scieee AI-readable full text Open interactive document viewer

Macrobiotus naginae sp. nov., a New Xerophilous Tardigrade Species from Rokua Sand Dunes (Finland)

Vecchi, Matteo; Stec, Daniel; Calhim, Tommi Vuori Sara; Ryndov, Serge; Chartrain, Justine

Abstract

Vecchi, Matteo, Stec, Daniel, Calhim, Tommi Vuori Sara, Ryndov, Serge, Chartrain, Justine (2022): Macrobiotus naginae sp. nov., a New Xerophilous Tardigrade Species from Rokua Sand Dunes (Finland). Zoological Studies (Zool. Stud.) 61 (22): 1-15, DOI: 10.6620/ZS.2022.61-22, URL: http://dx.doi.org/10.5281/zenodo.12826994

Full text

© 2022 Academia Sinica, Taiwan Open Access Macrobiotus naginae sp. nov., a New Xerophilous Tardigrade Species from Rokua Sand Dunes (Finland) Matteo Vecchi1,* , Daniel Stec2,3 , Tommi Vuori1, Serge Ryndov1, Justine Chartrain1, and Sara Calhim1 1Department of Biological and Environmental Science, University of Jyvaskyla, PO Box 35, FI-40014 Jyvaskyla, Finland. *Correspondence: E-mail: [email protected] (Vecchi). E-mail: [email protected] (Vuori); [email protected] (Ryndov); [email protected] (Chartrain); [email protected] (Calhim) 2Institute of Systematics and Evolution of Animals, Polish Academy of Sciences, Sławkowska 17, 31-016 Kraków, Poland. E-mail: [email protected].pl (Stec) 3Institute of Zoology and Biomedical Research, Faculty of Biology, Jagiellonian University, Gronostajowa 9, 30-387 Kraków, Poland. Received 19 November 2021 / Accepted 11 March 2022 / Published 30 May 2022 Communicated by Benny K.K. Chan Animals that colonize soil show specific adaptations to soil. Compared to closely related species living on the surface, the limbs of soil-dwelling animals are often shortened, reduced, or absent to allow a less restricted passage through cavities between soil particles. This pattern of limb reduction has also been observed in tardigrades, where multiple lineages that colonized the below-ground habitat show independent reduction and/or loss of legs and claws. In the tardigrade superfamily Macrobiotoidea, leg and claw reductions are a common trait found in the Macrobiotus pseudohufelandi complex. This rarely found species complex currently contains four nominal taxa. Here we describe, with the use of integrative taxonomy, Macrobiotus naginae sp. nov., a new species in the Macrobiotus pseudohufelandi complex from inland sand dunes in Finland. We also provide a dichotomous key to the Macrobiotus pseudohufelandi complex to assist with their identification in future studies. Key words: Tardigrada, Macrobiotus pseudohufelandi complex, Sand dunes, Taxonomy, Systematics, Soil habitat. BACKGROUND Animals that live in the soil have specific adaptations. Animal species living underground in the soil show shortened, reduced, or absent limbs compared to closely related species living on the surface to allow a less restricted passage through cavities between soil particles (Villani et al. 1999). This pattern of limb reduction has also been observed in tardigrades, where multiple lineages that have colonized the belowground habitat show independent reduction and/or loss of legs and claws (Bertolani and Biserov 1996). Tolerance to desiccation is also an important adaptation when living in soil habitats with reduced amount of water (Roszkowska et al. 2021). In the tardigrade superfamily Macrobiotoidea, leg and claw reductions are found in the Macrobiotus pseudohufelandi complex as well as in the genus Pseudohexapodibius Bertolani & Biserov, 1996. The first two members of the Macrobiotus pseudohufelandi complex were described as Macrobiotus pseudohufelandi Iharos, 1966 and Parhexapodibius xerophilus Dastych, 1978. Later, Bertolani and Biserov (1996) recognized the similarities in their buccal apparatus and in the claw symmetry and erected