiscus de Barros, 1942 Gao et al. 2012 Macrobiotus insignis Bartoš, 1963 Gao et al. 2012 Macrobiotus rollei Heinis, 1920 Gao et al. 2012 Macrobiotus shennongensis Yang, 1999 Yang 2015 Macrobiotus terricola Mihelčič, 1951 Gao et al. 2012 Macrobiotus yunshanensis Yang, 2002 Yang 2015 page 2 of 18Zoological Studies 61:86 (2022) © 2022 Academia Sinica, Taiwan digital camera, and measurements were made using the embedded software. Immediately after mounting the specimens in the medium, slides where checked under PCM for the presence of males and females in the studied population based on the spermatozoa in testis and spermathecae, which remain visible for several hours after mounting (Coughlan et al. 2019; Coughlan and Stec 2019). To obtain clean and extended specimens for SEM, tardigrades were processed according to the protocol by Stec et al. (2015). Specimens were examined under a low-vacuum environmental scanning electron microscopy—SEM (Tabletop Microscope TM3030 Plus, Hitachi, Tokyo, Japan)—at Shaanxi Normal University, Xian, China. All figures were assembled in Photoshop CS6. Morphometrics and morphological nomenclature All measurements are given in micrometres (μm). Structures were measured only if they were in the proper orientation. Structures were measured only if their orientation was suitable. Body length was measured from the anterior extremity to the end of the body, excluding the hind legs. The terminology used to describe oral cavity armature and eggshell morphology follows Michalczyk and Kaczmarek (2003) and Kaczmarek and Michalczyk (2017). The terminology used to describe cuticular bars and muscle attachments on legs follows Kiosya et al. (2021). Macroplacoid length was measured according to Kaczmarek et al. (2014). Buccal tube length and the level of the stylet support insertion point were measured according to Pilato (1981). The pt index is the ratio of the length of a given structure to the length of the buccal tube expressed as a ratio (Pilato 1981). Measurements of buccal tube widths and heights of claws and eggs follow Kaczmarek and Michalczyk (2017). Morphometric data were analysed with the Parachela ver. 1.7 template available from the Tardigrada Register, http://www. tardigrada.net/register (Michalczyk and Kaczmarek 2013), and are provided in the Supplementary Materials (Table S2). Tardigrade taxonomy follows Bertolani et al. (2014), Stec et al. (2020c 2021c). Genotyping The DNA was extracted from individual animals with the TIANamp Micro DNA Kit (Tiangen) following the manufacturer’s standard protocols. We sequenced four DNA fragments: the small ribosomal subunit (18S rRNA, nDNA), large ribosomal subunit (28S rRNA, nDNA), internal transcribed spacer (ITS-2, nDNA), and cytochrome oxidase subunit I (COI, mtDNA). All fragments were amplified and sequenced according to the protocols described in Stec et al. (2020b); primers and original references for specific PCR programs are listed in table 2. Sequencing products were read with the ABI 3130xl sequencer at Tsingke Biology Limited Company, Xian, China. Sequences were processed in BioEdit ver. 7.2.5 (Hall 1999) and submitted to GenBank. See table 3 for accession numbers. Phylogenetic analysis and p-distances The phylogenetic analyses were conducted using COI sequences. Sequences were downloaded from GenBank or produced de novo (Table 3). Type sequences of Macrobiotus caelestis (Coughlan et al. 2019) were used as the outgroup. The sequences were aligned using MAFFT ver. 7 (Katoh et al. 2002; Katoh and Toh 2008). The COI sequences were aligned according to their amino acid sequences (translated using the invertebrate mitochondrial code) with the MUSCLE algorithm (Edgar 2004) in MEGA X version 10.1.7 (Kumar et al. 2018) with default settings (i.e., all gap penalties = 0, max iterations = 8, clustering method = UPGMB, lambda = 24). Alignments were visually inspected and trimmed in MEGA X. Sequences Table 2. Primers and references for PCR protocols for amplification of the four DNA fragments sequenced in this study DNA fragment Primer name Primer direction Primer sequence (5'-3') Primer source PCR program 18S rRNA SSU01_F forward AACCTGGTTGATCCTGCCAGT Sands et al. (2008) Zeller (2010) SSU82_R reverse TGATCCTTCTGCAGGTTCACCTAC 28S rRNA 28S_Eutar_F forward ACCCGCTGAACTTAAGCATAT Gąsiorek et al. (2018) Mironov et al. (2012) 28SR0990 reverse CCTTGGTCCGTGTTTCAAGAC Mironov et al. (2012) ITS-2 Eutar_Ff forward CGTAACGTGAATTGCAGGAC Stec et al. (2018) Wełnicz et al. (2011) Eutar_Rr reverse TCCTCCGCTTATTGATATGC COI LCO1490 forward GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) Michalczyk et al. (2012) HCO2198 reverse GTAAATATATGRTGDGCTC page 3 