Two New Genera and Species of Polynoidae (Annelida: Polychaeta) Associated with Sea Urchins

© 2025 Academia Sinica, Taiwan Open Access Two New Genera and Species of Polynoidae (Annelida: Polychaeta) Associated with Sea Urchins Naoto Jimi1,2,* , Natsumi Hookabe3, Sau Pinn Woo2, and Hisanori Kohtsuka4 1Sugashima Marine Biological Laboratory, Graduate School of Science, Nagoya University, 429-63 Sugashima, Toba, Mie 517-0004, Japan. *Correspondence: E-mail: [email protected] (Jimi) 2Centre for Marine & Coastal Studies, Universiti Sains Malaysia 11800 USM, Penang, Malaysia. E-mail: [email protected] (Woo) 3Research Institute for Global Change (RIGC), JAMSTEC, Yokosuka, Kanagawa 237-0061, Japan. E-mail: [email protected] (Hookabe) 4Misaki Marine Biological Station, Graduate School of Science, The University of Tokyo, 1024 Koajiro, Misaki, Miura, Kanagawa, 238-0225, Japan. E-mail: [email protected] (Kohtsuka) urn:lsid:zoobank.org:pub:41DE4426-D844-4CF1-BB0B-37547A6405D6 Received 9 October 2024 / Accepted 16 April 2025 / Published -- 2025 Communicated by James D. Reimer Symbiotic relationships between polychaetes and marine invertebrates are well-documented, with echinoderms—primary starfish and sea cucumbers—as common hosts and sea urchins being more rarely involved. Although many sea urchins possess venomous spines that are effective defenses and make them suitable hosts for symbionts, the dense packing of these spines difficult hosting symbiotic polychaetes. In this study, we describe two new genera and species of polynoid polychaetes found in association with two different species of sea urchins, collected through dredging from Sagami Bay, Japan. Echinophilia gen. nov. is characterized by an elongated body, 12 pairs of elytra, subdistally inflated antennae and dorsal cirri. Paraechinophilia gen. nov., in contrast, has a non-elongated body, 12 pairs of elytra, not inflated antennae and dorsal cirri. Additionally, we provide insights into their phylogenetic relationships based on four gene sequences (COI, 16S, 18S, and 28S). Key words: Polychaetes, Symbiosis, Taxonomy, Echinodermata, Japan Citation: Jimi N, Hookabe N, Woo SP, Kohtsuka H. 2025. Two new genera and species of Polynoidae (Annelida: Polychaeta) associated with sea urchins. Zool Stud 64:21. BACKGROUND Echinoderms play a crucial role in marine biodiversity as hosts for a wide array of symbiotic and parasitic organisms (Jangoux 1987), including over 200 species of polychaetes (Martin and Britayev 1998 2018). While Asteroidea (starfish) are the most common echinoderm hosts for symbiotic polychaetes, Echinoidea (sea urchins) harbor far fewer symbiotic species (Martin and Britayev 2018). Nevertheless, sea urchins are not devoid of polychaete associations, which include representatives of five families (Clark 1956; Stroch and Niggermann 1967; Martin and Britayev 1998). This relatively low number underscores the need for further unexploration to better understand the diversity of polychaetes are associated with sea urchins. Sea urchins, with their entire body covered by spines, often armed with venom, possess well-defined structures for defense against predators. This makes them highly suitable hosts for symbiotic organisms, providing a secure refuge in the interstices between their spines where symbionts are less likely to be attacked by predators. Symbiotic relationships with sea urchins have been reported across a diverse array of taxa, including