Lepidoptera from the Pantepui. Part XVI: A new species of Thaeides Johnson, Kruse & Kroenlein, 1997 (Lycaenidae: Theclinae: Eumaeini)

ZOOBANK: http://zoobank.org/urn:lsid:zoobank.org:pub:4591AF78-48B4-4E02-B91B-A658C7838CD0 ANNALES MUSEI HISTORICO-NATURALIS HUNGARICI Volume 116 Budapest, 2024 pp. 275–295 DOI: https://doi.org/10.53019/AnnlsMusHistNatHung.2024.116.275 HU-ISSN 0521-4726 (print) ISSN 2786-1368 (online) published: 2024. 11. 25. arrived: 2024. 10. 28. Lepidoptera from the Pantepui. Part XVI: A new species of Thaeides Johnson, Kruse & Kroenlein, 1997 (Lycaenidae: Theclinae: Eumaeini) Mauro Costa1, Ángel L. Viloria2, Stéphane Attal3, Mohamed Benmesbah4, Andrew Neild5, Nick Grishin6, Krisztián Kertész7 & Zsolt Bálint7, 8, * 1 Museo del Instituto de Zoología Agrícola, Universidad Central de Venezuela, Maracay, Venezuela. E-mail: [email protected] 2 Centro de Ecología, Instituto Venezolano de Investigaciones Científicas, km 11 carretera Panamericana, Altos de Pipe, edo. Miranda 1204, Venezuela. E-mail: [email protected] 3 5–15 rue Olivier-Noyer, 75014 Paris, France. E-mail: [email protected] 4 28T avenue des Pyrénées, 31880 La Salvetat Saint Gilles, France. E-mail: [email protected] 5 Research Associate, McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, PO Box 112710, Gainesville, FL 32611-2710, USA E-mail: [email protected] 6 Howard Hughes Medical Institute, Departments of Biophysics and Biochemistry, University of Texas. Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75390-9050, USA E-mail: [email protected] 7 HUN-REN, Centre for Energy Research Institute of Technical Physics and Materials Science, Nanostructures Department, 121 Budapest, Konkoly Thege Miklós út 29–33, Hungary. E-mail: [email protected], [email protected] 8 Hungarian National Museum Public Collections Centre, Budapest – Hungarian Natural History Museum, Department of Zoology, H-1088 Budapest, Baross utca 13, Hungary. E-mail: [email protected] Abstract – A new species of Lepidoptera (Papilionoidea) is described on the basis of specimens collected at upper elevations in the Guiana Shield: Thaeides hyperion Bálint, Costa & Grishin, n. sp. (Lycaenidae: Theclinae: Eumaeini). Due to its adaptation to mountainous areas, it is probably a taxon endemic to the biogeographic Pantepui Province. With 16 figures, one table. Key words – Auyán Tepui, endemism, genitalia morphology, molecular analysis, Ptarí Tepui, spectral characteristics, Yaví Tepui, wing fragments. * corresponding author. Costa et al. 276 Annls Mus. hist.-nat. hung. 116, 2024 Resumen – Se describe una nueva especie de Lepidoptera (Papilionoidea) de las zonas elevadas del Escudo guayanés: Thaeides hyperion Bálint, Costa & Grishin, n. sp. (Lycaenidae: Theclinae: Eumaeini). Debido a su adaptación a zonas montañosas, es probablemente un taxón endémico de la Provincia biogeográfica del Pantepui. Con 16 figuras, y una tabla. Palabras clave – Análisis molecular, Auyán Tepui, características espectrales, endemismo, fragmentos de alas, morfología de genitalia, Ptarí Tepui, Yaví Tepui. INTRODUCTION The genus Thaeides was erected by Johnson, Kruse & Kroenlein (1997) for the type species Thecla theia Hewitson, 1870 (type locality: Ecuador) and a south-eastern Brazilian species described as Thaeides annandon (Johnson, Kruse & Kroenlein, 1997). The genus was characterized as “known species with thick brush organs along dorsum of vinculum; male genitalia [stands out] from other macusiines by their narrow, elongate and terminally curvate valvae”. Later, a male genitalic valval character was noted as “pincer-like valve tip”, and because some other eumaeines also possess this trait (although differing in wing shape, colouration, and pattern), they were transferred from other genera and placed in Thaeides by Robbins (2004a). According to D’Abrera (1995), Robbins (2004b), and Warren et al. (2024) Thaeides theia (Hewitson, 1870) is a Transamerican species, recorded from the southern part of Mexico through Central America to the Venezuelan Cordillera de Merida, the Andes of Colombia, Ecuador, Peru, Bolivia, south to Argentina and to south-eastern Brazil, thus including T. annandon as a synonym or in subspecific status (Robbins 2004b). Over the course of multiple expeditions to the Pantepui, carried out since 2012 (Bálint & Costa 2012; Costa et al. 2014a,b; 2016; 2017; 2018; 2019a,b,c; 2020; 2021a,b; 2022; 2023a,b), several specimens of a Thaeides species were collected or recorded. In the laboratory we found that these males and females have different colouration than specimens originating from the Central American, Andean, or Atlantic populations, and subtle differences in wing pattern and genitalia morphology were noted. Using whole genome sequencing, the distinctiveness of the Pantepui populations has been confirmed and a hidden genetic diversity of T. theia (sensu auctorum) has been revealed. In this work, we describe the new Pantepui taxon as a new species, Thaeides hyperion, and comment on the habitat, life history, genomic data, and dorsal wing surface colouration of Thaeides. A New Pantepuian Lycaenidae 277 Annls Mus. hist.