of 18Zoological Studies 61:86 (2022) © 2022 Academia Sinica, Taiwan were concatenated with PhyloSuite v1.2.2 (Zhang et al. 2020). Model selection and phylogenetic reconstructions were undertaken using the CIPRES Science Gateway (Miller et al. 2010). Model selection was performed for each alignment partition using PartitionFinder2 (Lanfear et al. 2016). Maximum Likelihood (ML) phylogenetic reconstruction was performed using MEGA X. Bootstrapping was done with 500 replicates for ML trees. The phylogenetic tree was visualised using iTOL v6.5.2 (https://itol.embl.de/), and the image was edited with Photoshop CS6. The species in the M. pallarii complex are phylogenetically and morphologically distinct (Stec et al. 2021a), so the p-distances for the genetic differential diagnosis were calculated between species in the M. pallarii complex for the four sequenced markers separately (18S rRNA, 28S rRNA, ITS2, and COI) using the alignments used for analysis. Pairwise distances were calculated with the software MEGA X using pairwise deletion for the Gap/Missing Data Treatment option. Detailed p-distance tables are provided in table S3. Species delimitation To assess the genetic differentiation of species within our dataset of 18 Macrobiotus pallarii complex COI sequences, we used the ASAP procedure designated for a list of partitions of species hypotheses using genetic distances, calculated between DNA sequences, and ranked the partitions by their ASAP-scores: the lower the score, the better the partition (Puillandre et al. 2021). The online ASAP version (https://bioinfo.mnhn. fr/abi/public/asap/asapweb.html) was used with default settings and the K2P distance model. Statistical analysis Statistical analyses were run in SPSS software (version 23.0; SPSS Inc., Chicago, IL, USA). Morphometric data for eggs and animals were analysed with principal component analysis (PCA). We analysed the eggs and animals using absolute values (raw measurements in μm) and relative (pt) values, respectively. Missing data in the animal dataset were replaced with median site data in SPSS. PCA extracts maximum variance from a dataset with a few orthogonal components. The first principal component (PC1) is the linear combination of observed variables that maximally separates the subjects by maximizing the variance of their component scores. The second component (PC2) is the linear combination of the observed variables Table 3. GenBank accession numbers of sequences used in the present study. Newly generated sequences are in bold Taxon Individual 18S 28S COI ITS2 Macrobiotus caelestis MK737073 MK737071 MK737922 MK737072 Macrobiotus pallarii complex hp04130206 MW183923 MZ474842 hp04130207 MZ470349 MZ474843 hp04130208 MZ470350 MW186952 hp04130209 MW187003 FI.066.1 MT809075 MT809088 MT807929 FI.066.2 MT809076 MT809089 MT807930 MT809103 FI.066.3 MT807931 MT809104 FI.066.4 MT807932 MT809105 IT.337.1 MT809069 MT809081 MT807924 MT809094 IT.337.2 MT809070 MT809082 MT807925 MT809095 IT.337.3 MT809071 MT809083 MT807926 MT809096 ME.007.1 MT809065 MT809077 MT809090 ME.007.2 MT809066 MT809078 MT807920 ME.007.3 MT809067 MT809079 MT807921 MT809091 ME.007.4 MT809068 MT809080 MT807922 MT809092 ME.007.5 MT807923 MT809093 PL.015.1 MT809074 MT809086 MT809100 PL.015.2 MT809087 MT807933 MT809101 PL.015.3 MT807934 PL.015.4 MT807935 MT809102 US.057.1 MT809072 MT809084 MT807927 MT809098 US.057.2 MT809073 MT809085 US.057.3 MT807928 MT809099 US.057.4 MT809097 page 4 of 18Zoological Studies 61:86 (2022) © 2022 Academia Sinica, Taiwan that extract maximum variability uncorrelated with the first component. PC1 extracts the most variance and PC2 extracts less (Tabachnick and Fidell 2007). A one-way ANOVA was used to calculate differences between the paired species based on the results of PCA. The data for the animal and egg PCAs were analysed using OriginPro 2022 software to visualize it appropriately. RESULTS Phylogenetic analysis The ML phylogenetic reconstructions yielded a topology (Fig. 1) with five well-supported clades: the first clade comprised all sequences of Macrobiotus ripperi Stec et al. (2021b) (the Polish (PL) and Finnish (FI) population); the second contained all sequences of Macrobiotus pallarii Maucci (1954) (the Italian (IT) population); the third contained sequences of Macrobiotus pseudopallarii Stec et al. (2021b) (the Montenegrin (ME) population); and the fourth contained sequences of Macrobiotus margoae Stec et al. (2021b) (the US populations); and the fifth contained sequences from the Chinese (CN) population (obtained in this study). Species delimitation The ASAP results from the COI marker are shown in figure 1. The applied ASAP procedure identified