Integrative Description of a New Freshwater Tardigrade Species, Dactylobiotus taiwanensis (Tardigrada: Eutardigrada: Murrayidae), Discovered Through Social Media

© 2025 Academia Sinica, Taiwan Open Access Integrative Description of a New Freshwater Tardigrade Species, Dactylobiotus taiwanensis (Tardigrada: Eutardigrada: Murrayidae), Discovered Through Social Media Daniele Camarda1, Chih-Yu Pai2, Reinhardt Møbjerg Kristensen3, and Daniel Stec4,* 1University of Catania, Department of Biological, Geological and Environmental Sciences, Section of Animal Biology, Via Androne 81, 95124, Catania, Italy. E-mail: [email protected] (Camarda) 2Ruey Long Industry co., LTD, 1 F., No. 247, Sec. 3, Datong Rd., Xizhi Dist., New Taipei City 22178, Taiwan. E-mail: [email protected] (Pai) 3Natural History Museum of Denmark, University of Copenhagen, DK-2100 Copenhagen Ø, Denmark. E-mail: rmkrist[email protected] (Kristensen) 4Institute of Systematics and Evolution of Animals of the Polish Academy of Sciences, Sławkowska 17, 31-016 Kraków, Poland. *Correspondence: E-mail: [email protected] (Stec) urn:lsid:zoobank.org:pub:98CC3B62-CA99-40B9-A17E-2FC8756AE5CA Received 7 December 2024 / Accepted 8 March 2025 / Published 7 May 2025 Communicated by Benny K.K. Chan Two freshwater tardigrade populations belonging to the genus Dactylobiotus were investigated using phase contrast microscopy, scanning electron microscopy, and molecular markers commonly employed in tardigrade phylogenetic studies (18S rRNA, 28S rRNA, ITS2, and COI). The population from Taiwan, discovered through social media, represents a new species, described here as Dactylobiotus taiwanensis sp. nov. This species is most similar to Dactylobiotus parthenogeneticus but differs in the presence of singular rings of pores surrounding the egg processes and specific morphometric traits. The second population, from Greenland, was provisionally identified as D. cf. octavi, and its morphological discrepancies are discussed in detail. A revision of the type material for Dactylobiotus caldarellai and Dactylobiotus lombardoi raises questions about their validity due to insufficient data. Finally, a phylogenetic analysis incorporating taxa from the family Murrayidae, along with the newly sequenced populations, is presented. An updated dichotomous key for the genus Dactylobiotus is also provided. Key words: Meiofauna, Taxonomy, Freshwater, Egg ornamentation, New species Citation: Camarda D, Pai CY, Kristensen RM, Stec D. 2025. Integrative description of a new freshwater tardigrade species, Dactylobiotus taiwanensis (Tardigrada: Eutardigrada: Murrayidae), discovered through social media. Zool Stud 64:14. doi:10.6620/ZS.2025.64-14. BACKGROUND Tardigrades, commonly known as water bears or moss piglets, belong to a phylum of micrometazoans (50–1000 µm) with approximately 1500 described species (Degma and Guidetti 2007 2024; Guidetti and Bertolani 2005). The Phylum is represented by two classes, Heterotardigrada comprising armoured-bodied tardigrades (marine and limno-terrestrial) and the softbodied Eutardigrada (mostly limno-terrestrial), which inhabit nearly all limno-terrestrial environments on Earth (Nelson et al. 2015 2020). Within Eutardigrada, the most species-rich superfamily is Macrobiotoidea, which currently includes 399 nominal taxa, 38 of which (approximately 10%) are considered doubtful. This superfamily accounts for 27% of all known tardigrade species. However, knowledge of some of its families remains limited due to the relatively small number of recognized and studied taxa. One such family is Murrayidae Guidetti, Rebecchi and Bertolani, 2000, which includes 37 nominal taxa grouped into four genera: Dactylobiotus Schuster, 1980 (in Schuster et al. 1980), the monospecific genus Macroversum Pilato and Catanzaro, 1988, Murrayon Bertolani and Pilato, 1988, Zoological Studies 64:14 (2025) doi:10.6620/ZS.2025.64-14 1 © 2025 Academia Sinica, Taiwan and Paramurrayon Guidetti et al., 2022. Interestingly, sexual reproduction has never been observed in this family, and all its taxa are commonly recognized as parthenogenetic (Nelson et al. 2015 2020). Among the four recognized genera within Murrayidae, the cosmopolitan genus Dactylobiotus contains the majority of taxa (19 species), which are considered strictly freshwater inhabitants. However, the genus currently includes several species with vague diagnoses, four of which have already been designated as nomina dubia: Dactylobiotus aquatilis Yang, 1999, Dactylobiotus henanensis Yang, 2002, Dactylobiotus kansae Beasley, Miller and Shively, 2009, and Dactylobiotus macronyx (Dujardin, 1851) (Dastych et al. 2015; Kaczmarek et al. 2012; Pogwidz and Stec 2020). When referring to the latest taxonomic key, the genus Dactylobiotus can be divided into two groups of species, distinguished by the presence or absence of papillae on the dorso-caudal region of the animals’ body (Kaczmarek et al. 2012). Although this division currently lacks molecular confirmation due to limited genetic data, it remains a useful framework for species classification during morphological analyses. Currently, only a small amount of molecular data is available for species of this genus, as well as for other members of the family Murrayidae. This scarcity likely arises from the fact that the majority of taxa within the family were described prior to 2000, a time when genetic data were rarely used for the delineation and characterization of tardigrade species. At present, genetic data are available for six nominal species within the genus Dactylobiotus: Dactylobiotus ambiguus (Murray, 1907) (in Guil et al. 2019), Dactylobiotus parthenogeneticus Bertolani, 1982 (in Guidetti et al. 2022; Pogwidz and Stec 2020), Dactylobiotus grandipes (Schuster, Toftner and Grigarick, 1978) (in Guidetti et al. 2022), Dactylobiotus octavi Guidetti, Altiero and Hansen, 2006 (in Jorgensen et al. 2010), Dactylobiotus ovimutans Kihm, Kim, McInnes, Zawierucha, Rho, Kang and Park, 2020 (in Kihm et al. 2020), and Dactylobiotus selenicus Bertolani, 1982 (in Stec et al. 2020). In this study, newly discovered populations of the genus Dactylobiotus from Taiwan and Greenland were investigated using an integrative approach. Morphological, morphometric, and phylogenetic analyses revealed that the Taiwanese population represents a species new to science, which is formally described here. The phenotypic discrepancies between the Greenlandic population and other similar taxa are discussed in detail. Additionally, the type material of two older species, Dactylobiotus caldarellai Pilato and Binda, 1994, and Dactylobiotus lombardoi Binda and Pilato, 1999, was re-examined, leading to further discussion on the validity of these taxa. Finally, an updated taxonomic key to the valid species of the genus Dactylobiotus is provided. MATERIALS AND METHODS Sample processing In autumn 2023, the second author posted photos on Facebook of their freshwater tardigrade culture, showing hundreds of chunky, whitish tardigrades clustering together. Following a brief private conversation, a decision was made to collaborate on identifying the species. A sample of debris from a Limnophila sp. leaf was collected from a lotus pond in Xinzhuang Touqian Sports Park, New Taipei City, Taiwan, on December 1, 2022 (25.0506021, 121.4628704; leg. Chih-Yu Pai). Approximately 20 live tardigrades were observed and extracted from the sample under a stereomicroscope. These animals were transferred to a six-well plate containing a medium of spring water supplemented with algae and rotifers as food. The medium was changed every three days, with a fresh portion of food added to the culture, which was maintained at room temperature. After about one year of maintaining this culture, a batch of live animals and eggs was extracted and divided into three groups for specific analyses: (1) morphological analysis using phase contrast microscopy (PCM) and scanning electron microscopy (SEM), and (2) molecular analyses of DNA sequences targeting ribosomal markers (18S rRNA, 28S rRNA, ITS-2) and the mitochondrial marker COI. For details, please see the “Material examined” section below in the description. Additionally, a mixed sample of moss