-nat. hung. 116, 2024 MATERIALS AND METHODS Abbreviations –AM = collection of Alfred Moser, São Leopoldo, Brazil; HNHM = Hungarian Natural History Museum, Budapest, Hungary; LPD = Lycaenidae Pantepui Database of Mauro Costa; MB = collection of Mohamed Benmesbah, Toulouse, France; MC = collection of Mauro Costa, Caracas, Venezuela; MIZA = Museo del Instituto de Zoología Agrícola, Facultad de Agronomía, Universidad Central de Venezuela, Maracay, Venezuela; NECJU = Nature Education Center, Zoological Museum, Jagiellonian University, Krakow, Poland; PB = collection of Pierre Boyer, Le Puy Sainte Réparade, France; SP = spectral peak; [//] = line break. In addition to the type material (n = 11), the following specimens (n = 17) were used for comparative purposes: Thaeides annandon – Brazil (n = 4): 2 males, 1 female (AM), male (HNHM); Thaeides theia – Costa Rica (n = 4): 2 males, 2 females (PB); Ecuador (n = 1): female (PB); Peru, Amazonas (n = 1): female (NECJU); Venezuela, Aragua (n = 6): 1 male, 1 female (NECJU), 2 males, 2 females (HNHM); Venezuela, Mérida (n = 1): male (NECJU). Information and data provided by Draudt (1919), D’Abrera (1995), and the website “Butterflies of America” (Warren et al. 2024) were also taken into consideration. For populations representing different biogeographical regions in South America (Brown 1993) the species-group names theia (Transandean–Andean) and annandon (Atlantic) are employed. As our intent is to diagnose and describe the new species, and not to revise Thaeides theia (sensu auctorum), the usage of these names does not represent any taxonomic decision. After capture, specimens were placed in glassin envelopes, then transferred to the laboratory where they were set, labelled, digitized, and inventoried with serial numbers of the Lycaenidae Pantepui Database (LPD), edited by MC with identifications by ZB. For morphological studies, we used standard lepidopterological techniques (Winter 2000). Two male and two female specimens of Thaeides hyperion n. sp. (HNHM Bálint genitalia preparations nos. 1527, 1725: males; 1723-1724: females), and one male and one female specimen of Thaeides theia were dissected (HNHM Bálint genitalia preparations nos. 1730: male; 1731: female). Furthermore, genitalic information provided by Johnson, Kruse & Kroenlein (1997) and dissections of NECJU were also used. For spectral measurements, the following specimens (n = 7) were taken: Thaeides annandon, male, Brazil, Rio Grande do Sul, São Francisco de Paula, 900 m, 3. V. 1998, Moser; Thaeides hyperion n. sp., male, Venezuela, Bolívar Auyán Tepui, Entre el Danto y El Peñón, 1750 m, 25. III. 2013, Costa; Thaeides hyperion n. sp., female, Venezuela, Bolívar, Auyán Tepui, El Peñón, 1850 m 1. X. 2017, Costa; Thaeides hyperion n. sp., female, Venezuela, Bolívar, Auyán Tepui, El Dragón, 1750 m, 4. II. 2019, Costa/Benmesbah; Thaeides hyperion n. sp., male, Venezuela, Bolívar, Auyán Tepui, El Dragón, 1750 m, 6. II. 2019, Costa et al. 278 Annls Mus. hist.-nat. hung. 116, 2024 Costa/Benmesbah; Thaeides theia, female, Venezuela, Aragua, Rancho Grande, 1100 m, X. 1967, Romero; Thaeides theia, male, Venezuela, Aragua, Rancho Grande, Cumbre, 1100 m V. 1995, Romero. Wing structural colouration was measured using our in-house spectroboard (Bálint et al. 2010, Kertész et al. 2021). The terminology of wing venation follows the Comstock-Needham nomenclature system (Miller 1970). In genomic analysis, the following specimens (n = 6) were used: Thaeides annandon, male, Brazil, Rio Grande do Sul, São Francisco de Paula, 900 m, 3. V. 1998, Moser; Thaeides hyperion n. sp., female, Venezuela, Bolívar, Auyán Tepui, Entre Libertador y El Oso, 2200 m, 24. XII. 2012, Costa; Thaeides hyperion n. sp., male, Venezuela, Bolívar, Auyán Tepui, Entre el Danto y El Peñón, 1750 m, 25. III. 2013, Costa; Thaeides hyperion n. sp., male, Venezuela, Bolívar, Auyán Tepui, El Dragón, 1750 m, 3. II. 2019, Costa/Benmesbah; Thaeides