ctenophores, flatworms, arthropods, mollusks, annelids, echinoderms, and fish (Jangoux 1987a b; Britayev et al. 2013). However, much remains unknown about the biology and diversity of organisms symbiotic with sea urchins, highlighting the need for further research to clarify their species composition (Britayev et al. 2013). Zoological Studies 64:21 (2025) doi:10.6620/ZS.2025.64-21 1 © 2025 Academia Sinica, Taiwan Polynoidae—commonly known as scale worms— is diverse family comprising over 900 species globally distributed across habitats ranging from shallow waters to deep sea (Bonifácio and Menot 2019; Hourdez 2022; Gonzalez et al. 2023). Around 45% of these species are symbiotic, associating with a wide spectrum of hosts including Echinodermata, Mollusca, Cnidaria, Porifera, Annelida, Crustacea, and other Polychaeta, and showing highly specialized adaptations (Taboada et al. 2021; Marin and Antokhnia 2022; Maxwell et al. 2022; Núñez et al. 2022; Sato et al. 2023). This emphasizes the need for further studying the diversity, taxonomy, and evolutionary history of scale worms (Jimi et al. 2021). Despite they are associated with a wide range of echinoderms, only ten species have been reported from sea urchins, with most found in shallow waters (Martin and Britayev 1998). During a dredge survey conducted in Sagami Bay, Japan, we collected two species of symbiotic scale worms from two different species of sea urchins. Using morphology and molecular phylogenetics based on four genes (COI, 16S, 18S, and 28S), this study describes these scale worms as two new genera and two new species, discussing their phylogenetic relationships and the evolutionary implications of their symbiotic interactions with their hosts. MATERIALS AND METHODS The sea urchins Araeosoma owstoni Mortensen, 1904 and Clypeaster virescens Döderlein, 1885 were collected from Sagami Bay, Japan by dredging (Figs. 1A, 4A). The worms were removed from their hosts and one parapodium from holotype (NSMT-Pol H-1001 and 9001) was cut off and fixed in 99.5% ethanol for DNA extraction prior to fixed and preserve the specimen in 70% ethanol. The preserved specimens were observed under stereomicroscopes MZ 16F (LEICA, Germany) and E600 (Nikon, Japan) and then deposited in the National Museum of Nature and Science, Tsukuba (NSMT). The body width of specimens was measured as the distance between the ends of the parapodia, excluding the chaetae. Genomic DNA was extracted from a small piece of the parapodium of the holotype (NSMT-Pol H-1001 and 9001) using the DNeasy Blood & Tissue Kit (Qiagen, USA) following the manufacturer’s protocol. Partial cytochrome c oxidase subunit I (COI), 16S ribosomal RNA (16S), 18S ribosomal RNA (18S), 28S ribosomal RNA (28S) gene sequences were amplified in the polymerase chain reaction (PCR) with the primer sets of polyLCO (5'-GAYTATWTTCAACAAATCAT AAAGATATTGG-3') and polyHCO (5'-TAMACTTC WGGGTGACCAAARAATCA-3') (Carr et al. 2011), 16SarL (CGCCGTTTATCAAAAACAT) and 16SbrH (CCGGTCTGAACTCAGATCACGT) (Palumbi et al. 1991), mitchA (CAACCTGGTTGATCCTGCCAGT) and mitchB (TGATCCTTCCGCAGGTTCACCTAC) (Medlin et al. 1988), and LsudiF (ACCCGCTGAATTT AAGCATA) and D3aR (ACGAACGATTTGCAC GTCAG) (Lenaers et al. 1989), respectively. The reaction mixture [0.25 µl TaKaRa Ex Taq (Takara, Japan), 5 µl of 10 × Ex Taq Buffer (Takara, Japan), 4.0 µl dNTP mixture (Takara, Japan), 5 µl of each primer pair (10 µM), 0.75 µl of extracted DNA, and 35 µl of distilled water] was used