and algae was collected in Greenland from a wet stone in a river outlet of Tasersuaq (Lake) in Qaqortoq (Julianehåb) on July 30, 2022 (GPS: 60.7192427, -46.0409180; leg. Lars Engberg Hansen). The sample was examined for tardigrades using standard methods described by Stec et al. (2015). It contained animals and eggs belonging to the genus Dactylobiotus. An embryonated egg was used to obtain DNA sequences for this species, while other specimens were mounted on permanent slides or prepared for SEM analysis as described below. Microscopy and imaging Specimens for light microscopy were mounted on microscope slides in a small drop of Hoyer’s medium and secured with a cover slip, following the protocol by Morek et al. (2016). The dried slides were sealed with transparent nail polish and examined under a Leica DMLB phase contrast microscope (PCM) equipped page 2 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan with a digital camera. Specimens of the new species prepared for SEM were processed according to the “A2” protocol described by Camarda et al. (2024) and sputter-coated with gold. The SEM imaging was conducted using a Phenom XL-G2 SEM at the University of Catania, Sicily, Italy (voltage 15.00 kV, working distance 5.5 mm). Eggs of the Greenlandic population designated for SEM analyses were prepared following the protocol of Stec et al. (2015). Briefly, the eggs underwent a water/ethanol and ethanol/ acetone series, followed by CO₂ critical point drying, and were subsequently sputter-coated with a thin layer of gold. These specimens were examined under high vacuum using a Versa 3D DualBeam Scanning Electron Microscope at the ATOMIN facility of the Jagiellonian University, Kraków, Poland (voltage 10.00 kV, working distance 10.2 mm). All figures were assembled in Corel Photo-Paint X6. For structures that could not be satisfactorily focused in a single photograph, a stack of 2–6 images was captured at an equidistance of approximately 0.2 μm and manually combined into a single deep-focus image. Morphometrics and morphological nomenclature All measurements are given in micrometres (μm). Sample size was adjusted following recommendations by Stec et al. (2016). Structures were measured only if their orientation was suitable. Body length was measured from the anterior extremity to the end of the body, excluding the hind legs. The buccal apparatus and claws were classified according to Pilato and Binda (2010). The terminology used to describe oral cavity armature and egg shell morphology follows Michalczyk and Kaczmarek (2003). Macroplacoid length sequence is given according to Kaczmarek et al. (2014) whereas morphological states of cuticular bars on legs follow Kiosya et al. (2021). Buccal tube length and the level of the stylet support insertion point were measured according to Pilato (1981). The pt index is the ratio of the length of a given structure to the length of the buccal tube expressed as a percentage (Pilato 1981). Claws were measured according to Binda and Pilato (1999). Buccal tube width was measured as the external and internal diameter at the level of the stylet support insertion point. Distance between egg processes was measured as the shortest distance between the base edges of the two closest processes. Morphometric data underlying the new species description were handled using the “Parachela” ver. 1.8 template available from the Tardigrada Register (Michalczyk and Kaczmarek 2013) and are given in Supplementary Materials (SM. 1). Tardigrade taxonomy follows Bertolani et al. (2014) and Stec et al. (2020a). DNA sequencing The DNA was extracted from individual animals following a Chelex® 100 resin (Bio-Rad) extraction method by Casquet et al. (2012) with modifications described in detail in Stec et al. (2020b). After DNA extraction, the exoskeletons of the new species were recovered from Chelex® beads and mounted on permanent slides as described above. This procedure was not successful for the embryonated egg of the Greenlandic population. Four DNA fragments differing in mutation rates were sequenced. Namely: the small ribosome subunit (18S rRNA, nDNA), the large ribosome subunit (28S rRNA, nDNA), the internal transcribed spacer (ITS-2, nDNA), and the cytochrome oxidase subunit I (COI, mtDNA). All fragments were amplified and sequenced according to the protocols described in Stec et al. (2020b); primers are listed in table 1. Sequencing products were read with the ABI 3130xl sequencer at the Genomed company (Warsaw, Poland). Sequences were processed in BioEdit ver. Table 1. Primers with their original references used for amplification of the four DNA fragments sequenced in the study DNA marker Primer name Primer direction Primer sequence (5'-3') Primer source 18S rRNA 18S_Tar_Ff1 forward AGGCGAAACCGCGAATGGCTC Stec et al. (2017) 18S_Tar_Rr1 reverse GCCGCAGGCTCCACTCCTGG 28S rRNA 28SF0002 forward GRCRAGAKTACCCGCTGAAC Stec (2022) Mironov et al. (2012) 28SR0990 reverse CCTTGGTCCGTGTTTCAAGAC ITS-2 ITS2_Eutar_Ff forward CGTAACGTGAATTGCAGGAC Stec et al. (2018) ITS2_Eutar_Rr reverse TCCTCCGCTTATTGATATGC COI LCO1490-JJ forward CHACWAAYCATAAAGATATYGG Astrin and Stüben (2008) HCO2198-JJ reverse AWACTTCVGGRTGVCCAAARAATCA page 3 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan 7.2.5 (Hall 1999) and submitted to GenBank. Prior submission all obtained COI sequences were translated into protein sequences in MEGA11 (Tamura et al. 2021) to check against pseudogenes. Phylogenetic analysis In order to investigate phyletic position of the new species and the Greenlandic population a phylogenetic tree was constructed. For this purpose a data set was compiled from taxa/specimens for which DNA sequences of at least two (out of all four analysed in this study) molecular markers are available and suitable for concatenation (Table 2). The DNA sequences of Adorybiotus cf. granulatus and Crenubiotus salishani Vecchi, Choong and Calhim, 2022 were used as the outgroup. The sequences were aligned using the AUTO method (for COI and ITS-2) and the Q-INS-I method (for ribosomal markers: 18S rRNA and 28S rRNA) of MAFFT version 7 (Katoh et al. 2002; Katoh and Toh 2008) and manually checked against nonconservative alignments in BioEdit. Then, the aligned sequences were trimmed to: 831 (18S rRNA), 725 (28S rRNA), 466 (ITS-2), 658 (COI) bp and concatenated using SequenceMatrix (Vaidya et al. 2011). Before partitioning, the concatenated alignment was divided into 6 data blocks constituting three separate blocks of ribosomal markers and three separate blocks of three codon positions in COI data set. Using PartitionFinder under the Akaike Information Criterion (AIC), the best scheme of partitioning and substitution models were chosen for Bayesian phylogenetic analysis. Bayesian inference (BI) marginal posterior probabilities were calculated for the concatenated (18S rRNA+28S rRNA+ITS-2+COI) data set using MrBayes v3.2 (Ronquist and Huelsenbeck 2003). Random starting trees were used and the analysis was run for fifteen million generations, sampling the Markov chain every 1000 generations. An average standard deviation of split frequencies of < 0.01 was used as a guide to ensure the two independent analyses had converged. The program Tracer v1.7 (Rambaut et al. 2018) was then used to ensure Markov chains had reached stationarity, and to determine the correct ‘burn-in’ for the analysis which was the first 10% of generations. The ESS values were greater than 200 and the consensus tree was obtained after summarising the resulting topologies and discarding the ‘burn-in’. ModelFinder Table 2. Sequences used for phylogenetic analysis. Bold font indicates sequences obtained in this study, while taxa annotated with quotation marks indicate possible misidentifications Taxon 18S rRNA 28S rRNA COI ITS-2 Source D. grandipes V1 OP380711 OP379718 OP390261 Guidetti et al. (2022) D. grandipes V2 OP380712 OP379719 OP390262 Guidetti et al. (2022) D. cf. octavi PV211928 PV211931 PV213452 PV211934 this study D. ovimutans MT136805 MT132333 Kihm et al. (2020) D. parthenogeneticus FR MT373694 MT373700 MT373804 MT374191 Pogwizd and Stec (2020) D. parthenogeneticus GB MT373693 MT373699 MT373803 MT374190 Pogwizd and Stec (2020) D. parthenogeneticus