List of NDD candidate genes - Insitute of Human Genetics in Leipzig, Germany
Abstract
This dataset is a list a NDD candidate genes which was created by the Institute of Human Genetics, University of Leipzig Medical Center in Leipzig, Germany on 3rd of December 2025.
Full text
HGNC_Symbol Variant1FullName Variant2FullName Inheritance AutoCaSc Zygosity Origin Number_Ca ndidates_In _Family DiseaseGro up_Leadin gSymptom HPO_Main_Terms GLS NM_001256310.1:c.695dupp.(Asp232Glufs*2) AR_homo 12.4 homo maternal& paternal 1 NDD + Epilepsy Seizures, Status epilepticus, Infantile onset, Infantile spasms, Epileptic encephalopathy DGKZ NM_001199266.1:c.3227C>Gp.(Thr1076Arg) NM_001199266.1:c.3326A>Gp.(Gln1109Arg) AR_comphet 3.7 comphet maternal& paternal 1 NDD + Epilepsy Epileptic encephalopathy, Seizures, Failure to thrive, Hypoplasia of the corpus callosum, Hypsarrhythmia, Infantile onset, muscular hypotonia, DUT XM_005254212.1:c.218T>Cp.(Val73Ala) AD_denovo 7.6 het de novo 1 NDD + Epilepsy Retrognathia, Myoclonus, EEG abnormality, Infantile encephalopathy, Epileptic encephalopathy GLS NM_001256310.1:c.815G>Ap.(Arg272Lys) NM_001256310.1:c.241C>Tp.(Gln81*) AR_comphet 10.7 comphet maternal& paternal 1 NDD + Epilepsy Microcephaly, Seizures, Status epilepticus, CNS demyelination, EEG with burst suppression, Peripheral demyelination, Epileptic encephalopathy PLXNB3 NM_001163257.1:c.4343C>Ap.(Thr1448Asn) AD_denovo 7.1 het de novo 2 NDD Hydrocephalus, Intellectual disability, hypotonia, Global developmental delay, Atria septal defect, Patent ductus arteriosus,Transposition of the great arteries with ventricular septal defect GBP5 NM_001134486.2:c.154T>Cp.(Ser52Pro) NM_001134486.2:c.502_505dupp.(Ser169*) AR_comphet 5.0 comphet maternal& paternal 2 NDD Hydrocephalus, Intellectual disability, hypotonia, Global developmental delay, Atria septal defect, Patent ductus arteriosus,Transposition of the great arteries with ventricular septal defect GRIN3B NM_138690.1:c.1811C>Tp.(Thr604Met) NM_138690.1:c.2114A>Cp.(Tyr705Ser) AR_comphet 6.1 comphet maternal& paternal 1 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Hypsarrhythmia, Infantile onset, CLSTN1 NM_001009566.1:c.1844C>Tp.(Thr615Met) AR_homo 8.1 homo maternal& paternal 2 NDD Cataract, Peters anomaly, Autism, Global developmental delay CASP9 NM_001229.4:c.868+5G>Cp.? AR_homo 8.8 homo maternal& paternal 2 NDD Cataract, Peters anomaly, Autism, Global developmental delay PUM2 NM_015317.1:c.1595G>Ap.(Ser532Asn) AD_denovo 7.6 het de novo 1 NDD + Epilepsy Seizures, Global developmental delay, Hypsarrhythmia, CARMIL1 XM_005249221.1:c.3617C>Tp.(Ser1206Leu) XM_005249221.1:c.2659G>Ap.(Glu887Lys) AR_comphet 3.5 comphet maternal& paternal 1 NDD + Epilepsy Microcephaly, Delayed puberty, Abnormality of skin pigmentation, Seizures, Agenesis of corpus callosum, Growth delay, Intellectual disability, Limb hypertonia, Scoliosis, Chorioretinal lacunae, Muscular hypotonia of the trunk, Infantile axial hypotonia, Infantile spasms, Small hand SMCR8 NM_144775.2:c.2404C>Tp.(Arg802Cys) AD_denovo 4.7 het de novo 2 NDD Microcephaly, Epicanthus, Intellectual disability, Global developmental delay, Plagiocephaly, Abnormal facial shape, Wide nasal base FRMPD3 XM_042978.8:c.3538C>Tp.(Arg1180Trp) XL 3.3 hemi maternal 2 NDD Microcephaly, Epicanthus, Intellectual disability, Global developmental delay, Plagiocephaly, Abnormal facial shape, Wide nasal base PUM1 NM_001020658.1:c.3439C>Tp.(Arg1147Trp) AD_denovo 9.5 het de novo 2 NDD Global developmental delay, Microcephaly, Cryptorchidism, Ptosis, Short stature, Short phalanx of finger, Frontal hirsutism, Arachnoid cyst BAIAP3 NM_001199096.1:c.892G>Tp.(Gly298Trp) AD_denovo 5.9 het de novo 2 NDD Global developmental delay, Microcephaly, Cryptorchidism, Ptosis, Short stature, Short phalanx of finger, Frontal hirsutism, Arachnoid cyst PSMB3 NM_002795.2:c.424T>Cp.(Cys142Arg) AD_denovo 4.7 het de novo 1 NDD Trismus, Arthrogryposis multiplex congenita, Vesicoureteral reflux, Abnormality of the kidney, abnormal facial shape, Global developmental delay VPS4A NM_013245.2:c.291T>Gp.(Ser97Arg) AD_denovo 7.3 het de novo 2 NDD + Epilepsy Intellectual disability, Seizures, Epileptic encephalopathy TAB3 NM_152787.3:c.1952A>Gp.(Gln651Arg) XL 3.9 hemi maternal 2 NDD + Epilepsy Intellectual disability, Seizures, Epileptic encephalopathy PPP1R37 NM_019121.1:c.509C>Tp.(Ser170Phe) AD_denovo 6.0 het de novo 2 NDD Bilateral cryptorchidism, Short stature, Epileptic encephalopathy, Microcephaly AQP6 NM_001652.3:c.146C>Tp.(Pro49Leu) AD_denovo 5.2 het de novo 2 NDD Bilateral cryptorchidism, Short stature, Epileptic encephalopathy, Microcephaly IRAK1 NM_001025242.1:c.609T>Gp.(Cys203Trp) AD_denovo 6.1 het de novo 2 NDD + Epilepsy Intellectual disability, Seizures, Generalized myoclonic seizures, Infantile onset MED22 NM_133640.4:c.397_399delp.(Glu133del) AR_homo 5.6 homo maternal& paternal 1 NDD + Epilepsy Seizures, Global developmental delay, Microcephaly, Hearing impairment, Visual impairment, Intellectual disability, GTPBP2 NM_019096.3:c.1191C>Ap.(Asn397Lys) AD_denovo 7.1 het de novo 1 NDD Tall stature, Macrocephaly, Retrognathia, High forehead, Low-set ears, Global developmental delay
NCOA2 NM_006540.2:c.1454T>Cp.(Met485Thr) NM_006540.2:c.3509T>Cp.(Met1170Thr) AR_comphet 6.1 comphet maternal& paternal 1 NDD Intellectual disability, Seizures, Encephalopathy, Cerebral atrophy, Intellectual disability, profound, EEG abnormality, Intellectual disability, severe, Cognitive impairment SPEN NM_015001.2:c.8092A>Gp.(Asn2698Asp) AD_denovo 8.0 het de novo 2 NDD Microcephaly, Underdeveloped nasal alae, Strabismus, Intellectual disability, Muscular hypotonia, Global developmental delay, Motor delay, Postnatal microcephaly BOK NM_032515.4:c.356C>Tp.(Thr119Met) AD_denovo 5.6 het de novo 2 NDD Microcephaly, Underdeveloped nasal alae, Strabismus, Intellectual disability, Muscular hypotonia, Global developmental delay, Motor delay, Postnatal microcephaly ENOX2 NM_006375.2:c.148A>Gp.(Met50Val) XL 3.3 hemi maternal 2 NDD Microcephaly, Underdeveloped nasal alae, Strabismus, Intellectual disability, Muscular hypotonia, Global developmental delay, Motor delay, Postnatal microcephaly CHD5 NM_015557.2:c.5003-5G>Ap.? NM_015557.2:c.5249C>Tp.(Thr1750Met) AR_comphet 5.3 comphet maternal& paternal 3 NDD Autism, Intellectual disability, Global developmental delay HDAC4 NM_006037.3:c.1663G>Ap.(Gly555Ser) AD_inherited 6.7 het maternal 3 NDD Autism, Intellectual disability, Global developmental delay SLC10A3 NM_001142391.1:c.1160C>Tp.(Thr387Met) XL 5.0 hemi maternal 3 NDD Autism, Intellectual disability, Global developmental delay WBP1 NM_012477.3:c.25G>Ap.(Gly9Ser) AD_denovo 3.8 het de novo 1 NDD + Epilepsy Seizures, Generalized tonic-clonic seizures, Atonic seizures DUX4L4 NM_001177376.2:c.880C>Tp.(Gln294*) AD_denovo 7.0 het de novo 1 NDD Microcephaly, Intellectual disability, Global developmental delay, Short stature TEX44 NM_152614.2:c.1146C>Gp.(His382Gln) AD_denovo 4.9 het de novo 1 NDD mild global developmental delay, delayed speech and language development ASIC1 NM_001095.3:c.363-2A>Gp.? AD_denovo 10.2 het de novo 3 NDD + Epilepsy Seizures, Abnormal social behavior, Epileptic encephalopathy FAM168B NM_001009993.2:c.452G>Ap.(Gly151Glu) AD_denovo 6.5 het de novo 3 NDD + Epilepsy Seizures, Abnormal social behavior, Epileptic encephalopathy COL20A1 NM_020882.2:c.3402+5C>Tp.? NM_020882.2:c.1662C>Tp.(=) AR_comphet 2.7 comphet maternal& paternal 3 NDD + Epilepsy Seizures, Abnormal social behavior, Epileptic encephalopathy SPEN NM_015001.2:c.3968T>Gp.(Met1323Arg) AD_denovo 8.1 het de novo 3 NDD + Epilepsy mild global developmental delay, seizures, heterotopia, oral cleft, tall stature, obesity CSMD1 NM_033225.5:c.7327A>Gp.(Ile2443Val) NM_033225.5:c.8444A>Cp.(Glu2815Ala) AR_comphet 5.3 comphet maternal& paternal 3 NDD + Epilepsy mild global developmental delay, seizures, heterotopia, oral cleft, tall stature, obesity CENPV NM_181716.2:c.75_92delp.(Ala26_Ala31del) AD_denovo 5.4 het de novo 3 NDD + Epilepsy mild global developmental delay, seizures, heterotopia, oral cleft, tall stature, obesity CACNB4 NM_000726.3:c.848C>Tp.(Ser283Leu) AD_denovo 9.5 het de novo 5 NDD + Epilepsy Seizures, Global developmental delay, Generalized clonic seizures KLHL17 NM_198317.2:c.1568C>Tp.(Ala523Val) AR_homo 5.2 homo maternal& paternal 5 NDD + Epilepsy Seizures, Global developmental delay, Generalized clonic seizures POLR2A NM_000937.4:c.4808G>Ap.(Arg1603His) NM_000937.4:c.778G>Ap.(Val260Met) AR_comphet 6.1 comphet maternal& paternal 5 NDD + Epilepsy Seizures, Global developmental delay, Generalized clonic seizures PNMA3 NM_013364.4:c.82G>Ap.(Glu28Lys) XL 2.9 hemi maternal 5 NDD + Epilepsy Seizures, Global developmental delay, Generalized clonic seizures ZNF12 NM_006956.2:c.670T>Cp.(Ser224Pro) NM_006956.2:c.1438G>Ap.(Val480Ile) AR_comphet 3.1 comphet maternal& paternal 5 NDD + Epilepsy Seizures, Global developmental delay, Generalized clonic seizures CASKIN1 NM_020764.3:c.4103G>Ap.(Ser1368Asn) AR_homo 7.8 homo maternal& paternal 3 NDD global developmental delay, absent speech, gait disturbance, EEG abnormality, decreased body weight CELSR2 NM_001408.2:c.4706C>Tp.(Pro1569Leu) NM_001408.2:c.8629G>Ap.(Gly2877Ser) AR_comphet 7.6 comphet maternal& paternal 3 NDD global developmental delay, absent speech, gait disturbance, EEG abnormality, decreased body weight
FAT3 NM_001008781.2:c.3669+7G>Ap.? NM_001008781.2:c.12922G>Cp.(Asp4308His) AR_comphet 4.5 comphet maternal& paternal 3 NDD + Epilepsy Autism, Seizures, Global developmental delay, Motor delay, Absent speech, Epileptic encephalopathy MADD NM_001135943.1:c.1037T>Cp.(Leu346Pro) AR_homo 9.6 homo maternal& paternal 3 NDD global developmental delay, absent speech, gait disturbance, EEG abnormality, decreased body weight CHMP7 NM_152272.3:c.214C>Ap.(Leu72Met) AD_denovo 6.0 het de novo 3 NDD + Epilepsy Autism, Seizures, Global developmental delay, Motor delay, Absent speech, Epileptic encephalopathy ANKFY1 NM_001257999.1:c.1966G>Ap.(Ala656Thr) AR_homo 5.5 homo maternal& paternal 3 NDD + Epilepsy Autism, Seizures, Global developmental delay, Motor delay, Absent speech, Epileptic encephalopathy LUC7L NM_018032.3:c.614G>Ap.(Arg205His) AD_denovo 5.9 het de novo 2 NDD + Epilepsy Seizures, Global developmental delay PRDX4 NM_006406.1:c.724G>Ap.(Gly242Arg) XL 5.5 hemi maternal 2 NDD + Epilepsy Seizures, Global developmental delay DIS3 NM_001128226.1:c.1486A>Gp.(Arg496Gly) NM_001128226.1:c.2785T>Cp.(*929Glnext*14 ) AR_comphet 7.1 comphet maternal& paternal 2 NDD Microcephaly, Intellectual disability, Global developmental delay, Abnormality of body weight, Increased body weight, CAMTA2 NM_001171166.1:c.2639A>Gp.(Asp880Gly) AR_homo 4.6 homo maternal& paternal 2 NDD + Epilepsy Seizures, Status epilepticus, Hypsarrhythmia, FAT1 NM_005245.3:c.2137A>Gp.(Ile713Val) NM_005245.3:c.9440T>Gp.(Val3147Gly) AR_comphet 5.6 comphet maternal& paternal 2 NDD + Epilepsy Seizures, Status epilepticus, Hypsarrhythmia, STAM NM_003473.3:c.119G>Cp.(Arg40Pro) AD_denovo 8.1 het de novo 1 NDD Short stature, Ataxia, Cataract, Microphthalmia, Microcephaly, Nystagmus, Global developmental delay GAL3ST3 NM_033036.2:c.39G>Cp.(Lys13Asn) AD_denovo 5.0 het de novo 3 NDD + Epilepsy seizures, focal seizures SDK1 NM_152744.3:c.1295G>Cp.(Gly432Ala) NM_152744.3:c.3802C>Tp.(Arg1268Trp) AR_comphet 4.7 comphet maternal& paternal 3 NDD + Epilepsy seizures, focal seizures ZNF503 NM_032772.4:c.69_71dup, p.(Gly27dup) NM_032772.4:c.1105G>Tp.(Gly369Cys) AR_comphet 4.1 comphet maternal& paternal 3 NDD + Epilepsy seizures, focal seizures TOB1 NM_001243877.1:c.888_907delTAACCTCAGTCCT CTCCAGTinsGGGp.(Leu296Leufs*4) AD_denovo 9.9 het de novo 1 NDD Cerebral calcification, Seizures, Congenital cataract, Autistic behavior, Obesity, Global developmental delay GPKOW NM_015698.4:c.1334G>Ap.(Arg445Gln) XL 3.4 hemi maternal 1 NDD Autism, Global developmental delay MACF1 NM_012090.5:c.1531C>Tp.(Arg511Cys) NM_012090.5:c.3465G>Ap.(=) AR_comphet 6.3 comphet maternal& paternal 1 NDD + Epilepsy global developmental delay, seizures, TAAR2 NM_001033080.1:c.113G>Tp.(Arg38Ile) AD_denovo 4.4 het de novo 3 NDD + Epilepsy Microcephaly, Intellectual disability, Seizures, Global developmental delay, Abnormality of the caudate nucleus, Infantile onset, Attention deficit hyperactivity disorder MORF4L2 NM_001142418.1:c.287A>Gp.(Gln96Arg) XL 4.8 hemi maternal 3 NDD + Epilepsy Microcephaly, Intellectual disability, Seizures, Global developmental delay, Abnormality of the caudate nucleus, Infantile onset, Attention deficit hyperactivity disorder SLC35B3 NM_001142540.1:c.1135C>Tp.(Pro379Ser) NM_001142540.1:c.1069G>Cp.(Gly357Arg) AR_comphet 3.5 comphet maternal& paternal 3 NDD + Epilepsy Microcephaly, Intellectual disability, Seizures, Global developmental delay, Abnormality of the caudate nucleus, Infantile onset, Attention deficit hyperactivity disorder URB2 NM_014777.2:c.1949delp.(Gly650Valfs*2) AD_denovo 5.8 het de novo 2 NDD + Epilepsy Seizures, Myoclonic absences, developmental delay
OGDHL NM_001143996.1:c.489G>Cp.(Trp163Cys) NM_001143996.1:c.1315C>Tp.(Arg439Cys) AR_comphet 4.7 comphet maternal& paternal 2 NDD + Epilepsy Seizures, Myoclonic absences, developmental delay SNX27 NM_030918.5:c.913G>Ap.(Ala305Thr) NM_030918.5:c.69_71dup, p.(Gly25dup) AR_comphet 6.7 comphet maternal& paternal 1 NDD Microcephaly, Hirsutism, Intellectual disability, Global developmental delay, Short stature DOC2B NM_003585.4:c.898G>Ap.(Gly300Ser) AD_denovo 6.9 het de novo 3 NDD + Epilepsy global developmental delay, encephalopathy, seizures, infantile onset ANKFN1 NM_153228.2:c.1052A>Gp.(Asn351Ser) AD_denovo 6.4 het de novo 3 NDD + Epilepsy global developmental delay, encephalopathy, seizures, infantile onset POU4F2 NM_004575.2:c.417C>Ap.(Asp139Glu) NM_004575.2:c.180_200delp.(Gly62_Gly68del )AR_comphet 3.8 comphet maternal& paternal 3 NDD + Epilepsy global developmental delay, encephalopathy, seizures, infantile onset C11ORF95 NM_001144936.1:c.1592T>Cp.(Val531Ala) AR_homo 4.9 homo maternal& paternal 2 NDD + Epilepsy global developmental delay, seizures, hypoplasia of the corpus callosum SCUBE2 NM_001170690.1:c.68C>Tp.(Pro23Leu) AD_denovo 4.9 het de novo 2 NDD + Epilepsy global developmental delay, seizures, hypoplasia of the corpus callosum NINL NM_025176.4:c.277+2T>Cp.? AR_homo 9.4 homo maternal& paternal 4 NDD Intellectual disability, Global developmental delay CTSB NM_001908.3:c.444C>Tp.(=) AR_homo 5.7 homo maternal& paternal 4 NDD Intellectual disability, Global developmental delay CNOT1 NM_001265612.1:c.6727A>Gp.(Met2243Val) AR_homo 7.8 homo maternal& paternal 2 NDD Intellectual disability, Global developmental delay B4GALNT3 NM_173593.3:c.1798G>Ap.(Glu600Lys) NM_173593.3:c.1640C>Tp.(Pro547Leu) AR_comphet 3.5 comphet maternal& paternal 4 NDD Intellectual disability, Global developmental delay SRPX NM_001170750.1:c.1270A>Tp.(Thr424Ser) XL 3.9 hemi maternal 4 NDD Intellectual disability, Global developmental delay NPTX1 NM_002522.3:c.970G>Ap.(Gly324Arg) AD_denovo 6.7 het de novo 2 NDD Spastic tetraparesis, Optic atrophy, Periventricular leukomalacia, Microcephaly, Global developmental delay H2BC4 NM_003526.2:c.154G>Tp.(Asp52Tyr) AD_denovo 5.4 het de novo 2 NDD Spastic tetraparesis, Optic atrophy, Periventricular leukomalacia, Microcephaly, Global developmental delay FRY NM_023037.2:c.4688G>Cp.(Ser1563Thr) AD_denovo 7.5 het de novo 1 NDD global developmental delay, intellectual disability, epileptic seizures, microcephaly, Dandy-Walker malformation, Polymicrogyria, syndactyly, partial duplication of thumb phalanx MICAL1 NM_001159291.1:c.571+1G>Tp.? NM_001159291.1:c.2724-8C>Tp.? AR_comphet 3.8 comphet maternal& paternal 3 NDD + Epilepsy Specific learning disability, Absence seizures, Cortical dysplasia, EEG with continuous slow activity, Seizures SPATA31A3 NM_001083124.1:c.3206C>Tp.(Ser1069Phe) AD_denovo 3.6 het de novo 3 NDD + Epilepsy Specific learning disability, Absence seizures, Cortical dysplasia, EEG with continuous slow activity, Seizures ATP2B4 NM_001001396.2:c.2819A>Gp.(Lys940Arg) AR_homo 5.3 homo maternal& paternal 3 NDD + Epilepsy Specific learning disability, Absence seizures, Cortical dysplasia, EEG with continuous slow activity, Seizures EGR3 NM_001199880.1:c.477C>Ap.(Tyr159*) AD_denovo 10.1 het de novo 1 NDD Intellectual disability, learning disability FREM3 NM_001168235.1:c.728delp.(Glu243Glyfs*25) NM_001168235.1:c.5401C>Tp.(Leu1801Phe) AR_comphet 5.3 comphet maternal& paternal 2 NDD + Epilepsy Seizures, Encephalopathy, Focal seizures, Encephalitis PLXNA1 NM_032242.3:c.2690G>Ap.(Arg897His) NM_032242.3:c.1045G>Cp.(Val349Leu) AR_comphet 4.3 comphet maternal& paternal 2 NDD + Epilepsy Seizures, Encephalopathy, Focal seizures, Encephalitis