for amplification. To confirm successful amplification, PCR products were visualized using 1.2% Agarose S (Nippon Gene, Japan) gel electrophoresis. Direct sequencing reaction of the PCR products was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) and the 3130xl Genetic Analyzer (Applied Biosystems, USA). Sequencing reactions utilized the same 1-µM primers that were used for PCR amplification. Additional sequences of other polynoids were obtained from GenBank (Table 1). All sequences were aligned using MAFFT ver. 7.205 under the E-INS-i strategy (Katoh and Standley 2013). after removing the ambiguous positions by trimAL following the gappyout strategy (Capella-Gutiérrez et al. 2009). The trimmed sequences for COI (517 bp), 16S (312 bp), 18S (1627 bp), and 28S (908 bp) were concatenated by using Kakusan (Tanabe 2007), following the recommended GTR+G evolutionary models. A phylogenetic tree was constructed using maximum likelihood (ML) method in RAxML-VI-HPC (Stamatakis 2006) and the robustness of the ML tree was evaluated by 1,000 bootstrap pseudo-replicates (-f option). K2P genetic distances were calculated by MEGA11 (Tamura et al. 2021). Newly obtained sequences have been deposited in the GenBank (Table 1). RESULTS SYSTEMATICS Polynoidae Kinberg, 1856 Echinophilia gen. nov. [New Japanese name: Uni-kakure-urokomushi-zoku] urn:lsid:zoobank.org:act:D268D40B-193F-44F5-BAE04D20B670176A Type species: Echinophilia araeosomai gen. et sp. nov. page 2 of 15Zoological Studies 64:21 (2025) © 2025 Academia Sinica, Taiwan Diagnosis: Body flat, elongated, with 12 pairs of elytra on segments 2, 4, 5, 7, 9, 11, 13, 15, 17, 19, 21, 24, absent from posterior chaetigers. Prostomium lacking distinct cephalic peaks, with two pairs of eyes, two conical, elongated palps, and three antennae subdistally inflated, with filiform tip; median antenna with ceratophores inserted in anterior notch, lateral antennae with ceratophores inserted termino-ventrally on distal end of prostomium. Tentaculophores lateral to prostomium, achaetous, tentacular cirri subdistally inflated, with filiform tip. Parapodia biramous, notopodia small, neuropodia larger. Neuropodial prechaetal lobes subconical, with rounded tips; post chaetal lobes shorter, rounded. Dorsal cirri long, Table 1. List of polynoids included in the phylogenetic analysis, together with accession numbers in GenBank Species 18S 28S 16S COI References Acholoe squamosa (Delle Chiaje, 1827) AY839567 JN852850 JN852888 AY839576 Norlinder et al. (2012) Antarctinoe ferox (Baird, 1865) MG905039 –MG905033 KJ676611 Neal et al. (2018) Asterophilia culcitae Britayev & Fauchald, 2005 PQ441976 PQ441985 PQ443350 PQ426599 This study Branchinotogluma sagamiensis Jimi, Chen & Fujiwara, 2022 ON244618 ON244614 ON244617 ON255503 Jimi et al. (2022) Bylgides elegans (Théel, 1879) JN852822 JN852852 JN852890 JN852924 Norlinder et al. (2012) Bylgides sarsi (Kinberg in Malmgren, 1866) JN852823 JN852853 JN852891 JN852925 Norlinder et al. (2012) Echinophilia owstoni gen. et sp. nov. PQ441974 PQ441983 PQ443348 PQ431392 This study Eunoe oerstedi Malmgren, 1865 –––HQ024019 Carr et al. (2011) Eunoe shirikishinai Imajima & Hartman, 1964 MW444683 MW444692 MW444675 MW429800 Jimi et al. (2021) Eunoe shirikishinai_Korea –––JX503009 Kim et al. (unpublished) Eunoe spinicirris Annenkova, 1937 –––HM473744 Carr et al. (2011) Eunoe uniseriata Banse & Hobson, 1968 –––MK390764 Carr et al. (2011) Gastrolepidia clavigera Schmarda, 