theia, female, Venezuela, Aragua, Rancho Grande, 1100 m, X. 1967, Romero; Thaeides theia, male, Venezuela, Aragua, Rancho Grande, Cumbre, 1100 m, V. 1995, Romero. Protocol for genomic work followed previous publications (Li et al. 2019; Zhang et al. 2019). In brief, genomic DNA was extracted from a single leg, mate-pair libraries constructed and sequenced at 150 bp on Illumina platform. Protein-coding regions were assembled using DIAMOND (Buchfink et al. 2015) from the resulting sequence reads and a reference protein set of Calycopis cecrops (Fabricius, 1793) (Cong et al. 2016), and three phylogenetic trees were constructed using IQtree v1.6.12, utilizing the GTR+GAMMA model (Nguyen et al. 2015): (1) from autosomes in the nuclear genome, (2) from the gene predicted to be located in the Z chromosome, and (3) from the mitochondrial genome. Ultrafast bootstrap (Minh et al. 2013) was used to indicate statistical support of branches. RESULTS Thaeides hyperion Bálint, Costa & Grishin, n. sp. (Figs. 1–3, 7–8) Classification – Order: Lepidoptera, family: Lycaenidae, subfamily: Theclinae, tribe: Eumaeini, genus: Thaeides Johnson, Kruse & Kroenlein, 1997 (type species: Thecla theia Hewitson, 1870). Generic placement – Representatives of Thaeides can be recognized by the warm-brown forewing ventral surface with dark-brown postbasal, median, postmedian, submarginal, and marginal transverse bands or lines from wing costa to inner margin. There is no similar member of the Lycaenidae with such a phenotype in the Neotropical fauna. Males have an oval-shaped scent pad (according to Faynel & Bálint 2012) in the forewing discal cell apical A New Pantepuian Lycaenidae 279 Annls Mus. hist.-nat. hung. 116, 2024 area. Phylogenetic analysis based on molecular sequencing results in grouping individuals of the new species within the same clade of the type species of Thaeides. Figures 1–3. Type specimens of Thaeides hyperion n. sp.; in dorsal (above) and ventral (below) views (scale bar 1 cm): 1 = holotype male (LPD # 311); 2 = allotype female (LPD # 81); 3 = paratype female (LPD # 306); photos by G. Katona Figures 4–6. Specimens of Thaeides species, in dorsal (above) and ventral (lower image) views (scale bar 1 cm): 4 = T. theia, male (Venezuela, Aragua); 5 = ditto, female; 6 = T. annandon, male (Brazil, Rio Grande do Sul); photos by G. Katona 1 4 2 5 3 6 Costa et al. 280 Annls Mus. hist.-nat. hung. 116, 2024 Type material – Holotype male (LPD # 311), set dorsally, in good condition (dorsal wing surfaces slightly worn), forewing costa length: 14 mm; labelled as “VENEZUELA [//] Bolívar [//] Auyán Tepui, El Dragón [//] 1750 m, 6 II 2019 [//] Costa/Benmesbah” (label oblong, paper white, letters and numbers black printed), to be deposited in MIZA. Paratypes, all from Venezuela (n = 10; six males, four females): male (specimen), Amazonas, Cerro Yaví, 2200 m, 24–28. II.1995, 5°43’N;65°54’W; J. L. García, Exp. Terramar (LPD # 114; MIZA); female, ditto (LPD # 116; MIZA); female, Bolívar, Auyán Tepui, entre Libertador y El Oso, 2200 m, 24.XII.2012, M. Costa (LPD # 165; DNA sample NVG-23032D08; HNHM); male, Bolívar, Auyán Tepui, entre El Danto y El Peñón, 1750 m, 25.III.2013, M. Costa (gen. prep. Bálint no. 1527) (LPD # 158; DNA sample NVG23032D07; HNHM); male, Bolívar, Talud Ptarí Tepui, 1500 m, 15.XII.2015, M. Costa (LPD # 368; MC, to be deposited in MIZA); male, Bolívar, Auyán Tepui, El Peñón, 1850 m, 10.I.2017, Costa/Benmesbah (LPD # 081; HNHM, to be deposited in MC); male (right hindwing), Bolívar, Auyán Tepui, El Dragón, 1750 m, 03.II.2019, Costa/Benmesbah (LPD # 292; DNA sample NVG23032D09; HNHM, to be deposited in MB); female, Bolívar, Auyán Tepui, El Dragón, 1750 m, 04.II.2019, Costa/Benmesbah (LPD # 306; HNHM, to be deposited in MIZA); male (left forewing), Bolívar, Auyán Tepui, Campo Lecho, 1750 m, 05.II.2019, M. Costa (LPD # 369; MC; to be deposited in MIZA); male, Bolívar, Auyán Tepui, El Peñón, 1850 m, 07.II.2019, Costa/Benmesbah (LPD # 260; HNHM). Diagnosis (Figs. 1–6) – In males of Thaeides hyperion n. sp., the area around the scent pad in the forewing discal cell is black, whilst it is at least partly blue in all other known T. theia-like species and populations. Males of T. hyperion n. sp. have a shining blue (SP: 465 nm) dorsal wing surface, whilst the male of T. annandon is somewhat darker (SP: 450 nm), and in T. theia, the colour is closer to purple (SP: 415 nm). The female dorsal wing surface is deep blue (SP: 465 nm) or light purple (SP: 400 nm) in T. hyperion