five MOTUs (hypothetical species) at the threshold distance of 9.15% (K2P) with the best ASAP‐score (1.50) within the available molecular data: M. ripperi, M. pallarii, M. pseudopallarii, M. margoae, and a fifth putative species represented by Chinese population analyzed in this study. At the threshold distance of 0.16% (K2P) (but with a poorer ASAP‐score of 6.00), the ASAP analysis retrieved nine species (M. ripperi was delimited as three species, M. pseudopallarii as two species, and a putative species represented by Chinese population analyzed in this study as two species); however, we did not consider this result to be valid, as the lower the ASAP result is scored, the better the partition. Morphometric analysis A plot of PC1 and PC2 for the animal and egg measurements is also shown in figure 2. The PCA Fig. 1. Maximum Likelihood tree of the Macrobiotus pallarii complex, obtained from 19 nucleotide COI sequences. Bootstrap values > 50% are provided at major nodes for ML tree calculation methods. The results of species delimitation are indicated by vertical bars. Sequences generated in the course of the present study are given in red box line. page 5 of 18Zoological Studies 61:86 (2022) © 2022 Academia Sinica, Taiwan for the animal measurements extracted five principal components, from which PC1 explained 50.6% of the total variation and PC2 explained 8.3%. ANOVA showed that species identity had an overall significant effect on the PCs (p < 0.001, Table 4). Most post hoc pairwise one-way ANOVA comparisons were significant (Table 4); however, the species could not be separated by any of the analysed traits (Fig. 2A), a conclusion that was also supported by low R2 values (Table 4), thus making morphometric indices impractical for traditional species identification. The only exception was between two groups of populations (M. pallarii + M. ripperi vs M. margoae + M. pseudopallarii + the new species analyzed in this study) that showed some separation between the first and second PCs (Fig. 2A). According to the loading plot of PC1 and PC2 (Fig. 2A), the separation between these two groups was driven mainly by the pt indices related to the buccal apparatus structures. The PCA for the egg measurements extracted six principal components, from which PC1 explained 50.8% of the total variation and PC2 explained 18.3%. One-way ANOVA showed that the species had an overall significant effect on the PCs (p < 0.001, Table 4). All the post hoc pairwise one-way ANOVA comparisons, except M. pallarii vs M. ripperi (probably due to the big different sample sizes for the two species (10 vs 60, respectively)), were significant (Table 4). However, like animal traits, egg measurements did not distinguish the analysed species (Table 5, Fig. 2B). Table 4. Results of one-way ANOVA and post hoc pairwise one-way ANOVA comparisons for the first two principal components (PCs) of animal pt values; significant post hoc p-values at the α-level of p < 0.045 are in bold Term d.f. SS F R2p Species 4 5588.01 79.697 0.676 < 0.001 Residuals 154 2681.91 0.324 Total 158 8269.92 1 Post hoc comparisons M. pallarii vs M. ripperi 1 25.70 1.09 0.02 0.30 M. ripperi vs M. pseudopallarii 1 218.09 19.98 0.19 < 0.001 M. ripperi vs M. margoae 1 1760.22 121.93 0.58 < 0.001 M. ripperi vs M. hupingensis sp. nov. 1 3090.58 208.39 0.70 < 0.001 M. pseudopallarii vs M. margoae 1 2413.11 126.45 0.69 < 0.001 M. pseudopallarii vs M. hupingensis sp. nov. 1 3712.99 188.64 0.77 < 0.001 M. pallarii vs M. pseudopallarii sp. nov. 1 139.33 7.50 0.17 0.01 M. pallarii vs M. margoae 1 402.88 14.83 0.29 < 0.001 M. pallarii vs M. hupingensis sp. nov. 1 769.28 27.34 0.43 < 0.001 M. margoae vs M. hupingensis sp. nov. 1 139.50 5.57 0.09 0.02 Table 5. Results of one-way ANOVA and post hoc pairwise one-way ANOVA comparisons for the first two principal components (PCs) of egg measurements; significant post hoc p-values at the α-level of p < 0.040 are in bold Term d.f. SS F R2p Species 4 1093.40 77.00 0.668 < 0.001 Residuals 154 543.17 0.332 Total 158 1636.6 1 Post hoc comparisons M. pallarii vs M. ripperi 1 0.08 0.04 0.00 0.84 M. ripperi vs M. pseudopallarii 1 75.87 30.51 0.26 < 0.001 M. ripperi vs M. margoae 1 43.83 16.58 0.16 < 0.001 M. ripperi vs M. hupingensis sp. nov. 1 783.75 198.46 0.69 < 0.001 M. pseudopallarii vs M. margoae 1 173.66 50.85 0.48 < 0.001 M. pseudopallarii vs M. hupingensis sp. nov. 1 278.95 51.95 0.47 < 0.001 M. pallarii vs M. pseudopallarii 1 31.35 12.44 0.25 0.001 M. pallarii vs M. margoae 1 14.83 5.12 0.12 0.03 M. pallarii vs M. hupingensis sp. nov. 1 303.06 51.31 0.58 < 0.001 M. margoae vs M. hupingensis sp. nov. 1 875.53 153.23 0.73 < 0.001 page 6 of 