PL MT373695 MT373701 MT373805 MT374192 Pogwizd and Stec (2020) D. parthenogeneticus V3 OP380708 OP379716 OP390258 Guidetti et al. (2022) D. parthenogeneticus V7 OP380710 OP379717 OP390260 Guidetti et al. (2022) D. selenicus MT812476 MT812466 MT808076 MT812602 Stec et al. (2020a) Dactylobiotus sp. (1) EF632436 EF632524 Sands et al. (2008) Dactylobiotus sp. (2) EF632439 EF632525 Sands et al. (2008) D. taiwanensis sp. nov. (1) PV211926 PV211929 PV213453 PV211932 this study D. taiwanensis sp. nov. (2) PV211927 PV211930 PV213454 PV211933 this study Paramurrayon cf. stellatus OQ029312 OQ029486 Massa et al. (2024) M. cf. pullari IT.338 MT812477 MT812465 MT808080 MT812603 Stec et al. (2020a) M. cf. pullari US1 OP380713 OP379720 OP390263 Guidetti et al. (2022) M. cf. pullari V1 OP380714 OP379721 OP390264 Guidetti et al. (2022) “Paramurrayon dianeae” FJ435737 FJ435762 FJ435801 Guil and Giribet (2012) P. meieri 13 OP380715 OP379723 OP390265 Guidetti et al. (2022) P. meieri A14 OP380718 OP379726 OP390268 Guidetti et al. (2022) P. meieri A3 OP380716 OP379724 OP390266 Guidetti et al. (2022) P. meieri A4 OP380717 OP379725 OP390267 Guidetti et al. (2022) A. cf. granulatus JP.008 MT812475 MT812464 MT808075 MT812600 Stec et al. (2020a) C. salishani S1916_1 ON062322 ON062305 ON059359 ON062326 Vecchi et al. (2022) C. salishani S1916_2 ON062323 ON062306 ON059360 ON062327 Vecchi et al. (2022) page 4 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan (Kalyaanamoorthy et al. 2017) was used to choose the best-fit models according to the AIC for Maximum Likelihood (ML) analysis. Than ML reconstruction was conducted using W-IQ-TREE (Nguyen et al. 2015; Trifinopoulos et al. 2016). One thousand ultrafast bootstrap (UFBoot) replicates were applied to provide support values for branches (Hoang et al. 2018). The consensus tree was viewed and visualised by FigTree v.1.4.3 available from http://tree.bio.ed.ac.uk/software/ figtree. The best evolutionary models of sequence evolution selected for BI and ML analyses as well as respective raw trees are given in supplementary materials (SM. 2). Examined type material To facilitate a morphological comparison with the new species, the holotype and paratypes of D. caldarellai and D. lombardoi (species for which eggs have not yet been found or described) were also examined. These specimens are preserved at the University of Catania (Slide Nos. 4299, 4300, and 4333). Microphotographs of the type material are provided in the supplementary materials (SM. 3). Morphometric comparison According to the taxonomic key provided by Kaczmarek et al. (2012), the new species is most similar to D. parthenogeneticus. To investigate this similarity, we conducted a morphometric comparison of the eggs and animals of the new species and D. parthenogeneticus using Principal Component Analysis (PCA). All analyses were performed in R v.4.3.3. For eggs, absolute values (raw measurements in μm) were used for the analysis, whereas for the animals, relative (pt) and absolute values were analysed. The PCA was performed using the NIPALS algorithm (which allows for the presence of missing data; Wold 1966) using the R package “pcaMethods” (Stacklies et al. 2007). The PCAs were visualized with the packages “ggplot2 ver. 3.3.2”, “plyr ver. 1.8.6” and “gridExtra ver. 2.3” (Wickham 2011; Wickham et al. 2016). The R code and input data are given in supplementary materials (SM. 4 and SM. 5), respectively. RESULTS Phylogeny The phylogenetic trees generated using Maximum Likelihood (ML) and Bayesian Inference (BI) methods showed very similar topologies (Fig. 1 and SM. 2). These analyses illustrated the evolutionary relationships among taxa within the family Murrayidae. However, due to limited taxonomic and phylogenetic coverage, the exact relationships between Dactylobiotus, Murrayon, and Paramurrayon could not be confidently resolved (nodal support < 90; Fig. 1). The analysis clearly indicates that the new species belongs to the genus Dactylobiotus and clusters with D. parthenogeneticus, D. selenicus, and D. grandipes. The DNA sequences labeled in GenBank as Dactylobiotus sp. (GenBank accession numbers: EF632436, EF632439, EF632524, EF632525) and included in our study cluster closely with D. ovimutans, indicating that these three terminals represent a single species. A similar result is observed for sequences of Paramurrayon dianeae (Kristensen, 1982) (GenBank accession numbers: FJ435737, FJ435762, FJ435801), which form a uniform, specieslevel clade together with sequences of the recently described Paramurrayon meieri Guidetti, Giovannini, Del Papa, Ekrem, Nelson, Rebecchi and Cesari, 2022. TAXONOMIC ACCOUNT Phylum: Tardigrada Doyère, 1840 Class: Eutardigrada Richters, 1926 Superfamily: Macrobiotoidea Thulin, 1928 (in Marley et al. 2011) Family: Murrayidae Guidetti et al., 2000 Genus: Dactylobiotus Schuster, 1980 (in Schuster et al. (1980)) Dactylobiotus taiwanensis sp. nov. (Figs. 2–9, Tables 3–4) urn:lsid:zoobank.org:act:2F270225-1415-4690-B8E87673F0FF4131 Material examined: 82 animals, 73 eggs mounted on microscope slides in Hoyer’s medium (some of the eggs were embryonated), six animals and two eggs examined in SEM and two specimens processed for DNA sequencing. Type locality: 25.0506021, 121.4628704; 3 m asl: Xinzhuang Touqian Sports Park, New Taipei City, Taiwan; debris from the leaf of Limnophila sp.; coll. Chih-Yu Pai; 1 December 2022. Etymology: The species is named after the country in which it was discovered. Type depositories: Holotype: slide TW.001.11 and 46 paratypes (slides: TW.001.*, where the asterisk can be substituted by any of the following numbers: 04, 05, 07–10, 12, 13) and 59 eggs (slides: TW.001.*: 01, 14–17) are deposited at the Institute of Systematics and Evolution of Animals, Polish Academy of Sciences, page 5 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan Sławkowska 17, 31-016, Kraków, Poland, whereas 35 paratypes (slides: TW.001.*: 03, 06) and 14 eggs (slide: TW.001.02) deposited in the Biodiversity Research Center of Academia Sinica. 6 animals and 3 eggs prepared for SEM (UNICT-Stub N.67) are deposited at the University of Catania, Italy. DNA voucher: Two exoskeletons mounted on permanent slides, labelled Dac.tai._TW.001.01 and Dac.tai._TW.001.02, are deposited at the Institute of Systematics and Evolution of Animals, Polish Academy of Sciences, Sławkowska 17, 31-016 Kraków, Poland. Description of the new species Animals (measurements and statistics in Table 3): Body transparent in juveniles and whitish in adults, but transparent after fixation in Hoyer’s medium (Fig. 2A). In live specimens, eyes are present but they dissolve in Hoyer’s medium (out of 21 measured animals). In the dorso-lateral head region an area with minute pores (probably chemosensory function) can be identified in both sides of the head, but only with SEM (Fig. 3A– B). Other than that cuticle is without typical pores but wrinkled with two flat, oval papillae present on the dorsum between legs III and IV in adults and juveniles (Figs. 2B–C and 3C–D). Granulation absent on all legs. Claws of the Dactylobiotus type with short basal portion and primary branches with distinct accessory points (Figs. 4 and 5). Lunules absent, but under PCM a robust semilunar cuticular connection is present between external/posterior and internal/anterior claws (Fig. 4). Under SEM this connection is visible as Fig. 1. Bayesian phylogeny (BI) constructed from concatenated sequences (18S rRNA, 28S rRNA, ITS-2, and COI) of the family Murrayidae. Numbers above the branches indicate Bayesian posterior probabilities (pp). Nodes with pp < 0.80 were collapsed. The new species sequenced in this study is highlighted in bold. Taxa from the genera Dactylobiotus, Paramurrayon, and Murrayon are shown in blue, green, and red fonts, respectively. For details on the taxa included in the tree, refer to table 2. The outgroup is shown in black. The scale bar represents substitutions per site. 0.2 Paramurrayon meieri A3 Crenubiotus salishani S1916_1 Paramurrayon cf. stellatus Paramurrayon meieri 13 Murrayon cf. pullari US1 Dactylobiotus parthenogeneticus GB Dactylobiotus cf. octavi Dactylobiotus parthenogeneticus V3 „Paramurrayon