DPP9 ENST00000262960:c.842G>C p.Arg281Pro AD_denovo Ahet de novo 1 other (+) Splenomegaly,(+) Pancytopenia,(+) Congenital thrombocytopenia,(+) Immunodeficiency,(+) Bone marrow hypocellularity,(+) Hemophagocytosis,(+) Lymphocytosis SPTBN5 NM_016642.3:c.5680G>Tp.(Glu1894*) AR_homo 8.2 homo maternal& paternal 2 NDD intellectual disability HOOK2 NM_001100176.1:c.1718-6C>Tp.? AR_homo 4.4 homo maternal& paternal 2 NDD intellectual disability ZKSCAN3 NM_001242894.1:c.253A>Tp.(Ile85Phe) AD_denovo 5.0 het de novo 3 NDD Hypothyroidism, Intellectual disability, Intellectual disability, mild, Global developmental delay, Abnormal facial shape, Short stature, Abnormal social behavior DAGLA ENST00000257215:c.2613dup p.Ser872GlnfsTer6 AD_denovo Ahet de novo 1 Neuro abnormality of eye movement, ataxia KALRN NM_001024660.3:c.5980C>Gp.(Leu1994Val) NM_001024660.3:c.2171C>Tp.(Ser724Leu) AR_comphet 6.9 comphet maternal& paternal 3 NDD Hypothyroidism, Intellectual disability, Intellectual disability, mild, Global developmental delay, Abnormal facial shape, Short stature, Abnormal social behavior SFXN3 NM_030971.3:c.785G>Ap.(Arg262His) NM_030971.3:c.640delp.(Ala214Glnfs*9) AR_comphet 4.9 comphet maternal& paternal 3 NDD Hypothyroidism, Intellectual disability, Intellectual disability, mild, Global developmental delay, Abnormal facial shape, Short stature, Abnormal social behavior AP1G1 XM_005255821.1:c.468G>Ap.(=) AD_denovo 6.9 het de novo 1 NDD + Epilepsy Seizures, Epileptic encephalopathy NLRX1 NM_024618.2:c.428C>Tp.(Pro143Leu) AD_denovo 4.7 het de novo 1 NDD Ptosis, Muscular hypotonia, Global developmental delay, Abnormal facial shape, Short stature, Feeding difficulties, Thick hair L3MBTL1 NM_015478.6:c.478T>Ap.(Ser160Thr) AR_homo 7.2 homo maternal& paternal 3 NDD Agitation, Aggressive behavior, Delayed speech and language development, Intellectual disability MIA3 NM_198551.2:c.3981+3A>Gp.? AR_homo 7.0 homo maternal& paternal 3 NDD Agitation, Aggressive behavior, Delayed speech and language development, Intellectual disability GCN1 NM_006836.1:c.7082G>Ap.(Arg2361Gln) AD_denovo 7.7 het de novo 3 Neuro Seizures, Hypoglycemia, Myopathy, Focal seizures, Ichthyosis, EEG with focal epileptiform discharges GRIA1 NM_000827.3:c.81C>Ap.(=) AR_homo 8.2 homo maternal& paternal 3 Neuro Seizures, Hypoglycemia, Myopathy, Focal seizures, Ichthyosis, EEG with focal epileptiform discharges DEPTOR NM_022783.2:c.496A>Gp.(Met166Val) NM_022783.2:c.426-5C>Tp.? AR_comphet 4.0 comphet maternal& paternal 3 NDD + Epilepsy Seizures, Hypoglycemia, Myopathy, Focal seizures, Ichthyosis, EEG with focal epileptiform discharges SPTAN1 NM_001130438.2:c.2612delp.(Lys871Serfs*5) AD_denovo 13.4 het de novo 4 NDD + Epilepsy Intellectual disability,Global developmental delay, Motor delay, Developmental regression FHDC1 NM_033393.2:c.568C>Tp.(Arg190Trp) AD_denovo 4.8 het de novo 1 NDD Hypertension, Intellectual disability,mild, Obesity, Abnormality of the pulmonary valve, I Hyperlipidemia, Childhood-onset truncal obesity RASGRP1 NM_001128602.1:c.1487C>Gp.(Ser496*) AD_denovo 9.8 het de novo 3 NDD + Epilepsy global developmental delay, encephalopathy, seizures CNTNAP4 NM_033401.3:c.3353G>Cp.(Gly1118Ala) AD_denovo 8.3 het de novo 3 NDD + Epilepsy global developmental delay, encephalopathy, seizures ZNF708 NM_021269.2:c.443T>Ap.(Val148Asp) NM_021269.2:c.1013G>Ap.(Cys338Tyr) AR_comphet 2.3 comphet maternal& paternal 3 NDD + Epilepsy global developmental delay, encephalopathy, seizures MCM7 NM_001278595.1:c.1147A>Cp.(Met383Leu) AD_denovo 7.7 het de novo 1 NDD + Epilepsy Intellectual disability, Seizures, IGlobal developmental delay, Infantile onset, epileptic encephalopathy DRG1 NM_004147.3:c.43-1G>Tp.? AD_denovo 5.9 het de novo 3 NDD + Epilepsy Autism, Intellectual disability, Seizures, Global developmental delay, Poor speech, Focal seizures ANK2 NM_001148.4:c.1288-1G>Ap.? AD_denovo 12.4 het de novo 3 NDD + Epilepsy benign epilepsy KMT2E NM_018682.3:c.3554C>Gp.(Ser1185*) AD_denovo 12.4 het de novo 1 NDD Intellectual disability, Seizures, EEG with spike-wave complexes, EEG with continuous slow activity, DGKZ NM_001199266.1:c.132_134delp.(Ser45del) NM_001199266.1:c.16G>Cp.(Gly6Arg) AR_comphet 4.4 comphet maternal& paternal 3 NDD + Epilepsy Autism, Intellectual disability, Seizures, Global developmental delay, Poor speech, Focal seizures ARHGEF7 NM_001113511.2:c.17A>Cp.(Gln6Pro) AD_denovo 7.9 het de novo 3 NDD global developmental delay, intellectual disability
CUX1 NM_001202543.1:c.3783_3784dup, p.(Leu1262Argfs*10) AD_denovo 12.1 het de novo 1 NDD Macrocephaly, Umbilical hernia, Chronic constipation, Inguinal hernia, Delayed speech and language development, mild global developmental delay SEMA3B NM_001005914.2:c.952C>Tp.(His318Tyr) NM_001005914.2:c.728T>Cp.(Phe243Ser) AR_comphet 3.6 comphet maternal& paternal 3 NDD global developmental delay, intellectual disability ETV5 NM_004454.2:c.232+1G>Ap.? AD_denovo 10.0 het de novo 4 NDD global developmental delay, intellectual disability, generalized hypotonia, DGKK NM_001013742.3:c.689T>Gp.(Phe230Cys) XL 2.0 hemi maternal 4 NDD global developmental delay, intellectual disability, generalized hypotonia, ANK2 ENST00000357077.4:c.10768G>T p.Glu3590Ter AD_denovo 11.9 het de novo 1 Epilepsy Focal myoclonic seizure MDN1 NM_014611.2:c.2965-3T>Cp.? NM_014611.2:c.9524A>Cp.(His3175Pro) AR_comphet 4.4 comphet maternal& paternal 4 NDD global developmental delay, intellectual disability, generalized hypotonia, CASS4 NM_001164114.1:c.1576G>Ap.(Val526Ile) NM_001164114.1:c.1421G>Tp.(Arg474Leu) AR_comphet 3.1 comphet maternal& paternal 4 NDD global developmental delay, intellectual disability, generalized hypotonia, EXD3 NM_017820.4:c.859G>Ap.(Asp287Asn) NM_017820.4:c.1831-2A>Gp.? AR_comphet 6.7 comphet maternal& paternal 2 NDD + Epilepsy seizures, peripheral axonal neuropathy, motor delay, gait disturbance, EEG with focal epilepti-form discharges FAM83G NM_001039999.2:c.1133G>Ap.(Gly378Asp) NM_001039999.2:c.2179G>Ap.(Val727Ile) AR_comphet 2.6 comphet maternal& paternal 3 NDD Coloboma, Iris coloboma, mild Intellectual disability, mild Global developmental delay CFAP54 XM_001715090.5:c.2257A>Gp.(Met753Val) XM_001715090.5:c.2057G>Ap.(Arg686Lys) AR_comphet 3.4 comphet maternal& paternal 3 NDD Coloboma, Iris coloboma, mild Intellectual disability, mild Global developmental delay GRIN3B NM_138690.1:c.1090_1091delp.(Met364Valfs*5) NM_138690.1:c.1936A>Gp.(Met646Val) AR_comphet 7.2 comphet maternal& paternal 1 NDD Intellectual disability, Abnormal facial shape, Myoclonus EIF5B NM_015904.3:c.3607C>Tp.(Gln1203*) AD_denovo 10.1 het de novo 1 NDD Macrocephaly, Autism, Intellectual disability, Absent speech, Intellectual disability, severe PTP4A1 NM_003463.4:c.8G>Ap.(Arg3Gln) AD_denovo 5.3 het de novo 1 NDD mental retardation, autism POLR1B NM_001137604.1:c.2893G>Ap.(Val965Ile) AD_denovo 6.5 het de novo 3 NDD Seizures, Pachygyria, Delayed CNS myelination, Heterotopia, Periventricular gray matter heterotopia, Intracranial cystic lesion, Abnormality of brain morphology HIST1H4B NM_003544.2:c.158A>Gp.(Glu53Gly) AD_denovo 4.2 het de novo 3 NDD Seizures, Pachygyria, Delayed CNS myelination, Heterotopia, Periventricular gray matter heterotopia, Intracranial cystic lesion, Abnormality of brain morphology BAHCC1 NM_001080519.2:c.4691+5C>G AD_denovo 3.0 het de novo 3 NDD Seizures, Pachygyria, Delayed CNS myelination, Heterotopia, Periventricular gray matter heterotopia, Intracranial cystic lesion, Abnormality of brain morphology PHACTR1 NM_001242648.2:c.1156G>Ap.(Glu386Lys) AD_denovo 7.4 het de novo 2 NDD Global developmental delay, Intellectual disability, mild KDM5A NM_001042603.2:c.4048C>Tp.(Arg1350*) AD_denovo 11.5 het de novo 1 NDD + Epilepsy Microcephaly, Intellectual disability, Seizures, Global developmental delay, Focal clonic seizures, Focal seizures with impairment of consciousness or awareness, Intellectual disability, severe, Focal motor seizures, Focal tonic seizures DBP NM_001352.4:c.511G>Tp.(Ala171Ser) AD_denovo 6.1 het de novo 2 NDD Global developmental delay, Intellectual disability, mild TANC2 NM_025185.3:c.4405delp.(Arg1469Glyfs*6) AD_denovo 11.4 het de novo 1 NDD + Epilepsy Seizures, Global developmental delay, Encephalopathy, Epileptic encephalopathy STC1 NM_003155.2:c.693_697delp.(Glu232Glyfs*12) AD_denovo 6.7 het de novo 1 NDD mild global developmental delay, expressive speech disorder, obesity since age three years KANK4 NM_181712.4:c.1849C>Tp.(Gln617*) AD_denovo 4.6 het de novo 1 NDD Retinal coloboma, Seizures, Intellectual disability, mild, Global developmental delay, Motor delay, Hypoplasia of the retina, Intracranial cystic lesion, Mild global developmental delay, Infantile spasms LCTL NM_207338.3:c.692_693dup AD_denovo 5.7 het de novo 2 NDD + Epilepsy epileptic encephalopathy, seizures
PABPC1 NM_002568.3:c.1691A>Gp.(Glu564Gly) AD_denovo 11.0 het de novo 1 NDD + Epilepsy global developmental delay, seizures, visual impairment, bicuspid aortic valve KLHL6 NM_130446.2:c.1061C>Ap.(Pro354Gln) AR_homo 4.9 homo maternal& paternal 2 NDD + Epilepsy epileptic encephalopathy, seizures MAPK8IP3 NM_001040439.1:c.1556G>Ap.(Arg519Gln) AD_denovo 10.9 het de novo 2 NDD Microcephaly, Intellectual disability, Global developmental delay, Abnormality of body weight, Increased body weight, RORB AD_denovo 10.9 het de novo 2 NDD Hearing impairment, Hypermetropia, Nystagmus, Delayed speech and language development, Intellectual disability, Global developmental delay, Motor delay, Generalized tonic-clonic seizures, Short stature, Decreased body weight, Simple febrile seizures GRIN3B NM_138690.2:c.2114A>Gp.(Tyr705Cys) NM_138690.2:c.2314G>Ap.(Gly772Ser) AR_comphet 6.0 comphet maternal& paternal 1 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Intellectual disability, moderate, Intellectual disability, progressive, Focal seizures, EEG with focal slow activity, Intellectual disability, severe, Focal motor seizures, EEG with focal epileptiform discharges, Mild global developmental delay, Moderate global developmental delay, Severe global developmental delay, Neurodevelopmental abnormality, Cognitive impairment DNAJC7 NM_001144766.2:c.941C>Tp.(Ala314Val) AD_denovo 6.4 het de novo 1 NDD + Epilepsy Seizures, Global developmental delay, Generalized seizures, Hypsarrhythmia, Epileptic spasms ACTL6B NM_016188.4:c.1027G>Ap.(Gly343Arg) AD_denovo 10.7 het de novo 1 NDD Muscular hypotonia, Abnormality of mouth shape, Stereotypical hand wringing, Microcephaly, Global developmental delay KIRREL2 NM_032123.6:c.1275delp.(Pro425Profs*41) AD_inherited 6.0 het paternal 1 NDD + Epilepsy Seizures, Generalized tonic-clonic seizures, Absence seizures, Generalized myoclonic seizures, Episodic vomiting, Epileptic spasms, Myoclonic atonic seizures, Epileptic encephalopathy CACNA1C NM_199460.3:c.496T>Cp.(Phe166Leu) AD_denovo 10.7 het de novo 2 NDD + Epilepsy epilepsy with absences and generalized tonic-clonic seizures, severe intellectual disability with autistic traits, low blood pressure, obstipation, normal MRI 2008 EIF3B NM_001037283.1:c.28C>Ap.(Pro10Thr) AD_denovo 7.0 het de novo 1 NDD + Epilepsy Absence seizures, EEG abnormality, Febrile seizures, Eyelid myoclonias, Childhood onset HIST1H3H NM_003536.2:c.397G>Tp.(Gly133Cys) AD_denovo 4.6 het de novo 1 NDD + Epilepsy Global developmental delay, Hypsarrhythmia, Inability to walk, Epileptic spasms, Infantile spasms FBP2 NM_003837.3:c.128A>Gp.(Lys43Arg) AD_denovo 6.2 het de novo 1 NDD Macrocephaly, Delayed speech and language development, Global developmental delay, Motor delay, Frontal bossing, Delayed gross motor development, Delayed fine motor development, Mild global developmental delay, Moderate global developmental delay, Severe global developmental delay, Profound global developmental delay TAB2 NM_015093.5:c.1448delp.(Pro483Leufs*16) AD_denovo 10.6 het de novo 3 NDD Hypotelorism, Delayed speech and language development, Intellectual disability, Intellectual disability, mild, Global developmental delay, Abnormal facial shape, Intellectual disability, moderate, Single median maxillary incisor, Agenesis of permanent teeth, Abnormality of dental morphology, Reduced number of teeth, Intellectual disability, severe AASDH NM_181806.3:c.2908-5_2908-4insGTTp.? NM_181806.3:c.3220dup, p.(Leu1074Profs*10) AR_comphet 5.6 comphet maternal& paternal 3 NDD + Epilepsy Narrow mouth, Upslanted palpebral fissure, Delayed speech and language development, Intellectual disability, Global developmental delay, Pachygyria, Lissencephaly, Absent speech, Dysphagia, Polymicrogyria, Status epilepticus, Gliosis, Intellectual disability, moderate, Cerebellar malformation, Poor speech, Abnormality of the cerebral white matter, Excessive salivation, Focal white matter lesions, Focal seizures, Multifocal epileptiform discharges, Intellectual disability, severe, Epileptic spasms, EEG with focal epileptiform discharges, Cerebral white matter atrophy, Cerebral white matter agenesis, Oralpharyngeal dysphagia CAST deletionexon16 AD_denovo 9.0 het de novo 3 NDD + Epilepsy Narrow mouth, Upslanted palpebral fissure, Delayed speech and language development, Intellectual disability, Global developmental delay, Pachygyria, Lissencephaly, Absent speech, Dysphagia, Polymicrogyria, Status epilepticus, Gliosis, Intellectual disability, moderate, Cerebellar malformation, Poor speech, Abnormality of the cerebral white matter, Excessive salivation, Focal white matter lesions, Focal seizures, Multifocal epileptiform discharges, Intellectual disability, severe, Epileptic spasms, EEG with focal epileptiform discharges, Cerebral white matter atrophy, Cerebral white matter agenesis, Oralpharyngeal dysphagia E2F4 NM_001950.3:c.947_958delp.(Ser316_Ser319del )AD_denovo 6.6 het de novo 2 NDD Cleft palate, Intellectual disability, Intellectual disability, mild, Global developmental delay, Absent speech, Atria septal defect, Abnormal facial shape, Intellectual disability, moderate, Short stature, Intellectual disability, severe C1orf228 NM_001145636.1:c.979C>Tp.(Arg327Cys) AD_denovo 4.6 het de novo 2 NDD Cleft palate, Intellectual disability, Intellectual disability, mild, Global developmental delay, Absent speech, Atria septal defect, Abnormal facial shape, Intellectual disability, moderate, Short stature, Intellectual disability, severe
NSD2 NM_001042424.2:c.3295G>Ap.(Glu1099Lys) AD_denovo 10.3 het de novo 1 NDD Cryptorchidism, Renal dysplasia, Phenotypic abnormality, Nephrocalcinosis, Delayed speech and language development, Global developmental delay, Motor delay, Cholestasis, Patent ductus arteriosus, Splenomegaly, Pyloric stenosis, Splenic cyst KDM6B NM_001080424.1:c.1130C>Tp.(Ala377Val) AR_homo 8.4 homo maternal& paternal 3 NDD + Epilepsy Nystagmus, Horizontal nystagmus, Seizures, Global developmental delay, Absent speech, Cardiomyopathy, Vacuolated lymphocytes, Abnormal facial shape, Gait ataxia, Absence seizures, EEG abnormality, Myoclonic atonic seizures, Epileptic encephalopathy ZNF664 NM_001204298.1:c.691G>Ap.(Glu231Lys) AD_denovo 4.8 het de novo 2 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Hypsarrhythmia, Epileptic spasms, Mild global developmental delay, Moderate global developmental delay, Severe global developmental delay, Profound global developmental delay, Cognitive impairment, Epileptic encephalopathy NIT1 NM_001185092.1:c.244_256delp.(Phe83Hisfs*63 ) NM_001185092.1:c.302T>Cp.(Leu101Pro) AR_comphet 6.2 comphet maternal& paternal 2 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Hypsarrhythmia, Epileptic spasms, Mild global developmental delay, Moderate global developmental delay, Severe global developmental delay, Profound global developmental delay, Cognitive impairment, Epileptic encephalopathy LPIN2 NM_014646.2:c.2537A>Gp.(Asn846Ser) AD_denovo 7.2 het de novo 3 NDD + Epilepsy Nystagmus, Horizontal nystagmus, Seizures, Global developmental delay, Absent speech, Cardiomyopathy, Vacuolated lymphocytes, Abnormal facial shape, Gait ataxia, Absence seizures, EEG abnormality, Myoclonic atonic seizures, Epileptic encephalopathy GBP2 NM_004120.4:c.576_578delp.(Glu192_Pro193del insAsp) NM_004120.4:c.412G>Ap.(Ala138Thr) AR_comphet 2.6 comphet maternal& paternal 3 NDD + Epilepsy Nystagmus, Horizontal nystagmus, Seizures, Global developmental delay, Absent speech, Cardiomyopathy, Vacuolated lymphocytes, Abnormal facial shape, Gait ataxia, Absence seizures, EEG abnormality, Myoclonic atonic seizures, Epileptic encephalopathy MAPKAPK2 NM_004759.4:c.445C>Tp.(Arg149*) AD_denovo 9.3 het de novo 1 NDD + Epilepsy Cryptorchidism, Hypospadias, Microcephaly, Visual impairment, Visual field defect, Intellectual disability, Muscular hypotonia, Global developmental delay, Plagiocephaly, Oligohydramnios, Intellectual disability, severe, Epileptic spasms, Moderate global developmental delay, Severe global developmental delay, Profound global developmental delay MOXD1 NM_015529.3:c.350A>Gp.(His117Arg) AR_homo 6.0 homo maternal& paternal 3 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Intellectual disability, profound, Intellectual disability, moderate, Febrile seizures, Intellectual disability, borderline, Intellectual disability, severe, Focal tonic seizures TLK2 NM_001112707.1:c.667A>Tp.(Met223Leu) AD_unknown 4.8 het unknown 3 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Intellectual disability, profound, Intellectual disability, moderate, Febrile seizures, Intellectual disability, borderline, Intellectual disability, severe, Focal tonic seizures TTLL6 NM_001130918.1:c.2129G>Tp.(Ser710Ile) AD_unknown 1.0 het unknown 3 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Intellectual disability, profound, Intellectual disability, moderate, Febrile seizures, Intellectual disability, borderline, Intellectual disability, severe, Focal tonic seizures CPXM2 NM_198148.2:c.170_172delp.(Phe57del) AD_unknown 2.0 het unknown 3 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Intellectual disability, profound, Intellectual disability, moderate, Febrile seizures, Intellectual disability, borderline, Intellectual disability, severe, Focal tonic seizures KDM5B NM_006618.4:c.1286T>Gp.(Ile429Ser) AD_denovo 10.1 het de novo 1 NDD + Epilepsy Renal duplication, Hydrocephalus, Autism, Hypertrichosis, Intellectual disability, Seizures, Global developmental delay, Agenesis of corpus callosum, Abnormal facial shape, Intellectual disability, moderate, Impaired pain sensation, Intellectual disability, severe, Colpocephaly, Cognitive impairment, Septo-optic dysplasia NIPAL3 NM_020448.4:c.205G>Ap.(Ala69Thr) NM_020448.4:c.163-8G>Ap.? AR_comphet 3.7 comphet maternal& paternal 2 NDD Hearing impairment, Sensorineural hearing impairment, Delayed speech and language development, Precocious puberty, Muscular hypotonia, Global developmental delay, Absent speech, Poor speech, Highfrequency hearing impairment, Muscular hypotonia of the trunk