n. sp., whilst in T. theia it is green (SP: 560 nm). In males of T. hyperion n. sp., the ventral hindwing “Thecla” spot in the submarginal area of veins Cu1 and Cu2 is larger than in other known populations resulting in a more obvious pattern. Thorax and abdomen dorsal surfaces are a deeper blue in T. hyperion n. sp., whilst in the other species these are gleaming blue. Barcode sequence of a topotypic paratype – Sample NVG-23032D09, GenBankPQ585653, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATATTAGGTACATCCT TAAGAATTTTAATTCGGATAGAATTAGGAACTCCAGGATCATTAATTG GAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCCTTTATTAT AATTTTTTTCATAGTAATACCTATTATAATCGGAGGCTTTGGAAATTGA TTAGTACCATTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATAA ATAATATAAGATTTTGATTATTACCCCCCTCTTTAATATTATTAATTTCA AGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAATTTACC A New Pantepuian Lycaenidae 281 Annls Mus. hist.-nat. hung. 116, 2024 Description – Wings (Figs. 1–3): Shape: costa length measured from base to apex 11–15 mm (n = 11); hindwing vein Cu1 terminus with tail <1 mm, vein Cu2 terminus with filamentous tail longer than 2 mm; tornal area slightly lobed. Male (Fig. 1): Dorsal wing surface: fringes dark brown; forewing basal and medial area under cubital vein blue (SP: 460 nm) otherwise black in costal, postmedian and marginal areas; hindwing blue with black costa and apex, margin with grey scaling forming a delicate line, tornal lobe with orange scaling, anal fold grey. Ventral wing surface: fringes dark brown; forewing ground colour warm brown with a complicated pattern comprised of five transverse lines or bands (1) postbasal cell area with a short straight band, (2) median area with the widest dark band running straight from costa narrowing progressively to inner margin, (3) postmedian area with a nebulous band, fainter near costa and absent at inner margin, (4) a dark submarginal band slightly bent parallel to outer margin from costa to inner margin, and (5) a dark antemarginal line parallel to outer margin; hindwing ground colour as in forewing but with more complicated pattern comprised of transverse bands and lines basically separated by vein Cu2 to anterior and posterior regions; anterior region with pattern similar to forewing but bands and lines running towards tornal Thecla spot; posterior region with veins Cu2, 1A and 2A covered by black scales forming thin lines supplemented by a delicate line between vein 1A and outer margin, all running from base to tornal Thecla spot; space Cu1-Cu2 in submarginal area with large orange spot, additional but less extensive submarginal orange scaling in spaces between vein Cu1 and inner margin, tornal lobe black with long fringes. Female (Figs. 2–3): similar to male, but wing dorsal surface ground colour darker blue to purplish, hindwing antemarginal pattern darker, more developed. Body: Male and female similar. Head: vertex and frontoclypeus covered by black hair-like scales, labial palpus with middle segment black-haired in its lower part with some white scales mixed, terminal segment short and pointed, eyes large and hairy; antennal flagellum and club dorsally black with white ventral scaling in each segment, club tip reddish brown. Thorax and legs: covered with dark hair-like scales, excluding tibia and tarsus with normal scaling. Abdomen: dorsally darker blue, ventrally lighter grey. Genitalia (Figs. 7–8): Male capsule high and robust with prominent saccus and vinculum equal in length without tegumenal brush organ, tegumen large with a central depression visible only in dorso-ventral aspect, posterior parts CCCCATTGTCATCTAATATTGCACACAGAGGATCATCAGTTGATTTAG CCATTTTTTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATT AATTTTATTACAACTATTATTAATATACGAGTAAATAATTTATCTTTTGA TCAAATATCATTATTTATCTGAGCTGTAGGGATTACAGCTTTATTACTAT TATTATCTCTTCCTGTATTAGCAGGAGCTATCACTATATTATTAACTGAT CGAAATTTAAATACCTCATTCTTTGATCCAGCAGGAGGGGGAGATCC TATTTTATATCAACATTTATTT Costa et al. 282 Annls Mus. hist.