dianeae” Crenubiotus salishani S1916_2 Dactylobiotus ovimutans Dactylobiotus parthenogeneticus V7 Dactylobiotus sp. (1) Dactylobiotus parthenogeneticus PL Murrayon cf. pullari V1 Dactylobiotus sp. (2) Paramurrayon meieri A4 Dactylobiotus grandipes V1 Dactylobiotus selenicus Adorybiotus cf. granulatus JP.008 Paramurrayon meieri A14 Dactylobiotus taiwanensis sp. nov. (2) Dactylobiotus grandipes V2 Dactylobiotus taiwanensis sp. nov. (1) Murrayon cf. pullari IT.338 Dactylobiotus parthenogeneticus FR 1 1 1 0.98 1 0.87 1 1 0.84 1 1 1 1 0.82 0.83 1 1 page 6 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan discontinuous, being composed of extended lunulelike thickenings under the claws on the lateral sides whereas its median portion is located within or under cuticle (Fig. 5). Claws on the first three pairs of legs similar in size but obviously larger on the hind legs. A cuticular thickening is present above claws I–III (Fig. 4C and 5A), which under PCM is visible a darkened continuous cuticular bar (Fig. 4C). Under PCM the area above claws IV is darkened (4D), being similar to the darkened area present in horseshoe structure connecting the anterior and the posterior claw in many species of the family Macrobiotidae. The cuticle of this area under SEM appears smooth when compared to the surrounding cuticle (Fig. 5C). Mouth antero-ventral followed by ten short peribuccal lamellae, bucco-pharyngeal apparatus of the Table 3. Measurements [in µm] of selected morphological structures of individuals of Dactylobiotus taiwanensis sp. nov. mounted in Hoyer’s medium Character N Range Mean SD Holotype µm pt µm pt µm pt µm pt Body length 21 243–640 511 122 575 Buccal tube Buccal tube length 21 32.3–68.6 – 59.0 –11.3 –68.6 – Stylet support insertion point 21 23.3–49.8 71.0–73.3 42.6 72.2 8.2 0.7 49.8 72.5 Buccal tube external width 21 3.9–9.7 11.1–15.1 7.5 12.7 1.6 0.8 7.8 11.4 Buccal tube internal width 21 2.6–7.2 7.6–11.1 5.1 8.6 1.2 0.8 5.4 7.9 Ventral lamina length 21 13.5–30.4 36.9–44.9 24.7 41.8 4.9 2.0 30.4 44.3 Placoid lengths Macroplacoid 1 20 7.0–27.0 21.7–39.4 19.2 31.9 5.6 4.7 22.1 32.2 Macroplacoid 2 20 4.2–15.5 13.0–24.0 11.8 19.5 3.6 3.2 13.4 19.5 Macroplacoid row 21 12.5–44.0 38.6–66.5 33.7 55.8 9.5 8.0 38.5 56.1 Claw 1 heights External primary branch 20 14.3–33.5 40.2–49.0 26.3 44.8 5.5 2.3 30.3 44.2 External secondary branch 20 4.8–13.7 13.6–21.3 10.3 17.3 2.8 2.1 11.3 16.4 External secondary/primary branch 20 29.2–45.6 – 38.6 –4.2 –37.2 – Internal primary branch 18 14.1–32.6 29.9–47.7 24.4 42.1 5.7 4.2 29.6 43.1 Internal secondary branch 19 4.6–13.4 13.4–19.7 9.9 16.6 2.7 2.0 11.1 16.2 Internal secondary/primary branch 18 30.0–64.0 – 39.7 –7.0 –37.6 – Claw 2 heights External primary branch 20 14.5–33.9 37.3–51.6 26.6 45.2 5.8 3.0 31.5 45.9 External secondary branch 20 4.5–13.4 13.0–20.8 10.5 17.6 2.9 2.2 12.0 17.4 External secondary/primary branch 20 29.8–46.2 – 38.9 –4.5 –38.0 – Internal primary branch 17 13.4–32.3 37.3–50.0 25.7 43.4 5.8 3.2 28.0 40.8 Internal secondary branch 17 4.3–13.1 12.7–20.4 10.1 16.7 2.9 2.2 11.7 17.1 Internal secondary/primary branch 17 29.5–45.1 – 38.6 –4.5 –41.9 – Claw 3 heights External primary branch 17 14.5–33.6 39.6–49.7 27.3 45.9 5.6 2.8 33.6 49.0 External secondary branch 16 4.7–13.8 14.4–21.3 10.8 18.1 2.7 1.9 ?? External secondary/primary branch 16 32.2–45.6 – 39.6 –3.4 –?– Internal primary branch 17 13.3–31.8 38.6–48.6 26.2 44.2 5.3 2.8 29.6 43.1 Internal secondary branch 17 4.1–13.8 12.8–20.3 10.2 17.0 2.7 2.1 11.4 16.6 Internal secondary/primary branch 17 30.9–43.3 – 38.3 –3.5 –38.6 – Claw 4 heights Anterior primary branch 11 16.0–41.3 49.4–65.3 33.0 58.2 8.9 5.2 38.8 56.5 Anterior secondary branch 13 6.6–18.2 19.1–29.3 14.7 25.1 4.0 2.8 17.2 25.1 Anterior secondary/primary branch 11 37.7–47.1 – 42.6 –2.7 –44.4 – Posterior primary branch 15 16.3–43.0 50.4–66.5 34.1 60.0 8.9 4.7 39.8 57.9 Posterior secondary branch 15 7.0–19.7 20.7–30.6 15.2 26.3 4.5 3.3 17.3 25.3 Posterior secondary/primary branch 14 36.6–50.4 – 43.5 –3.7 –43.6 – N, number of specimens/structures measured; Range refers to the smallest and the largest structure among all measured specimens; SD, standard deviation). page 7 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan Macrobiotus type (Fig. 3A, 6A and 7). Under PCM, only the second and third bands of teeth are visible in the oral cavity armature (Fig. 6B–C). However, in SEM three bands of teeth are clearly visible with the first band being situated at the base of peribuccal lamellae and composed of several rows of scattered small conical teeth arranged around the oral cavity (Fig. 7). The second band of teeth is situated below the ring fold, and comprises 4–6 rows of small cone-shaped teeth which are larger than those of the first band and increase in size towards the third band of teeth (Figs. 6B–C and 7). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Figs. 6B–C and 7B– C). The third band of teeth is discontinuous and divided into dorsal and the ventral portions. Under PCM, the dorsal teeth are seen as three distinct transversal ridges whereas the ventral teeth appear as two separate lateral transverse ridges, between which a roundish median tooth is visible (Fig. 6B–C). In SEM, both dorsal and ventral teeth are also clearly distinct (Fig. 7B–C). Under PCM, in the lateral view of the buccal apparatus, a strengthening bar (ventral lamina) with an incision determining a ventral hook is clearly visible (Fig. 6D). Fig. 2. Dactylobiotus taiwanensis sp. nov. – habitus and dorsal cuticle (PCM): A, dorso-ventral view (holotype); B–C, dorsal cuticle showing two flat, oval papillae on the dorsum between legs III and IV (holotype and paratype, respectively). Arrows indicate the dorsal papillae. Scale bars in μm. page 8 of 24 Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids which sometimes have jagged edges (Fig. 6E–G). The macroplacoid length sequence 2 < 1. The first macroplacoid has a central constriction, whereas the second macroplacoid is only gently constricted sub-terminally (Fig. 6E–G). Eggs (measurements and statistics in Table 4): Laid freely, whitish, spherical (Fig. 9A). Processes in the shape of short and wide cones with apexes usually divided into multiple (typically three to six) short, nodular, finger-like apices (Figs. 8 and 9). Under SEM, apices usually covered with microgranulation (Fig. 9C). The egg surface between the processes appears wrinkled; however, this is barely visible under PCM (Fig. 8C, D), where most often the surface appears to be smooth (Fig. 8A, B), whereas wrinkles are clearly distinguishable under SEM imaging (Fig. 9). Under PCM, the margins of the process bases appear serrated and are surrounded by a crown of faint, small thickenings/projections, usually with faintly visible pores (Fig. 8A–D). Under SEM these dark projections are clearly visible as vertical thickenings present on basal portions of processes walls and each process base is surrounded by a line of around 25 small, but evident Fig. 3. Dactylobiotus taiwanensis sp. nov. – cuticle of the head and dorso-caudal body regions (SEM, all paratypes): A, head and mouth opening; B, detail of the porous area in the dorso-lateral cuticle of the head; C, dorsal cuticle with two flat, oval papillae on the dorsum between legs III and IV; D, detail of the dorsal papilla. Filled arrows indicate dorsal papillae, while the empty arrow indicates the porous area in the head cuticle. Scale bars in μm. page 9 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan D. parthenogeneticus D. taiwanensis sp. nov. Animals - absolute values Animals - rela�ve values (pt) Eggs Fig. 10. Results of PCA of animals and eggs measurements of D. taiwanensis sp. nov. and D. parthenogeneticus. For animals the PCA was done on absolute and relative (pt) measurements values. Left quadrants show score scatterplots while right quadrants show loading plots. page 16 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan exhibit dorsal papillae (D. grandipes, D. selenicus, D. parthenogeneticus, and D. taiwanensis sp. nov.) cluster together to form a well-supported clade. However, the relationship of this clade with other Dactylobiotus taxa remains poorly supported in