for those two species the easily recognizable genus Xerobiotus. The third formally described species, Macrobiotus euxinus (Pilato, Kiosya, Lisi, Inshina & Biserov, 2011), was found in Ukraine and it is Citation: Vecchi M, Stec D, Vuori T, Ryndov S, Chartrain J, Calhim S. 2022. Macrobiotus naginae sp. nov., a new xerophilous tardigrade species from Rokua sand dunes (Finland). Zool Stud 61:22. doi:10.6620/ZS.2022.61-22. Zoological Studies 61:22 (2022) doi:10.6620/ZS.2022.61-22 1 © 2022 Academia Sinica, Taiwan most similar to Macrobiotus pseudohufelandi, from which it differs mainly by morphometric characters. The fourth and last described species, Macrobiotus gretae (Massa, Guidetti, Cesari, Rebecchi & Jönsson, 2021), was found in Sweden; however, molecular data confirmed its presence also in South Africa (Massa et al. 2021). Phylogenetic analyses showed that taxa previously recognized as Xerobiotus are deeply nested inside the genus Macrobiotus (Stec et al. 2020a 2021; Kiosya et al. 2021; Vecchi and Stec 2021; Stec et al. in press). Except for the specific adaptations to life in soil (reduced legs and claws), Xerobiotus taxa share with Macrobiotus the following characters: the presence of cuticular pores, identical buccal apparatus structure as well as similar sperm and egg morphology (Rebecchi 1997; Stec et al. 2021). In addition, in order for tardigrade taxonomy to reflect evolutionary relationships in the phylum, Stec et al. (2021) abolished the genus Xerobiotus and transferred its species to Macrobiotus, creating a species complex for them. Supressing Xerobiotus preserves the monophyly of Macrobiotus and expands the diagnostic features of Macrobiotus to encompass the Xerobiotus morphotype. Species of the Macrobiotus pseudohufelandi complex are usually found in uncommon substrates such as mosses growing on sandy soils or dunes. The scarcity of material (especially eggs) available for each description has led to a poor understanding of the actual species and morphological diversity in this peculiar tardigrade group. To further contribute to our understanding of the M. pseudohufelandi complex, here we describe a new species from sand dunes in inland Finland. MATERIALS AND METHODS Study area Rokua National Park is located in the North Ostrobothnia region of Finland. As one of their northernmost locations in Finland, it is a key habitat for rare and threatened esker (long, winding ridge of stratified sand and gravel) organisms (Sarala et al. 2006), including many plant species adapted to parched environments (e.g., Carex ericetorum, Thymus serpyllum serpyllum and Pilosella peleteriana, Jalas, 1953), which in turn support many lepidopteran and hymenopteran taxa (From 2005). However, Rokua’s main feature is the presence of aeolian deposits that take the form of not only eskers, but also inland sand dunes (composed by medium-fine sand with grains size 0.03–1.50 mm), kettle holes (depression in a plain formed by retreating glaciers or draining floodwaters) and kames (irregularly shaped hill or mound composed of sand, gravel and till that accumulates in a depression on a retreating glacier) (Aartolahti 1973). The dominant vegetation cover in these formations is a lichenrich forest, composed mainly of Cladonia, and to a lesser extent, Vaccinium and Calluna lichens; only a few patches of moss (Polytrichum, Pleurozium and Dicranum) co-occur (Aartolahti 1973). Finnish inland dune forests are a delicate habitat that is threatened on many fronts, chief among them being human activity and lack of forest fires (Kontula and Raunio 2018). Samples and specimens Samples of mosses, lichens, leaf litter and grass roots on different substrates (mostly on sand) were collected from Rokua National Park (Finland) on the 25th of May 2020 