-nat. hung. 116, 2024 sclerotized with a pair of strong gnathi bent 180 degrees in middle and with pointed apex, valva extremely long and narrow in lateral view with 0.5 length of aedeagus and pointed central process, but smoother and flat in dorso-ventral view, and valve terminus pincer-like, especially evident in dorso-ventral aspect, aedeagus prominent, twice length of valva, vesica with a single large sclerotized cornutus (Fig. 7). Female genitalia comprised of a centrally membranous but otherwise sclerotized ductus with pointed terminal plate, ductus bursae expanded and heavily sclerotized by entrance to corpus bursae, further expanded to the side in this area connecting with the ductus seminalis, and connected by a membranous area to the ductus, corpus bursae appears small, half of ductus length, signa faint (Fig. 8). Figures 7–8. Thaeides hyperion n. sp. genitalia in lateral aspect: 7 = male; 8 = female. Scale bars = 1.2 mm; photos: Zsolt Bálint, compiled by G. Katona Variation – There is a marked degree of variation in wing size, forewing length in both sexes is 11–15 mm. Female dorsal wingsurface may be purple instead of blue (see Discussion). Distribution – Thaeides hyperion n. sp. is currently only known from three tepuis, at elevations between 1500 and 2200 m (Fig. 9): Auyán Tepui and Ptarí Tepui (in the eastern Pantepui) and from Cerro Yaví (in the north-western Pantepui). Because most tepuis are still unexplored and considering the great distance between Cerro Yaví and Ptarí Tepui (about 470 km), it is likely that this new species occurs on other local mountains in suitable habitat and at favourable elevations. 7 8 A New Pantepuian Lycaenidae 283 Annls Mus. hist.-nat. hung. 116, 2024 Figure 9. Known distribution of Thaeides hyperion n. sp. (red circled white points); compiled by M. Costa Etymology – In Greek mythology, Hyperion was one of the titans, like Theia. Selecting this mythological name, we emphasize the close relationship between T. theia and T. hyperion n. sp. Furthermore, the name Hyperion means “the one who walks in the heights”, indicating that the species does not occur in the lowlands, but in the highlands of the Pantepui. DISCUSSION Habitat – The habitat of Thaeides hyperion n. sp. is defined as upper montane evergreen low growing forest by Huber & Riina (1997). On most tepuis, between about 1600 and 2200 m elevation, there is a belt of low upper montane forest that usually extends along the higher slopes until it reaches the base of the vertical cliffs; this is the case of the cloud forest at El Peñón (Fig. 10) on Auyán Tepui, characterized by a very high frequency of orographic mist during most of the year. Predominant plants are members of the families Theaceae, Podocarpaceae, Magnoliaceae, Cunoniaceae, and Araliaceae. Tree trunks and branches are covered densely by lichens, mosses, ferns, and other epiphytes. The understorey is also very dense with Xyridaceae, Cyperaceae, Bromeliaceae, and bambusoid grasses, as well as numerous low shrubs. Similar habitat also occurs on the summits of some tepuis, where there are no vertical rock walls separating the summit from the slopes; this is the case of El Dragón (Fig. 11), also on Auyán Tepui, where there is a low evergreen high tepui forest that grows mostly on organic substrates (peat) overlying sandstone, with plants between 6 and 12 m high (Costa et al. 2020: 34–35). Costa et al. 290 Annls Mus. hist.-nat. hung. 116, 2024 REFERENCES Bálint Zs. 2006: Arcas Swainson, 1832 is revisited: review of some species-group names, identification of the sister group and a key for species (Lepidoptera, Lycaenidae: Eumaeini). – Annales historico-naturales Musei nationalis hungarici 98: 147–158. Bálint Zs. 2022: Függelék. Az új tribuszok, génuszok és fajok leírása. In: D’Abrera L. B. & Bálint Zs: Pillangóvilág. Bevezetés: A teremtett sokféleség rendje. [Appendix. Descriptions of the new tribes, genera and species. In: D’Abrera L. B. & Bálint Zs: World Butterflies. Introduction. Order of the created diversity.] – Budapest, Pytheas könyvmanufaktúra, pp. 85–105. Bálint Zs. & Costa M. 2012: Description of an Ocaria species from the Venezuelan Pantepuy (Lepidoptera: Lycaenidae: Theclinae). – Annales historico-naturales Musei nationalis hungarici 104: 299–310. Bálint Zs. & Moser A. 2001: Notes on the genus Paraspiculatus (Insecta: Lepidoptera: Lycaenidae: Eumaeini) with a synopsis of the taxa occurring in southern Brazil. – Annalen der naturhistorischen Museum Wien 103(B): 249–262. Bálint Zs. & Moser A. 2007: Description of a Denivia species from south and southeast Brazil with notes on the genus (Lepidoptera, Lycaenidae: Eumaeini). – Folia entomologica hungarica 68: 147–156. Bálint Zs., Wojtusiak J., Kertész K. & Biró P. L. 2007: The description of Theritas gozmanyi from the Andes and its spectroscopic characterization with some notes on the genus (Lepidoptera: Lycaenidae: Eumaeini). – Acta zoologica Academiae scientiarum hungaricae 53(Supplement 1): 211–224. Bálint Zs.,Wojtusiak J., Piszter G., Kertész K. & Biró L. P. 2010: Spectroboard: An instrument for