PLEKHG4B NM_052909.3:c.461G>Tp.(Cys154Phe) NM_052909.3:c.3124G>Ap.(Asp1042Asn) AR_comphet 2.8 comphet maternal& paternal 2 NDD Hearing impairment, Sensorineural hearing impairment, Delayed speech and language development, Precocious puberty, Muscular hypotonia, Global developmental delay, Absent speech, Poor speech, Highfrequency hearing impairment, Muscular hypotonia of the trunk ZIK1 NM_001010879.3:c.924delp.(Ser308Serfs*203) AR_homo 7.8 homo maternal& paternal 3 NDD + Epilepsy Intellectual disability, Generalized seizures, Febrile seizures, Focal seizures ZNF331 NM_001079906.1:c.281G>Ap.(Arg94His) AR_homo 3.8 homo maternal& paternal 3 NDD + Epilepsy Intellectual disability, Generalized seizures, Febrile seizures, Focal seizures UBE3C NM_014671.2:c.485G>Cp.(Ser162Thr) NM_014671.2:c.871G>Ap.(Val291Ile) AR_comphet 4.9 comphet maternal& paternal 3 NDD + Epilepsy Intellectual disability, Generalized seizures, Febrile seizures, Focal seizures SGF29 NM_138414.2:c.733T>Cp.(Tyr245His) AD_denovo 6.7 het de novo 1 NDD Microcephaly, Abnormality of the outer ear, Protruding ear, Abnormality of the ear, Hypotelorism, Autistic behavior, Delayed speech and language development, Intellectual disability, Intellectual disability, mild, Global developmental delay, Talipes equinovarus, Hypoplasia of the corpus callosum, Intellectual disability, profound, Intellectual disability, moderate, Short stature, Intellectual disability, severe, Clinodactyly HSPD1 NM_002156.4:c.1394_1406delp.(Ile465Lysfs*9) AD_denovo 12.8 het de novo 1 Neuro Hypogonadotrophic hypogonadism, Tall stature, Psychosis, Depression, Psychotic episodes, Dementia, Overgrowth, Neurodegeneration, Bipolar affective disorder, Brain atrophy PLCB3 NM_000932.2:c.1792G>Cp.(Glu598Gln) AD_denovo Bhet de novo 1 Fehlbildung en Failure to thrive, Growth delay, Omphalocele, Double outlet right ventricle STARD9 NM_020759.2:c.1649A>Gp.(Asn550Ser) NM_020759.2:c.10380C>Gp.(His3460Gln) AR_comphet 3.9 comphet maternal& paternal 1 NDD + Epilepsy Global developmental delay, Absence seizures, Intellectual disability, moderate, Progressive truncal ataxia, Epileptic spasms, Myoclonic absences, Mild global developmental delay, Moderate global developmental delay, Severe global developmental delay, Infantile spasms GABRA3 NM_000808.3:c.931+5G>Ap.? XL 7.3 hemi maternal 2 NDD + Epilepsy Microcephaly, Agitation, Intellectual disability, Intellectual disability, mild, Global developmental delay, Constipation, Intellectual disability, moderate, EEG abnormality, Intellectual disability, borderline, Attention deficit hyperactivity disorder, Epileptic spasms, Anteverted ears ELMOD2 NM_153702.3:c.580C>Tp.(Arg194Cys) AD_denovo 5.3 het de novo 2 NDD + Epilepsy Microcephaly, Agitation, Intellectual disability, Constipation, moderate, Attention deficit hyperactivity disorder, Epileptic spasms, Anteverted ears NR2F6 NM_005234.3:c.1051G>Ap.(Gly351Arg) AD_denovo 5.49 het de novo 1 NDD Microcephaly, Global developmental delay, Generalized hypotonia, Neonatal hypotonia, Failure to thrive, Severe failure to thrive, Failure to thrive in infancy, Ventricular septal defect, Abnormal cardiac septum morphology, Overlapping toe, Neonatal onset, Short stature, Muscular hypotonia of the trunk, Infantile muscular hypotonia, Abnormal ventricular septum morphology, Gerbode ventricular septal defect, Inlet ventricular septal defect, Muscular ventricular septal defect, Subarterial ventricular septal defect, Perimembranous ventricular septal defect, Restrictive ventricular septal defect, Abnormality of cardiovascular system morphology, Ventricular septal aneurysm, Muscular ventricular septal aneurysm TMEM199 NM_152464.2:c.5C>Tp.(Ala2Val) AD_denovo 5.3 het de novo 2 NDD + Epilepsy Microcephaly, Intellectual disability, Muscular hypotonia, Global developmental delay, Motor delay, Abnormal facial shape, Status epilepticus, Intellectual disability, moderate, Infantile muscular hypotonia, Intellectual disability, severe, Epileptic spasms, Cognitive impairment NCAPH NM_001281710.1:c.563-4T>Gp.? NM_001281710.1:c.667G>Ap.(Glu223Lys) AR_comphet 5.2 comphet maternal& paternal 2 NDD + Epilepsy Microcephaly, Intellectual disability, Muscular hypotonia, Global developmental delay, Motor delay, Abnormal facial shape, Status epilepticus, Intellectual disability, moderate, Infantile muscular hypotonia, Intellectual disability, severe, Epileptic spasms, Cognitive impairment DOK2 NM_003974.3:c.1007C>Ap.(Thr336Asn) NM_003974.3:c.602G>Ap.(Arg201His) AR_comphet Ccomphet maternal& paternal 1 Immunolog y Hemolytic anemia, Fever, Abnormal thrombosis, Vasculitis, Intermittent thrombocytopenia, Congenital blindness, Colon perforation
PSD3 NM_015310.3:c.3092A>Gp.(Glu1031Gly) NM_015310.3:c.2929-3C>Tp.? AR_comphet 5.8 comphet maternal& paternal 2 NDD + Epilepsy Seizures, Generalized tonic-clonic seizures, Focal seizures, Intellectual disability, severe ARMC3 NM_173081.4:c.1346G>Ap.(Arg449His) AR_homo 3.4 homo maternal& paternal 2 NDD + Epilepsy Seizures, Generalized tonic-clonic seizures, Focal seizures, Intellectual disability, severe SRGAP3 NM_014850.3:c.2227+6_2227+9delp.? AD_denovo Chet de novo 1 Fehlbildung en Premature birth, Esophageal atresia, Spina bifida, Total anomalous pulmonary venous return CSMD1 NM_033225.5:c.3641T>Cp.(Leu1214Pro) AD_denovo 7.7 het de novo 3 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Intellectual disability, severe, Epileptiform EEG discharges, Neurodevelopmental delay, Epileptic encephalopathy, Myoclonic absences, EMG: myotonic discharges, Generalized tonic-clonic seizures MFAP1 NM_005926.2:c.88T>Cp.(Ser30Pro) AD_denovo 6.8 het de novo 3 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Intellectual disability, severe, Epileptiform EEG discharges, Neurodevelopmental delay, Epileptic encephalopathy, Myoclonic absences, EMG: myotonic discharges, Generalized tonic-clonic seizures DPY19L4 NM_181787.2:c.1256C>Tp.(Ser419Phe) NM_181787.2:c.1870C>Tp.(Arg624*) AR_comphet 3.5 comphet maternal& paternal 3 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Intellectual disability, severe, Epileptiform EEG discharges, Neurodevelopmental delay, Epileptic encephalopathy, Myoclonic absences, EMG: myotonic discharges, Generalized tonic-clonic seizures AP3B2 NM_001278512.1:c.2879A>Gp.(Asn960Ser) NM_001278512.1:c.2662G>Ap.(Glu888Lys) AR_comphet 8.3 comphet maternal& paternal 4 NDD + Epilepsy Intellectual disability, Intellectual disability, mild, Global developmental delay, Motor delay, Intellectual disability, profound, Delayed gross motor development, Intellectual disability, moderate, Developmental regression, Intellectual disability, progressive, Intellectual disability, borderline, Intellectual disability, severe, Mild global developmental delay, Moderate global developmental delay, Severe global developmental delay, Delayed social development, Profound global developmental delay, Neurodevelopmental delay, Cognitive impairment EIF3B NM_001037283.1:c.2120G>Ap.(Arg707Gln) AD_denovo 7.6 het de novo 4 NDD + Epilepsy Intellectual disability, Intellectual disability, mild, Global developmental delay, Motor delay, Intellectual disability, profound, Delayed gross motor development, Intellectual disability, moderate, Developmental regression, Intellectual disability, progressive, Intellectual disability, borderline, Intellectual disability, severe, Mild global developmental delay, Moderate global developmental delay, Severe global developmental delay, Delayed social development, Profound global developmental delay, Neurodevelopmental delay, Cognitive impairment GABRE NM_004961.3:c.41T>Cp.(Leu14Ser) XL 5.2 hemi maternal 1 NDD Strabismus, Myopia, Autistic behavior, Anxiety, Hyperactivity, Intellectual disability, Muscular hypotonia, Intellectual disability, mild, Global developmental delay, Intellectual disability, moderate, Abnormal fear/anxiety-related behavior PRRG3 NM_024082.3:c.572C>Tp.(Pro191Leu) XL 3.5 hemi maternal 4 NDD + Epilepsy Intellectual disability, Intellectual disability, mild, Global developmental delay, Motor delay, Intellectual disability, profound, Delayed gross motor development, Intellectual disability, moderate, Developmental regression, Intellectual disability, progressive, Intellectual disability, borderline, Intellectual disability, severe, Mild global developmental delay, Moderate global developmental delay, Severe global developmental delay, Delayed social development, Profound global developmental delay, Neurodevelopmental delay, Cognitive impairment USP20 NM_001008563.4:c.582delp.(Lys194Asnfs*46) AR_homo 8.0 homo maternal& paternal 3 NDD Micropenis, Intellectual disability, Intellectual disability, mild, Global developmental delay, Motor delay, Intellectual disability, profound, Delayed gross motor development, Intellectual disability, moderate, Expressive language delay, Delayed fine motor development, Intellectual disability, severe FAM171A1 NM_001010924.1:c.2435C>Tp.(Ala812Val) AR_homo 4.8 homo maternal& paternal 3 NDD Micropenis, Intellectual disability, Intellectual disability, mild, Global developmental delay, Motor delay, Intellectual disability, profound, Delayed gross motor development, Intellectual disability, moderate, Expressive language delay, Delayed fine motor development, Intellectual disability, severe
LCN15 NM_203347.1:c.399C>Ap.(Ser133Arg) AR_homo 3.8 homo maternal& paternal 3 NDD Micropenis, Intellectual disability, Intellectual disability, mild, Global developmental delay, Motor delay, Intellectual disability, profound, Delayed gross motor development, Intellectual disability, moderate, Expressive language delay, Delayed fine motor development, Intellectual disability, severe ADAM11 NM_002390.5:c.98G>Tp.(Trp33Leu) AD_denovo 6.6 het de novo 1 NDD Strabismus, Hypermetropia, Delayed speech and language development, Intellectual disability, Seizures, Global developmental delay, Absent speech, Absence seizures, Febrile seizures, Receptive language delay HMGXB3 NM_014983.2:c.2026C>Tp.(Pro676Ser) AD_denovo 6.1 het de novo 1 NDD Delayed speech and language development, Intellectual disability, Global developmental delay, Expressive language delay RAB11FIP2 NM_001330167.1:c.1334T>Cp.(Met445Thr) AD_denovo 5.9 het de novo 1 NDD kombinierte Entwicklungsverzögerung/Lernbehinderung (IQ=69), leichtes Übergewicht, faziale Dysmorphie, kurze Finger, Brachyzephalus, CA und FRAX unauffällig, Array: Dup1q31.1 mat, Dup11q14.1 mat KDM2B NM_032590.4:c.2345C>Tp.(Ser782Leu) AR_homo 7.1 homo maternal& paternal 9 NDD Urinary incontinence, Microcephaly, Micrognathia, Strabismus, Aggressive behavior, Inappropriate laughter, Paroxysmal bursts of laughter, Poor eye contact, Seizures, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia, Absent speech, Global brain atrophy, Sleep disturbance, Excessive salivation, Infantile muscular hypotonia UNC5D NM_080872.3: c.977A>Gp.(His326Arg) AR_homo 6.5 homo maternal& paternal 9 NDD Urinary incontinence, Microcephaly, Micrognathia, Strabismus, Aggressive behavior, Inappropriate laughter, Paroxysmal bursts of laughter, Poor eye contact, Seizures, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia, Absent speech, Global brain atrophy, Sleep disturbance, Excessive salivation, Infantile muscular hypotonia RNF10 NM_001330474.1:c.850C>Tp.(His284Tyr) AR_homo 5.8 homo maternal& paternal 9 NDD Urinary incontinence, Microcephaly, Micrognathia, Strabismus, Aggressive behavior, Inappropriate laughter, Paroxysmal bursts of laughter, Poor eye contact, Seizures, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia, Absent speech, Global brain atrophy, Sleep disturbance, Excessive salivation, Infantile muscular hypotonia PCLO NM_033026.5 :c.13206G>T p.(Gln4402His) NM_033026.5:c.1297G>Ap.(Ala433Thr) AR_comphet 5.9 comphet maternal& paternal 9 NDD Urinary incontinence, Microcephaly, Micrognathia, Strabismus, Aggressive behavior, Inappropriate laughter, Paroxysmal bursts of laughter, Poor eye contact, Seizures, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia, Absent speech, Global brain atrophy, Sleep disturbance, Excessive salivation, Infantile muscular hypotonia DOCK1 NM_001380.4:c.4546A>Gp.(Ser1516Gly) AR_homo 6.3 homo maternal& paternal 9 NDD Urinary incontinence, Microcephaly, Micrognathia, Strabismus, Aggressive behavior, Inappropriate laughter, Paroxysmal bursts of laughter, Poor eye contact, Seizures, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia, Absent speech, Global brain atrophy, Sleep disturbance, Excessive salivation, Infantile muscular hypotonia SF3B2 NM_006842.2:c.76G>Ap.(Ala26Thr) AR_homo 5.1 homo maternal& paternal 9 NDD Urinary incontinence, Microcephaly, Micrognathia, Strabismus, Aggressive behavior, Inappropriate laughter, Paroxysmal bursts of laughter, Poor eye contact, Seizures, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia, Absent speech, Global brain atrophy, Sleep disturbance, Excessive salivation, Infantile muscular hypotonia PCDHA9 NM_031857.1:c.1134_1135delCGinsTTp.(Ala379S er) AR_homo 4.6 homo maternal& paternal 9 NDD Urinary incontinence, Microcephaly, Micrognathia, Strabismus, Aggressive behavior, Inappropriate laughter, Paroxysmal bursts of laughter, Poor eye contact, Seizures, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia, Absent speech, Global brain atrophy, Sleep disturbance, Excessive salivation, Infantile muscular hypotonia MRPL15 NM_014175.3:c.743C>Tp.(Thr248Ile) AR_homo 6.0 homo maternal& paternal 9 NDD Urinary incontinence, Microcephaly, Micrognathia, Strabismus, Aggressive behavior, Inappropriate laughter, Paroxysmal bursts of laughter, Poor eye contact, Seizures, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia, Absent speech, Global brain atrophy, Sleep disturbance, Excessive salivation, Infantile muscular hypotonia TCP11 NM_001093728.2:c.256A>Gp.(Lys86Glu) AR_homo 3.4 homo maternal& paternal 9 NDD Urinary incontinence, Microcephaly, Micrognathia, Strabismus, Aggressive behavior, Inappropriate laughter, Paroxysmal bursts of laughter, Poor eye contact, Seizures, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia, Absent speech, Global brain atrophy, Sleep disturbance, Excessive salivation, Infantile muscular hypotonia