18Zoological Studies 61:86 (2022) © 2022 Academia Sinica, Taiwan Fig. 2. Results of PCA of animal pt indices and egg raw measurements. A, Animal pt indices, 1st and 2nd Principal Components; B, Egg measurements, 1st and 2nd Principal Components; Top-left quadrants: score scatter plots; Top-right quadrants: long plot; bottom-left and right quadrants: boxplots of single component scores. page 7 of 18Zoological Studies 61:86 (2022) © 2022 Academia Sinica, Taiwan TAXONOMY Phylum: Tardigrada Doyère, 1840 Class: Eutardigrada Richters, 1926 Order: Parachela Schuster et al., 1980 Superfamily: Macrobiotoidea Thulin, 1928 (Marley et al. 2011) Family: Macrobiotidae Thulin, 1928 Genus: Macrobiotus C.A.S. Schultze, 1834 Macrobiotus hupingensis sp. nov. urn:lsid:zoobank.org:act:DF765A1E-F6C6-4044-AE8B17FAF9D648F2 Etymology: This species is named after the type locality. Material examined: 238 animals and 46 eggs. Specimens mounted on microscope slides in Hoyer’s medium (223 animals + 42 eggs), fixed on SEM stubs (11 + 4), and processed for DNA sequencing (4 + 0). Type locality: 30°02'19.1"N, 110°54'45.2"E, 1,065 m asl, the Hupingshan National Nature Reserve, Shimen Country, Hunan Province, China. Type repository: Holotype (Slide hp1110202 with 29 paratypes), 183 paratypes (Slides: hp I. II. 02. III, the Roman numerals can be substituted by the following numbers: 1–5, 01–25, 1–10, respectively; SEM stub: 11.02) and 40 eggs (slides: hp–I. II. 02. III; SEM stub: 11.02) were deposited at Xiaochen Li’s tardigrade collection, Molecular Ecology, Department of Biology, College of Life Sciences of Shaanxi Normal University, China. Additional paratypes (10 animals) (slides: Slides: hp 2. II. 02. III, the Roman numerals II– III can be substituted by the following numbers: 01–25, 1–10) and 6 eggs (slides: hp–I. II. 02. III) are deposited at the Department of Invertebrate Evolution, Institute of Zoology and Biomedical Research, Faculty of Biology, Jagiellonian University, Poland. Description of the new species: Animals (measurements and statistics in Table 6): In live animals, body almost transparent in smaller specimens and whitish in larger animals; transparent after fixation in Hoyer’s medium (Fig. 3). Eyes present in live animals and after fixation in Hoyer’s medium. Small round and oval cuticular pores (0.5–1.5 μm in diameter) visible under both PCM and SEM scattered randomly throughout the entire body (Figs. 4A–D, 5A–D). Patches of fine granulation on the external surface of legs I– III as well as on the dorsal and dorsolateral sides of leg IV visible in PCM (Fig. 4B, D) and SEM (Fig. 5B, D). Only pulvinus is present on the internal surface of legs I–III whereas the granulation on the internal surface is absent (Figs. 4C, 5C). In addition to the typical patches of leg granulation, other types of cuticular granulation are absent. Claws slender, of the hufelandi type. Primary branches with distinct accessory points, a long common tract, and an evident stalk connecting the claw to the lunula (Fig. 6A–B, 6D–E). Lunulae on legs I–III smooth, whereas on legs IV usually clearly dentate (Fig. 6A–F). Dark areas under each claw on legs I– III are often visible in PCM (Fig. 6A). Paired muscle attachments and faintly visible continuous cuticular bars above them on legs I–III are often visible both with PCM and SEM (Fig. 6A, D), whereas the horseshoeshaped structure connecting anterior and posterior claw IV is visible only in PCM (Fig. 6B–C). Mouth antero-ventral: Buccal apparatus of the Macrobiotus type (Fig. 7A), with the ventral lamina and ten peribuccal lamellae (Fig. 8A–B). The oral cavity armature (OCA) was well developed and composed of three bands of teeth, from which only the second and third bands were always clearly visible under PCM (Fig. 7B–C), whereas the first band was only visible under SEM (Fig. 8A–B). The first band of teeth is composed of numerous small teeth visible under SEM as cones (Fig. 8A–B), arranged in several rows, situated anteriorly in the oral cavity, just behind the bases of the peribuccal lamellae. The second band of teeth is situated between the ring fold and the third band of teeth and comprises 3–4 rows of teeth visible with PCM as granules (Fig. 7B–C), and as cones in SEM (Fig. 8A– B) but larger than those in the first band. The posterior row of teeth within the second band seems to comprise larger teeth than the previous anterior rows (Fig. 8A– B). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Figs. 7B–C, 8A–B). The third band of teeth is divided into the dorsal and ventral portions. Under PCM, the dorsal teeth are seen as three distinct transverse ridges, whereas the ventral teeth appear as two separate lateral transverse ridges, between which one large tooth (circular in PCM) is visible (Fig. 7B–C). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids (2 < 1) and a microplacoid positioned close to them (i.e., the distance between the second macroplacoid and the microplacoid is shorter than the microplacoid length; Fig. 7A, D). The first macroplacoid is anteriorly narrowed and constricted in the middle, whereas the second has a subterminal constriction (Fig. 7D–E). Eggs (measurements and statistics in Table 7): Laid freely, white, spherical with conical processes surrounded by one row of areolae (Fig. 9A–B). In SEM, multiple rings of faintly visible annulation were visible on the entire process (Fig. 10B, E), although in some processes, annulation was present only in the upper portion of the process (Fig. 10A–F) (annulation page 8 of 18Zoological Studies 61:86 (2022) © 2022 Academia Sinica, Taiwan not visible in PCM because it was obscured by the eminent labyrinthine layer). The upper parts of the processes are smooth and not covered with granulation (Fig. 10B, C, E–F). The labyrinthine layer between the process walls is present and visible as reticulation with circular/ellipsoidal meshes throughout the entire process (Figs. 9A–B, 10A–F). Small areas without reticulation are rarely present in some processes (Fig. 9B). The upper part of the process is often elongated into short flexible apices (Figs. 9C–F, 10A–C, E–F), which are occasionally absent or bifurcated and sometimes have bubble-like structures (Figs. 9C–F, 10A–F). The base of the processes extends into the six (only sometimes five) arms that form areolae rims (Fig. 9A–B). Each process is surrounded by six (only sometimes five) hexagonal areolae (Figs. 9A–B, 10A–C), which are occasionally falsely subdivided in the middle into two areolae by a thin thickening perpendicular to the process base (Figs. 9A–B, 10B). Areolae rims (walls) thick and usually flat (Fig. 10A, C), with the labyrinthine layer inside the rims visible as bubbles in PCM (Fig. 9B). Areolae rims also delimit the areolae at the bases of processes, which forms an irregular collar around process bases (Figs. 9B, 10A, C) and makes the process bases pentaor hexagonal in the top view (Figs. 9A–B, 10A–C). The areola surface has wrinkles that are faintly visible under PCM (Fig. 9A–B) but clearly visible under SEM (Fig. 10B–D). Micropores are present within the areolae, Table 6. Measurements and pt values of selected morphological structures of the holotype and paratypes of Macrobiotus hupingensis sp. nov. Character N Range Mean SD Holotype µm pt µm pt µm pt µm pt Body length 30 307–496 794–1151 371 945 49 91 426 1078 Buccal tube Buccal tube length 30 31.7–54.2 – 39.3 –4.4 –39.5 – Stylet support insertion point 30 24.7–43.6 77.5–81.9 31.4 80.0 3.6 1.2 31.9 80.8 Buccal tube external width 30 3.5–7.2 9.6–16.6 5.3 13.4 0.9 1.7 5.4 13.7 Buccal tube internal width 30 2.6–6.3 7.1–16.3 4.2 10.7 0.8 1.8 4.2 10.6 Ventral lamina length 30 17.2–34.8 50.7–65.7 23.1 58.7 3.4 5.5 25.4 64.3 Placoid lengths Macroplacoid 1 30 4.6–11.1 13.0–29.3 7.3 18.7 1.4 3.2 8.1 20.5 Macroplacoid 2 30 3.9–7.8 11.3–18.4 5.9 15.1 0.9 1.6 6.3 15.9 Microplacoid 30 1.9–3.4 4.8–8.4 2.5 6.3 0.4 1.0 2.9 7.3 Macroplacoid row 30 10.6–18.8 29.9–45.4 14.8 37.8 2.1 3.9 16.0 40.5 Placoid row 29 15.9–27.3 47.1–55.3 20.0 51.2 2.4 1.8 20.5 51.9 Claw I heights External primary branch 29 7.2–11.1 15.9–29.3 8.9 22.7 1.0 3.0 8.4 21.3 External secondary branch 27 5.7–9.7 13.8–25.6 7.2 18.4 0.9 2.5 7.2 18.2 Internal primary branch 30 6.6–10.4 16.6–28.1 8.6 22.0 0.8 2.6 8.3 21.0 Internal secondary branch 29 5.4–8.6 13.1–22.7 6.8 17.3 0.7 1.8 6.5 16.5 Claw II heights External primary branch 30 7.9–11.8 17.9–32.8 9.2 23.6 0.9 3.3 8.4 21.3 External secondary branch 30 4.8–11.0 12.2–29.0 7.2 18.4 1.1 3.0 7.2 18.2 Internal primary branch 30 7.4–10.6 16.8–32.8 8.8 22.7 1.0 3.2 8.1 20.5 Internal secondary branch 29 5.7–8.8 13.5–22.0 7.0 17.9 0.9 2.1 7.1 18.0 Claw III heights External primary branch 29 7.1–11.7 19.4–33.4 9.5 24.4 1.0 3.3 8.7 22.0 External secondary branch 29 5.4–8.2 12.7–24.9 7.1 18.2 0.8 2.7 7.4 18.7 Internal primary branch 30 7.1–10.6 18.3–29.1 9.0 23.2 0.8 2.7 8.7 22.0 Internal secondary branch 27 5.5–9.0 13.1–23.7 7.3 18.9 0.8 2.3 7.3 18.5 Claw IV heights Anterior primary branch 30 8.5–13.7 22.3–35.7 10.7 27.3 1.3 3.2 10.9 27.6 Anterior secondary branch 30 5.7–10.2 14.9–25.6 8.0 20.4 1.2 2.7 9.2 23.3 Posterior primary branch 30 9.5–13.0 20.3–35.3 11.1 28.4 1.0 3.3 10.6 26.8 Posterior secondary branch 28 6.2–11.2 13.5–29.6 8.1 20.8 1.1 2.8 8.1 20.5 N = number of specimens/structures measured; Range = the smallest and the largest structure among all measured specimens; SD = standard deviation. page 9 of 18Zoological Studies 61:86 (2022) © 2022 Academia Sinica, Taiwan the entire process wall (only small circular bubbles scattered randomly within the process wall are found in M. caymanensis). Genotypic differential diagnosis Interspecific uncorrected genetic p-distances between M. hupingensis sp. nov. and other species in the M. pallarii complex are as follows: 18S rRNA: 4.3–4.8% (4.6% on average), with the most similar being M. margoae from the USA (MT809072–3) and the least similar being M. pallarii from Italy (MT809069–71) and M. pseudopallarii from Montenegro (MT809065–7). 