by M.V., J.C., S.R., and S.C. See table 1 for the sample coordinates and additional tardigrade genera found. The samples were examined for tardigrades using the sieving protocol by Dastych (1980) and the N-G Baermann extractor protocol by Czerneková et al. (2018). To perform the taxonomic analysis, animals and eggs were split into several groups for specific analyses: morphological analysis with PCM and SEM, as well as DNA sequencing (for details see Table 1). Microscopy and imaging Specimens for light microscopy were mounted on microscope slides in a small drop of Hoyer’s medium and secured with a cover slip, following the protocol by Morek et al. (2016). Slides were examined under an Olympus BX53 light microscope with phase contrast (PCM), associated with an Olympus DP74 digital camera. To obtain clean and extended specimens for SEM, tardigrades were processed according to the protocol by Stec et al. (2015). Additional specimens (n = 2) were stained with Orcein (see Bertolani 1971) and examined for the presence of sperm. Specimens were examined under high vacuum in a Raith e-LINE E-beam at the Nanoscience Center of Jyväskylä University, Finland. All figures were assembled in FigureJ (Mutterer and Zinck 2013). For structures that could not be satisfactorily focused in a single light microscope photograph, a stack of 2–6 images was taken with an equidistance of ca. 0.2 μm and assembled manually into a single deep-focus image in Corel Photo-Paint X6. Photographs of Macrobiotus gr. pseudohufelandi PL.360 and Macrobiotus gretae ZA.373 (Stec et al. 2021) claws IV were kindly provided by Witold Morek (Jagellonian University, Poland). page 2 of 15Zoological Studies 61:22 (2022) © 2022 Academia Sinica, Taiwan Morphometrics and morphological nomenclature All measurements are given in micrometres (μm). Sample size was adjusted following recommendations by Stec et al. (2016). Structures were measured only if their orientation was suitable. Body length was measured from the anterior extremity to the end of the body, excluding the hind legs. The terminology used to describe oral cavity armature and eggshell morphology follows Michalczyk and Kaczmarek (2003) and Kaczmarek and Michalczyk (2017). Macroplacoids length sequence is given according to Kaczmarek et al. (2014). Buccal tube length and the level of the stylet support insertion point were measured according to Pilato (1981). The pt index is the ratio of the length of a given structure to the length of the buccal tube (Pilato 1981). Measurements of buccal tube widths, heights of claws and eggs follow Kaczmarek and Michalczyk (2017). Morphometric data were handled using the “Parachela” ver. 1.7 template available from the Tardigrada Register (Michalczyk and Kaczmarek 2013). The raw morphometric data are provided as the supplementary materials (Table S1). Tardigrade taxonomy follows Bertolani et al. (2014) and Stec et al. (2021). Genotyping The DNA was extracted from individual animals following a Chelex® 100 resin (BioRad) extraction method by Casquet et al. (2012) with modifications described in detail in Stec et al. (2020b). Each specimen was mounted in water and examined under a light microscope to verify the identification prior to DNA extraction. We sequenced four DNA fragments, three nuclear (18S rRNA, 28S rRNA, ITS2) and one mitochondrial (COI). All fragments were amplified and sequenced according to the protocols described in Stec et al. (2020b); primers with original references are listed in table 2. Sequencing products were read with the ABI 3130xl sequencer in the Molecular Ecology Lab, Institute of Environmental Sciences of the Jagiellonian University, Kraków, Poland. Sequences were processed in MEGA7 (Kumar et al. 2016) and submitted to NCBI GenBank (Table 