KDM2A NM_012308.2:c.956G>Ap.(Arg319Gln) AD_denovo 9.4 het de novo 3 NDD + Epilepsy Narrow mouth, Upslanted palpebral fissure, Delayed speech and language development, Intellectual disability, Global developmental delay, Pachygyria, Lissencephaly, Absent speech, Dysphagia, Polymicrogyria, Status epilepticus, Gliosis, Intellectual disability, moderate, Cerebellar malformation, Poor speech, Abnormality of the cerebral white matter, Excessive salivation, Focal white matter lesions, Focal seizures, Multifocal epileptiform discharges, Intellectual disability, severe, Epileptic spasms, EEG with focal epileptiform discharges, Cerebral white matter atrophy, Cerebral white matter agenesis, Oralpharyngeal dysphagia MARCHF6 NM_005885.3:c.1108T>Cp.(Tyr370His) NM_005885.3:c.1897-3C>Tp.? AR_comphet 4.3 comphet maternal& paternal 1 NDD + Epilepsy global development delay, seizures, microcephaly, autism, single transverse palmar crease, broad palm, abnormal fracial shape RSRC2 NM_023012.5:c.603-8T>Cp.? AD_denovo 4.0 het de novo 3 NDD + Epilepsy Behavioral abnormality, Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Generalized tonic-clonic seizures, Absence seizures, Generalized myoclonic seizures, Intellectual disability, moderate, Generalized tonic seizures, Atonic seizures, Cognitive impairment WDR59 NM_030581.3:c.2326G>Tp.(Val776Leu) NM_030581.3:DelExons19-25 AR_comphet 4.4 comphet maternal& paternal 3 NDD + Epilepsy Behavioral abnormality, Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Generalized tonic-clonic seizures, Absence seizures, Generalized myoclonic seizures, Intellectual disability, moderate, Generalized tonic seizures, Atonic seizures, Cognitive impairment WWC3 NM_015691.3:c.2935C>Tp.(Arg979Trp) XL 4.2 hemi maternal 3 NDD + Epilepsy Behavioral abnormality, Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Generalized tonic-clonic seizures, Absence seizures, Generalized myoclonic seizures, Intellectual disability, moderate, Generalized tonic seizures, Atonic seizures, Cognitive impairment ZMYM2 NM_001190964.2:c.2881G>Cp.(Glu961Gln) AD_denovo 9.0 het de novo 2 NDD + Epilepsy Seizures, Global developmental delay, Episodic ataxia OPCML NM_001012393.2:c.175delp.(Val59Trpfs*4) AD_denovo 7.1 het de novo 2 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Generalized tonicclonic seizures, Focal clonic seizures, Intellectual disability, moderate, Focal seizures with impairment of consciousness or awareness, Intellectual disability, borderline, Generalized tonic seizures, Symptomatic seizures, Focal tonic seizures, Cognitive impairment PRKCA NM_002737.2:c.64C>Tp.(Arg22Cys) AD_denovo 8.6 het de novo 4 NDD Tall stature, Strabismus, Esotropia, Precocious puberty, Intellectual disability, Muscular hypotonia, Global developmental delay, Motor delay, Curly hair, Scoliosis SRRT NM_015908.5:c.437C>Tp.(Pro146Leu) AD_denovo 8.4 het de novo 4 NDD Tall stature, Strabismus, Esotropia, Precocious puberty, Intellectual disability, Muscular hypotonia, Intellectual disability, mild, Global developmental delay, Motor delay, Curly hair, Woolly hair, Intellectual disability, moderate, Scoliosis, Infantile muscular hypotonia, Precocious puberty in females, Proportionate tall stature, Cognitive impairment KALRN NM_001024660.4:c.4026-8T>Cp.? NM_001024660.4:c.5369A>Gp.(Gln1790Arg) AR_comphet 6.3 comphet maternal& paternal 4 NDD Tall stature, Strabismus, Esotropia, Precocious puberty, Intellectual disability, Muscular hypotonia, Intellectual disability, mild, Global developmental delay, Motor delay, Curly hair, Woolly hair, Intellectual disability, moderate, Scoliosis, Infantile muscular hypotonia, Precocious puberty in females, Proportionate tall stature, Cognitive impairment TRMT1 NM_001136035.2:c.1964G>Ap.(Gly655Glu) AD_denovo 8.0 het de novo 4 NDD Tall stature, Strabismus, Esotropia, Precocious puberty, Intellectual disability, Muscular hypotonia, Intellectual disability, mild, Global developmental delay, Motor delay, Curly hair, Woolly hair, Intellectual disability, moderate, Scoliosis, Infantile muscular hypotonia, Precocious puberty in females, Proportionate tall stature, Cognitive impairment SLC2A8 NM_014580.4:c.1150G>Ap.(Gly384Ser) NM_014580.4:c.1239C>Gp.(Cys413Trp) AR_comphet 4.5 comphet 2 NDD + Epilepsy Behavioral abnormality, Delayed speech and language development, Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Absent speech, Generalized tonic-clonic seizures, Generalized myoclonic seizures, Generalized seizures, Focal clonic seizures, Intellectual disability, moderate, Focal seizures with impairment of consciousness or awareness, Poor speech, Focal seizures, Intellectual disability, severe, Epileptic spasms, Focal motor seizures, Focal tonic seizures, Abnormality of movement, Cognitive impairment GDF11 NM_005811.4:c.955dup, p.(Thr319Asnfs*5) AD_denovo 8.9 het de novo 3 NDD + Epilepsy Delayed speech and language development, Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Absence seizure, Typical absence seizure, Early onset absence seizures STX1A NM_004603.3:c.284-1G>Ap.? AR_homo 12.9 homo maternal& paternal 1 NDD severe ID, decreased fetal movements, muscular hypotonia
TRAK2 NM_015049.2:c.1210G>Ap.(Val404Ile) AD_denovo 6.9 het de novo 1 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Intellectual disability, profound, Intellectual disability, moderate, Multifocal epileptiform discharges, Intellectual disability, severe, Epileptiform EEG discharges, Cognitive impairment, Epileptic encephalopathy TENM1 NM_001163278.1:c.5977A>Tp.(Thr1993Ser) XL 5.7 hemi maternal 1 NDD Delayed speech and language development, Intellectual disability, Global developmental delay ACTR5 NM_024855.3:c.958G>Tp.(Asp320Tyr) AR_homo 6.9 homo maternal& paternal 3 NDD + Epilepsy Delayed speech and language development, Seizures, Global developmental delay, Motor delay, Generalized tonic-clonic seizures, Generalized myoclonic seizures, Febrile seizures, Postnatal microcephaly TENM3 NM_001080477.3:c.2221G>Ap.(Glu741Lys) AD_denovo 7.8 het de novo 1 NDD Autism, Autistic behavior, Intellectual disability, Global developmental delay, Intellectual disability, severe, no speech ZMYM4 NM_005095.2:c.1300A>Gp.(Thr434Ala) AD_denovo 6.6 het de novo 1 NDD + Epilepsy Seizures, Global developmental delay, Generalized tonic-clonic seizures with focal onset, Focal seizures, Epileptic encephalopathy GALNT2 NM_004481.4:c.865C>Tp.Gln289* AR_homo 9.4 homo maternal& paternal 1 NDD + Epilepsy very severe ID, seizures, autism, aggressive behavior, feeding problems in infancy, short stature, constipation, strabismus, inguinal hernia MAGI2 NM_012301.3:c.3780C>Ap.Asp1260Glu AR_homo 8.9 homo maternal& paternal 1 NDD mild ID, hypermetropia SLC44A1 NM_080546.4:c.377_380delGTGAp.Ser126fs AR_homo 9.1 homo maternal& paternal 1 NDD mild ID, macrocephaly, acanthosis nigricans, accessory mamilla, muscular hypotonia, frontotemporal cerebral atrophy TRAP1 NM_016292.2:c.1941-1G>Ap.? AR_homo 10.0 homo maternal& paternal 1 NDD moderate ID, mental deterioration, autism, self-mutilation, muscular hypotonia, nystagmus, leukodystrophy CCAR2 NM_021174.5:c.2484C>Ap.Tyr828* AR_homo 9.7 homo maternal& paternal 2 NDD moderate ID, small for gestational age, short stature CLMN NM_024734.3:c.730C>Tp.Arg244* AR_homo 7.7 homo maternal& paternal 1 NDD moderate ID, muscular hypotonia, gait disturbance, EEG abnormalities, cerebral atrophy ENO2 NM_001975.2:c.710C>Tp.Thr237Met AR_homo 8.6 homo maternal& paternal 1 NDD mild ID, small for gestational age, short stature, microcephaly AMZ2 NM_001033569.1:c.25C>Tp.Gln9* AR_homo 7.4 homo maternal& paternal 2 NDD mild ID, muscular hypotonia, microcephaly, hypospadias, megalocornea, cerebral atrophy ICE2/NARG2 NM_024611.5:c.2764G>Tp.Gly922* AR_homo 9.4 homo maternal& paternal 1 NDD + Epilepsy mild ID, deafness, febrile seizures, EEG abnormalities, atrial septal defect FAM234B NM_020853.1:c.1009C>Tp.Gln337* AR_homo 8.2 homo maternal& paternal 1 NDD + Epilepsy mild ID, seizures, obesity, delayed puberty SEC23IP NM_007190.3:c.2101G>Tp.Glu701* AR_homo 8.5 homo maternal& paternal 1 NDD severe ID, feeding problems in infancy, microcephaly, non-midline cleft of the upper lip, 1-2 and 3-4 toe syndactyly, broad toes, mirror image dupliction of toes, craniosynostosis, scaphocephaly, hypoplastic corpus callosum, holoprosencephaly, lissencephaly, leukodystrophy, central diabetes insipidus SV2C NM_014979.3:c.533G>Cp.Ser178Thr AR_homo 7.0 homo maternal& paternal 1 NDD moderate ID, microcephaly, short stature PPFIA1 NM_003626.3:c.1070A>Gp.His357Arg AR_homo 7.9 homo maternal& paternal 1 NDD very severe ID, muscular hypotonia, spasticity, resting tremor, abnormality of the thorax, seizures, cerebral atrophy LRRIQ3 NM_001105659.1:c.968C>Ap.Ser323* AR_homo 7.1 homo maternal& paternal 2 NDD mild ID INIP NM_021218.2:c.266delCp.Ala89fs AR_homo 9.2 homo maternal& paternal 1 NDD + Epilepsy mild ID, febrile seizures, recurrent infections, carious teeth, microcephaly, muscular hypotonia, ataxia, myopia GTF3C3 NM_012086.4:c.1436A>Gp.Tyr479Cys AR_homo 8.0 homo maternal& paternal 1 NDD + Epilepsy mild ID, seizures, recurrent infections, constipation, abnormalities of the face, postaxial hexadactyly, ataxia, radioulnar synostosis, ventricular septal defect, EEG abnormalities MBNL3 NM_018388.3:c.279delTp.Ala94fs AR_homo 9.0 hemi maternal& paternal 1 NDD moderate ID, autism OGDHL NM_018245.2:c.2606G>Ap.Arg869Gln AR_homo 7.2 homo maternal& paternal 2 NDD moderate ID, small for gestational age, short stature CACNA2D1 NM_000722.3:c.1514C>Tp.Thr505Ile AR_homo 8.7 homo maternal& paternal 1 NDD severe ID, muscular hypotonia, stereotypical motor behaviors, inguinal hernia, omphalocele TMEM132D NM_133448.2:c.1489A>Gp.Lys497Glu AR_homo 6.2 homo maternal& paternal 2 NDD mild ID HACL1 NM_012260.3:c.1246C>Gp.His416Asp AR_homo 7.2 homo maternal& paternal 1 NDD severe ID, muscular hypotonia, low-set ears, bifid uvula, cryptorchidism, aplasia cutis congenita, unilateral renal agenesis, cardiac malformation, increased creatine kinase SPOUT1 NM_016390.3:c.1058C>Tp.Thr353Met AR_homo 6.6 homo maternal& paternal 1 NDD + Epilepsy profound ID, seizures, microcephaly, short stature, limb hypertonia, bruxism
SMURF2 NM_022739.3:c.1921A>Gp.Thr641Ala AR_homo 8.2 homo maternal& paternal 2 NDD mild ID, muscular hypotonia, microcephaly, hypospadias, megalocornea, cerebral atrophy GRAMD1B NM_001286563.1:c.586C>Tp.Arg196Trp AR_homo 7.2 homo maternal& paternal 1 NDD moderate ID PPRC1 NM_015062.4:c.1825C>Tp.Pro609Ser AR_homo 6.2 homo maternal& paternal 1 NDD + Epilepsy severe ID, seizures, cerebral atrophy, leukodystrophy, macular degeneration, abnormality of the retina BDH1 NM_004051.4:c.668G>Ap.Arg223His AR_homo 7.2 homo maternal& paternal 1 NDD + Epilepsy very severe ID, seizures, muscular hypotonia, limb hypertonia, spasticity, short stature, microcephaly, leukodystrophy CHD1L NM_004284.4:c.1175G>Ap.Arg392His AR_homo 9.0 homo maternal& paternal 1 NDD mild ID, microcephaly, muscular hypotonia, rigidity, ataxia, intention tremor, hypopigmented macules, EEG abnormalities ATP2C2 NM_001286527.2:c.2636A>Gp.Asp879Gly AR_homo 7.8 homo maternal& paternal 1 NDD severe ID, muscular hypotonia of the trunk, spastic paraparesis, preaxial polydactyly, abnormality of muscle fibers, colpocephaly, cerebellar hypoplasia, hypoplasia of the corpus callosum PARD6A NM_016948.2:c.934C>Tp.Arg312* AD_denovo 6.2 het de novo 1 NDD mild ID, stereotypical motor behaviors, muscular hypotonia, strabismus, EEG abnormalities HMG20A NM_001304504.1:c.694C>Gp.Arg232Gly AR_homo 6.6 homo maternal& paternal 1 NDD + Epilepsy moderate ID, seizures TSPAN18 NM_130783.4:c.275T>Cp.Leu92Pro AR_homo 6.4 homo maternal& paternal 1 NDD severe ID, deafness CEP76 NM_024899.3:c.302T>Cp.Ile101Thr AR_homo 7.6 homo maternal& paternal 1 NDD moderate ID, muscular hypotonia, short stature, microcephaly ADIPOR1 NM_001290553.1:c.644T>Cp.Leu215Pro AR_homo 6.9 homo maternal& paternal 1 NDD very severe ID, EEG abnormalities, microcephaly TMEM147 NM_032635.3:c.344+5G>Ap.? AR_homo 5.7 homo maternal& paternal 1 NDD very severe ID, impaired vision, joint contractures GCC2 NM_181453.3:c.3982C>Tp.His1328Tyr AR_homo 7.6 homo maternal& paternal 1 NDD ID, short stature, elbow contractures, wrist contractures, axillar pterygium, abnormalities of the face, deafness, abnormality of thrombocytes SKIDA1 NM_207371.3:c.2600C>Tp.Ala867Val AR_homo 6.5 homo maternal& paternal 1 NDD severe ID, small for gestational age, strabismus, short stature LRCH3 NM_032773.3:c.761A>Gp.Gln254Arg AR_homo 5.8 homo maternal& paternal 1 NDD + Epilepsy severe ID, seizures, muscular hypotonia, cardiac malformation, cerebral atrophy RXRB NM_001270401.1:c.1091C>Tp.Pro364Leu AR_homo 7.1 homo maternal& paternal 1 NDD very severe ID, short stature, microcephaly BTN2A2 NM_001197237.1:c.386G>Ap.Cys129Tyr AR_homo 6.3 homo maternal& paternal 1 NDD very severe ID, muscular hypotonia, constipation LENG8 NM_052925.3:c.2147G>Ap.Arg716Gln AR_homo 6.2 homo maternal& paternal 1 NDD severe ID, mental deterioration, sleep disturbances, behavioral abnormality, hyperpigmented macules, EEG abnormalities FNDC3A NM_001079673.1:c.1186G>Ap.Asp396Asn AR_homo 7.1 homo maternal& paternal 1 NDD + Epilepsy severe ID, seizures, muscular hypotonia, short stature KCTD18 NM_001321547.1:c.875C>Tp.Ser292Leu AR_homo 5.5 homo maternal& paternal 1 NDD moderate ID, short stature, microcephaly, dislocated hips EIF4A2 NM_001967.3:c.109_111delGATp.Asp37del AR_homo 7.6 homo maternal& paternal 1 NDD mild ID, muscular hypotonia, tremor RSRC2 NM_023012.5:c.1271T>Gp.(Phe424Cys) AD_denovo 6.1 het de novo 2 NDD Global developmental delay, Microcephaly, Agenesis of corpus callosum, Failure to thrive, Growth delay, EEG abnormality, Abnormal cry TTBK1 NM_032538.2:c.3116_3118delp.(Thr1039del) AD_inherited 4.4 het paternal 2 NDD Tall stature, Behavioral abnormality, Short attention span, Delayed speech and language development, Intellectual disability, Intellectual disability, mild, Attention deficit hyperactivity disorder, Cognitive impairment SNF8 NM_007241.3:c.572G>Ap.(Gly191Asp) NM_007241.3:c.236C>Tp.(Pro79Leu) AR_comphet 5.0 comphet maternal& paternal 2 NDD Global developmental delay, Microcephaly, Agenesis of corpus callosum, Failure to thrive, Growth delay, EEG abnormality, Abnormal cry ARL13A NM_001162491.1:c.349G>Cp.(Asp117His) XL 3.3 hemi maternal 1 NDD Intellectual disability, Global developmental delay, Hemiplegia/hemiparesis TMEM94 NM_001321148.1:c.2906G>Ap.(Arg969Gln) NM_001321148.1:c.2978T>Cp.(Met993Thr) AR_comphet 6.2 comphet maternal& paternal 1 NDD + Epilepsy Seizures, Global developmental delay, Focal seizures, Retinoblastoma
AFDN NM_001207008.1:c.436A>Gp.(Lys146Glu) AD_inherited 6.0 het paternal 2 NDD Tall stature, Behavioral abnormality, Short attention span, Delayed speech and language development, Intellectual disability, Intellectual disability, mild, Attention deficit hyperactivity disorder, Cognitive impairment GEMIN5 NM_015465.4:c.1627A>Gp.(Ser543Gly) NM_015465.4:c.851G>Ap.(Arg284His) AR_comphet 5.3 comphet maternal& paternal 2 NDD Cryptorchidism, Microcephaly, Global developmental delay, Motor delay, Growth delay, Intrauterine growth retardation ARFGEF3 NM_020340.4:c.421-4A>Gp.? NM_020340.4:c.2003C>Tp.(Ala668Val) AR_comphet 5.0 comphet maternal& paternal 2 Neuro Abnormality of the corpus callosum, Agenesis of corpus callosum, Talipes equinovarus, Polymicrogyria, Myelomeningocele, Brainstem dysplasia, Dysplastic corpus callosum, Periventricular gray matter heterotopia COL19A1 NM_001858.5:c.1843G>Ap.(Gly615Ser) AR_homo 4.7 homo maternal& paternal 3ndd Microcephaly, Intellectual disability, Intellectual disability, mild, Global developmental delay, Intellectual disability, moderate, Poor speech, Intellectual disability, severe SLC25A35 NM_001320870.1:c.194G>Ap.(Gly65Asp) AR_homo 4.7 homo maternal& paternal 3ndd Microcephaly, Intellectual disability, Intellectual disability, mild, Global developmental delay, Intellectual disability, moderate, Poor speech, Intellectual disability, severe GRIK5 NM_001301030.1:c.818C>Ap.(Ser273Tyr) NM_001301030.1:c.1745G>Ap.(Arg582His) AR_comphet 8.6 comphet maternal& paternal 2 NDD + Epilepsy Strabismus, Single umbilical artery, Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Spastic tetraparesis, Absent speech, Generalized myoclonic seizures, Polymicrogyria, Tetraparesis, Intellectual disability, moderate, EEG abnormality, Sleep disturbance, Myoclonic spasms, Unilateral polymicrogyria, Frontoparietal polymicrogyria, Generalized tonic seizures, Epileptic spasms, Focal myoclonic seizures, EEG with generalized spikes, Perisylvian polymicrogyria, Tetraplegia/tetraparesis, Cognitive impairment, Maternal seizures, Abnormal eating behavior, Exodeviation, Segmental myoclonic seizures SLC25A43 NM_145305.2:c.224C>Tp.(Ala75Val) XL 6.3 hemi maternal 2 NDD Cryptorchidism, Microcephaly, Global developmental delay, Motor delay, Growth delay, Intrauterine growth retardation TRIM9 NM_015163.5:c.1117G>Ap.(Val373Met) AD_denovo 8.3 het de novo 1 NDD + Epilepsy Intellectual disability, Seizures, Muscular hypotonia, Global developmental delay, Mental deterioration, Pes cavus, Generalized tonic-clonic seizures, Generalized myoclonic seizures, Generalized seizures,Leukodystrophy, Abnormality of the cerebral white matter, Infantile spasms TAOK1 NM_020791.2:c.332C>Tp.(Ser111Phe) AD_denovo 8.8 het de novo 1 NDD Dysmorphic syndrome, cleft lip and palate, failure to thrive, macrocephaly, muscular hypotonia, developmental delay LAMA5 NM_005560.4:c.6659G>Tp.(Arg2220Leu) NM_005560.4:c.1246C>Gp.(Pro416Ala) AR_comphet 5.3 comphet maternal& paternal 2 NDD + Epilepsy Seizures, Global developmental delay, Episodic ataxia AGO2 NM_001164623.1:c.602G>Tp.(Gly201Val) AD_denovo 8.8 het de novo 1 NDD + Epilepsy Intellectual disability, Global developmental delay, Motor delay, Gait disturbance, Absent speech, Bicuspid aortic valve, Patent foramen ovale, Atrioventricular block, Intellectual disability, moderate, Poor speech, Obstructive sleep apnea, Short stature, Sleep apnea, Intellectual disability, severe, Epileptic spasms, Epileptic encephalopathy CDH20 NM_031891.3:c.958G>Cp.(Asp320His) AD_denovo 6.5 het de novo 5 NDD + Epilepsy Tall stature, Autism, Precocious puberty, Intellectual disability, Seizures, Global developmental delay, Focal seizures with impairment of consciousness or awareness, Focal seizures, Precocious puberty in males, Increased serum insulin-like growth factor 1 FUNDC1 NM_173794.3:c.154A>Gp.(Thr52Ala) XL 6.8 hemi maternal 5 NDD + Epilepsy Tall stature, Autism, Precocious puberty, Intellectual disability, Seizures, Global developmental delay, Focal seizures with impairment of consciousness or awareness, Focal seizures, Precocious puberty in males, Increased serum insulin-like growth factor 1 DDB1 NM_001923.4:c.563G>Ap.(Arg188Gln) AD_denovo 8.8 het de novo 1 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Status epilepticus, Intellectual disability, severe, Epileptiform EEG discharges, EEG with focal sharp slow waves, EEG with generalized sharp slow waves, EEG with occipital sharp slow waves, EEG with parietal sharp slow waves, EEG with temporal sharp slow waves, EEG with frontal sharp slow waves, EEG with central sharp slow waves, EEG with occipital sharp waves, EEG with parietal sharp waves SPSB1 NM_025106.3:c.572T>Cp.(Ile191Thr) AD_denovo 6.5 het de novo 5 NDD + Epilepsy Tall stature, Autism, Precocious puberty, Intellectual disability, Seizures, Global developmental delay, Focal seizures with impairment of consciousness or awareness, Focal seizures, Precocious puberty in males, Increased serum insulin-like growth factor 1