28S rRNA: 2.8–3.1% (2.9% on average), with the most similar being M. pseudopallarii from Montenegro (MT809077–80) and the least similar being M. margoae from the USA (MT809084–5). ITS-2: 14.5–15.7% (15.2% on average), with the most similar being M. ripperi from Finland (MT809100– 2) and M. ripperi from Poland (MT809103), and the least similar being M. pseudopallarii from Montenegro (MT809090–3). COI: 28.8–37.0% (32.5% on average), with the most similar being M. margoae from the USA (MT807927–8) and the least similar being M. ripperi from Finland (MT807933–5). CONCLUSIONS Macrobiotus hupingensis sp. nov. is new to science and was identified by integrating phase contrast light microscopy, scanning electron microscopy, and DNA analysis. To the best of our knowledge, 1) this is the 28th Macrobiotus species found in China to be reported in a peer-reviewed publication and 2) the number of tardigrade species reported in China is much smaller than those of countries in which tardigrades are more intensively studied, thus the actual number of Macrobiotus species in China is likely higher than 28. Importantly, the newly studied population from China stays in the sister relationship with M. margoe. M. pallarii has been recorded from China by Sun (2014), but there is no slide for us to confirm whether the previous record was the species we are currently describing or yet another distinct species of the complex. Only further integrative studies can disentangle this issue with confidence. Acknowledgment: This work and the new species name were registered with ZooBank under urn:lsid:zoobank.org:pub:A6527143-69CD-41808A1C-C9579A486B01. We are thankful to the staff of the Hupingshan National Nature Reserve for their kind help in moss collecting. We are grateful to Ms Bi Rui and Guo Yan for their kind help in specimen sorting and slide mounting. We are especially grateful to Professor Zhaoming Wei and his postgraduate Xiaolan Miao in SEM imaging. We also sincerely thank an anonymous reviewer for their valuable comments and suggestions which greatly improved the manuscript. This work was supported by the Natural Science Foundation of Science and Technology Department of Shaanxi Province, China (No. 2013JM3013 and 2014JM2-3026) and Natural Science Foundation of Education Department of Shaanxi Province, China (No. 16JK1186). Authors’ contributions: Conceived and designed the experiments: ZY and XL. Performed the experiments: ZY, YW, QL and LL. Analyzed the data: ZY and YW. Fig. 11. Macrobiotus hupingensis sp. nov. from China (paratypes) – reproduction (PCM): A, spermatheca (seminal vesicle) filled with spermatozoa and visible in females freshly mounted in Hoyer’s medium; B, testis filled with sperm visible in a male freshly mounted in Hoyer’s medium. The indented arrowhead indicates the female spermathecae, double arrowhead indicates the testis, and the arrows indicate gibbosity on the IV leg. Scale bars in μm. page 16 of 18 Zoological Studies 61:86 (2022) © 2022 Academia Sinica, Taiwan Wrote the paper: ZY. All authors read and approved the final manuscript. Competing interests: No potential conflict of interest was reported by the authors. Availability of data and materials: Sequences generated in the study have been deposited into the GenBank database (accession numbers in Table 3 in manuscript). Consent for publication: Not applicable. Ethics approval consent to participate: Not applicable. REFERENCES Bertolani R, Guidetti R, Marchioro T, Altiero T, Rebecchi L, Cesari M. 2014. Phylogeny of Eutardigrada: New molecular data and their morphological support lead to the identification of new evolutionary lineages. Mol Phylogenet Evol 76:110–126. doi:10.1016/j.ympev.2014.03.006. Bi R. 2019. Study on tardigrada fauna and species diversity in Dabie Mountain area. MSc Thesis, Shaanxi Normal University. (in Chinese) Cesari M, Giovannini I, Altiero T, Guidetti R, Cornette R, Kikawada T, Rebecchi L. 2022. Resistance to extreme stresses by a newly discovered Japanese Tardigrade