1861 JN852825 JN852855 JN852893 JN852927 Norlinder et al. (2012) Gattyana cirrhosa (Pallas, 1766) JN852826 JN852856 JN852894 JN852928 Norlinder et al. (2012) Gorgoniapolynoe caeciliae (Fauvel, 1913) KU738170 KU738185 KU738150 KU738203 Serpetti et al. (2017) Gorgoniapolynoe corralophilia (Day, 1960) KU738173 KU738189 KU738154 KU738206 Serpetti et al. (2017) Harmothoe glabra (Malmgren, 1865) JN852828 JN852858 JN852896 JN852929 Norlinder et al. (2012) Harmothoe imbricata (Linnaeus, 1767) AY340434 AY340400 AY340463 AY839580 Rousset et al. (2007) Harmothoe impar (Johnston, 1839) JN852829 JN852859 JN852897 JN852930 Norlinder et al. (2012) Harmothoe oculinarum (Storm, 1879) –JN852860 JN852898 – Norlinder et al. (2012) Harmothoe rarispina (M. Sars, 1861) KY823451 KY823465 KY823482 KY823497 Gonzalez et al. (2017) Harmothoe cf. imbricata KY823450 KY823464 KY823481 KY823496 Gonzalez et al. (2017) Harmothoe sp._Norway (Eunoe nodosa mis ident.) JN852824 JN852854 JN852892 JN852926 Norlinder et al. (2012) Harmothoe sp._P1 MW444678 MW444685 MW444669 MW429795 Jimi et al. (2021) Harmothoe sp._P3 MW444679 MW444686 MW444670 MW429796 Jimi et al. (2021) Harmothoe sp._P5 MW444681 MW444689 MW444672 MW429798 Jimi et al. (2021) Harmothoe sp._P6 MW444682 MW444690 MW444673 MW429799 Jimi et al. (2021) Halosydna brevisetosa Kinberg, 1856 (outgroup) JN852827 JN852857 JN852895 HM473394 Norlinder et al. (2012) Hyperhalosydna striata (Kinberg, 1856) (outgroup) JN852831 JN852862 JN852900 JN852932 Norlinder et al. (2012) Lepidasthenia elegans (Grube, 1840) JN852832 JN852863 JN852901 JN852933 Norlinder et al. (2012) Malmgrenia mcintoshi (Tebble & Chambers, 1982) JN852834 JN852866 JN852904 JN852935 Norlinder et al. (2012) Melaenis loveni Malmgren, 1865 JN852835 JN852867 JN852905 JN852936 Norlinder et al. (2012) Neopolynoe acanellae (Verrill, 1882) MN653050 MN653123 MN653064 MN656076 Taboada et al. (2019) Neopolynoe chondrocladiae (Fauvel, 1943) MN653051 MN653124 MN653092 MN656104 Taboada et al. (2019) Neopolynoe paradoxa (Anon, 1888) JN852836 JN852868 JN852906 JN852937 Norlinder et al. (2012) Ophthlamonoe sp. – – PQ885508 PQ889565 This study Paradyte crinoidicola (Potts, 1910) JN852837 JN852869 JN852907 JN852938 Norlinder et al. (2012) Paraechinophilia clypeasteri gen. et sp. nov. PQ441975 PQ441984 PQ443349 PQ431393 This study Paralepidonotus ampulliferus (Grube, 1878) (out group) JN852838 –JN852908 JN852939 Norlinder et al. (2012) Polynoe scolopendrina Savigny, 1822 JN852839 JN852870 JN852909 JN852940 Norlinder et al. (2012) Polynoe? sp._P7 – MW444691 MW444674 – Jimi et al. (2021) Polynoe? sp._P9 MW444684 MW444693 MW444676 MW429801 Jimi et al. (2021) Polyeunoa laevis McIntosh, 1885 KU738176 KU738193 KU738160 KU738212 Serpetti et al. (2017) Polyeunoa laevis_2 – – – MK593134 Bogantes et al. (2020) Robertianella synophthalma McIntosh, 1885 MN653053 MN653126 MN653122 MN656132 Taboada et al. (2020) Polynoidae sp. MW444680 MW444688 MW444671 MW429797 Jimi et al. (2021) Eunoe issunboushi MW444677 MW444685 MW444668 MW429794 Jimi et al. (2021) page 3 of 15Zoological Studies 64:21 (2025) © 2025 Academia Sinica, Taiwan subdistally inflated, with filiform tips, throughout body. Notoand neurochaetae with rows of serrations, semi-lunar pockets, and notched tips. Ventral cirri short, inflated subdistally and filiform tips at segment 2, conical from segment 3 till body end. Elytra with hemisphere microtubercles; macrotubercles and fringing papillae at outer