PRSS41 NM_001135086.1:c.30_41dup, p.(Leu11_Ala14dup) AR_homo 3.0 homo maternal& paternal 5 NDD + Epilepsy Tall stature, Autism, Precocious puberty, Intellectual disability, Seizures, Global developmental delay, Focal seizures with impairment of consciousness or awareness, Focal seizures, Precocious puberty in males, Increased serum insulin-like growth factor 1 RNF44 NM_014901.4:c.802-8T>Gp.? AD_denovo 4.9 het de novo 5 NDD + Epilepsy Tall stature, Autism, Precocious puberty, Intellectual disability, Seizures, Global developmental delay, Focal seizures with impairment of consciousness or awareness, Focal seizures, Precocious puberty in males, Increased serum insulin-like growth factor 1 MINPP1 NM_004897.4:c.75_94delp.(Leu27Argfs*39) AR_homo 9.2 homo maternal& paternal 2 NDD + Epilepsy Microcephaly, Intellectual disability, Seizures, Ataxia, Global developmental delay, Gait ataxia, Olivopontocerebellar atrophy, Short stature, Pontocerebellar atrophy, Olivopontocerebellar hypoplasia, Cognitive impairment LAMA5 NM_005560.4:c.10753G>Tp.(Asp3585Tyr) NM_005560.4:c.1390G>Ap.(Gly464Ser) AR_comphet 5.7 comphet maternal& paternal 1 NDD + Epilepsy Abnormality of the head, Microcephaly, Seizures, Postnatal microcephaly, Loss of consciousness, Atonic seizures CRYBG1 NM_001624.3:c.4489G>Ap.(Val1497Ile) AD_denovo 6.1 het de novo 1 NDD Hearing impairment, Prelingual sensorineural hearing impairment, Conductive hearing impairment, Hypermetropia, Nystagmus, Horizontal nystagmus, Intellectual disability, Motor delay, Growth delay, Generalized tonic-clonic seizures, Mild short stature, Proportionate short stature, Decreased body weight, High hypermetropia, Simple febrile seizures GRK3 NM_005160.3:c.916G>Tp.(Glu306*) AD_inherited 6.1 het maternal 3 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Mild global developmental delay, Moderate global developmental delay, Severe global developmental delay, Neurodevelopmental delay, Cognitive impairment, Epileptic encephalopathy TENM1 NM_001163278.1:c.757A>Gp.(Asn253Asp) XL 5.5 het maternal 3 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Mild global developmental delay, Moderate global developmental delay, Severe global developmental delay, Neurodevelopmental delay, Cognitive impairment, Epileptic encephalopathy DNAJC27 NM_016544.2:c.422delp.(His141Leufs*4) AD_inherited 5.7 het maternal 3 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Mild global developmental delay, Moderate global developmental delay, Severe global developmental delay, Neurodevelopmental delay, Cognitive impairment, Epileptic encephalopathy GUCY2F NM_001522.2:c.1445C>Gp.(Ser482Cys) AR_homo 5.1 homo maternal& paternal 2 NDD + Epilepsy Microcephaly, Intellectual disability, Seizures, Ataxia, Global developmental delay, Gait ataxia, Olivopontocerebellar atrophy, Short stature, Pontocerebellar atrophy, Olivopontocerebellar hypoplasia, Cognitive impairment ANKRD30B NM_001145029.1:c.1795G>Tp.(Glu599*) AR_homo 6.2 homo maternal& paternal 1 NDD + Epilepsy Microcephaly, Intellectual disability, Seizures, Global developmental delay UNC5A NM_133369.2:c.578C>Ap.(Ser193Tyr) NM_133369.2:c.267C>Gp.(Ile89Met) AR_comphet 4.7 comphet maternal& paternal 1 NDD + Epilepsy Hypermetropia, Intellectual disability, Seizures, Global developmental delay, Absence seizure, Intellectual disability, severe, Moderate global developmental delay, Severe global developmental delay, Profound global developmental delay, Cognitive impairment PIKFYVE NM_015040.3:c.1319A>Gp.(Gln440Arg) AR_homo 9.0 homo maternal& paternal 4 NDD Microcephaly, Autistic behavior, Intellectual disability, Intellectual disability, mild, Global developmental delay, Intellectual disability, moderate, Poor speech, Intellectual disability, severe GEMIN5 NM_015465.4:c.3340C>Gp.(Leu1114Val) NM_015465.4:c.2504A>Gp.(Lys835Arg) AR_comphet 6.6 comphet maternal& paternal 3 NDD + Epilepsy Delayed speech and language development, Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Absence seizure, Typical absence seizure, Early onset absence seizures VPS54 NM_016516.2:c.701C>Tp.(Ala234Val) AR_homo 8.2 homo maternal& paternal 4 NDD Microcephaly, Autistic behavior, Intellectual disability, Intellectual disability, mild, Global developmental delay, Intellectual disability, moderate, Poor speech, Intellectual disability, severe BCAS1 NM_003657.3:c.1720C>Tp.(Pro574Ser) AR_homo 6.6 homo maternal& paternal 4 NDD Microcephaly, Autistic behavior, Intellectual disability, Intellectual disability, mild, Global developmental delay, Intellectual disability, moderate, Poor speech, Intellectual disability, severe LRIG3 NM_153377.4:c.979G>Ap.(Asp327Asn) AD_denovo 6.7 het de novo 1 NDD Global developmental delay, Absent speech, Myelomeningocele
COPS2 NM_001143887.1:c.37G>Ap.(Glu13Lys) AD_denovo 8.6 het de novo 3 NDD + Epilepsy Delayed speech and language development, Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Absence seizure, Typical absence seizure, Early onset absence seizures ATP2B1 NM_001001323.1:c.1376A>Gp.(His459Arg) AD_denovo 8.8 het de novo 3 NDD + Epilepsy Autism, Intellectual disability, Seizures, Global developmental delay, Poor speech, Focal seizures CD99L2 NM_001242614.1:c.541G>Cp.(Gly181Arg) XL 3.9 hemi maternal 1 NDD + Epilepsy Tall stature, Glaucoma, Growth hormone excess, Intellectual disability, Seizures, Global developmental delay, Obesity, Mitral regurgitation, Abnormal facial shape, Progeroid facial appearance, Focal-onset seizure RHEB NM_005614.3:c.47C>Tp.(Ser16Phe) AD_denovo 7.9 het de novo 1 NDD + Epilepsy Tall stature, Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Abnormal facial shape, normal MRI PSMC5 NM_002805.5:c.587delp.(Lys196Argfs*29) AD_inherited 8.4 het maternal 2 NDD Microcephaly, Intellectual disability, Muscular hypotonia, Intellectual disability, mild, Global developmental delay, Abnormal facial shape, Intellectual disability, moderate, Scoliosis, Short stature, Cognitive impairment NOVA2 NM_002516.3:c.1267G>Cp.(Gly423Arg) AD_inherited 5.5 het maternal 2 NDD Microcephaly, Intellectual disability, Muscular hypotonia, Intellectual disability, mild, Global developmental delay, Abnormal facial shape, Intellectual disability, moderate, Scoliosis, Short stature, Cognitive impairment PTPRN2 Del(NM_002847.4)-7-157873875-158384503 AD_denovo 6.7 het de novo 1 NDD Behavioral abnormality, Autism, Delayed speech and language development, Intellectual disability, Intellectual disability, mild, Intellectual disability, moderate, Poor speech, Intellectual disability, borderline LCN1 NM_001252618.1:c.305A>Gp.(His102Arg) AD_denovo 3.4 het de novo 1 NDD Tall stature, delayed speech and language development, neuroblastoma ORC3 NM_181837.2:c.419A>Gp.(Asp140Gly) AR_homo 6.7 homo maternal& paternal 4 NDD Delayed speech and language development, Intellectual disability, Muscular hypotonia, Global developmental delay, Motor delay, Intellectual disability, profound, Delayed gross motor development, Intellectual disability, moderate, Severe muscular hypotonia, Muscular hypotonia of the trunk, Infantile muscular hypotonia, Intellectual disability, severe, Central hypotonia, Cognitive impairment SRRM4 NM_194286.3:c.560G>Ap.(Arg187His) NM_194286.3:c.140C>Tp.(Pro47Leu) AR_comphet 5.1 comphet maternal& paternal 1 NDD Microcephaly, Brachydactyly, Syndactyly, Intellectual disability, Intellectual disability, mild, Motor delay, Hypertonia, Toe syndactyly, Intellectual disability, moderate, 2-3 toe syndactyly, Feeding difficulties, Cognitive impairment, Impaired feeding ability ALDH8A1 NM_022568.3:c.160G>Tp.(Ala54Ser) AD_denovo 5.6 het de novo 1 NDD Macrocephaly, Global developmental delay, Hepatosplenomegaly, Hypertriglyceridemia, Hepatomegaly, Recurrent infections PLCH2 NM_014638.3:c.595C>Tp.(His199Tyr) AD_inherited 2.5 het paternal 2 NDD Intellectual disability FEN1 NM_004111.5:c.140G>Ap.(Arg47His) AR_homo 6.5 homo maternal& paternal 1 NDD + Epilepsy Seizures, Focal impaired awareness seizure, Spherocytosis, Arrhythmia CX3CR1 NM_001171174.1:c.756delp.(Cys253Alafs*12) AD_inherited 6.0 het maternal 1 Neuro Familial predisposition, Migraine, EEG abnormality, Episodic hemiplegia, Left hemiplegia TMEM151B NM_001137560.1:c.1319T>Ap.(Val440Asp) AD_denovo 6.3 het de novo 1 NDD + Epilepsy Cleft soft palate, Hydrocephalus, Abnormality of the inner ear, Hearing impairment, Iris coloboma, Delayed speech and language development, Macular coloboma, Intellectual disability, Seizures, Global developmental delay, Agenesis of corpus callosum, Dandy-Walker malformation, Abnormal ear morphology FAM214B NM_001317991.1:c.588delp.(Ile196Metfs*115) AD_inherited 6.5 het paternal 2 NDD Intellectual disability SENP3 NM_015670.5:c.713C>Ap.(Ser238*) AD_denovo 8.7 het de novo 3 NDD + Epilepsy epilepsy with absences and generalized tonic-clonic seizures, severe intellectual disability with autistic traits, low blood pressure, obstipation, normal MRI 2008 BDP1 NM_018429.2:c.6847G>Tp.(Glu2283*) AR_homo 9.4 homo maternal& paternal 3 NDD + Epilepsy Delayed speech and language development, Seizures, Global developmental delay, Motor delay, Generalized tonic-clonic seizures, Generalized myoclonic seizures, Febrile seizures, Postnatal microcephaly, suspected myopia CHD5 NM_015557.2:c.776C>Gp.(Ser259Cys) NM_015557.2:c.3650C>Tp.(Thr1217Ile) AR_comphet 5.8 comphet maternal& paternal 2 NDD Delayed speech and language development, Intellectual disability DENND4B NM_014856.2:c.319G>Ap.(Val107Met) NM_014856.2:c.941G>Ap.(Ser314Asn) AR_comphet 4.3 comphet maternal& paternal 2 NDD Delayed speech and language development, Intellectual disability
RHOT2 NM_138769.2:c.586T>Gp.(Ser196Ala) NM_138769.2:c.1201C>Tp.(Arg401Cys) AR_comphet 4.9 comphet maternal& paternal 1 NDD + Epilepsy spastic tetraparesis, generalized tonic-clonic seizures, microcephaly, polymicrogyria, periventricular gliosis and cysts, global developmental delay CAPN9 NM_006615.2:c.1591G>Ap.(Ala531Thr) NM_006615.2:c.12731_1287delp.(Cys425Glufs*262) AR_comphet 7.4 comphet maternal& paternal 1 NDD Global developmental delay, Motor delay, Polyneuropathy, Hip dysplasia, Coxa valga, Kyphosis KCNJ4 NM_020452.3:c.1745G>Ap.(Arg582Gln) AD_denovo 6.4 het de novo 2 NDD Intellectual disability, Intellectual disability, mild, Intellectual disability, moderate, Increased body weight, Increased adipose tissue DIP2A NM_015151.3:c.410C>Tp.(Ser137Leu) NM_015151.3:c.2476G>Ap.(Ala826Thr) AR_comphet 6.0 comphet maternal& paternal 2 NDD Intellectual disability, Intellectual disability, mild, Intellectual disability, moderate, Increased body weight, Increased adipose tissue AKAP13 NM_006738.5:c.742C>Tp.(Arg248*) AD_denovo 9.9 het de novo 1 NDD + Epilepsy Seizures, Global developmental delay, Generalized tonic-clonic seizures, Generalized myoclonic seizures, Generalized tonic seizures, Epileptic encephalopathy AKAP17A NM_005088.2:c.1328T>Cp.(Leu443Pro) AD_denovo 4.9 het de novo 2 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Generalized tonic-clonic seizures, Focal clonic seizures, Intellectual disability, moderate, Increased body weight, Focal-onset seizure, Increased adipose tissue, Generalized tonic seizures, Focal myoclonic seizures, Focal tonic seizures UTP11 NM_016037.3:c.230A>Gp.(Asp77Gly) AD_denovo 5.2 het de novo 2 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Generalized tonic-clonic seizures, Focal clonic seizures, Intellectual disability, moderate, Increased body weight, Focal-onset seizure, Increased adipose tissue, Generalized tonic seizures, Focal myoclonic seizures, Focal tonic seizures GPSM3 NM_001276501.1:c.318G>Cp.(Gln106His) AD_denovo 4.7 het de novo 2 Neuro Microcephaly, Edema, Agenesis of corpus callosum, Abnormal cerebellum morphology, Cerebellar hypoplasia, Growth abnormality, Growth delay, Intrauterine growth retardation, Hypoplasia of the corpus callosum, Polymicrogyria, Abnormality of neuronal migration, Gray matter heterotopias, Gray matter heterotopia, Spontaneous abortion, Periventricular heterotopia, White matter neuronal heterotopia, Aplasia/Hypoplasia of the cerebellum, Fetal onset, Small cerebellar cortex EMC9 NM_016049.3:c.158A>Tp.(His53Leu) AD_denovo 5.0 het de novo 2 Neuro Microcephaly, Edema, Agenesis of corpus callosum, Abnormal cerebellum morphology, Cerebellar hypoplasia, Growth abnormality, Growth delay, Intrauterine growth retardation, Hypoplasia of the corpus callosum, Polymicrogyria, Abnormality of neuronal migration, Gray matter heterotopias, Gray matter heterotopia, Spontaneous abortion, Periventricular heterotopia, White matter neuronal heterotopia, Aplasia/Hypoplasia of the cerebellum, Fetal onset, Small cerebellar cortex SLC4A7 NM_001321103.1:c.249_252delp.(Lys83Asnfs*62 ) AR_homo 8.2 homo maternal& paternal 4 NDD Adducted thumb, Intellectual disability, Intellectual disability, mild, Global developmental delay, Abnormal facial shape, Pyloric stenosis, Ventriculomegaly, Intellectual disability, moderate, Infantile muscular hypotonia, Feeding difficulties, Cognitive impairment, Impaired feeding ability SCRN1 NM_001145514.1:c.1106A>Gp.(Lys369Arg) AR_homo 5.9 homo maternal& paternal 4 NDD Adducted thumb, Intellectual disability, Intellectual disability, mild, Global developmental delay, Abnormal facial shape, Pyloric stenosis, Ventriculomegaly, Intellectual disability, moderate, Infantile muscular hypotonia, Feeding difficulties, Cognitive impairment, Impaired feeding ability, VUS in COLQ (31.07.2019) COL20A1 NM_020882.2:c.3614-8C>Tp.? AD_denovo 3.9 het de novo 4 NDD Adducted thumb, Intellectual disability, Intellectual disability, mild, Global developmental delay, Abnormal facial shape, Pyloric stenosis, Ventriculomegaly, Intellectual disability, moderate, Infantile muscular hypotonia, Feeding difficulties, Cognitive impairment, Impaired feeding ability, VUS in COLQ (31.07.2019) WTAP NM_001270531.1:c.463A>Gp.(Lys155Glu) AD_denovo 6.9 het de novo 1 NDD Microcephaly, Hyperactivity, Global developmental delay, dystrophy