species, Macrobiotus kyoukenus (Eutardigrada, Macrobiotidae). Insects 13:634. doi:10.3390/ insects13070634. Chen CD, Li DH. 2003. On the biodiversity and the ecological in tegrity of Wulingyuan district, Hunan Province. Acta Ecologica Sinica 23:2415–2423. (in Chinese) Coughlan K, Michalczyk Ł, Stec D. 2019. Macrobiotus caelestis sp. nov., a new tardigrade species (Macrobiotidae: hufelandi group) from the Tien Shan mountains (Kyrgyzstan). Ann Zool 69:499– 513. doi:10.3161/00034541ANZ2019.69.3.002. Coughlan K, Stec D. 2019. Two new species of the Macrobiotus hufelandi complex (Tardigrada: Eutardigrada: Macrobiotidae) from Australia and India, with notes on their phylogenetic position. Eur J Taxon 573:1–38. doi:10.5852/ejt.2019.573. Dastych H. 1980. Niesporczaki (Tardigrada) Tatrzańskiego Parku Narodowego. Monografie Fauny Polski 9:1–232. Degma P, Bertolani R, Guidetti R. 2009–2021. Actual checklist of Tardigrada species. Accessed 19 July 2021. Degma P, Guidetti R. 2007. Notes to the current checklist of Tardigrada. Zootaxa 1579:41–53. doi:10.11646/zootaxa.1579.1.2. Edgar R. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Rese 32:1792– 1797. doi:10.1093/nar/gkh340. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3:294–299. Gao XY, Li XC, Wang LZ. 2012. Taxonomic composition of the Chinese terrestrial-freshwater tardigrades. J Anhui Agric Sci 40:9721–9725. (in Chinese) Gąsiorek P, Stec D, Zawierucha Z, Kristensen RM, Michalczyk Ł. 2018. Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus. Zootaxa 4472:261–297. doi:10.11646/ zootaxa.4472.2.3. Greven H. 2018. From Johann August Ephraim Goeze to Ernst Marcus: A Ramble Through the History of Early Tardigrade Research (1773 Until 1929). In: Water Bears: The Biology of Tardigrades. Springer, Cham. Guidetti R, Bertolani R. 2005. Tardigrade taxonomy: an updated check list of the taxa and a list of characters for their identification. Zootaxa 845:1–46. doi:10.11646/zootaxa.845.1.1. Guidetti R, Schill, RO, Bertolani R, Dandekar T, Wolf M. 2009. New molecular data for tardigrade phylogeny, with the erection of Paramacrobiotus gen. nov. J Zool Sys Evol Res 47:315–321. doi:10.1111/j.1439-0469.2009.00526.x. Guo Y. 2020. Study on tardigrada fauna and species diversity in Funiu Mountain area. Mster thesis, Shaanxi Normal University. (in Chinese) Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/ NT. Nucleic Acids Symposium Series 41:95–98. Kaczmarek Ł, Cytan J, Zawierucha K, Diduszko D, Michalczyk Ł. 2014. Tardigrades from Peru (South America), with descriptions of three new species of Parachela. Zootaxa 3790:357–379. doi:10.11646/zootaxa.3790.2.5. Kaczmarek Ł, Michalczyk Ł. 2017. The Macrobiotus hufelandi (Tardigrada) group revisited. Zootaxa 4363:101–123. doi:10.11646/zootaxa.4363.1.4. Katoh K, Toh H. 2008. Recent developments in the MAFFT multiple sequence alignment program. Brief Bioinform 9:286–298. doi:10.1093/bib/bbn013. Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res 30:3059–3066. doi:10.1093/nar/gkf436. Kiosya Y, Pogwizd J, Matsko Y, Vecchi M, Stec D. 2021. Phylogenetic position of two Macrobiotus species with a revisional note on Macrobiotus sottilei Pilato, Kiosya, Lisi & Sabella, 2012 (Tardigrada: Eutardigrada: Macrobiotidae). Zootaxa 4933:113– 135. doi:10.11646/zootaxa.4933.1.5. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol Bio Evol 35:1547–1549. doi:10.1093/molbev/ msy096. Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B. 2016. PartitionFinder 2: new methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol Biol Evol 34:772–773. doi:10.1093/molbev/ msw260. Liu H, Tang DW, Song EP, Chang S. 2020. Spatiotemporal Dynamics of Vegetation net Primary Productivity and Its Driving Factors in Wuling Mountains Areas During 2000–2015. Res Soil Water Conv 27:218–225. doi:10.13869/j.cnki.rswc.2020.06.029. (in Chinese) Marley NJ, McInnes SJ, Sands CJ. 2011. Phylum Tardigrada: a reevaluation of the Parachela. Zootaxa 2819:51–64. doi:10.11646/ zootaxa.2819.1.2. Michalczyk Ł, Kaczmarek Ł. 2003. A description of the new tardigrade Macrobiotus reinhardti (Eutardigrada, Macrobiotidae, harmsworthi group) with some remarks on the oral cavity armature within the genus Macrobiotus Schultze. Zootaxa 331:1–24. doi:10.5281/zenodo.156189. Michalczyk Ł, Kaczmarek Ł. 2013. The Tardigrada Register: a comprehensive online data repository for tardigrade taxonomy. J Limnol 72:175–181. doi:10.4081/jlimnol.2013.s1.e22. page 17 of 18Zoological Studies 61:86 (2022) © 2022 Academia Sinica, Taiwan Michalczyk Ł, Wełnicz W, Frohme M, Kaczmarek Ł. 2012. Redescriptions of three Milnesium Doyere, 1840 taxa (Tardigrada: Eutardigrada: Milnesiidae), including the nominal species for the genus. Zootaxa 3154:120. doi:10.11646/zootaxa.3154.1.1. Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. 2010 gateway computing environments workshop (GCE): pp. 1–8. doi:10.1109/GCE.2010.5676129. Mironov SV, Dabert J, Dabert M. 2012. A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa 3253:54–61. doi:10.11646/ zootaxa.3253.1.2. Pilato G. 1981. Analisi di nuovi caratteri nello studio degli Eutardigrada. Animalia 8:51–57. Puillandre N, Brouillet S, Achaz G. 2021. ASAP: Assemble species by automatic partitioning. Mol Ecol Resour 21:609–620. doi:10.1111/1755-0998.13281. Sands CJ, McInnes SJ, Marley NJ, Goodall-Copestake W, Convey P, Linse K. 2008. Phylum Tardigarda: an “individual” approach. Cladistics 24:1–18. doi:10.1111/j.1096-0031.2008.00219.x. Stec D, Dudziak M, Michalczyk Ł. 2020a. Integrative descriptions of two new Macrobiotidae species (Tardigrada: Eutardigrada: Macrobiotoidea) from French Guiana and Malaysian Borneo. Zool Stud 59:23. doi:10.6620/ZS.2020.59-23. Stec D, Morek W, Gąsiorek P, Michalczyk Ł. 2018. Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). Syst Biodivers 16:357–376. doi:10.1080/14772000.2 018.1424267. Stec D, Smolak R, Kaczmarek Ł, Michalczyk Ł. 2015. An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052(5):501–526. doi:10.11646/zootaxa.4052.5.1. Stec D, Tumanov DT, Kristensen RM. 2020b. Integrative taxonomy identifies two new tardigrade species (Eutardigrada: Macrobiotidae) from Greenland. Eur J Taxon 614:1–40. doi:10.5852/ejt.2020.614. Stec D, Vecchi M, Calhim S, Michalczyk Ł. 2021a. New multilocus phylogeny reorganises the family Macrobiotidae (Eutardigrada) and unveils complex morphological evolution of the Macrobiotus hufelandi group. Mol Phylogenet Evol 160:106987. doi:10.1016/ j.ympev.2020.106987. Stec D, Vecchi M, Dudziak M, Bartels PJ, Calhim S, Michalczyk Ł. 2021b. Integrative taxonomy resolves species identities within the Macrobiotus pallarii complex (Eutardigrada: Macrobiotidae). Zool Lett 7:9. doi:10.1186/s40851-021-00176-w. Stec D, Vecchi M, Maciejowski W, Michalczyk Ł. 2020c. Resolving the systematics of Richtersiidae by multilocus phylogeny and an integrative redescription of the nominal species for the genus Crenubiotus (Tardigrada). Sci Rep 10:19418. doi:10.1038/ s41598-020-75962-1. Stec D, Vončina K, Kristensen RM, Michalczyk Ł. 2022. The Macrobiotus ariekammensis species complex provides evidence for parallel evolution of claw elongation in macrobiotid tardigrades. Zool J Linn Soc 195:1067–1099. doi:10.1093/ zoolinnean/zlab101. Sun XL, Zhang JY, Wang N, Zhao M, Luo XG. 2020. A new species of Diphascon (Tardigrada: Hypsibiidae) from Northern China supported by integrated taxonomy. Zootaxa 4722:185–194. doi:10.11646/zootaxa.4722.2.5. Sun XZ. 2014. Relationship between species diversity and environment of tardigrada in China. PhD disseratation, Shaanxi Normal University. (in Chinese) Tabachnick BG, Fidell LS. 2007. Using Multivariate Statistics, 5th ed., Allyn and Bacon, Boston, USA. Vecchi M, Cesari M, Bertolani R, Jönsson KI, Rebecchi L, Guidetti R. 2016. Integrative systematic studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and Echiniscoidea. Invertebr Syst 30:303–322. doi:10.1071/IS15033. Vecchi M, Stec D, Tommi V, Ryndov S, Chartrain J, Calhim S. 2022. Macrobiotus naginae sp. nov., a new xerophilous tardigrade species from Rokua sand dunes (Finland). Zool Stud 61:22. doi:10.6620/ZS.2022.61-22. Wang Y. 2021. Study on tardigrada fauna and species diversity in Wumeng Mountain area. Master thesis, Shaanxi Normal University. (in Chinese) Wełnicz W, Grohme MA, Kaczmarek Ł, Schill RO, Frohme M. 2011. ITS-2 and 18S rRNA data from Macrobiotus polonicus and Milnesium tardigradum (Eutardigrada, Tardigrada). J Zool Syst Evol Res 49:34–39. doi:10.1111/j.1439-0469.2010.00595.x. Yang T. 2015. Fauna Sinica Invertebrata. Vol. 50. Tardigrada. Science Press, Beijing, 279 pp. (in Chinese) Zeller C. 2010. Untersuchung der Phylogenie von Tardigradenanhand der Genabschnitte 18S rDNA und Cytochrom c Oxidase Untereinheit 1 (COX I). Master thesis, Technische Hochschule Wildau 105 pp. Zhang D, Gao F, Jakovlic I, Zou H, Zhang J, Li WX, Wang GT. 2020. PhyloSuite: an integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol Ecol Resour 7220:348– 355. doi:10.1111/1755-0998.13096. Supplementary materials Table S1. A list of species of the genus Macrobiotus (valid and doubtful taxa), and the species formally described from China are in bold. (download) Table S2. Raw morphometric data underlying the description of Macrobiotus hupingensis sp. nov. (download) Table S3. Uncorrected pairwise distances. (download) page 18 of 18Zoological Studies 61:86 (2022)