3). Phylogenetic analysis The phylogenetic analyses were conducted using concatenated 18S rRNA + 28S rRNA + ITS–2 + COI sequences. All Macrobiotidae isolates/strains with the 4 sequenced markers present in GenBank were included Table 1. Analysed samples containing Macrobiotus naginae sp. nov. Square brackets indicate the number of analysed specimens [animals + eggs]. All sampling sites are at about 60 m a.s.l. Sample code Coordinates Macrobiotus naginae sp. nov. material analysed Substrate Other taxa found S226 64°34'36.4"N 26°29'46.1"E PCM (Holotype + Paratypes) [6+2] + SEM [11+3] + Orcein [2+0] + DNA [2+0] Moss on sand S227 64°35'06.3"N 26°30'45.0"E PCM (Paratypes) [18+5] Moss on sand S228 64°35'06.5"N 26°30'46.6"E PCM (Paratypes) [1+0] Moss on sand Milnesium S232 64°34'30.3"N 26°31'34.5"E PCM (Paratypes) [2+0] Moss on sand Macrobiotus S233 64°34'28.8"N 26°31'31.7"E PCM (Paratypes) [2+0] Moss and lichen on sand Macrobiotus S235 64°34'27.5"N 26°31'38.3"E PCM (Paratypes) [2+0] Moss on sand S245 64°34'26.2"N 26°31'38.5"E PCM (Paratypes) [5+0] Moss and lichen on sand Minibiotus S246 64°34'41.1"N 26°31'09.9"E PCM (Paratypes) [6+0] Lichen on sand S247 64°34'41.2"N 26°31'10.1"E PCM (Paratypes) [8+0] Moss on sand S248 64°34'44.9"N 26°31'07.0"E PCM (Paratypes) [10+0] Lichen on sand S249 64°34'46.3"N 26°31'06.5"E PCM (Paratypes) [9+0] Moss and lichen on sand page 3 of 15Zoological Studies 61:22 (2022) © 2022 Academia Sinica, Taiwan in the analysis. In addition, all sequences from members of Macrobiotus clade B (sensu Stec et al. 2021) were included. Sequences from Adorybiotidae, Murrayidae and Richtersiusidae were used as outgroups. Additional Macrobiotidae populations were sequenced for the four markers to improve the phylogenetic reconstruction (in Table S2). GenBank accession numbers of the newly generated sequences are presented in table 2. Accession numbers of sequences downloaded from GenBank are listed in table S3. The sequences of the 18S and 28S markers did not completely overlap (thus creating problems in the alignment phase), so they had to be aligned to reference alignments. The reference alignments were generated by downloading the longest available sequences for tardigrades on GenBank and aligned using MAFFT ver. 7 (Katoh et al. 2002; Katoh and Toh 2008) with the G-INS-i method (thread = 4, threadtb = 5, threadit = 0, reorder, adjust direction, any symbol, max iterate = 1000, retree 1, global pair input). Reference alignments are available as appendixes 1 and 2. The sequences to be analysed were then aligned to the corresponding reference alignment using MAFFT ver. 7 with the L-INS-i method (thread = 8, adjustdirection, ep = 0.0, add new_sequences, localpair, maxiterate = 16). The ITS-2 sequences were aligned using MAFFT ver. 7 (Katoh et al. 2002; Katoh and Toh 2008) with the G-INS-i method (thread = 4, threadtb = 5, threadit = 0, reorder, adjust direction, any symbol, max iterate=1000, retree = 1, global pair input). The COI sequences were aligned according to their amino acid sequences (translated using the invertebrate mitochondrial code) with the MUSCLE algorithm (Edgar 2004) in MEGA7 with default settings (all gap penalties = 0, max iterations = 8, clustering method = UPGMB, lambda = 24). Alignments were visually inspected and trimmed in MEGA7. Sequences were concatenated with the R package ‘concatipede’ v1.0.0 (Vecchi and Bruneaux 2021). Model selection was performed for each alignment partition (6 in total: 18S rRNA, 28S rRNA, ITS-2 and three COI codons) with PartitionFinder2 (Lanfear Table 2. Primers with their original references used for amplification of the four DNA fragments sequenced in the study DNA marker Primer name Primer direction Primer sequence (5’-3’) Primer source 18S rRNA 18S_Tar_Ff1 