GPR161 NM_001267609.1:c.1550dup, p.(Gly518Argfs*44) AD_denovo 7.1 het de novo 2 NDD Hypertelorism, Low-set ears, Brachydactyly, Intellectual disability, Global developmental delay, Hypoplasia of the corpus callosum, Elevated serum creatinine, Moderate global developmental delay TENM2 NM_001122679.1:c.4082A>Gp.(Tyr1361Cys) NM_001122679.1:c.7924G>Ap.(Val2642Met) AR_comphet 5.0 comphet maternal& paternal 2 NDD Hypertelorism, Low-set ears, Brachydactyly, Intellectual disability, Global developmental delay, Hypoplasia of the corpus callosum, Elevated serum creatinine, Moderate global developmental delay H3-3A NM_002107.4:c.250C>Gp.(Arg84Gly) AD_denovo 9.8 het de novo 2 NDD + Epilepsy Stereotypy, Delayed speech and language development, Global developmental delay, Motor delay, Delayed gross motor development, EEG abnormality, Delayed fine motor development CHURC1 NM_145165.3:c.349_350insGp.(Leu117Argfs*15) NM_145165.3:c.400delp.(Arg134Aspfs*3) AR_comphet 7.8 comphet maternal& paternal 2 NDD + Epilepsy Tall stature, Macrocephaly, Delayed speech and language development, Enuresis, Seizures, Global developmental delay, Obesity, Rett syndrome RGL1 NM_015149.4:c.737C>Gp.(Ser246Cys) AD_denovo 6.4 het de novo 2 NDD + Epilepsy Tall stature, Macrocephaly, Delayed speech and language development, Enuresis, Seizures, Global developmental delay, Obesity, Rett syndrome USF3 NM_001009899.3:c.1750C>Tp.(Gln584*) AD_denovo 8.6 het de novo 1 NDD muscular hypotonia, developmental delay, normal cMRI, left retinal coloboma EFHC1 NM_018100.3:c.323delp.(Pro108Leufs*13) AR_homo 9.9 homo maternal& paternal 3 NDD Microcephaly, Intellectual disability, Intellectual disability, mild, Global developmental delay, Intellectual disability, moderate, Poor speech, Intellectual disability, severe WWP2 NM_001270453.1:c.491A>Cp.(Glu164Ala) NM_001270453.1:c.166G>Cp.(Ala56Pro) AR_comphet 4.6 comphet maternal& paternal 2 NDD + Epilepsy Strabismus, Single umbilical artery, Intellectual disability, Seizures, Intellectual disability, mild, Global developmental delay, Spastic tetraparesis, Absent speech, Generalized myoclonic seizures, Polymicrogyria, Tetraparesis, Intellectual disability, moderate, EEG abnormality, Sleep disturbance, Myoclonic spasms, Unilateral polymicrogyria, Frontoparietal polymicrogyria, Generalized tonic seizures, Epileptic spasms, Focal myoclonic seizures, EEG with generalized spikes, Perisylvian polymicrogyria, Tetraplegia/tetraparesis, Cognitive impairment, Maternal seizures, Abnormal eating behavior, Exodeviation, Segmental myoclonic seizures CTBP2 NM_022802.2:c.1192dup, p.(Arg398Profs*68) AD_inherited 7.9 het maternal 3 NDD + Epilepsy Intellectual disability, epilepsy with generalized tonic-clonic seizures, short attention span SLIT3 NM_003062.3:c.2818C>Tp.(Arg940Cys) AD_inherited 5.1 het maternal 3 NDD + Epilepsy Intellectual disability, epilepsy with generalized tonic-clonic seizures, short attention span CHKA NM_001277.2:c.1021T>Cp.(Phe341Leu) NM_001277.2:c.14dup, p.(Cys6Leufs*19) AR_comphet 7.0 comphet maternal& paternal 1 NDD + Epilepsy severe psychomotor retardation, central movement disorder with preference for right-sided extremities, epilepsy with epileptic spasms, microcephaly, tendency to self-harm CLCC1 NM_001048210.2:c.1324C>Tp.(Leu442Phe) AD_inherited 4.0 het maternal 3 NDD + Epilepsy Intellectual disability, epilepsy with generalized tonic-clonic seizures, short attention span ABCA2 NM_001606.4:c.2261T>Cp.(Phe754Ser) AD_denovo 9.0 het de novo 3 NDD + Epilepsy epilepsy, febrile seizures SF3A3 NM_006802.3:c.1408C>Tp.(Arg470*) AD_denovo 8.9 het de novo 3 NDD + Epilepsy epilepsy with febrile seizures and dyscognitive seizures NLE1 NM_018096.4:c.593A>Gp.(His198Arg) AD_denovo 6.7 het de novo 3 NDD + Epilepsy epilepsy, febrile seizures FRYL NM_015030.1:c.3851T>Gp.(Leu1284Arg) AR_homo 6.3 homo maternal& paternal 1 NDD Cryptorchidism, Hydroureter, Cleft palate, Cleft soft palate, Global developmental delay, Absent septum pellucidum, Polyhydramnios, Premature birth, Abnormal facial shape, Ventriculomegaly, Severe short stature, Short stature, Frontal cortical atrophy, Temporal cortical atrophy, Bilateral cryptorchidism, Moderately short stature, Brain atrophy ADAMTSL1 NM_001040272.5:c.1316A>Gp.(Lys439Arg) AD_denovo 5.8 het de novo 1 NDD + Epilepsy Global developmental delay, dystonic movements, abnormal EEG, epilepsy, microcephaly, clinodactyly of the 5th finger, pectus excavatum STARD9 NM_020759.2:c.4624C>Ap.(Leu1542Met) NM_020759.2:c.1655G>Tp.(Arg552Leu) AR_comphet 3.3 comphet maternal& paternal 2 NDD Seizures, Generalized tonic-clonic seizures, Myoclonic atonic seizures, Epileptic encephalopathy CRIM1 NM_016441.2:c.2867C>Tp.(Ala956Val) NM_016441.2:c.1658+4C>Tp.? AR_comphet 3.5 comphet maternal& paternal 2 Neuro Dystonia, Flexion contracture, Difficulty walking, Limb dystonia, Progressive inability to walk, Ankle flexion contracture, Loss of ability to walk in first decade, Inability to walk by childhood/adolescence, Loss of ability to walk, Generalized dystonia
ABCA2 NM_001606.4:c.801_802delTGinsGTp.(Val268Ph e) AR_homo 7.3 homo maternal& paternal 4 NDD Adducted thumb, Intellectual disability, Intellectual disability, mild, Global developmental delay, Abnormal facial shape, Pyloric stenosis, Ventriculomegaly, Intellectual disability, moderate, Infantile muscular hypotonia, Feeding difficulties, Cognitive impairment, Impaired feeding ability, VUS in COLQ (31.07.2019) BIRC6 NM_016252.3:c.10735A>Gp.(Met3579Val) AR_homo 6.4 homo maternal& paternal 2 NDD + Epilepsy Microcephaly, Visual impairment, Intellectual disability, Seizures, Global developmental delay, Motor delay, Encephalopathy, Generalized tonic-clonic seizures PPM1L NM_139245.3:c.237G>Cp.(Glu79Asp) AR_homo 4.4 homo maternal& paternal 2 NDD + Epilepsy Microcephaly, Visual impairment, Intellectual disability, Seizures, Global developmental delay, Motor delay, Encephalopathy, Generalized tonic-clonic seizures RGMA NM_001166283.1:c.748G>Cp.(Ala250Pro) AD_denovo 6.9 het de novo 2 NDD Spasticity, Global developmental delay, Motor delay, Cerebral palsy, Abnormality of movement, Dyskinesia ANXA6 NM_001155.4:c.1670C>Tp.(Pro557Leu) NM_001155.4:c.319-6_319-5delCCinsTGp.? AR_comphet 4.0 comphet maternal& paternal 2 NDD Spasticity, Global developmental delay, Motor delay, Cerebral palsy, Abnormality of movement, Dyskinesia NRDE2 NM_017970.3:c.441delp.(Arg148Alafs*11) AR_homo 8.5 homo maternal& paternal 1 NDD Intellectual disability, seizures, global developmental delay, encephalopathy infantile spasms INTS7 NM_015434.3:c.2240G>Tp.(Arg747Ile) AD_denovo 6.0 het de novo 1 NDD Microcephaly, Intrauterine growth retardation, Abnormal facial shape, Basal ganglia calcification, Cerebral calcification, Congenital intracerebral calcification SF3A1 NM_005877.5:c.310G>Ap.(Gly104Arg) AD_denovo 7.3 het de novo 1 NDD + Epilepsy Seizures, Global developmental delay, Abnormality of movement, Epileptic encephalopathy SLC16A10 NM_018593.4:c.626G>Ap.(Gly209Asp) AD_denovo 6.6 het de novo 1 NDD + Epilepsy Microcephaly, Behavioral abnormality, Seizures, Global developmental delay, Absence seizure, Generalized-onset seizure, Myoclonic atonic seizures MROH2B NM_173489.4:c.3685delp.(Asp1229Thrfs*15) AD_denovo 5.0 het de novo 1 NDD + Epilepsy Seizures, Encephalopathy, Absence seizure, Generalized-onset seizure PRDX2 NM_005809.5:c.153C>Ap.(Cys51*) AD_denovo 7.3 het de novo 1 NDD + Epilepsy Seizures, absent septum pellucidum, paroxysmal dyskinesia, dyskinesia SLC5A7 NM_021815.4:c.178+1G>Cp.? AD_inherited 7.8 het maternal 1 Neuro Ataxia, spastic paraplegia, muscle weakness, hyperreflexia, pes cavus, myalgia, limb muscle weakness, paraplegia ZNF341 NM_032819.4:c.2260C>Tp.(Arg754Cys) AD_denovo 4.3 het de novo 2 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Specific learning disability, Absence seizure, Generalized-onset seizure, Intellectual disability, borderline, Attention deficit hyperactivity disorder KCNK7 NM_033347.1:c.681C>Gp.(His227Gln) AD_denovo 4.7 het de novo 1 NDD + Epilepsy Seizures, Generalized tonic-clonic seizures, Generalized myoclonic seizures ZZEF1 NM_015113.3:c.1580C>Tp.(Pro527Leu) AD_denovo 5.9 het de novo 2 NDD + Epilepsy Intellectual disability, Seizures, Intellectual disability, mild, Specific learning disability, Absence seizure, Generalized-onset seizure, Intellectual disability, borderline, Attention deficit hyperactivity disorder MTMR3 NM_021090.3:c.848A>Gp.(Asn283Ser) NM_021090.3:c.1088G>Ap.(Arg363Gln) AR_comphet 4.3 comphet maternal& paternal 1 NDD + Epilepsy Delayed speech and language development, Seizures, Global developmental delay, Focal impaired awareness seizure, Cortical dysplasia, Focal-onset seizure, Complex febrile seizures, Abnormal morphology of the hippocampus INPP5F NM_014937.3:c.3172_3174delp.(Ser1058del) NM_014937.3:c.3144_3149delp.(Leu1049_Glu 1050del) AR_comphet 4.1 comphet maternal& paternal 1 NDD + Epilepsy Global developmental delay, Epileptic spasms HCN2 NM_001194.3:c.1120A>Cp.(Met374Leu) AD_denovo 8.9 het de novo 1 NDD + Epilepsy Microcephaly, delayed speech and language development, intellectual disability, global developmental delay, motor delay, generalized-onset seizure, epileptic spasms, cognitive impairment DHX36 NM_020865.2:c.800_802delp.(Ile267del) AD_denovo 5.9 het de novo 1 NDD Short attention span, Delayed speech and language development, Intellectual disability, Muscular hypotonia, Global developmental delay, Motor delay, Delayed gross motor development, Attention deficit hyperactivity disorder, Delayed fine motor development DOCK3 NM_004947.4:c.1175G>Ap.(Arg392Gln) NM_004947.4:c.3740T>Cp.(Met1247Thr) AR_comphet 9.3 comphet maternal& paternal 1 NDD + Epilepsy Seizures, Global developmental delay
SEZ6L2 NM_001243332.1:c.1084G>Ap.(Val362Met) NM_001243332.1:c.85C>Tp.(Pro29Ser) AR_comphet 6.1 comphet maternal& paternal 1 NDD + Epilepsy Seizures, status epilepticus, focal-onset seizure, EEG with spike-wave complexes, epilepsy not completely under control, cognitive deficiency, intellectual disability NOP58 NM_015934.4:c.1018C>Gp.(Leu340Val) AD_denovo 7.0 het de novo 1 NDD + Epilepsy Autism, Intellectual disability, Status epilepticus, Focal-onset seizure, Hippocampal atrophy SLITRK4 NM_001184749.2:c.2435T>Cp.(Phe812Ser) XL 5.1 hemi maternal 1 NDD Myopia, Autism, Autistic behavior, Delayed speech and language development, Intellectual disability, Intellectual disability, mild, Dysarthria, Global developmental delay, Delayed gross motor development, Intellectual disability, moderate, Delayed fine motor development, High myopia PGBD2 NM_170725.2:c.607A>Cp.(Thr203Pro) AD_denovo 4.0 het de novo 2 NDD Autism, Autistic behavior, Intellectual disability, Global developmental delay, Situs inversus totalis, Abnormal facial shape, Asthma, Recurrent respiratory infections, Short stature, Respiratory tract infection ZNF81 NM_007137.3:c.476A>Gp.(Lys159Arg) XL 6.5 hemi maternal 2 NDD Autism, Autistic behavior, Intellectual disability, Global developmental delay, Situs inversus totalis, Abnormal facial shape, Asthma, Recurrent respiratory infections, Short stature, Respiratory tract infection ZFYVE26 NM_015346.3:c.5779T>Ap.(Tyr1927Asn) AD_denovo 10.3 het de novo 1 NDD Global developmental delay, Absent speech, Proportionate short stature, Short stature FAT3 NM_001008781.2:c.1367C>Tp.(Ala456Val) NM_001008781.2:c.11012G>Tp.(Arg3671Leu) AR_comphet 5.1 comphet maternal& paternal 1 NDD + Epilepsy strukturelle und therapierefraktäre Epilepsie (ESES/CSWS), zervikale Syringomyelie, Intelligenzminderung, Verhaltensauffälligkeiten, Z.n. IVH Grad IV (intraventrikuläre Hämorrhagie) in 2. Lebenswoche, cMRT-Auffälligkeiten PKN3 NM_013355.4:c.137A>Cp.(Asp46Ala) AD_denovo 5.0 het de novo 1 NDD + Epilepsy Generalisierte Epilepsie mit febrilen Anfällen seit dem 3. LJ DACH2 NM_053281.3:c.1519G>Tp.(Val507Phe) XL 3.4 hemi maternal 2 NDD Macrocephaly, Intellectual disability, Intellectual disability, mild, Global developmental delay, Intellectual disability, profound, Intellectual disability, moderate, Intellectual disability, severe, Cognitive impairment GABRE NM_004961.3:c.319G>Tp.(Gly107Cys) XL 4.9 hemi maternal 2 NDD Macrocephaly, Intellectual disability, Intellectual disability, mild, Global developmental delay, Intellectual disability, profound, Intellectual disability, moderate, Intellectual disability, severe, Cognitive impairment ARRB2 NM_001257328.1:c.684+1G>Cp.? AD_denovo 10.2 het de novo 1 NDD + Epilepsy autism-spectre disorder, focalonset epilepsy DBF4B NM_145663.2:c.902G>Tp.(Cys301Phe) AR_homo 6.3 homo maternal& paternal 4 NDD Microcephaly, Autistic behavior, Intellectual disability, Intellectual disability, mild, Global developmental delay, Intellectual disability, moderate, Poor speech, Intellectual disability, severe TBC1D9B NM_198868.2:c.583G>Tp.(Ala195Ser) AD_denovo 5.6 het de novo 1 Neuro Abnormality of the optic nerve, Optic atrophy, Polyneuropathy, Encephalopathy, Leukoencephalopathy, Leukodystrophy, Tetraplegia CASP9 NM_001229.4:c.631-6T>Cp.? NM_001229.4:c.710A>Cp.(His237Pro) AR_comphet 6.5 comphet maternal& paternal 3 NDD Renal agenesis, Abnormal cornea morphology, Aniridia, Microphthalmia, Global developmental delay TNPO3 NM_012470.3:c.2541dup, p.(Tyr848Leufs*8) AD_denovo 6.9 het de novo 3 NDD Renal agenesis, Abnormal cornea morphology, Aniridia, Microphthalmia, Global developmental delay SLC23A1 NM_152685.3:c.1105A>Gp.(Ile369Val) NM_152685.3:c.1063C>Ap.(Pro355Thr) AR_comphet 4.5 comphet maternal& paternal 3 NDD Renal agenesis, Abnormal cornea morphology, Aniridia, Microphthalmia, Global developmental delay DGKK NM_001013742.3:c.1247A>Tp.(His416Leu) XL 1.0 hemi maternal 4 NDD Micropenis, Intellectual disability, Intellectual disability, mild, Global developmental delay SMARCA1 NM_003069.4:c.34G>Ap.(Val12Met) XL 6.5 hemi maternal 4 NDD Micropenis, Intellectual disability, Intellectual disability, mild, Global developmental delay PON1 NM_000446.5:c.717G>Cp.(Glu239Asp) AD_denovo 5.3 het de novo 4 NDD Micropenis, Intellectual disability, Intellectual disability, mild, Global developmental delay
KCNN2 NM_021614.3:c.1082A>Gp.(Tyr361Cys) AD_denovo 7.8 het de novo 2 NDD Myopia, Nystagmus, Stereotypy, Delayed speech and language development, Intellectual disability, Motor delay, Absent speech, Abnormality of the foot, Intellectual disability, profound, Difficulty walking, Poor speech, Equinus calcaneus, Vertical nystagmus, Intellectual disability, severe, Severe global developmental delay, Pschomotor retardation CAND2 NM_001162499.1:c.2591C>Tp.(Ala864Val) AD_denovo 4.8 het de novo 4 NDD Micropenis, Intellectual disability, Intellectual disability, mild, Global developmental delay MARVELD3 NM_001017967.3:c.1168G>Ap.(Gly390Ser) AD_denovo 5.2 het de novo 1 NDD Autistic behavior, Intellectual disability, Global developmental delay, Obesity, Polyphagia, Developmental stagnation, Retractile testis, Cognitive impairment SLC32A1 NM_080552.2:c.787G>Ap.(Val263Met) AD_denovo 7.8 het de novo 2 NDD + Epilepsy Intellectual disability, Seizures, Generalized myoclonic seizures, Infantile onset CLCN3 NM_173872.3:c.336_339delp.(Lys112Asnfs*6) AR_homo 11.1 homo maternal& paternal 2 NDD + Epilepsy Microcephaly, Intellectual disability, Seizures, Global developmental delay, Abnormal corpus callosum morphology, Agenesis of corpus callosum, Generalized tonic-clonic seizures, Hypoplasia of the corpus callosum, Generalized myoclonic seizures, Generalized-onset seizure, Atonic seizures, Epileptic spasms ANKRD6 NM_001242809.1:c.1667C>Tp.(Pro556Leu) AD_denovo 5.1 het de novo 1 NDD Dandy-Walker malformation, Omphalocele, Occipital encephalocele, Meningocele MORC4 NM_024657.4:c.1382A>Gp.(Tyr461Cys) XL 5.1 hemi maternal 2 NDD + Epilepsy Microcephaly, Intellectual disability, Seizures, Global developmental delay, Abnormal corpus callosum morphology, Agenesis of corpus callosum, Generalized tonic-clonic seizures, Hypoplasia of the corpus callosum, Generalized myoclonic seizures, Generalized-onset seizure, Atonic seizures, Epileptic spasms PAM NM_001319943.1:c.1670C>Gp.(Ser557Trp) AR_homo 6.5 homo maternal& paternal 2 NDD Strabismus, Delayed speech and language development, Intellectual disability, Intellectual disability, mild, Global developmental delay, Motor delay, Generalized hypotonia, Intellectual disability, moderate, Intellectual disability, severe MYO9B NM_001130065.1:c.248C>Tp.(Ser83Leu) NM_001130065.1:c.5020G>Ap.(Val1674Met) AR_comphet 4.5 comphet maternal& paternal 2 NDD Strabismus, Delayed speech and language development, Intellectual disability, Intellectual disability, mild, Global developmental delay, Motor delay, Generalized hypotonia, Intellectual disability, moderate, Intellectual disability, severe CSNK1A1 NM_001025105.2:c.686G>Ap.(Arg229Gln) AD_denovo 7.7 het de novo 3 NDD Microcephaly, Delayed speech and language development, Intellectual disability, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia HEPH NM_138737.4:c.812_814delp.(Pro271del) XL 3.9 hemi maternal 3 NDD Microcephaly, Delayed speech and language development, Intellectual disability, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia DNHD1 NM_144666.2:c.2758A>Gp.(Ser920Gly) NM_144666.2:c.2546G>Ap.(Arg849Gln) AR_comphet 3.7 comphet maternal& paternal 3 NDD Microcephaly, Delayed speech and language development, Intellectual disability, Muscular hypotonia, Global developmental delay, Motor delay, Generalized hypotonia RADIL NM_018059.4:c.1450C>Tp.(Gln484*) AR_homo 7.5 homo maternal& paternal 1 NDD recurrent hypoglycemia, microcephaly, hypopiturism PHACTR3 NM_001199505.1:c.17G>Tp.(Gly6Val) AD_denovo 5.5 het de novo 1 NDD Intellectual disability, Global developmental delay PTBP1 NM_002819.4:c.144A>Tp.(Lys48Asn) AD_denovo 8.3 het de novo 2 NDD Cleft palate, Cleft soft palate, Thickened nuchal skin fold, Intellectual disability, Global developmental delay, Small for gestational age, Short stature, Cleft hard palate TNR NM_003285.2:c.3659C>Tp.(Ser1220Phe) NM_003285.2:c.496A>Gp.(Thr166Ala) AR_comphet 5.2 comphet maternal& paternal 2 NDD Cleft palate, Cleft soft palate, Thickened nuchal skin fold, Intellectual disability, Global developmental delay, Small for gestational age, Short stature, Cleft hard palate MAB21L4 NM_001085437.2:c.755A>Gp.(Tyr252Cys) AD_denovo 3.8 het de novo 1 NDD Abnormality of dental enamel, Autistic behavior, Delayed speech and language development, Global developmental delay, Motor delay, Sleep disturbance, Poor coordination NAV2 NM_001244963.1:c.2486C>Tp.(Pro829Leu) NM_001244963.1:c.7137+3G>Ap.? AR_comphet 5.4 comphet maternal& paternal 1 NDD Astigmatism, Hypermetropia, Delayed speech and language development, Intellectual disability, Intellectual disability, mild, Global developmental delay, Motor delay, Dandy-Walker malformation, Cerebellar hypoplasia, Delayed gross motor development, Enlarged cisterna magna, Scoliosis, High hypermetropia, Intellectual disability, severe, Mild global developmental delay, Cognitive impairment, Hernia, Mild hypermetropia