our analyses (Fig. 1). Doubtful Dactylobiotus taxa Several explanations could account for the discrepancies in egg ornamentation morphology observed between the newly discovered Greenlandic Fig. 11. Dactylobiotus cf. octavi from Greenland–egg chorion morphology observed in PCM: A–B, egg surface showing conspicuous pores between the processes; C–G, midsections of egg processes. Filled flat arrowheads indicate delicate pores around the bases of the egg processes. Scale bars in μm. page 17 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan Fig. 12. Dactylobiotus cf. octavi from Greenland–egg chorion morphology observed in SEM: A, entire egg; B–E, details of the egg surface and egg processes; F, broken egg surface with one egg process detached. Filled flat arrowheads indicate delicate pores around the bases of the egg processes, and filled indented arrowheads indicate egg processes with introverted apices. Scale bars in μm. page 18 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan population and D. octavi. Specifically: (i) the eggs in the type material may have had undeveloped (not fully extended) processes, (ii) the processes may have been distorted by environmental factors or during preparation, or (iii) the varying morphologies could reflect intraspecific variability. Intraspecific variability in egg morphology has been previously documented in several other tardigrade genera, such as Bertolanius Özdikmen, 2008 (primarily variability in the apical portion of the processes; Dastych 1983), Ramazzottius Binda and Pilato, 1986 (mainly in process length and shape; Stec et al. 2016 2017; Vecchi and Stec 2024), and Paramacrobiotus Guidetti, Schill, Bertolani, Dandekar and Wolf, 2009 (notably in minor differences in the shape of the processes, sometimes even within the same egg; Guidetti et al. 2019). However, an extreme case was recently reported in the latter genus for Paramacrobiotus bifrons Brandoli, Cesari, Massa, Vecchi, Rebecchi and Guidetti, 2024, which exhibits two morphologically distinct egg forms. Regarding the considerable intraspecific variability of egg ornamentation in Dactylobiotus, this phenomenon has so far been reported only for D. ovimutans. Eggs of this species, thoroughly examined in a culture maintained under stable laboratory conditions by Kihm et al. (2020), exhibited variability in the number, size, and inflation of egg processes. This variability was unlikely to result from seasonality or the production of dormant or active eggs, given the consistent conditions under which the culture was maintained (Kihm et al. 2020). Thus, it cannot be excluded that a similar variability may also occur in D. octavi, given the correspondence in all egg characters between the type population and the newly examined population, except for the number and inflation of processes. Specifically, fewer and less inflated processes were observed in the type population from Greenland (Guidetti et al. 2006), whereas eggs with more processes, which were always well extended, were found in the Greenlandic population studied here. Interestingly, differences in the shape of egg processes, attributed to developmental stages, have also been reported for Paramacrobiotus derkai (Degma, Michalczyk and Kaczmarek 2008) and P. bifrons (Brandoli et al. 2024; Degma et al. 2008). This suggests that similar situations might occur in other genera as well. Given these uncertainties and the inability to compare DNA sequences of variable markers from the population studied here with those of D. octavi, we classify our population as D. cf. octavi until further data become available. After examining the type material of D. caldarellai and reviewing its original description, we concluded that this species is insufficiently diagnosed. Pilato and Binda (1994) described D. caldarellai based on two specimens collected from two different locations in Tierra del Fuego, without finding any eggs. The authors considered a morphologically identical population of D. ambiguus reported by Dastych (1984) on King George Island as conspecific with D. caldarellai. Their rationale was based on Dastych’s (1984) observation that the eggs of the newly found population of D. ambiguus differed from those of the population from the species’ type locality in Europe. Notably, the two locations (Tierra del Fuego (type locality of D. caldarellai) and King George Island) are more than 300 km apart. Given the morphological uniformity among animals of different species within the genus and the absence of egg description for D. caldarellai, it cannot be confidently determined whether these populations represent the same or different species. Furthermore, the suboptimal condition of the holotype and paratype of D. caldarellai hinders a detailed examination (SM. 3). Therefore, until further analyses and a potential integrative redescription based on material from the locus typicus are conducted, D. caldarellai should be considered a nomen dubium, as designated in the results section. For the second dubious species, D. lombardoi, the original description was based on two specimens also collected in Tierra del Fuego. In their study, Binda and Pilato (1999) provided a table of pt values derived from the measurements of a single specimen of D. lombardoi. These values fall within the pt range of the most similar species, D. parthenogeneticus, as reported in the same paper, with the exception of buccal tube width and ventral lamina length. However, it is likely that these small differences are the result of an insufficient number of measured specimens or variations in measurement techniques used by different authors. Importantly, when the original measurements from Binda and Pilato (1999) are compared with those provided for D. parthenogeneticus by Pogwizd and Stec (2020), the specimen falls perfectly within the newly reported measurement ranges. Although dorsal papillae are not mentioned in the original description of D. lombardoi, it has been suggested that this species can be distinguished from D. parthenogeneticus by the absence (D. lombardoi) or presence (D. parthenogeneticus) of these structures. However, despite the poor condition of the type series, it appears that dorsal papillae may indeed be present in specimens of D. lombardoi (SM. 3). Given the vague diagnosis of this species, which prevents its clear distinction from other congeners, the lack of a population with a sufficient number of specimens, the unknown egg morphology, and the poor condition of the type material, D. lombardoi should be considered a nomen dubium. This designation, as outlined in the results section, will remain until further analyses confirm whether it represents a distinct species. page 19 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan As a result, all species for which eggs have never been found (i.e., D. aquatilis, D. caldarellai, D. henanensis, D. kansae, D. lombardoi, D. macronyx), with the exception of D. haplonyx Maucci, 1981, are considered nomina dubia. Regarding D. haplonyx, although no specimens from the type series have been examined, it is important to note that the type series comprises individuals collected from multiple locations, with the holotype originating from a different locality than the paratypes (a total of 33 paratypes from five distinct locations, all different from that of the holotype). Furthermore, the species description lacks not only an account of the eggs but also distinctive diagnostic traits that clearly differentiate it from other species. Consequently, further analyses are necessary to assess its validity. Therefore, we consider it appropriate to designate this species as a nomen inquirendum with the following combination: Dactylobiotus haplonyx Maucci, 1981 nom. inq. Dichotomous key Given that egg ornamentation often comprises fundamental diagnostic characters for distinguishing Dactylobiotus taxa, the presented key includes only valid species for which eggs have been described (12 species), excluding from the key all the species designated as nomina dubia or nomina inquirenda. 1. Two dorso-lateral papillae present ............................................ . 2 - two dorso-lateral papillae absent ................................................ 