forward AGGCGAAACCGCGAATGGCTC Stec et al. (2017) 18S_Tar_Rr1 reverse GCCGCAGGCTCCACTCCTGG 28S rRNA 28S_Eutar_F forward ACCCGCTGAACTTAAGCATAT Gąsiorek et al. (2018) Mironov et al. (2012) 28SR0990 reverse CCTTGGTCCGTGTTTCAAGAC ITS-2 ITS2_Eutar_Ff forward CGTAACGTGAATTGCAGGAC Stec et al. (2018) ITS2_Eutar_Rr reverse TCCTCCGCTTATTGATATGC COI LCO1490-JJ forward CHACWAAYCATAAAGATATYGG Astrin and Stüben (2008) HCO2198-JJ reverse AWACTTCVGGRTGVCCAAARAATCA Table 3. Newly generated sequences GenBank accession numbers 18S 28S COI ITS2 Macrobiotus naginae sp. nov. S226-01 OK663219 OK663230 OK662990 OK663209 Macrobiotus naginae sp. nov. S226-02 OK663220 OK663231 OK662991 OK663208 Macrobiotus hufelandi S605-1 OK663221 OK663232 OK662992 OK663210 Macrobiotus hufelandi S605-2 OK663222 OK663233 OK662993 OK663211 Macrobiotus sandrae S859-1 OK663223 OK663234 OK662994 OK663212 Macrobiotus cf. sapiens S12-1 OK663226 OK663237 OK662997 OK663215 Macrobiotus scoticus DK.056-1 OK663218 OK663228 OK662989 OK663207 Macrobiotus scoticus DK.056-2 OK663217 OK663229 OK662988 OK663206 Minibiotus cf. diversus S69-1 OK663227 OK663238 * OK663216 Paramacrobiotus richtersi S38-1 OK663224 OK663235 OK662995 OK663213 Paramacrobiotus spatialis S107-1 OK663225 OK663236 OK662996 OK663214 Notes: * See table S3. page 4 of 15Zoological Studies 61:22 (2022) © 2022 Academia Sinica, Taiwan et al. 2016), partitions and models selection process and results are present in appendix 3. BI phylogenetic reconstruction was done with MrBayes v3.2.6 (Ronquist et al. 2012) without BEAGLE on the CIPRES Science Gateway (Miller et al. 2010). Two runs with one cold chain and three heated chains were run for 25 million generations with a burning of 2.5 million generations, sampling a tree every 1000 generations. Posterior distribution sanity was checked with the Tracer v1.7 (Rambaut et al. 2018). MrBayes input file with the input alignment is available as appendix 4. The phylogenetic tree was visualized with FigTree v1.4.4 (Rambaut 2007) and the image was edited with Inkscape 0.92.3 (Bah 2011). The complete phylogenetic tree is available in appendix 5. Species delimitation Only a subset of the COI alignment containing the species of the Macrobiotus pseudohufelandi complex + Mac. annewintersae + Mac. polonicus AT.002 was used for species delimitation, which was performed on the K80 distance matrix of the alignment with the ABGD online server (Puillandre et al. 2012) with default parameters (Pmin = 0.001, Pmax = 0.1, Steps = 10, X = 1.5, TS/TV = 2.0, Nb bins = 20). Results are available as appendix 6. RESULTS Species delimitation and phylogenetic reconstruction The phylogenetic reconstruction (Fig. 1) recovered the same overall topology of Stec et al. (2021), with the genus Macrobiotus and its three clades (A, B and C) being monophyletic. However, the relationships Fig. 1. Phylogenetic reconstruction of Macrobiotidae based on four concatenated markers (18S + 28S + COI + ITS2). Boxes delimit species of the Macrobiotus pseudohufelandi complex identified by ABGD performed on the COI alignment. Outgroups not shown. Values above branches represent node posterior probabilities (pp). pp = 1 not shown. All nodes with pp < 0.70 were collapsed. page 5 of 15Zoological Studies 61:22 (2022) © 2022 Academia Sinica, Taiwan between these three clades are different from Stec et al. (2021) as clade A and C are in a sister relationship. In addition, the persimilis complex was not recovered to be monophyletic. The pseudohufelandi group is confirmed to be nested inside Macrobiotus and basal in clade B. The ABGD species delimitation recovered the presence of four species among all the Macrobiotus pseudohufelandi complex sequences used (Fig. 1). Those species form a well-supported (posterior probability (pp) = 