MED14 NM_004229.3:c.3657T>Gp.(His1219Gln) XL 4.0 hemi maternal 1 NDD + Epilepsy Autistic behavior, Intellectual disability, Seizures, Global developmental delay, Intellectual disability, severe, Severe global developmental delay, Epileptic encephalopathy MYRIP NM_001284423.1:c.1525G>Ap.(Asp509Asn) NM_001284423.1:c.2419C>Tp.(Pro807Ser) AR_comphet 4.3 comphet maternal& paternal 1 NDD + Epilepsy Hearing impairment, Delayed speech and language development, Atopic dermatitis, Intellectual disability, Seizures, Motor delay, Pachygyria, Lissencephaly, Bradykinesia, Dysdiadochokinesis, Orofacial dyskinesia, Poor speech, Scoliosis, Aspiration, Thoracic scoliosis, Thoracolumbar scoliosis, Lumbar scoliosis, Allergy ZNF692 NM_001136036.2:c.70C>Gp.(Gln24Glu) AD_denovo 5.4 het de novo 2 NDD + Epilepsy Seizures, Global developmental delay, Generalized-onset seizure, Periventricular leukomalacia FAT1 NM_005245.3:c.11017G>Cp.(Val3673Leu) NM_005245.3:c.6079C>Tp.(Arg2027Cys) AR_comphet 6.0 comphet maternal& paternal 2 NDD + Epilepsy Seizures, Global developmental delay, Generalized-onset seizure, Periventricular leukomalacia PAPOLG NM_022894.3:c.533C>Gp.(Ser178*) AD_denovo 9.2 het de novo 4 NDD + Epilepsy Seizures, Generalized-onset seizure SCN11A NM_014139.2:c.95C>Tp.(Ala32Val) NM_014139.2:c.2821G>Ap.(Glu941Lys) AR_comphet 6.1 comphet maternal& paternal 4 NDD + Epilepsy Seizures, Generalized-onset seizure HSD17B6 NM_003725.3:c.440G>Ap.(Ser147Asn) AD_denovo 6.0 het de novo 4 NDD + Epilepsy Seizures, Generalized-onset seizure XDH NM_000379.3:c.2559G>Cp.(Lys853Asn) AD_denovo 6.3 het de novo 4 NDD + Epilepsy Seizures, Generalized-onset seizure FYTTD1 NM_032288.6:c.755G>Cp.(Arg252Pro) AD_denovo 6.5 het de novo 1 NDD Microcephaly, Nystagmus, Impaired social interactions, Intellectual disability, Muscular hypotonia, Global developmental delay, EEG abnormality ARMCX1 NM_016608.1:c.520dup, p.(Arg174Profs*3) XL 6.6 hemi maternal 3 NDD + Epilepsy Autistic behavior, Delayed speech and language development, Intellectual disability, Seizures, Global developmental delay, EEG abnormality, Poor fine motor coordination, Delayed social development, Cognitive impairment ARFGEF NM_020340.4:c.787G>Ap.(Ala263Thr) AD_denovo 7.0 het de novo 3 NDD + Epilepsy Autistic behavior, Delayed speech and language development, Intellectual disability, Seizures, Global developmental delay, EEG abnormality, Poor fine motor coordination, Delayed social development, Cognitive impairment DMRT3 NM_021240.3:c.917C>Tp.(Ala306Val) AD_denovo 5.4 het de novo 3 NDD + Epilepsy Autistic behavior, Delayed speech and language development, Intellectual disability, Seizures, Global developmental delay, EEG abnormality, Poor fine motor coordination, Delayed social development, Cognitive impairment CFAP74 NM_001304360.1:c.3409delp.(Gln1137Argfs*37) AD_denovo 6.0 het de novo 1 NDD + Epilepsy Delayed speech and language development, Intellectual disability, Seizures, Global developmental delay, Absence seizure, Generalized-onset seizure, EEG abnormality, Developmental regression, Poor speech H1-10 NM_006026.3:c.80C>Tp.(Ser27Leu) AR_homo 3.5 homo maternal& paternal 2 NDD Retinal dystrophy, Microphthalmia, Delayed speech and language development, Global developmental delay, Poor speech, Vitreoretinopathy, Congenital blindness DNHD1 NM_144666.2:c.3410G>Ap.(Arg1137Gln) NM_144666.2:c.2450A>Cp.(His817Pro) AR_comphet 3.6 comphet maternal& paternal 2 NDD Retinal dystrophy, Microphthalmia, Delayed speech and language development, Global developmental delay, Poor speech, Vitreoretinopathy, Congenital blindness MRO NM_001127176.1:c.550T>Ap.(Phe184Ile) AR_homo 6.3 homo maternal& paternal 1 NDD + Epilepsy Absent speech, Obesity, Intellectual disability, severe, Epilepsy RIC8B NM_001330145.1:c.399G>Cp.(Gln133His) AD_denovo 6.1 het de novo 3 Neuro Sudden spastic of lower extremitiesa and bowel incontinence at the age of 43 years SLC25A14 NM_001282197.1:c.124G>Cp.(Val42Leu) XL 5.7 hemi maternal 3 Neuro Sudden spastic of lower extremitiesa and bowel incontinence at the age of 43 years TRPC7 NM_020389.2:c.1577A>Gp.(Tyr526Cys) AR_homo 3.7 homo maternal& paternal 3 Neuro Sudden spastic of lower extremitiesa and bowel incontinence at the age of 43 years PAPSS1 NM_005443.4:c.1672G>Ap.(Val558Ile) AR_homo 5.3 homo maternal& paternal 3 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Cerebellar vermis atrophy, Cognitive impairment PDE4DIP NM_001198834.3:c.5842A>Gp.(Lys1948Glu) NM_001198834.3:c.4063C>Tp.(Arg1355*) AR_comphet 6.2 comphet maternal& paternal 3 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Cerebellar vermis atrophy, Cognitive impairment TAF5 NM_006951.4:c.479C>Tp.(Ala160Val) AR_homo 4.9 homo maternal& paternal 3 NDD + Epilepsy Intellectual disability, Seizures, Global developmental delay, Cerebellar vermis atrophy, Cognitive impairment
JPH4 NM_001146028.1:c.953_956delp.(Gly318Alafs*5 3) AD_denovo 10.2 het de novo 1 NDD Microcephaly, Autism, Intellectual disability, Muscular hypotonia, Global developmental delay HSPA8 NM_006597.5:c.98A>Gp.(Gln33Arg) AD_denovo 8.9 het de novo 1 NDD + Epilepsy seizures, focal seizures, myoclonic seizures BAZ1B NM_032408.3:c.461G>Ap.(Gly154Asp) AD_denovo 9.7 het de novo 1 NDD + Epilepsy absence epilepsy, EEG abnormality ADARB2 NM_018702.3:c.1570G>Ap.(Glu524Lys) NM_018702.3:c.914G>Ap.(Ser305Asn) AR_comphet 6.2 comphet maternal& paternal 2 NDD Microcephaly, Hearing impairment, Autism, Intellectual disability, Spasticity, Global developmental delay, Cerebral calcification DISP1 NM_032890.3:c.1357A>Cp.(Met453Leu) NM_032890.3:c.3233G>Ap.(Arg1078His) AR_comphet 7.3 comphet maternal& paternal 2 NDD Cleft palate, Panhypopituitarism, Intellectual disability, Patent ductus arteriosus, Facial cleft, Scoliosis, Short stature, Median cleft lip and palate UNC79 NM_020818.4:c.3857-691A>Gp.(=) NM_020818.4:c.1547C>Tp.(Ser516Leu) AR_comphet 5.3 comphet maternal& paternal 2 NDD Cleft palate, Panhypopituitarism, Intellectual disability, Patent ductus arteriosus, Facial cleft, Scoliosis, Short stature, Median cleft lip and palate GABRG1 NM_173536.3:c.487A>Gp.(Thr163Ala) AD_denovo 7.7 het de novo 2 NDD Strabismus, Autism, Ataxia, Specific learning disability, Gait ataxia, Language impairment, Pain insensitivity, Abnormality of movement, Motor tics, Dyskinesia, Exodeviation ARFGEF3 NM_020340.4:c.5123+2T>Cp.? AD_inherited 7.3 het maternal 2 NDD Strabismus, Autism, Ataxia, Specific learning disability, Gait ataxia, Language impairment, Pain insensitivity, Abnormality of movement, Motor tics, Dyskinesia, Exodeviation ZHX1 NM_001017926.2:c.179A>Gp.(Asn60Ser) NM_001017926.2:c.962C>Tp.(Ala321Val) AR_comphet 3.4 comphet maternal& paternal 2 NDD + Epilepsy Hearing impairment, Visual impairment, Nystagmus, Seizures, Abnormality of the cerebrospinal fluid, Epileptic spasms, Abnormal CSF glucose level CEMIP2 NM_013390.2:c.2648G>Ap.(Ser883Asn) NM_013390.2:c.1204+6C>Tp.? AR_comphet 2.8 comphet maternal& paternal 2 NDD + Epilepsy Hearing impairment, Visual impairment, Nystagmus, Seizures, Abnormality of the cerebrospinal fluid, Epileptic spasms, Abnormal CSF glucose level PRPF6 NM_012469.3:c.67C>Tp.(Arg23Trp) AD_denovo 9.1 het de novo 1 NDD Visual impairment, Intellectual disability, Growth delay, Mildly reduced visual acuity, Feeding difficulties SOX7 NM_031439.3:c.723G>Ap.(Pro241=) AD_denovo 4.0 het de novo 2 NDD Microcephaly, Hearing impairment, Autism, Intellectual disability, Spasticity, Global developmental delay, Cerebral calcification KCTD16 NM_020768.3:c.1231T>Cp.(Phe411Leu) AD_denovo 6.2 het de novo 3 NDD + Epilepsy Therapy-resistant epilepsy since the age of two, Epileptic encephalopathy MST1 NM_020998.3:c.1603C>Gp.(Arg535Gly) AD_denovo 5.5 het de novo 2 Neuro Migraine, Migraine with aura, Migraine without aura, Cortical dysplasia, Frontoparietal cortical dysplasia AKAP13 NM_006738.5:c.914A>Gp.(Gln305Arg) NM_006738.5:c.8228A>Cp.(Lys2743Thr) AR_comphet 5.4 comphet maternal& paternal 2 Neuro Migraine, Migraine with aura, Migraine without aura, Cortical dysplasia, Frontoparietal cortical dysplasia ABCC12 NM_033226.2:c.796G>Ap.(Gly266Arg) NM_033226.2:c.442delp.(Ile148Serfs*20) AR_comphet 5.7 comphet maternal& paternal 3 NDD + Epilepsy Therapy-resistant epilepsy since the age of two, Epileptic encephalopathy LRCH2 NM_020871.3:c.2141A>Gp.(Asn714Ser) XL 4.1 hemi maternal 3 NDD + Epilepsy Therapy-resistant epilepsy since the age of two, Epileptic encephalopathy WARS1 NM_173701.1:c.397C>Tp.(Arg133Cys) AR_homo 8.7 homo maternal& paternal 2 NDD Microcephaly, Delayed speech and language development, Intellectual disability, Global developmental delay, Absent speech, Intellectual disability, profound, Intellectual disability, moderate, Poor speech, Inability to walk, Melanoma, Intellectual disability, severe CSTF2 NM_001306206.1:c.724G>Ap.(Ala242Thr) XL 5.6 hemi maternal 2 NDD Microcephaly, Delayed speech and language development, Intellectual disability, Global developmental delay, Absent speech, Intellectual disability, profound, Intellectual disability, moderate, Poor speech, Inability to walk, Melanoma, Intellectual disability, severe
TANK NM_001199135.1:c.1012T>Cp.(Tyr338His) AD_denovo 6.2 het de novo 1 NDD + Epilepsy Restlessness, Single transverse palmar crease, Seizures, Global developmental delay, Abnormal corpus callosum morphology, Abnormality of neuronal migration, Abnormality of the periventricular white matter, Infantile spasms TTC28 NM_001145418.1:c.3020A>Gp.(Tyr1007Cys) AD_unknown 6.6 het unknown 1 NDD Tall stature, Macrocephaly, Autistic behavior, Delayed speech and language development, Intellectual disability, Global developmental delay, Obesity, Abnormal social behavior TNN NM_022093.1:c.1949A>Tp.(Tyr650Phe) NM_022093.1:c.2852T>Gp.(Val951Gly) AR_comphet 4.5 comphet maternal& paternal 1 NDD + Epilepsy infantile spams since 6 months of age, conspicuous odor, crying phases, failure to thrive TKT NM_001135055.2:c.1751T>Cp.(Val584Ala) AD_denovo 8.5 het de novo 3 NDD Global developmental delay, Motor delay RASAL2 NM_004841.3:c.433G>Tp.(Glu145*) AD_denovo 7.9 het de novo 3 NDD Global developmental delay, Motor delay HSPB7 NM_014424.4:c.202C>Tp.(Arg68Cys) AD_denovo 5.1 het de novo 3 NDD Global developmental delay, Motor delay GNL3L NM_001184819.1:c.884T>Ap.(Leu295Gln) XL 3.1 hemi maternal 1 NDD Global developmental delay with delayed speech and language development and a suspected autism spectre disorder, makrosomia SETD1B NM_015048.1:c.3074G>Ap.(Arg1025Gln) NM_015048.1:c.4354C>Tp.(Arg1452Cys) AR_comphet 6.3 comphet maternal& paternal 4 NDD Delayed speech and language development, Neurological speech impairment, Language impairment, Poor speech TFE3 NM_006521.5:c.566A>Gp.(Tyr189Cys) AD_denovo 7.5 hemi de novo 1 NDD + Epilepsy Microcephaly, Myopia, Delayed speech and language development, Abnormality of the thumb, Intellectual disability, Seizures, Intellectual disability, mild, Spasticity, Global developmental delay, Mental deterioration, Motor delay, Absent speech, Hip dysplasia, Obesity, Small for gestational age, Short nail, Broad nail, Abnormal facial shape, Generalized tonic-clonic seizures, Generalized myoclonic seizures, Intellectual disability, profound, Hepatomegaly, Intellectual disability, moderate, EEG abnormality, Poor speech, Mild short stature, Short stature, Increased body weight, Precocious puberty in males, Moderately short stature, Generalized tonic seizures, Intellectual disability, severe, Epileptic spasms, Myoclonic atonic seizures, Broad thumb, Cerebral palsy, Cognitive impairment HYDIN NM_001270974.2:c.6271A>Cp.(Ile2091Leu) AD_denovo 6.9 het de novo 4 NDD Delayed speech and language development, Neurological speech impairment, Language impairment, Poor speech MMS22L NM_198468.2:c.2679+1G>Ap.? NM_198468.2:c.268A>Gp.(Arg90Gly) AR_comphet 5.4 comphet maternal& paternal 4 NDD Delayed speech and language development, Neurological speech impairment, Language impairment, Poor speech CHD6 NM_032221.4:c.1678C>Ap.(Gln560Lys) NM_032221.4:c.2224A>Gp.(Arg742Gly) AR_comphet 6.6 comphet maternal& paternal 4 NDD Delayed speech and language development, Neurological speech impairment, Language impairment, Poor speech ZNF804A NM_194250.1:c.1049delp.(Gly350Valfs*7) AR_homo 11.2 homo maternal& paternal 1 NDD High palate, Aggressive behavior, Autistic behavior, Intellectual disability, Global developmental delay, Hepatosplenomegaly, Protuberant abdomen, Abnormal facial shape, Muscular hypotonia of the trunk, Infantile muscular hypotonia, Low levels of vitamin D, Self-injurious behavior, Decreased serum iron GIPR NM_000164.3:c.784C>Gp.(Leu262Val) NM_000164.3:c.393G>Tp.(Arg131Ser) AR_comphet 4.0 comphet maternal& paternal 1 NDD Absent speech, Obesity, Intellectual disability, severe TENM2 NM_001122679.1:c.3881C>Gp.(Ser1294Cys) AD_unknown 4.5 het unknown 1 NDD + Epilepsy atonic-astatic seizures and mild intellectual disability KCTD8 NM_198353.2:c.82G>Cp.(Ala28Pro) AD_denovo 5.4 het de novo 1 NDD Regressive global developmental delay with intellectual disability, attention deficit disorder, dysplasia of the corpus callosum, obesity grade 1 TIAM2 NM_012454.3:c.4679_4681dup, p.(Asn1560_Leu1561insHis) AR_homo 5.7 homo maternal& paternal 4 NDD Intellectual disability, microcephaly, scoliosis, short stature and hip dysplasia CASZ1 NM_001079843.2:c.4004G>Ap.(Arg1335His) AR_homo 5.9 homo maternal& paternal 4 NDD Intellectual disability, microcephaly, scoliosis, short stature and hip dysplasia