measuring spectral characteristics of butterfly wings – A new tool for taxonomists. – Genus 21(1):163–168. Brévignon C. 2000: Contribution à l’étude des Lycaenidae de Guyane Française. Le groupe de gabriela sensus Draudt (1917) (Lepidoptera, Lycaenidae, Theclinae) (1ère partie). – Lambillionea 100(4)(1): 533–540. Brown K. S. Jr. 1993. Neotropical Lycaenidae: an overview. – Occasional Paper of the IUCN Species Survival Commission 8: 45–61, 3 figs., 3 tabs. Buchfink B., Xie C. & Huson D. H. 2015: Fast and sensitive protein alignment using DIAMOND. – Nature Methods 12: 59–60. https://doi.org/10.1038/nmeth.3176 Busby C. R., Faynel C., Moser A. & Robbins K. R. 2017: Sympatric diversification in the Upper Amazon. A revision of the eumaeine genus Paraspiculatus (Lepidoptera: Lycaenidae). – Smithsonian Contributions to Zoology 649: i–vii, 1–65. https://doi.org/10.5479/si.1943-6696.649 Cong Q., Shen J., Borek D., Robbins K. R., Otwinowski Z. & Grishin V. N. 2016: Complete genomes of hairstreak butterflies, their speciation, and nucleo-mitochondrial incongruence. – Scientific Reports 6(24863): 1–15. https://doi.org/10.1038/srep24863 A New Pantepuian Lycaenidae 291 Annls Mus. hist.-nat. hung. 116, 2024 Costa M., González M. J., Viloria L. Á., Neild A. F. E., Camico H., Benmesbah M., Attal S. & Worthy R. 2023a: Lepidoptera from the Pantepui. Part XII. Notes on Zegara fernandezi (González, 1992) (Castniidae, Castniinae). – Antenor 10(1): 6–20. Costa M., Viloria L. Á., Attal S., Benmesbah M., Fratello S. A. & Bálint Zs. 2019a: Lepidoptera from the Pantepui. Part VII. A distinctive Lamprospilus species from the Guiana highlands (Lepidoptera: Lycaenidae, Theclinae). – Opuscula zoologica 50(2): 111–128. https://doi.org/10.18348/opzool.2019.2.111 Costa M., Viloria L. Á., Attal S., Benmesbah M., Neild A. F. E. & Bálint Zs. 2018: Lepidoptera from the Pantepui. Part V. New Lycaenidae (Theclinae: Eumaeini). – Opuscula zoologica 49(2): 163–179. https://doi.org/10.18348/opzool.2018.2.163 Costa M., Viloria L. Á., Attal S., Blandin P., Neild A. F. E. & Benmesbah M. 2020: Lepidoptera del Pantepui. Parte IX. Nuevos Nymphalidae (Satyrinae) y Riodinidae (Riodininae). – Antenor 7(1): 19–41. Costa M., Viloria L. Á., Attal S., Neild A. F. E., Fratello S. A. & Benmesbah M. 2019b: Lepidoptera del Pantepui. Parte VIII. Nuevos Nymphalidae (Charaxinae y Satyrinae) y Riodinidae (Riodininae). – Anartia 29: 20–48. Costa M., Viloria L. Á., Attal S., Neild A. F. E., Fratello S. A., Callaghan J. C. & Gallard J. Y. 2017: Lepidoptera del Pantepui. Parte IV. Nuevos Riodinidae (Riodininae) y Pieridae (Pierinae). – Bulletin de la Société entomologique de France 122(3): 269–286. https://doi.org/10.3406/bsef.2017.29387 Costa M., Viloria L. Á., Attal S., Neild A. F. E., Fratello S. A. & Nakahara S. 2016: Lepidoptera del Pantepui. Parte III. Nuevos Nymphalidae (Cyrestinae y Satyrinae). – Bulletin de la Societé entomologique de France 121(2): 179–206. https://doi.org/10.3406/bsef.2016.2374 Costa M., Viloria L. Á., Attal S. & Orellana A. 2014a: Lepidoptera del Pantepui. Parte II. Descripción de nuevos Nymphalidae (Papilionoidea). – Bulletin de la Societé entomologique de France 119(1): 39–52. https://doi.org/10.3406/bsef.2016.2374 Costa M., Viloria L. Á., Attal S., Orellana A. & Benmesbah M. 2019c: Lepidoptera del Pantepui. Parte VI. Nuevos Hesperiidae (Hesperiinae) y Nymphalidae (Limenitidinae y Satyrinae). – Bulletin de la Société entomologique de France 123(1): 77–102. https://doi.org/10.32475/bsef_2055 Costa M., Viloria L. Á., Attal S., Orellana A., Neild A. F. E., Benmesbah M. & Girshin N. V. 2021a: Lepidoptera del Pantepui. Parte X. Nuevos Pieridae (Dismorphiinae) y Hesperiidae (Pyrrhopyginae). – Antenor 7(2): 82–105. Costa M., Viloria L. Á., Callaghan C., Trujano-Ortega M., Neild A. F. E., Benmesbah M. & Attal S. 2021b: Lepidoptera del Pantepui. Parte XI. Nuevos Riodinidae (Riodininae), Pieridae (Dismorphiinae) y Nymphalidae (Satyrinae). – Antenor 8(1): 2–28. Costa M., Viloria L. Á., Girshin N. V., Jost B., Benmesbah M., Attal S. & Neild A. F. E. 2022: Lepidoptera from the Pantepui. Part XII. A new subspecies of Pterourus menatius (Hübner, [1819]). – Antenor 8(2): 105–113. Costa et al. 292 Annls Mus. hist.