1, Fig. 1) monophyletic group with respect to the outgroups. Macrobiotus gretae appears have a sister relationship with a clade comprising all other species. The two newly sequenced individuals from Finland are most closely related to an unidentified species from Poland (Macrobiotus sp. pseudohufelandi complex PL.360). TAXONOMIC ACCOUNT Phylum: Tardigrada Doyère, 1840 Class: Eutardigrada Richters, 1926 Order: Parachela Schuster, Nelson, Grigarick and Christenberry, 1980 Superfamily: Macrobiotoidea Thulin, 1928 (in Marley et al. 2011) Family: Macrobiotidae Thulin, 1928 Genus: Macrobiotus Schultze C.A.S., 1834 Macrobiotus naginae sp. nov. Vecchi, Stec, Vuori, Ryndov, Chartrain and Calhim (Figs. 2–6; Tables 4–5; Table S1) urn:lsid:zoobank.org:act:53E10ACB-6DAA-4E63-B2635919B00FDF3C Material examined: 47 animals and 10 eggs. Specimens mounted on microscope slides in Hoyer’s medium (34 animals + 7 eggs), fixed on SEM stubs (11 + 3), and processed for DNA sequencing (2+0). Type locality: 64°34'36.4"N 26°29'46.1"E; 37 m a.s.l.; Rokua National Park, Utajärvi, Finland; moss on sand; coll. 25th of May 2020 by Matteo Vecchi, Sara Calhim, Justine Chartrain and Serge Ryndov. Type repository: Holotype (S226.SL1.F with 5 paratypes), 74 paratypes (slides S227.SL1, S228.SL1, S232.SL1, S233.SL1, S235.SL1, S245.SL1, S246.SL1, S247.SL1, S248.SL1, S249.SL1; SEM stubs S2261t) and 12 eggs (slides S226.SL.2–3, S227.SL.2–4; SEM stub S226-e1) are deposited at the Department of Biological and Environmental Sciences, University of Jyväskylä (Survontie 9C, 40500, Jyväskylä, Finland). Etymology: Named after J. K. Rowling’s Harry Potter book series character Nagini – Lord Voldemort’s treasured snake companion. Formerly a cursed woman who is ultimately and irreversibly transformed into a limbless beast, this fictional character provides a fitting name for the new species in the pseudohufelandi complex, which in turn is characterized by reduced legs and claws. Species description: Animals (measurements and statistics in Table 4): In live animals, body opaque whitish; transparent after fixation in Hoyer’s medium (Fig. 2A). Eyes present in live animals and after fixation in Hoyer’s medium. Cuticular pores weakly visible in PCM, and very visible in SEM (Figs. 2B–C, 3A–B) present on the dorsal surface of body and legs. Under PCM no granulation visible on legs. Few pores present on legs (Fig. 3A–B). Garter-like structure (as defined by Massa et al. 2021) covered with microgranulation present on all legs (Fig. 3). Claws reduced, Y-shaped, of the Xerobiotus type (Pilato and Binda 2010) without lunulae or cuticular thickenings at the base (Fig. 4). Cuticular bars associated with claws I–III absent. Mouth anteroventral. Buccopharyngeal apparatus of the Macrobiotus type (Fig. 5A), with ventral lamina and ten small peribuccal lamellae. Pharyngeal bulb spherical, with triangular apophyses, three anterior cuticular spikes (typically only two are visible in any given plane; Fig. 5C), two rod-shaped macroplacoids and a drop-shaped microplacoid (Fig. 5A). The macroplacoid length sequence is 2 < 1. The first and the second macroplacoid have a weak central and subterminal constriction, respectively (Fig. 5B–C). Under PCM, the oral cavity armature is of the maculatus type, i.e., with only the third band of teeth visible (Fig. 5D–G). The third band of teeth is divided into a dorsal and ventral portion. Under PCM, the dorsal teeth are composed of three distinct transverse ridges (Fig. 5D–E). The ventral teeth appear as two separate lateral transverse ridges between which one or two small medial teeth (roundish in PCM) are visible (Fig. 5F–G). Eggs (measurements and statistics in Table 5): Eggs round, whitish and laid freely in the environment (Fig. 6A, B and G). The