or posterior margin absent. Symbiont of echinoids. Etymology: The new genus name, masculine in gender, is composed by Echino, referring to the host Echinoidea, and philia (meaning affinity towards) in Latin, referring to the symbiotic nature of its association with sea urchins. Remarks: Echinophilia gen. nov. closely resembles the echinoderm symbiont genera Asterophilia, Gastrolepidia, and Paraechinophilia gen. nov. in having inflated antennae and dorsal or ventral cirri. However, they differ in body shape, number of elytra pairs, presence of inflated antennae and dorsal and ventral cirri, and host (see Table 2). Echinophilia araeosomai gen. et sp. nov. [New Japanese name: Fukuro-uni-kakure-urokomushi] (Figs. 1–3) urn:lsid:zoobank.org:act:053A9E76-9600-4D36-8F0976FE9709B43A Material examined: Holotype: NSMT-Pol H-982: complete specimen, 30 mm long, 3 mm width, 55 chaetigers, collected by dredging from outside body of Araeosoma owstoni at off Jogashima (35°08.856'N, 139°34.687'E), 80–81 m depth, 18 Nov. 2020. Paratype: NSMT-Pol P-983: complete specimen, 25 mm long, 3 mm width, 45 chaetigers, collected during the same dredging operation as the holotype, from another individual of Araeosoma owstoni, used for DNA extraction and SEM observation. Type locality: Sagami Bay, the North Western Pacific, 80–81 m depth. Sequences: Determined from the holotype (NSMTPol H-982): COI, 653 bp, PQ431392; 16S, 492 bp, PQ443348; 18S, 1792 bp, PQ441974; 28S, 1021 bp, PQ441983. Description: Body flat, elongated (Fig. 1), with 12 pairs of elytra on segments 2, 4, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 24, then absent until posterior end (Figs. 1C, 2C), whitish in vivo (Fig. 1B–D) and preserved (Fig. 2A–D), with a dorsal ciliated area between cirrophores/ erytrophores (Fig. 3A–B). Mid-dorsal surface covered by elytra. Dorsal side of base of dorsal cirrophore, tentaculorphore, ceratophore, elytrophore, notopodia, and tip of neuropodial prechaetal/postchaetal lobes with brownish pigmentation (Figs. 1B–D, 2A–B). Dorsal tubercles and ventral (nephridial) papillae absent. Pharynx not seen. Prostomium bilobed, without distinct cephalic peaks, with three antennae subdistally inflated with filiform tips, median antenna twice longer than lateral, with ceratophores inserted in anterior notch, lateral antennae with ceratophores inserted terminoventrally on distal end of prostomium (Fig. 2A). Tentaculophores lateral to prostomium, achaetous. Tentacular cirri inflated subdistally, with filiform tips, slightly longer than lateral antennae (Fig. 2A). Palps conical (Fig. 2B), not inflated, as long as lateral antennae. Two pairs of brownish eyes, anterior pair slightly larger than posterior one, present at dorsal lateral side of prostomium (Fig. 2A). Parapodia biramous (Figs. 3, 4), with notopodia shorter than neuropodia (Figs. 3A, 3B, 4A, 4C), without branchiae. Dorsal cirri inflated subdistally throughout body, with filiform tips, three times longer than lateral antennae (Figs. 1C, 3A, 3C). About 10 notochaetae in each parapodium, ranging from 150 to 300 µm. Notochaetae short to long, with about 15 rows of serrations, semi-lunar pockets, and unidentate or bidentate tips (Figs. 3D, 4C–D). Neuropodial prechaetal lobes subconical, with rounded tips (Figs. 3F, 4C); post chaetal lobes shorter, rounded. About 15 neurochaetae in each parapodium, with about 20 rows of serrations, Table 2. Comparison of Asterophilia, Gastrolepidia, Echinophilia