-nat. hung. 116, 2024 Costa M., Viloria L. Á., Huber O., Attal S. & Orellana A. 2014b: Lepidoptera del Pantepui. Parte I: endemismo y caracterización biogeográfica. – Entomotropica 28(3): 193–216. Costa M., Viloria L. Á., Neild A. F. E., Rosser N. , Attal S., Benmesbah M. & Lamas G. 2023b: Lepidoptera del Pantepui. Parte XIV. A new subspecies of Heliconius elevatus Nöldner, 1901 (Papilionoidea, Nymphalidae, Heliconiinae). – Antenor 10(2): 56–72. D’Abrera B. 1995: Butterflies of the Neotropical Region. Part VII. Lycaenidae. – Victoria, Black Rock, Hill House. pp. i–xi, 1098–1270. Draudt M.1919–1921: Familie: Lycaenidae. In: Seitz, A. (Ed.): Die Gross-Schmetterlinge der Erde. Die Amerikanischen Tagfalter. – Stuttgart, Alfred Kernen Verlag, 5(281): 744–752 (24 November 1919), (281): 753–768(6 December 1919), (282): 769–776 (12 January 1920), (283): 777–800 (3 February 1920), (285): 801–808 (3 February 1920), (288): 809–816 (10 December 1920),(289): 817–824 (11 January 1921), (294): 825–831 (24 January 1921), pls. 144–159. Huber O. & Riina R. 1997: Glosario fitoecológico de las Américas. América del Sur: países hispano parlantes. Vol. i-ii. – UNESCO, Caracas, Instituto Botánico de Venezuela, 500 pp. Johnson K., Kruse J. J. & Kroenlein R. K. 1997: The Macusiina, a new infratribe of the Eumaeini with description of ten new genera (Lycaenidae). – Revista de Theclinae colombianos 2(13): [iv] + 1–39. Kawahara A. Y. et al. & Lohman J. D. 2023: A global phylogeny of butterflies reveals their evolutionary history, ancestral hosts and biogeographic origins. – Nature Ecology & Evolution 7(6): 903–913. https://doi.org/10.1038/s41559-023-02041-9 Kertész K., Bálint Zs., Piszter G., Horváth Zs. E. & Biró L. P. 2021: Multi-instrumental techniques for evaluating butterfly structural colors: A case study on Polyommatus bellargus (Rottemburg, 1775) (Lepidoptera: Lycaenidae: Polyommatinae). – Arthropod Structure & Development 61(101010): 1–13. https://doi.org/10.1016/j.asd.2020.101010 Li W., Cong Q., Shen J., Zhang J., Hallwachs W., Janzen D.H. & Girshin N. V. 2019: Genomes of skipper butterflies reveal extensive convergence of wing patterns. – Proceedings of the National Academy of Sciences of the United States of America 116(13): 6232–6237. https://doi.org/10.1073/pnas.1821304116 Minh B. Q., Nguyen A. M. & von Haeseler A. 2013: Ultrafast approximation for phylogenetic bootstrap. – Molecular Biology and Evolution 30(5): 1188–1195. https://doi.org/10.1093/molbev/mst024 Miller D. L. 1970: Nomenclature of wing veins and cells. – Journal of Research on the Lepidoptera 8: 37–48. https://doi.org/10.5962/p.333547 Nguyen L. T., Schmidt H. A., von Haeseler A. & Minh Q. B. 2015: IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. – Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300 A New Pantepuian Lycaenidae 293 Annls Mus. hist.-nat. hung. 116, 2024 Prieto C., Pinilla C., Lorenc-Brudecka J. & Blake M. 2024: Integrative description of Thaeides ramoni sp. nov. (Lepidoptera: Lycaenidae), a sympatric sibling species of Thaeides theia (Hewitson, 1870) found in the Sierra Nevada de Santa Marta, Colombia. – Zootaxa 5501(1): 180–190. https://doi.org/10.11646/zootaxa.5501.1.9 Robbins R. K. 2004a: Introduction to the checklist of Eumaeini (Lycaenidae). In: Lamas, G. (Ed.): Checklist: Part 4A. Hesperioidea – Papilionoidea. In: Heppner, J. B. (Ed.): Atlas of Neotropical Lepidoptera. Volume 5A. – Gainesville, Association for Tropical Lepidoptera, Scientific Publishers, pp. xxiv–xxx. Robbins R. K. 2004b: Lycaenidae.Theclinae. Tribe Eumaeini. In: Lamas, G. (Ed.): Checklist: Part 4A. Hesperioidea – Papilionoidea. In: Heppner, J. B. (Ed.): Atlas of Neotropical Lepidoptera. Volume 5A. – Gainesville, Association for Tropical Lepidoptera; Scientific Publishers, pp. 118–137. Warren. A. D., Davis J. K., Stangeland M. E., Pelham J. P., Willmott K. R. & Girshin N. V. 2024: Illustrated Lists of American Butterflies. – http://www.butterfliesofamerica.com/ [Accessed: 9-III-2024.] Winter W. D. W. 2000: Basic techniques for observing and studying moths & butterflies. – Memoirs of the Lepidopterists’ Society 5: xviii + 444 pp. Zhang J., Cong Q., Shen J., Brockmann E. & Grishin N. V. 2019: Genomes reveal drastic and recurrent phenotypic divergence in firetip skipper butterflies (Hesperiidae: Pyrrhopyginae). – Proceedings of the Royal Society B: Biological Sciences 286(1903): 20190609. https://doi.org/10.1098/rspb.2019.0609 · Costa et al. 294 Annls Mus. hist.