surface between processes is of the hufelandi type, i.e., covered with a reticulum (Fig. 6E–F). The meshes of the reticulum are uniform in size and evenly distributed on the egg surface between the processes. Bars and nodes of the reticulum are usually thicker/wider than the meshes diameter that ranges from about 0.15 to 0.30 µm. The pillars connecting the reticulum with the chorion surface are visible only in SEM. Thickening surrounding process bases are poorly marked/visible and merge gently into the bars and nodes of the reticulum. An internal septum between the process trunk and the terminal disc is visible in PCM (Fig. 6C). Processes are of the hufelandi type with a concave trunk and a relatively small and concave page 6 of 15Zoological Studies 61:22 (2022) © 2022 Academia Sinica, Taiwan terminal disc. The terminal disk is greatly indented on the disk margin, creating evident teeth that have thickened and rounded tips and resemble short, nodular, finger-like apices (Fig. 5C–D). Sometimes these nodular finger-like apices are also present in the central area of the terminal disk, giving the disk a convex impression. Under SEM, the surface nodular apices/teeth in terminal discs are covered by microgranules (Fig. 6D and F). Reproduction: The species is dioecious. Sperm with corkscrew shaped nucleus (Fig. 6H). Spermathecae present in females (Fig. 6I). DNA sequences DNA sequences of four markers were obtained for two individuals. Their GenBank accession numbers are: 18S: OK663219, OK663220. 28S: OK663230, OK663231. COI: OK662990, OK662991. ITS2: OK663208, OK663209. DISCUSSION Evolution of leg adaptations Now that there are sufficient molecular and morphological data on the Macrobiotus pseudohufelandi complex, one can discuss potential hypotheses regarding the evolution of this group’s peculiar Table 4. Measurements [in µm] of selected morphological structures of individuals of Macrobiotus naginae sp. nov. mounted in Hoyer’s medium Character N Range Mean SD Holotype µm pt µm pt µm pt µm pt Body length 29 292–472 900–1209 394 1075 43 81 451 1171 Buccal tube Buccal tube length 30 30.3–39.9 - 36.7 - 2.3 - 38.5 - Stylet support insertion point 30 23.2–32.1 76.4–81.0 28.6 77.9 2.0 1.2 30.9 80.3 Buccal tube external width 30 3.3–4.9 10.5–13.0 4.3 11.8 0.4 0.6 4.8 12.4 Buccal tube internal width 30 2.0–3.3 6.5–8.7 2.8 7.6 0.3 0.6 3.3 8.7 Ventral lamina length 25 18.3–25.9 53.0–69.1 22.3 61.2 1.9 3.7 23.7 61.6 Placoid lengths Macroplacoid 1 30 5.2–8.9 15.6–22.8 6.8 18.5 0.9 2.0 8.4 21.9 Macroplacoid 2 30 3.7–5.4 11.5–14.6 4.8 13.0 0.4 0.7 4.7 12.2 Microplacoid 30 1.3–2.7 3.7–7.0 1.8 5.0 0.4 0.8 1.9 5.0 Macroplacoid row 30 10.3–17.7 30.1–46.0 12.7 34.7 1.6 3.2 17.7 46.0 Placoid row 30 11.5–19.3 31.2–48.4 15.1 41.0 1.6 3.1 14.7 38.3 Claw I heights External primary branch 30 5.3–7.9 13.8–20.4 6.7 18.2 0.6 1.5 7.2 18.8 External secondary branch 27 3.8–6.1 9.8–16.0 5.1 13.8 0.7 1.6 5.6 14.5 Internal primary branch 30 4.9–7.8 12.6–20.8 6.5 17.8 0.7 1.6 7.4 19.1 Internal secondary branch 30 3.6–5.8 10.6–15.1 4.8 12.9 0.6 1.2 5.0 13.0 Claw II heights External primary branch 30 5.4–7.9 14.7–22.0 6.8 18.6 0.6 1.7 7.7 19.9 External secondary branch 28 3.6–6.2 9.9–16.4 5.0 13.6 0.6 1.5 4.4 11.4 Internal primary branch 28 5.0–8.2 15.4–21.4 6.8 18.6 0.7 1.6 7.4 19.2 Internal secondary branch 26 3.0–6.1 9.9–16.3 4.8 13.1 0.7 1.7 4.9 12.6 Claw III heights External primary branch 28 5.9–8.1 17.0–21.8 7.1 19.4 0.6 1.3 7.3 18.9 External secondary branch 26 3.5–5.7 9.4–15.5 4.7 13.0 0.6 1.5 5.7 14.7 Internal primary branch 28 5.5–7.7 16.0–21.6 6.8 18.6 0.6 1.4 7.0 18.3 Internal secondary branch 25 3.7–6.0 10.6–16.3 5.0 13.7 0.6 1.4 4.9 12.8 Claw IV heights Anterior primary branch 30 4.6–7.4 12.7–20.2 6.3 17.1 0.8 1.8 7.4 19.1 Anterior secondary