6 2. (1). Accessory points not visible with LM, eggs with truncoconical (crater-like) processes ................ Dactylobiotus selenicus - Eggs with conical processes ....................................................... 3 3. (2). Secondary branch of each claw less than one-third the length of the primary branch; distal portion of egg processes not divided into multiple apices .................................................................... 4 - Secondary branch of each claw more than one-third the length of the primary branch; distal portion of egg processes divided into multiple apices ............................................................................ 5 4. (3). Pt value of the IV claws < 55, width of the egg processes lower than its height, ca. 40 processes present on the egg circumference .............................................. Dactylobiotus dispar - Pt value of the IV claws > 70, width of the egg processes similar to its height, ≥ 50 processes present on the egg circumference .... ................................................................ Dactylobiotus grandipes 5. (3). Egg process bases surrounded by a line of around 25 pores faintly visible with PCM .................. Dactylobiotus taiwanensis* - Few pores, randomly distributed around the bases of egg processes, not visible with PCM ................................................... ................................................ Dactylobiotus parthenogeneticus* 6. (1). Egg processes clearly spaced from each other .................... 7 - Egg processes in contact with each other, with almost no space left between them ....................................................................... 8 7. (6). Delicate reticulation on the egg surface between processes present ..................................................... Dactylobiotus vulcanus - Delicate reticulation on the egg surface between processes absent ..................................................................................................... 9 8. (6). Width of egg processes < 15 µm, more than 20 processes on the egg circumference ....................... Dactylobiotus ambiguus** - Width of egg processes > 15 µm, less than 20 processes on the egg circumference .................................................................... 10 9. (7). Egg process bases width > 10 µm, pores around egg processes bases regularly distributed and visible under light microscope ........................................... Dactylobiotus ovimutans - Egg process bases width < 10 µm, egg surface between processes with irregularly distributed pores or pores absent/not visible under light microscope ............................................................. 11 10. (8). Large, conical egg processes, pores around egg processes not visible under light microscope, width of egg processes bases ≤ 23 µm ............................................. Dactylobiotus ampullaceus - Large, dome-like (or conical) processes, pores around each process well visible under light microscope, width of egg processes bases ≥ 27 µm ....................... Dactylobiotus octavi*** 11. (9). Distal portion of egg processes occasionally bior trifurcated with short tips; width of egg process bases < 8 µm, egg surface between processes with irregularly distributed pores, 31–36 processes on the egg circumference ................................... ..................................................................... Dactylobiotus dervizi - Distal portion of egg processes bi-, trior multifurcated and often divided into short branches; width of egg processes bases about 9 µm, egg surface between processes without pores or pores not visible under light microscope, 37–41 processes on the egg circumference .................................................. Dactylobiotus luci *There are also two minor differences in egg morphology between these species, as their ranges slightly overlap. Dactylobiotus taiwanensis has 38–42 processes on the egg circumference, with process bases measuring 5–6.5 µm, whereas Dactylobiotus parthenogeneticus has 34–38 processes, with process bases ranging from 3 to 5.5 µm. Notably, differences in egg morphometrics clearly distinguish the two species (Fig. 10). **The measurement was obtained by proportionally scaling a drawing from the species description by Murray (1907), which reported the egg diameter, including processes, as 130 µm. Additionally, data from Thulin (1911) indicated that the process bases had a diameter of 9.5 µm. ***It must be stressed that further investigations are necessary to confirm whether the processes can also have a conical shape. For more details, please refer to the section on Dactylobiotus cf. octavi in this study, which discusses the shape of egg processes in Dactylobiotus octavi. CONCLUSIONS The genus Dactylobiotus remains understudied in terms of its phylogeny, and further analyses are necessary to better understand interspecies relationships. Egg morphology and morphometry have proven fundamental for species recognition. Due to the importance of these traits and the poor condition of the type material, two additional taxa (D. caldarellai and D. lombardoi) have been classified as nomina dubia in this study; moreover, due to the numerous localities reported for the type series and the incomplete species description, D. haplonyx is here designated as a nomen inquirendum. Resampling at their respective type localities and the discovery of their eggs are essential to determine whether they truly represent valid species. In page 20 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan this study, two populations of the genus Dactylobiotus were investigated using an integrative approach. One population represents a new tardigrade species, which was formally described as D. taiwanensis sp. nov. This discovery contributes to a better understanding of the Taiwanese tardigrade fauna, which is considered poorly recognized (Gąsiorek et al. 2021). The second population resembles Dactylobiotus octavi, but discrepancies in egg morphology identified during our analyses led to its provisional identification as D. cf. octavi. The data obtained in this study have contribute to the understanding of the genus Dactylobiotus and the phylogenetic positioning of currently sequenced taxa. Additionally, we constructed a new dichotomous key for all valid species of the genus, which will facilitate future species identification. Acknowledgments: We would like to thank Matteo Vecchi (Institute of Systematics and Evolution of Animals, PAS) for his valuable comments on the early version of the manuscript, as well as the two reviewers whose suggestions and corrections improved our work. The second author is particularly indebted to Dr. JrKai Yu and Dr. Yi-Hsien Su (Institute of Cellular and Organismic Biology, Academia Sinica) for providing sampling and preservation materials. This study was supported by the European Commission’s program Transnational Access to Major Research Infrastructures through the SYNTHESYS grant (grant no. DK-TAFTA4-005 to DS) and by the Institute of Systematics and Evolution of Animals, Polish Academy of Sciences. Authors’ contributions: Conceptualization: DC, CYP, RMK, DS; Methodology: DC, DS; Investigation: DC, DS; Data Curation: DC, DS; Writing - Original Draft: DC, DS; Writing - Review & Editing: DC, CYP, RMK, DS; Project administration DS; Funding acquisition: DC, DS. Competing interests: The authors declare that there are no competing interests. Availability of data and materials: The author confirms that the data supporting the findings of this study are available in the article and its supplementary materials. The types are deposited at the Institute of Systematics and Evolution of Animals of the Polish Academy of Sciences, Sławkowska 17, 31-016, Kraków, Poland and at the University of Catania, Via Santa Sofia, 102, Catania, Italy. The DNA sequences obtained in this study are deposited in GenBank with respective accession numbers. Consent for publication: Not applicable. Ethics approval consent to participate: Not applicable. REFERENCES Astrin JJ, Stüben PE. 2008. Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera: Curculionidae). Invertebr Syst 22:503–522. doi:10.1071/IS07057. Bertolani R. 1982. 15. Tardigradi (Tardigrada). Guide per il riconoscimento delle specie animali delle acque interne Italiane. Verona: Consiglio Nazionale Delle Ricerche, 104 pp. Bertolani R, Guidetti R, Marchioro T, Altiero T, Rebecchi et al. 2014. Phylogeny of Eutardigrada: New molecular data and their morphological support lead to the identification of new evolutionary lineages. Mol Phylogenet Evol 76:110–126. doi:10.1016/j.ympev.2014.03.006. Bertolani R, Pilato G. 1988. Struttura delle unghie nei Macrobiotidae e descrizione di Murrayon. gen. (Eutardigrada). Animalia 15:17– 24. Binda MG, Pilato G. 1999. Special Issue on Tardigrada - Dactylobiotus lombardoi sp n (Eutardigrada: Macrobiotidae) from Tierra del Fuego, with a Key to the Dactylobiotus-species. Zool Anz 238:147–156. Binda MG, Pilato G. 1986. Ramazzottius, nuova genere di Eutardigrado (Hypsibiidae). Animalia, 13:159–166. Biserov VI. 1998. The Tardigrada of Komondorskiye Islands, with a description of Dactylobiotus dervizi, sp. nov. (Eutardigrada, Macrobiotidae). Entomol Mitt Zool Mus Hamburg, 12:327–336. Brandoli S, Cesari M, Massa E, Vecchi M, Rebecchi L, Guidetti R. 2024. Diverse eggs, diverse species? Production of two egg morphotypes in Paramacrobiotus bifrons, a new eutardigrade species within the areolatus group. Eur Zool J 91:274–297. doi: 10.1080/24750263.2024.2317465. Camarda D, Massa E, Guidetti R, Lisi O. 2024. A new, simplified, drying protocol to prepare tardigrades for scanning electron microscopy. Microsc Res Tech 87:716–726. doi:10.1002/ jemt.24460. Casquet JT, Thebaud C, Gillespie RG. 2012. Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Mol Ecol Resour 12:136–141. doi:10.1111/j.1755-0998.2011.03073.x. Beasley CW, Miller WR, Shively S. 2009. A new freshwater Tardigrada Dactylobiotus kansae sp. n. (Eutardigrada: Parachela: Murrayidae) from Kansas, U.S.A. Proc Biol Soc Washington 122:460–463. doi:10.2988/09-09.1. Dastych H. 1983. Two new Eutardigrada species from West Spitsbergen and the Tatra Mts. Bull Soc Amis Sc Lettr Poznan 23:195–200. Dastych H. 1984. The Tardigrada from Antartica with description of several new species. Acta Zool Cracov 27:377–436. Dastych H, Holzinger WE, Chovanec A, Waringer JA. 2015. Checklisten der Fauna Österreichs, No. 8. Degma P, Guidetti R. 2007. Notes to the current checklist of Tardigrada. Zootaxa 1579:41–53. doi:10.11646/zootaxa.1579.1.2. Degma P, Guidetti R. 2024. Actual checklist of Tardigrada species. doi:10.25431/11380_1178608. Degma P, Michalczyk Ł, Kaczmarek Ł. 2008. Macrobiotus derkai, a new species of Tardigrada (Eutardigrada, Macrobiotidae, huziori group) from the Colombian Andes (South America). Zootaxa 1731:1–23. doi:10.11646/zootaxa.1731.1.1. Doyère LMF. 1840. Memoire sur les Tardigrades. Annales des Sciences Naturelles, Zool, Paris, Series, 2 14:269–362. page 21 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan Dujardin F. 1851. Observations zoologiques, II: Sure les Tardigrades et sur une espece a longs pieds vivant dans l’eau de mer. Ann Sci Nat Zool 3:158–166. Gąsiorek P, Vončina K, Kristensen RM, Michalczyk Ł. 2021. High mountain echiniscid (Heterotardigrada) fauna of Taiwan. Zool Stud 60:70. doi:10.6620/ZS.2021.60-70. Guidetti R, Altiero T, Hansen JG. 2006. A new species of freshwater tardigrades from Disko Island (Greenland) increases an unsolved paradox in tardigrade systematics. Hydrobiologia 558:69–79. doi:10.1007/s10750-005-1408-6. Guidetti R, Bertolani R. 2005. Tardigrade taxonomy: an updated check list of the taxa and a list of characters for their identification. Zootaxa 845:1–46. doi:10.11646/zootaxa.845.1.1. Guidetti R, Giovannini I, Del Papa V, Ekrem T, Nelson DR, et al. 2022. Phylogeny of the asexual lineage Murrayidae (Macrobiotoidea, Eutardigrada) with the description of Paramurrayon gen. nov. and Paramurrayon meieri sp. nov. Invertebr Syst 36:1099–1117. doi:10.1071/IS22031. Guidetti R, Peluffo JR, Rocha AM, Cesari M, Moly de Peluffo MC. 2013. The morphological and molecular analyses of a new South American urban tardigrade offer new insights on the biological meaning of the Macrobiotus hufelandi group of species (Tardigrada: Macrobiotidae). J Nat Hist 47:2409–2426. doi:10.1 080/00222933.2013.800610. Guidetti R, Cesari M, Bertolani R, Altiero T, Rebecchi L. 2019. High diversity in species, reproductive modes and distribution within the Paramacrobiotus richtersi complex (Eutardigrada, Macrobiotidae). Zool Lett 5:1. doi:10.1186/s40851-018-0113-z. Guidetti R, Schill RO, Bertolani R, Dandekar T, Wolf M. 2009. New molecular data for tardigrade phylogeny, with the erection of Paramacrobiotus gen. nov. J Zoolog Syst Evol Res 47:315–321. doi:10.1111/j.1439-0469.2009.00526.x. Guidetti R, Rebecchi L, Bertolani R. 2000. Cuticle structure and systematics of the Macrobiotidae (Tardigrada, Eutardigrada). Acta Zool 81:27–36. doi:10.1046/j.1463-6395.2000.00034.x. Guil N, Giribet G. 2012. A comprehensive molecular phylogeny of tardigrades—adding genes and taxa to a poorly resolved phylumlevel phylogeny. Cladistics 28:21–49. doi:10.1111/j.10960031.2011.00364.x. Guil N, Jørgensen A, Kristensen RM. 2019. An upgraded comprehensive multilocus phylogeny of the Tardigrada tree of life. Zool Scr 48:120–137. doi:10.1111/zsc.12321. Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. In Nucleic acids symposium series, 41:95–98. Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS. 2018. UFBoot2: improving the ultrafast bootstrap approximation. Mol Biol Evol 35:518–522. doi:10.1093/molbev/msx281. Jorgensen A, Faurby S, Hansen JG, Mobjerg N, Kristensen RM. 2010. Molecular phylogeny of Arthrotardigrada (Tardigrada). Mol Phyl Evol 54:1006–1015. doi:10.1016/j.ympev.2009.10.006. Kaczmarek Ł, Michalczyk Ł. 2017. The Macrobiotus hufelandi (Tardigrada) group revisited. Zootaxa 4363:101–123. doi:10.11646/zootaxa.4363.1.4. Kaczmarek Ł, Cytan J, Zawierucha K, Diduszko D, Michalczyk Ł. 2014. Tardigrades from Peru (South America), with descriptions of three new species of Parachela. Zootaxa 3790:357–379. doi:10.11646/zootaxa.3790.2.5. Kaczmarek Ł, Michalczyk Ł, Eggermont H. 2008. Dactylobiotus luci, a new freshwater tardigrade (Eutardigrada, Macrobiotidae) from the Rwenzori Mountains (Uganda/DR Congo). Afr Zool 43:150– 155. doi:10.3377/1562-7020-43.2.150. Kaczmarek Ł, Schabetsberger R, Litwin M, Michalczyk Ł. 2012. A new freshwater eutardigrade from Fiji and Vanuatu (Oceania), with remarks on the genus Dactylobiotus. N Z J Zool 39:311– 318. doi:10.1080/03014223.2012.693511. Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. 2017. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods 14:587–589. doi:10.1038/ nmeth.4285. Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res 30:3059–66. doi:10.1093/ nar/gkf436. Katoh K, Toh H. 2008. Recent developments in the MAFFT multiple sequence alignment program. Brief Bioinform 9:286–298. doi:10.1093/bib/bbn013. Kiosya Y, Pogwizd J, Matsko Y, Vecchi M, Stec D. 2021. Phylogenetic position of two Macrobiotus species with a revisional note on Macrobiotus sottilei Pilato, Kiosya, Lisi & Sabella, 2012 (Tardigrada: Eutardigrada: Macrobiotidae). Zootaxa 4933:113– 135. doi:10.11646/zootaxa.4933.1.5. Kihm JH, Kim S, McInnes SJ, Zawierucha K, Rho HS et al. 2020. Integrative description of a new Dactylobiotus (Eutardigrada: Parachela) from Antarctica that reveals an intraspecific variation in tardigrade egg morphology. Sci Rep 10:9122. doi:10.1038/ s41598-020-65573-1. Kristensen RM. 1982. New aberrant Eutardigrades from homothermic springs on Disko Island, West Greenland. In: Nelson D.R. ed, Proceedings of the Third International Symposium on Tardigrada. East Tennessee State University Press, Johnson City, Tennessee, pp. 203–220. Massa E, Vecchi M, Calhim S, Choong H. 2024. First records of limnoterrestrial tardigrades (Tardigrada) from Haida Gwaii, British Columbia, Canada. Eur Zool J 91:1–20. doi:10.1080/247 50263.2023.2288824. Maucci W. 1980. Dactylobiotus haplonyx sp. nov., nuova specie di tardigrado della fauna interstitiziale dei fiumi padani. Boll Mus Civ St nat Verona 7:495–499. Michalczyk Ł, Kaczmarek Ł. 2003. A description of the new tardigrade Macrobiotus