gen. nov., and Paraechinophilia gen. nov. Characters Asterophilia Hanley, 1989 Gastrolepidia Schmarda, 1861 Echinophilia gen. nov. Paraechinophilia gen. nov. Body flat, not elongated flat, elongated flat, elongated flat, not elongated Elytra 15 pairs variable, 15–31 pairs 12 pairs 12 pairs Antennae inflated subdistally inflated subdistally inflated subdistally not inflated subdistally Dorsal cirri inflated subdistally in all segments inflated subdistally in all segments inflated subdistally in all segments not inflated subdistally in all segments Ventral cirri not inflated subdistally in all segments not inflated subdistally in all segments inflated subdistally in segment 2; not in following segments inflated subdistally in all segments Host asteroids or holothuroids holothuroids echinoids echinoids page 4 of 15Zoological Studies 64:21 (2025) © 2025 Academia Sinica, Taiwan semi-lunar pockets, and bidentate tips (Figs. 3E, 4C, 4E). Ventral cirri inflated subdistally at segment 2, with filiform tips, conical from segment 3 till body end (Figs. 2C, 2D, 3F, 4F), short, 0.5 times longer than lateral antennae. Robust acicula in each ramum (Fig. 3B), acicula tip sharp. Pygidium with a pair of pygidial cirri, slightly inflated, with filiform tips (Fig. 2C, 2D). Elytra trapezoidal in segment 2, oval in following elytrophorous segments, transparent, with white and brownish bands on posterior margin and hemisphere microtubercles; macrotubercles and fringing papillae at outer or posterior margin absent (Figs. 2E, 2F, 3G, 3H). Etymology: The new specific name refers to the specific name of the host, Araeosoma, and is a noun in the genitive case. Habitat and distribution: specimens of E. owstoni gen. et sp. nov. were found among the spines of A. owstoni (Fig. 1) in Sagami Bay, in the North Western Pacific coast of Japan at 80–81 m depth. The host A. owstoni has been recorded at 70–210 m depth (Mortensen 1935), but the presence of the symbiont at shallower or deeper waters than those explored in this study cannot be confirmed. Paraechinophilia gen. nov. [New Japanese name: Nise-uni-kakure-urokomushizoku] urn:lsid:zoobank.org:act:8B5DBECE-D4AA-404F-BFBFE5C681F4B5E5 Type species: Paraechinophilia clypeasteri gen. et sp. nov. Diagnosis: Body flat, short, with 12 pairs of elytra on segments 2, 4, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23. Prostomium without distinct cephalic peaks, with two pairs of eyes, with conical palps not inflated, with Fig. 1. Live specimens of Echinophilia araeosomai gen. et sp. nov. B–C, holotype (NSMT-Pol H-982), D, paratype (NSMT-Pol P-983). A, an overview of host (Araeosoma owstoni). B, enlarged view, in life. Black arrow indicates the worm. C–D, whole view, dorsal side. Scale bars: C–D = 5 mm. page 5 of 15Zoological Studies 64:21 (2025) © 2025 Academia Sinica, Taiwan three antennae not inflated subdistally, conical; median one with ceratophores inserted in anterior notch, lateral ones with ceratophores inserted terminoventrally on distal end of prostomium. Tentaculophores lateral to prostomium, achaetous, with tentacular cirri not inflated subdistally, conical. Parapodia biramous, notopodia small, neuropodia larger. Neuropodia with subconical prechaetal lobes subconical, with rounded tips and post chaetal lobes shorter, rounded. Dorsal cirri not inflated subdistally, conical, long. Notoand neurochaetae with rows of serrations, semi-lunar pockets, and unidentate or bidentate tips. Ventral