branch 29 3.3–5.5 8.9–14.7 4.5 12.3 0.6 1.5 4.4 11.5 Posterior primary branch 30 4.6–7.4 13.8–19.7 6.3 17.2 0.7 1.5 6.5 16.8 Posterior secondary branch 29 3.2–5.7 9.1–15.1 4.7 12.7 0.7 1.7 3.9 10.2 N, number of specimens/structures measured; Range refers to the smallest and the largest structure among all measured specimens; SD, standard deviation. page 7 of 15Zoological Studies 61:22 (2022) © 2022 Academia Sinica, Taiwan Fig. 3. Macrobiotus naginae sp. nov. – cuticular structures on legs: A, garter-like structure on leg II under PCM; B, garter-like structure on leg III under PCM; C, garter-like structures and claws III under SEM. Flat arrowheads indicate pores on the leg cuticle, flat empty arrowheads indicate garter-like structures. Scale bars: A–B = 20 μm; C = 10 μm. Fig. 2. Macrobiotus naginae sp. nov. – habitus and cuticular pores: A, dorsoventral view of the body (Holotype; Hoyer’s medium, PCM); B–C, cuticular pores on the dorsal part of the body under PCM (B) and under SEM (C). Flat arrowheads indicate pores on the dorsocaudal cuticle. Scale bars: A = 100 mm; B–C = 10 mm. page 8 of 15 Zoological Studies 61:22 (2022) © 2022 Academia Sinica, Taiwan adaptations to the soil dwelling lifestyle. Among the species for which we have molecular data, Mac. gretae is not only the most basal in the group, but also the one with the fewest marked claw modifications. A general trend can be observed on the phylogenetic tree of this group, with the ancestral condition being the presence of lunules on the fourth pair of legs [Mac. gretae (Fig. 7A) and Mac. pseudohufelandi], and their loss in the more derived clades, [Mac. gr. pseudohufelandi PL.360 (Fig. 7B) and Mac. naginae]. Unfortunately, any formal analysis of such evolutionary patterns requires sequence data for more species. Nonetheless, an approximate phylogenetic position for the remaining nominal taxa within this complex can be deduced despite lacking the genetic data associated with these species. We believe that such predictions may stimulate future hypothesisbased research on the M. pseudohufelandi complex. For example, Mac. euxinus is hypothesized to be the closest relative of Mac. pseudohufelandi based on morphometric and morphological similarity. Conversely, Mac. xerophilous lacks lunules IV and therefore could be a close relative of Mac. naginae sp. nov. and Mac. gr. pseudohufelandi PL.360. Lastly, Pseudohexapodibius degenerans (Biserov, 1990) differs from the Mac. pseudohufelandi complex only in its lack of claws on the fourth pair of legs. It is possible, therefore, that this species represents an even more derived branch of the Mac. pseudohufelandi complex and could even be assigned to Macrobiotus. Nevertheless, new material, preferably in the form of integrative redescription, is needed to solve this issue. Biogeography Until the recent record of a population Mac. gretae from South Africa (Stec et al. 2021 2022), the Mac. pseudohufelandi complex seemed to be limited to the European continent, with one exception in Tunisia (McInnes 1994). The latter highlights how biased research efforts (due mostly to the historical location of tardigrade taxonomists) influence our knowledge biogeographical patterns of tardigrades. Since most records of the species belonging to the Mac. pseudohufelandi complex, including the current one, are from mosses on sandy substrates (see e.g., Bertolani et al. 1987; Rebecchi 1991), a comprehensive and Fig. 4. Macrobiotus naginae sp. nov. – claws: A–B, claws I and IV, respectively, under PCM; C, claws IV under SEM. Flat arrowhead indicates an abnormal additional spur on the base on anterior claw IV; flat empty arrowheads indicate accessory points on primary branches. Scale bars = 10 μm. page 9 of 15Zoological Studies 61:22 (2022)