reinhardti (Eutardigrada, Macrobiotidae, harmsworthi group) with some remarks on the oral cavity armature within the genus Macrobiotus Schultze. Zootaxa 331:1–24. doi:10.11646/zootaxa.331.1.1. Michalczyk Ł, Kaczmarek Ł. 2013. The Tardigrada Register: a comprehensive online data repository for tardigrade taxonomy. J Limnol 72:175–181. doi:10.4081/jlimnol.2013.s1.e22. Mironov SV, Dabert J, Dabert M. 2012. A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the long-tailed tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa 3253:54–61. doi:10.11646/ zootaxa.3253.1.2. Morek W, Stec D, Gąsiorek P, Schill RO, Kaczmarek Ł et al. 2016. An experimental test of eutardigrade preparation methods for light microscopy. Zool J Linn Soc 178:785–793. doi:10.1111/ zoj.12457. Murray J. 1907. XXIV—Scottish Tardigrada, collected by the Lake Survey. Trans Roy Soc Edinburgh 45:641–668. doi:10.1017/ S0080456800011777. Nelson DR, Guidetti R, Rebecchi L. 2015. Phylum tardigrada. In: Thorp and covich’s freshwater invertebrates. Academic Press, pp. 347–380. doi:10.1016/B978-0-12-385026-3.00017-6. Nelson DR, Guidetti R, Rebecchi L, Kaczmarek Ł, McInnes SJ. 2020. Phylum Tardigrada. In: Damborenea C, Rogers DC & Thorp T (ed) Thorp and Covich’s Freshwater Invertebrates. Keys to Neotropical and Antarctic Fauna 5:505–522. doi:10.1016/B9780-12-804225-0.00015-0. page 22 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. 2015. IQTREE: a fast and effective stochastic algorithm for estimating maximum likelihood phylogenies. Mol Biol Evol 32:268–274. doi:10.1093/molbev/msu300. Özdikmen H. 2008. Bertolanius nom. nov., a replacement name for the genus Amphibolus Bertolani, 1981 (Tardigrada: Parachela) with type species designation. Mun Ent Zool 3:330–332. Pilato G. 1981. Analisi di nuovi caratteri nello studio degli Eutardigradi. Animalia 8:51–57. Pilato G, Binda MG. 2010. Definition of families, subfamilies, genera and subgenera of the Eutardigrada, and keys to their identification. Zootaxa 2404:1–52. doi:10.11646/zootaxa.2124.1.1. Pilato G, Binda MG. 1994. Dactylobiotus caldarellai, nuova specie di eutardigrado della Terra del Fuoco. Animalia 21:87–91. Pilato G, Catanzaro R. 1988. Macroversum mirum n.gen. n. sp. nuovo eutardigrado dei Monti Nebrodi (Sicilia). Animalia 15:175–180. Pilato G. 1981. Analisi di nuovi caratteri nello studio degli eutardigradi. Animalia 8:51–57. Pogwizd J, Stec D. 2020. New records of Dactylobiotus parthenogeneticus Bertolani, 1982 provide insight into its genetic variability and geographic distribution. Folia Biologica (Kraków) 68:57–72. doi:10.3409/fb_68-2.08. Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA. 2018. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Syst Biol 67:901–904. doi:10.1093/sysbio/syy032. Richters F. 1926. Tardigrada. In: Kükenthal W, Krumbach T, eds. Handbuch der Zoologie, Vol. III. Berlin and Leipzig: Walter de Gruyter & Co, pp. 58–61. Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574. doi:10.1093/bioinformatics/btg180. Sands CJ, McInnes SJ, Marley NJ, Goodall-Copestake W, Convey P, Linse K. 2008 Phylum Tardigarda: an “individual” approach. Cladistics 24:1–18. doi:10.1111/j.1096-0031.2008.00219.x. Schuster RO, Nelson DR, Grigarick AA, Christenberry D. 1980. Systematic criteria of Eutardigrada. Trans Am Microsc Soc 99:284–303. doi:10.2307/3226004. Schuster RO, Toftner EC, Grigarick AA. 1978. Tardigrada of Pope Beach, Lake Tahoe, California. The Washmann J of Biol 35:115– 136. Stacklies W, Redestig H, Scholz M, Walther D, Selbig J. 2007. pcaMethods—a bioconductor package providing PCA methods for incomplete data. Bioinformatics 23:1164–1167. doi:10.1093/ bioinformatics/btm069. Stec D. 2022. An Integrative Description of Two New Mesobiotus Species (Tardigrada: Eutardigrada: Macrobiotidae) with Updated Genus Phylogeny. Zool Stud 61:85. doi:10.6620/ZS.2022.61-85. Stec D, Smolak R, Kaczmarek Ł, Michalczyk Ł. 2015. An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052:501–526. doi:10.11646/zootaxa.4052.5.1. Stec D, Kristensen RM, Michalczyk Ł. 2020b. An integrative description of Minibiotus ioculator sp. nov. from the Republic of South Africa with notes on Minibiotus pentannulatus Londoño et al. 2017 (Tardigrada: Macrobiotidae). Zool Anz 286:117–134. doi:10.1016/j.jcz.2020.03.007. Stec D, Vecchi M, Maciejowski W, Michalczyk Ł. 2020a. Resolving the systematics of Richtersiidae by multilocus phylogeny and an integrative redescription of the nominal species for the genus Crenubiotus (Tardigrada). Sci Rep 10:19418. doi:10.1038/ s41598-020-75962-1. Stec D, Morek W, Gąsiorek P, Michalczyk Ł. 2018. Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). Syst Biodivers 16:357–376. doi:10.1080/14772000.2 018.1424267. Stec D, Morek W, Gąsiorek P, Kaczmarek Ł, Michalczyk Ł. 2016. Determinants and taxonomic consequences of extreme egg shell variability in Ramazzottius subanomalus (Biserov, 1985) (Tardigrada). Zootaxa 4208:176–188. doi:10.11646/ zootaxa.4208.2.5. Stec D, Vecchi M, Calhim S, Michalczyk Ł. 2021. New multilocus phylogeny reorganises the family Macrobiotidae (Eutardigrada) and unveils complex morphological evolution of the Macrobiotus hufelandi group. Mol Phylogenet Evol 160:106987. doi:10.1016/ j.ympev.2020.106987. Stec D, Zawierucha K, Michalczyk Ł. 2017. An integrative description of Ramazzottius subanomalus (Biserov, 1985) (Tardigrada) from Poland. Zootaxa 4300:403–420. doi:10.11646/zootaxa.4300.3.4. Stec D, Gąsiorek P, Morek W, Kosztyła P, Zawierucha K, Michno K, Kaczmarek Ł, Prokop ZM, Michalczyk Ł. 2016a. Estimating optimal sample size for tardigrade morphometry. Zool J Linn Soc 178:776–784. doi:10.1111/zoj.12404. Tamura K, Stecher G, Kumar S. 2021. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022–3027. doi:10.1093/molbev/msab120. Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ. 2016. W-IQTREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res 44:232–235. doi:10.1093/nar/ gkw256. Thulin G. 1911. Beitrag zur Kenntnis der Tardigradenfauna Schwedens. Ark Zool Stockholm 7:1–60. Vaidya G, Lohman DJ, Meier R. 2011. SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27:171–180. doi:10.1111/j.1096-0031.2010.00329.x. Vecchi M, Tsvetkova A, Stec D, Ferrari C, Calhim S, Tumanov D. 2023. Expanding Acutuncus: Phylogenetics and morphological analyses reveal a considerably wider distribution for this tardigrade genus. Mol Phylogenet Evol 180:107707. doi:10.1016/j.ympev.2023.107707. Vecchi M, Stec D. 2024. Mitogenome of a new Ramazzottius species (Tardigrada: Eutardigrada: Ramazzottiidae) discovered in rock pools along with its temperature and desiccation-related proteins repertoire. Org Divers Evol. doi:10.1007/s13127-024-00662-x. Vecchi M, Choong H, Calhim S. 2022. A New Species of the Genus Crenubiotus (Tardigrada: Eutardigrada: Adorybiotidae) from Salt Spring Island, Strait of Georgia, British Columbia (Canada). Folia Biol Kraków 70:93–105. doi:10.3409/fb_70-3.11. Wickham H. 2011. ggplot2. Wiley interdisciplinary reviews: computational statistics 3:180–185. Wickham H, Chang W, Wickham MH. 2016. Package ‘ggplot2’. Create elegant data visualisations using the grammar of graphics. Version 2:1–189. Wold H. 1966. Estimation of principal components and related models by iterative least squares. In Multivariate Analysis (Ed., P.R. Krishnaiah), Academic Press, NY, pp. 391–420. Yang T. 1999. Three new species and six new records of the class Eutardigrada (Tardigrada) from China (Parachela: Macrobiotidae, Hypsibiidae). Acta Zootax Sin 24:444–453. Yang T. 2002. Three new species and one new record of the Tardigrada from China. Acta Hydrobiol Sin 26:505–508. page 23 of 24Zoological Studies 64:14 (2025) © 2025 Academia Sinica, Taiwan Supplementary materials SM. 1. Morphometric data for Dactylobiotus taiwanensis sp. nov. (download) SM. 2. The best evolutionary models of sequence evolution selected for phylogenetic analyses together with final raw trees. (download) SM. 3. Photomicrographs of the types of Dactylobiotus caldarellai and Dactylobiotus lombardoi. (download) SM. 4. R code for PCA analysis performed in this study. (download) SM. 5. Input data for PCA analysis performed in this study. (download) page 24 of 24Zoological Studies 64:14 (2025)