cirri inflated subdistally throughout body, long. Elytra without microtubercles, macrotubercles, and fringing papillae at outer or posterior margin. Symbiont of echinoids. Etymology: The new genus-group name, masculine in gender, refers to close similarity of the symbiotic association with echinoids of both genera, so that it Fig. 2. Echinophilia araeosomai gen. et sp. nov., holotype (NSMT-Pol H-982). A, anterior end, dorsal view. B, anterior end, ventral view. C, posterior end, dorsal view. D, posterior end, ventral view. E, elytra, segment 2. F, elytra, segment 11. Scale bars: A–D = 2 mm; D–E = 1 mm. page 6 of 15Zoological Studies 64:21 (2025) © 2025 Academia Sinica, Taiwan Fig. 3. Echinophilia araeosomai gen. et sp. nov., holotype (NSMT-Pol H-982). A, left parapodium, frontal view, chaetiger 28. B, enlarged view. C, dorsal cirrus. D, notochaetae. E, neurochaetae. F, acicula and ventral cirrus. G, elytrum, chaetiger 17. H, enlarged view of elytrum. Scale bars: A = 100 μm; B–C = 50 μm; G = 100 μm; H = 50 μm. page 7 of 15Zoological Studies 64:21 (2025) © 2025 Academia Sinica, Taiwan is formed by adding the Greek prefix para- (meaning proximity or close relationships) to Echinophilia. Remarks: See remarks of Echinophilia gen. nov. and table 2. Furthermore, this genus differs from Echinophilia in its body coloration, featuring a white base with green transverse bands. This pattern is reminiscent of the polynoid genus Ophthalmonoe Petersen and Britayev, 1997. While Paraechinophilia has 12 pairs of elytra, subdistally inflated ventral cirri, and is symbiotic with sea urchins, Ophthalmonoe has Fig. 4. Echinophilia araeosomai gen. et sp. nov., paratype (NSMT-Pol P-983), segment 11. A, segment 11, frontal view. B, dorsal side of body, frontal view. C, left parapodia, frontal view. D, notochaetae. E, neurochaetae. F, ventral cirri. Scale bars: A = 500 μm; B–C = 100 μm; E = 50 μm. page 8 of 15Zoological Studies 64:21 (2025) © 2025 Academia Sinica, Taiwan 15–17 pairs of elytra, non-inflated ventral cirri, and is symbiotic with members of Chaetopteridae (Annelida) (Petersen and Britayev 1997). Paraechinophilia clypeasteri gen. et sp. nov. [New Japanese name: Yamataka-kakure-urokomushi] urn:lsid:zoobank.org:act:9621F276-B94C-428A-8FF4CF118FAF9886 Material examined: Holotype: NSMT-Pol H-984: complete specimen, 14 mm long, 5 mm width, 23 chaetigers, collected by dredging from outside body of C. virescens at off Jogashima (35°07.426'N, 139°34.016'E), 147–244 m depth,12 March 2021. Paratype: NSMT-Pol P-985: complete specimen, 11 mm long, 5 mm width, 23 chaetigers, collected during the same dredging operation as the holotype, from another individual of C. virescens, used for DNA extraction and SEM observation. Type locality: Sagami Bay, the North Western Pacific, 147–244 m depth. Sequences. Determined from the holotype (NSMT-Pol H-984): COI, 578 bp, PQ431393; 16S, 497 bp, PQ443349; 18S, 1783 bp, PQ441975; 28S, 954 bp, PQ441984. Description: Body flat, whitish with dorsal green transverse band both in vivo (Fig. 5B) and preserved (Fig. 5E), with 12 pairs of elytra on segments 2, 4, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23, transparent, with brackish posterior margin, without microtubercles, macrotubercles, and fringing papillae at outer or posterior margin, trapezoid in segment 2, oval from segment 4 to body end (Figs. 5B, 5D, 6G, 6H). Middorsal surface covered by elytra. Dorsal tubercles and ventral (nephridial) papillae absent. Prostomium bilobed (Fig. 5F), lacking distinct cephalic peak, with two palps (1.5 times longer than lateral antennae) and three antennae conical, not subdistally inflated; antennophores inserted in anterior notch (median) and terminoventrally on distal end of prostomium (lateral); median style, 0.5 times longer than lateral style (Fig. 5E). Two pairs of brownish eyes, anterior pair slightly larger than posterior one, present at dorsal lateral side of prostomium (Fig. 5E). Tentaculophores lateral to prostomium, achaetous, with tentacular cirri not inflated subdistally, conical, as long as lateral antennae (Fig. 5B, 5C). Parapodia biramous, with notopodia shorter than neuropodia, without branchiae (Figs. 6A, 7A). Dorsal cirri not inflated subdistally, conical, long, twice longer than lateral antennae (Figs. 5B, 6A, 6C). About 15 notochaetae in each parapodium, with about 10 rows of serrations, semi-lunar pockets, and unidentate or bidentate tips (Figs. 6B, 6D, 7B–C). Neuropodia with subconical prechaetal lobes subconical, with rounded tips and post chaetal lobes shorter, rounded. About 40 neurochaetae in each parapodium, with about 25 rows of serrations, semi-lunar pockets, and unidentate or bidentate tips (Figs. 6D, 6E, 7D, 7E, 7F). Ventral cirri subdistally inflated throughout body, as long as lateral antennae (Fig. 5C, 6F). Robust acicula in each ramum, acicula tip sharp (Fig. 6A, 6B). Pygidium with one pair of pygidial cirri, not inflated, conical (Fig. 5H). Etymology: The new specific name refers to the genus name of the host, Clypeaster, and is a noun in the genitive case. Habitat and distribution: Specimens of P. clypeasteri gen. et sp. nov. were found among the spines on the external surface of C. virescens. The host echinoderms were collected in Sagami Bay, Japan, in the North Western Pacific at 144–244 m depth. Clypeaster virescens has been recorded at depths of 100–350 meters (Mortensen 1948), but the presence of the symbiont at shallower or deeper waters than explored in this study cannot be confirmed. Molecular analysis The genera Paradyte, Paraechinophilia, Echinophilia, Gastrolepidia, and Asterophilia formed a clade with strong support (BS = 100%) (Fig. 8). Within this clade, Gastrolepidia and Asterophilia formed a sister group relationship (BS = 98%). Echinophilia was resolved as the sister taxon to the Gastrolepidia– Asterophilia clade (BS = 70%), while Paraechinophilia was found to be the sister taxon to the Echinophilia– Gastrolepidia–Asterophilia clade (BS = 93%) (Fig. 8). The K2P distance of nucleotide sequences between Echinophilia and Paraechinophilia was 19.9% (COI) and 14.3% (16S), which is comparable to the distance observed between Asterophilia and Gastrolepidia at 20.5% (COI) and 10.1% (16S), supporting the establishment of the new genera. In the Remarks section for Paraechinophilia, we discussed the morphological similarities and differences with Ophthalmonoe. Additionally, we included an undescribed Japanese species of Ophthalmonoe in the molecular phylogenetic analysis. The results indicate that Ophthalmonoe sp. is not nested within the echinoderm-symbiont clade. Although we could not determine the 18S and 28S sequences, leaving the phylogenetic position somewhat ambiguous, the establishment of the new genus described in this paper and its distinction from Ophthalmonoe are supported by the molecular phylogenetic tree. page 9 of 15Zoological Studies 64:21 (2025)