-nat. hung. 116, 2024 A pántepui lepkéi, XVI. rész: A Thaeides Johnson, Kruse & Kroenlein, 1997 génusz új faja (Lycaenidae: Theclinae: Eumaeini) Mauro Costa1, Ángel L. Viloria2, Stéphane Attal3, Mohamed Benmesbah4, Andrew Neild5, Nick Grishin6, Krisztián Kertész7 & Zsolt Bálint7, 8, * 1 Museo del Instituto de Zoología Agrícola, Universidad Central de Venezuela, Maracay, Venezuela. E-mail: [email protected] 2 Centro de Ecología, Instituto Venezolano de Investigaciones Científicas, km 11 carretera Panamericana, Altos de Pipe, edo. Miranda 1204, Venezuela. E-mail: [email protected] 3 5–15 rue Olivier-Noyer, 75014 Paris, France. E-mail: [email protected] 4 28T avenue des Pyrénées, 31880 La Salvetat Saint Gilles, France. E-mail: [email protected] 5 Research Associate, McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, PO Box 112710, Gainesville, FL 32611-2710, USA E-mail: [email protected] 6 Howard Hughes Medical Institute, Departments of Biophysics and Biochemistry, University of Texas. Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75390-9050, USA E-mail: [email protected] 7 HUN-REN, Centre for Energy Research Institute of Technical Physics and Materials Science, Nanostructures Department, 121 Budapest, Konkoly Thege Miklós út 29–33, Hungary. E-mail: [email protected], [email protected] 8 Hungarian National Museum Public Collections Centre, Budapest – Hungarian Natural History Museum, Department of Zoology, H-1088 Budapest, Baross utca 13, Hungary. E-mail: [email protected] Összefoglalás – A Guyana-pajzs táblahegyeinek (tepui) magaslatán gyűjtött példányok alapján új nappali lepkefaj (Lepidoptera:Papilionoidea) kerül leírásra: Thaeides hyperion Bálint, Costa & Grishin, n. sp. (Lycaenidae: Theclinae: Eumaeini = Lángszinérfélék: Farkröpérformák: Farkincás-rokonúak). A hegyvidéki területekhez való alkalmazkodása miatt valószínűleg a Pántepui állatföldrajzi tartomány endemikus faja. 16 ábrával, egy táblázattal. Kulcsszavak – Auyán Tepui, Brazília, endemizmus, nemi szervek morfológiája, molekuláris analízis, Ptarí Tepui, spektrális jellemzők, szárnytöredékek, Yaví Tepui, Venezuela * levelező szerző. A New Pantepuian Lycaenidae 295 Annls Mus. hist.-nat. hung. 116, 2024 ÁBRA ÉS TÁBLAMAGYARÁZATOK 1–3. ábrák. Thaeides hyperion n. sp. típuspéldányok, a szárnyak felszíne (fenti kép) és fonákja (alsó kép) (méretléc: 1 cm). 1 = hím holotípus (LPD # 311); 2 = allotípus (nőstény) (LPD # 81); 3 = hím paratípus (LPD # 306); képek: Katona Gergely. 4–6. ábrák. Thaeides példányok, a szárnyak felszíne (fenti kép) és fonákja (alsó kép) (méretléc: 1 cm). 4 = hím T. theia (Venezuela, Aragua); 5 = nőstény, ditto, female; 6 = hím T. annandon, (Brazília, Rio Grande do Sul); képek: Katona Gergely. 7–8. ábrák. Thaeides hyperion n. sp. ivarszervek oldalnézetben. 7 = hím; 8 = nőstény; méretléc: 1.2 mm; képek: Bálint Zsolt, összeálította: Katona Gergely. 9. ábra. A Thaeides hyperion n. sp. ismert elterjedése (fehér pöttyök piros gyűrűvel); összeállította: Mauro Costa. 10. ábra. Táblahegy lábánál alacsonyan növő örökzöld esőerdő: Venezuela, Bolívar, Auyán Tepui, El Peñón; kép: Mauro Costa. 11. ábra. Táblahegy tetején alacsonyan növő örökzöld erdő: Venezuela, Bolívar, Auyán Tepui, El Dragón; kép: Mauro Costa. 12–13. ábrák. Szabadban gyűjtött Thaeides hyperion n. sp. paratípus hím szárnyak felszíne (bal oldal) és fonákja (jobb oldal). 12 = jobb elülső szárny, Campo Lecho, Auyán Tepui, 2019. II. 5., Costa (LPD # 369); 13 = bal hátulsó szárny, Talud Ptarí Tepui, 1500 m, 2015.XII.15, Costa (LPD # 368); képek: Mauro Costa. 14. ábra. A Thaeides génusz és külcsoportjainak fehérjekódoló régiókból kikövetkeztetett filogenetikus fái; a = nukleáris genomból (autoszómák, 9 558 282 pozíció); b = Z kromoszómából (227 031 pozíció, túl kevés pozíciót szekvenáltak az NVG-23032D12-ben ahhoz, hogy bekerüljenek ebbe a fába); c = a mitokondriális genom. A SAMN18673399 szekvenciáját a Kawahara és munkatársai (2023) által megadott illesztésből vettük. A T. theia csoport fajait különböző színekkel ábrázoltuk. Minden példány esetében a fajnevet követi a DNS-minta száma (NVG-előtag nélkül), a típus jellege (HT = holotípus és PT = paratípus), az általános lelőhely és a gyűjtés éve (ha ismert); összeállította: Nick Grishin. 15–16. ábrák. Thaeides fajok elülső szárnyainak felszínén mért normalizált spektrumok. Az áttekinthetőség kedvéért a 15. ábrán csak a hímek, a 16. ábrán a hím és nőstény spektrumok együtt láthatók. HypMH = T. hyperion n. sp., hím (holotípus); HypFP = u. a., nőstény (lila változat); TheM = T. theia, hím (Venezuela: Aragua); AnnM = T. annadon, hím; HypMP= T. hyperion n. sp., hím (paratípus); HypFB = T. hyperion n. sp., nőstény (kék változat); TheF = T. theia, nőstény (Venezuela: Aragua). Összeállította: Kertész Krisztián. 1. táblázat. Pánamerikai elterjedésű Lángszinérfélék (Lycaenidae) nemzetségei, különösképpen eltérő atlantikus fajokkal (a megadott források szerint).