PLEKHB1 NM_021200.2:c.164A>Cp.(His55Pro) AR_homo 6.7 homo maternal& paternal 4 NDD Intellectual disability, microcephaly, scoliosis, short stature and hip dysplasia BARX2 NM_003658.4:c.386G>Ap.(Arg129Gln) AR_homo 6.7 homo maternal& paternal 4 NDD Intellectual disability, microcephaly, scoliosis, short stature and hip dysplasia SKOR2 NM_001278063.1:c.2752+1G>Tp.? AR_homo 9.0 homo unknown 3 NDD Short stature, microcephaly, mild intellectual disability, hyperopia FMNL3 NM_175736.4:c.2575C>Tp.(Arg859Trp) AR_homo 6.1 homo unknown 3 NDD Short stature, microcephaly, mild intellectual disability, hyperopia ARHGEF10L NM_018125.3:c.354_355delCCinsTTp.(Arg119Trp ) AR_homo 6.0 homo maternal& paternal 1 NDD + Epilepsy Seizures, Ataxia, Spasticity, Focal clonic seizures, Myoclonic spasms, Generalized dystonia, Focal-onset seizure, Focal myoclonic seizures SPTB NM_001024858.2:c.610G>Ap.(Asp204Asn) NM_001024858.2:c.5063A>Gp.(Asn1688Ser) AR_comphet 5.2 comphet maternal& paternal 1 NDD Global developmental delay, Leukopenia, Leukemia, Acute lymphoblastic leukemia USP13 NM_003940.2:c.2498+1G>Ap.? AD_denovo 6.4 het de novo 1 NDD Renal dysplasia, Polycystic kidney dysplasia, Synophrys, Global developmental delay SNX8 NM_013321.3:c.922C>Tp.(Gln308*) AD_denovo Bhet de novo 2 Growth, Skeletal Growth delay, short stature, intrauterine growth retardation, Silver-Russell-like appearance ZNF449 NM_152695.5:c.1394G>Ap.(Cys465Tyr) AD_denovo Bhet de novo 2 Growth, Skeletal Growth delay, short stature, intrauterine growth retardation, Silver-Russell-like appearance MAGED1 NM_001005332.1:c.640A>Gp.(Thr214Ala) XL 4.7 hemi maternal 1 NDD Early onset autism SLC38A1 NM_001278390.1:c.529A>Gp.(Ile177Val) AD_unknown 5.5 het unknown 1 Neuro Seizure, Tremor, Hand tremor, Nevus, Focal-onset seizure, Abnormality of brain morphology ZSCAN10 NM_032805.2:c.1436C>Ap.(Ser479Tyr) NM_032805.2:c.2245G>Tp.(Ala749Ser) AR_comphet 3.5 comphet maternal& paternal 3 NDD + Epilepsy Seizure, Global developmental delay, Gait ataxia, Bilateral tonic-clonic seizure, Unsteady gait, Focalonset seizure, Cognitive impairment, Mild malformation of cortical development FLYWCH1 NM_001308068.1:c.2112-3T>Gp.? NM_001308068.1:c.1111A>Tp.(Ser371Cys) AR_comphet 6.0 comphet maternal& paternal 3 NDD + Epilepsy Seizure, Global developmental delay, Gait ataxia, Bilateral tonic-clonic seizure, Unsteady gait, Focalonset seizure, Cognitive impairment, Mild malformation of cortical development HEPHL1 NM_001098672.1:c.1097G>Ap.(Cys366Tyr) AD_denovo Chet de novo 2 Connective Tissue Syncope, Joint hypermobility, Recurrent fractures, Chronic pain, Dysesthesia COG6 NM_020751.2:c.1209T>Gp.(Ile403Met) AD_denovo Bhet de novo 2 Connective Tissue Syncope, Joint hypermobility, Recurrent fractures, Chronic pain, Dysesthesia ZBTB34 NM_001099270.1:c.18delp.(Phe6Leufs*14) AD_denovo 8.2 het de novo 1 NDD + Epilepsy Delayed speech and language development, Global developmental delay, Focal-onset seizure, Childhood onset PODN NM_001199080.2:c.559-1G>Cp.? AD_denovo Bhet de novo 2 Growth, Skeletal Joint hypermobility, Asymmetry of the thorax, Scoliosis GORAB NM_152281.2:c.383T>Cp.(Ile128Thr) AD_denovo Chet de novo 2 Growth, Skeletal Joint hypermobility, Asymmetry of the thorax, Scoliosis GIT2 NM_057169.4:c.699T>Gp.(Tyr233*) AD_denovo Ahet de novo 1 Growth, Skeletal Failure to thrive, Small for gestational age, Short stature, Decreased body weight, Attention deficit hyperactivity disorder, Focal-onset seizure, Abnormal growth hormone level NDST1 NM_001543.4:c.2468G>Ap.(Gly823Glu) AD_denovo 8.6 het de novo 1 NDD + Epilepsy Focal seizures with cyanosis, sec. generalizing, EEG highly pathological, so far no cMRI examination has been carried out TTC3 NM_001320703.1:c.3970G>Ap.(Glu1324Lys) AD_denovo 5.2 het de novo 1 NDD Abnormality of the kidney, Global developmental delay, Hip dysplasia, Short stature ASXL2 NM_018263.4:c.1894C>Gp.(His632Asp) AD_denovo 8.0 het de novo 2 NDD Seizures, Generalized tonic-clonic seizures, Myoclonic atonic seizures, Epileptic encephalopathy TBCCD1 NM_001134415.1:c.1392T>Gp.(Cys464Trp) AD_denovo Bhet de novo 3 Metabolis m Ketotic hypoglycemia MRM3 NM_018146.3:c.173C>Gp.(Pro58Arg) AD_denovo Bhet de novo 3 Metabolis m Ketotic hypoglycemia PACSIN3 NM_001184974.1:c.604-3C>Gp.? AD_denovo Bhet de novo 3 Metabolis m Ketotic hypoglycemia MDN1 NM_014611.2:c.13276C>Gp.(Leu4426Val) AD_denovo 6.8 het de novo 2 NDD + Epilepsy Microcephaly, Seizure, Dystonia, Cerebral palsy, Abnormality of movement, Epileptic encephalopathy MAP7D1 NM_018067.4:c.1225G>Tp.(Ala409Ser) AR_homo 3.5 homo maternal& paternal 1 NDD + Epilepsy Infantile febrile seizures and tonic-clonic seizures with aura, despite current treatment with valproate, seizures continue CPLX1 NM_006651.3:c.250dup, p.(Ala84Glyfs*256) AD_unknown 9.3 het unknown 3 NDD + Epilepsy Global developmental delay and obsessive-compulsive behavior, seizures HEATR1 NM_018072.5:c.394926_3954delp.(Asp1317Valfs*827) AD_unknown 6.9 het unknown 3 NDD + Epilepsy Global developmental delay and obsessive-compulsive behavior, seizures
HS6ST2 NM_001077188.1:c.853T>Gp.(Trp285Gly) XL 5.6 hemi maternal 1 NDD global developmental delay, focal epilepsy, absent speech, Delayed gross motor development, Tetraparesis, Facial palsy USP4 NM_003363.3:c.1748A>Gp.(Tyr583Cys) AR_homo Ahomo maternal& paternal 2 Metabolis m Myalgia, Hyperlipoproteinemia, Increased erythrocyte protoporphyrin concentration, Angioedema DNHD1 NM_144666.2:c.7549C>Tp.(Arg2517Cys) NM_144666.2:c.2104-4T>Ap.? AR_comphet 4.2 comphet maternal& paternal 2 NDD + Epilepsy Microcephaly, Seizure, Dystonia, Cerebral palsy, Abnormality of movement, Epileptic encephalopathy FBN3 NM_032447.4:c.7780G>Ap.(Val2594Ile) NM_032447.4:c.1135C>Tp.(Arg379*) AR_comphet Ccomphet maternal& paternal 3 Metabolis m Obesity, Increased adipose tissue, Glioma, Class III obesity, Overweight, Brain neoplasm SDR42E1 NM_145168.2:c.4G>Ap.(Asp2Asn) AR_homo Chomo maternal& paternal 3 Metabolis m Obesity, Increased adipose tissue, Glioma, Class III obesity, Overweight, Brain neoplasm FADS1 NM_013402.4:c.247G>Tp.(Ala83Ser) AD_denovo Ahet de novo 2 other Anemia, Fever, Recurrent fever, Refractory anemia TPR NM_003292.2:c.1038A>Gp.(Ile346Met) NM_003292.2:c.2380T>Ap.(Ser794Thr) AR_comphet Ccomphet maternal& paternal 2 other Anemia, Fever, Recurrent fever, Refractory anemia ZNF449 NM_152695.5:c.961A>Tp.(Lys321*) AD_denovo 6.6 hemi de novo 1 NDD + Epilepsy Hypothyroidism, Primary hypothyroidism, Congenital hypothyroidism, Seizure, Generalized-onset seizure, Atonic seizure, Focal emotional seizure with laughing, Clonic seizure DOHH NM_001145165.1:c.446C>Gp.(Pro149Arg) NM_001145165.1:c.224T>Gp.(Val75Gly) AR_comphet 6.8 comphet maternal& paternal 1 NDD + Epilepsy Global developmental delay, Epilepsy since the age of 3 with tonic-clonic seizures, EEG abnormalities, pain insensitivity ABCB10 NM_012089.2:c.833_838delp.(Asp278_Thr279de l) AD_denovo 4.8 het de novo 1 NDD Renal duplication, Global developmental delay, Annular pancreas, Esophageal atresia, Duodenal atresia, Tracheoesophageal fistula, Short stature, Partially duplicated kidney, Anorectal anomaly, Duodenal stenosis, Rectovestibular fistula DLGAP1 NM_004746.3:c.1018C>Tp.(Arg340*) AD_denovo 11.8 het de novo 4 NDD Renal duplication, Autism, Autistic behavior, Delayed speech and language development, Intellectual disability, Poor speech DAAM2 NM_001201427.1:c.1339C>Gp.(Gln447Glu) NM_001201427.1:c.1745C>Ap.(Pro582His) AR_comphet 4.7 comphet maternal& paternal 4 NDD Renal duplication, Autism, Autistic behavior, Delayed speech and language development, Intellectual disability, Poor speech SIGLEC9 NM_001198558.1:c.682G>Ap.(Val228Ile) AD_denovo 3.7 het de novo 4 NDD Renal duplication, Autism, Autistic behavior, Delayed speech and language development, Intellectual disability, Poor speech CDH13 NM_001220488.1:c.2228G>Ap.(Arg743His) NM_001220488.1:c.1505C>Tp.(Ser502Phe) AR_comphet 5.2 comphet maternal& paternal 4 NDD Renal duplication, Autism, Autistic behavior, Delayed speech and language development, Intellectual disability, Poor speech ASIC1 NM_020039.3:c.1116T>Ap.(Tyr372*) AD_unknown 6.1 het unknown 1 NDD + Epilepsy Behavioral abnormality, Autistic behavior, Delayed speech and language development, Seizure, Pyloric stenosis, Attention deficit hyperactivity disorder SSPOP NM_198455.2:c.1280T>Cp.(Met427Thr) NM_198455.2:c.1997G>Ap.(Arg666His) AR_comphet 2.6 comphet maternal& paternal 1 NDD + Epilepsy Global developmental delay, Incoordination, Poor coordination, Focal-onset seizure, Epileptic encephalopathy PKHD1L1 NM_177531.4:c.5194C>Tp.(Pro1732Ser) NM_177531.4:c.8005C>Tp.(Gln2669*) AR_comphet 5.0 comphet maternal& paternal 2 NDD + Epilepsy Seizure, Status epilepticus, EEG abnormality, Focal impaired awareness seizure, Focal-onset seizure, EEG with focal spike waves
LAMA5 NM_005560.4:c.8632G>Ap.(Val2878Ile) NM_005560.4:c.6578G>Ap.(Arg2193His) AR_comphet 5.4 comphet maternal& paternal 2 NDD + Epilepsy Seizure, Status epilepticus, EEG abnormality, Focal impaired awareness seizure, Focal-onset seizure, EEG with focal spike waves PRICKLE1 NM_153026.2:c.128A>Gp.(Glu43Gly) AD_denovo 8.7 het de novo 1 NDD + Epilepsy Global developmental delay with a decreased and autistic spectrum disorder characteristics, attends a special school, MRI and EEG inconspicuous CCDC66 NM_001141947.1:c.847_848delp.(Glu283Serfs*3 ) AR_homo 8.0 homo maternal& paternal 3 NDD + Epilepsy Global developmental delay with delayed speech, astatic attacks, absence epilepsy and EEG abnormalities CHMP3 NM_016079.3:c.220G>Ap.(Val74Met) AD_denovo 5.9 het de novo 3 NDD + Epilepsy Global developmental delay with delayed speech, astatic attacks, absence epilepsy and EEG abnormalities RGPD8 NM_001164463.1:c.3225G>Tp.(Gln1075His) AD_denovo 4.6 het de novo 3 NDD + Epilepsy Global developmental delay with delayed speech, astatic attacks, absence epilepsy and EEG abnormalities NUMBL NM_004756.4:c.1193C>Ap.(Pro398His) AR_homo 5.4 homo maternal& paternal 2 NDD Long palpebral fissure, Prominent fingertip pads, Intellectual disability, Large fleshy ears ATP13A4 NM_032279.3:c.826G>Ap.(Glu276Lys) AR_homo 6.0 homo maternal& paternal 2 NDD Long palpebral fissure, Prominent fingertip pads, Intellectual disability, Large fleshy ears UBR5 NM_015902.5:c.3682C>Tp.(Pro1228Ser) AD_denovo 8.9 het de novo 1 NDD + Epilepsy Epilepsy associated with fever or infection, tonic-clonic seizures, mild mental retardation, macrocephaly and sleep EEG with sharp slow waves NPTN NM_012428.3:c.1025C>Tp.(Pro342Leu) AD_denovo 8.7 het de novo 2 NDD Autism, Delayed speech and language development, Intellectual disability, Global developmental delay, Diarrhea, Macrocephaly, Partial Epilepsy LRRC2 NM_024512.4:c.412A>Gp.(Thr138Ala) NM_024512.4:c.14T>Cp.(Val5Ala) AR_comphet 2.8 comphet maternal& paternal 2 NDD Autism, Delayed speech and language development, Intellectual disability, Global developmental delay, Diarrhea, Macrocephaly, Partial Epilepsy USP8 NM_001128610.2:c.2658+2_2658+3insAAGAp.? NM_001128610.2:c.2371A>Gp.(Ile791Val) AR_comphet 5.9 comphet maternal& paternal 1 neuro Spasticity, Intention tremor, Vertigo, Dyskinesia VPS51 NM_013265.3:c.1777A>Gp.(Lys593Glu) AD_denovo 6.7 het de novo 3 NDD + Epilepsy Epilepsy with generalized tonic-clonic seizures, ED 10/2019, microcephaly RNF144A NM_014746.4:c.428G>Cp.(Cys143Ser) AR_homo 5.2 homo maternal 3 NDD + Epilepsy Epilepsy with generalized tonic-clonic seizures, ED 10/2019, microcephaly SCN7A NM_002976.3:c.2932A>Gp.(Ile978Val) AR_homo 5.8 homo maternal 3 NDD + Epilepsy Epilepsy with generalized tonic-clonic seizures, ED 10/2019, microcephaly UTP18 NM_016001.2:c.1503+1G>Ap.? AD_denovo 6.2 het de novo 2 NDD + Epilepsy Epilepsy (postbrain haemorrhage condition), intelligence impairment, autism, seizures, premature birth GCNA NM_052957.4:c.673C>Ap.(Pro225Thr) AD_denovo 4.1 het de novo 2 NDD + Epilepsy Epilepsy (postbrain haemorrhage condition), intelligence impairment, autism, seizures, premature birth RYR3 NM_001036.4:c.2770A>Gp.(Thr924Ala) NM_001036.4:c.11246-5C>Gp.? AR_comphet 6.1 comphet maternal& paternal 1 Neuro Torticollis, Ataxia, Dysarthria, Dystonia, Slurred speech, Gait ataxia, Limb ataxia, Truncal ataxia, Episodic ataxia, Apraxia, Limb dystonia, Focal dystonia, Gait apraxia, Oromandibular dystonia MTCH1 NM_001271641.1:c.2T>Ap.0? AR_homo 6.6 homo maternal& paternal 4 NDD Deeply set eye, Intellectual disability, Failure to thrive, Narrow palpebral fissure KCNG4 NM_172347.2:c.1022C>Tp.(Ala341Val) AR_homo 5.8 homo maternal& paternal 4 NDD Deeply set eye, Intellectual disability, Failure to thrive, Narrow palpebral fissure KIAA1107 NM_015237.3:c.299C>Tp.(Thr100Ile) AR_homo 3.9 homo maternal& paternal 4 NDD Deeply set eye, Intellectual disability, Failure to thrive, Narrow palpebral fissure CRYBG3 NM_153605.3:c.8492G>Ap.(Arg2831His) AR_homo 4.8 homo maternal& paternal 4 NDD Deeply set eye, Intellectual disability, Failure to thrive, Narrow palpebral fissure PDE4DIP NM_001198834.3:c.6862A>Cp.(Lys2288Gln) NM_001198834.3:c.6043A>Gp.(Ile2015Val) AR_comphet 6.2 comphet maternal& paternal 1 NDD Intellectual disability, Global developmental delay, Motor delay, Failure to thrive, Increased serum lactate, Infantile muscular hypotonia, Delayed myelination, Alaninuria TCEAL3 NM_001006933.1:c.585C>Gp.(His195Gln) XL 3.7 hemi maternal 1 NDD Global developmental delay, Gait ataxia, Infantile muscular hypotonia PLEKHM3 NM_001080475.2:c.2219G>Ap.(Arg740Lys) AD_denovo 4.4 het de novo 2 Neuro Gait disturbance, Dystonia, Progressive spastic paraplegia, Paraplegia, Leg dystonia
GPX4 NM_001039848.3:c.587+5G>Ap.? NM_001039848.3:c.475G>Tp.(Gly159Cys) AR_comphet 5.8 comphet maternal& paternal 2 Neuro Gait disturbance, Dystonia, Progressive spastic paraplegia, Paraplegia, Leg dystonia KLHDC4 NM_017566.3:c.908T>Cp.(Met303Thr) NM_017566.3:c.529C>Tp.(Arg177Trp) AR_comphet 3.6 comphet maternal& paternal 1 NDD + Epilepsy Neurodevelopmental delay, Global developmental delay, Infantile spasms, Seizure, Epileptic spasm, Abnormal nervous system physiology, Neonatal seizure TDRD9 NM_153046.2:c.2273C>Tp.(Pro758Leu) AR_homo 4.2 homo maternal& paternal 2 NDD Autism, Hypertrichosis, Intellectual disability, Global developmental delay, Absent speech, Mutism PRSS35 NM_001170423.1:c.1231G>Tp.(Ala411Ser) NM_001170423.1:c.632G>Ap.(Ser211Asn) AR_comphet 2.6 comphet maternal& paternal 2 NDD Autism, Hypertrichosis, Intellectual disability, Global developmental delay, Absent speech, Mutism TEC NM_003215.2:c.1526G>Tp.(Gly509Val) AD_inherited Chet maternal 2 Immunolog y recurrent purulent abscess of the groin RAB11FIP4 NM_032932.5:c.1562G>Ap.(Gly521Asp) AD_inherited Chet maternal 2 Immunolog y recurrent purulent abscess of the groin ITSN1 NM_003024.2:c.1690T>Cp.(Ser564Pro) AD_unknown 6.6 het unknown 5 NDD + Epilepsy Macrocephaly, Aggressive behavior, Delayed speech and language development, Enuresis, Intellectual disability, Seizure, Global developmental delay, Intellectual disability, moderate, Febrile seizure (within the age range of 3 months to 6 years), Polyphagia, Increased adipose tissue, Feeding difficulties, Cognitive impairment, Overweight DYNC1I1 NM_004411.4:c.1421C>Gp.(Ala474Gly) AD_unknown 4.5 het unknown 5 NDD + Epilepsy Macrocephaly, Aggressive behavior, Delayed speech and language development, Enuresis, Intellectual disability, Seizure, Global developmental delay, Intellectual disability, moderate, Febrile seizure (within the age range of 3 months to 6 years), Polyphagia, Increased adipose tissue, Feeding difficulties, Cognitive impairment, Overweight TMEM63A NM_014698.2:c.1423T>Cp.(Phe475Leu) AD_unknown 3.5 het unknown 5 NDD + Epilepsy Macrocephaly, Aggressive behavior, Delayed speech and language development, Enuresis, Intellectual disability, Seizure, Global developmental delay, Intellectual disability, moderate, Febrile seizure (within the age range of 3 months to 6 years), Polyphagia, Increased adipose tissue, Feeding difficulties, Cognitive impairment, Overweight SLC22A23 NM_015482.1:c.1076A>Gp.(Tyr359Cys) AD_unknown 2.8 het unknown 5 NDD + Epilepsy Macrocephaly, Aggressive behavior, Delayed speech and language development, Enuresis, Intellectual disability, Seizure, Global developmental delay, Intellectual disability, moderate, Febrile seizure (within the age range of 3 months to 6 years), Polyphagia, Increased adipose tissue, Feeding difficulties, Cognitive impairment, Overweight MTR NM_000254.2:c.2812A>Gp.(Ser938Gly) AD_unknown 6.2 het unknown 5 NDD + Epilepsy Macrocephaly, Aggressive behavior, Delayed speech and language development, Enuresis, Intellectual disability, Seizure, Global developmental delay, Intellectual disability, moderate, Febrile seizure (within the age range of 3 months to 6 years), Polyphagia, Increased adipose tissue, Feeding difficulties, Cognitive impairment, Overweight HNRNPM NM_005968.4:c.23C>Tp.(Ala8Val) AR_homo 5.0 homo maternal& paternal 2 NDD + Epilepsy generalized epilepsy with nocturnal tonic-clonic seizures (onset in the 2nd year of life), mild intellectual impairment LRRC7 NM_001330635.1:c.2143C>Tp.(Gln715*) AD_unknown 7.5 het unknown, not maternal 1 NDD Intellectual disability, Global developmental delay, Overweight DUSP9 NM_001318503.1:c.745G>Ap.(Asp249Asn) XL 3.8 hemi maternal 2 NDD + Epilepsy generalized epilepsy with nocturnal tonic-clonic seizures (onset in the 2nd year of life), mild intellectual impairment SLC4A2 NM_003040.3:c.2507T>Cp.(Ile836Thr) AD_denovo 7.0 het de novo 1 NDD + Epilepsy Global developmental delay with intelligence impairment and speech delay; epilepsy with tonic-clonic seizures and atypical absences (pseudo-Lennox); short stature; hypercholesterinemia UTP14A NM_006649.3:c.124A>Gp.(Lys42Glu) XL 4.1 hemi maternal 2 NDD + Epilepsy Epileptic encephalopathy, Seizure since the age of 11 SMURF1 NM_020429.2:c.1390C>Tp.(Gln464*) AD_denovo 9.6 het de novo 2 NDD Premature infant (32 weeks, 1600g), maldescensus testis bilateral, plagiocephalus, central motor coordination and movement disorder with dystonic movements, trunk muscular hypotension, delayed development, MRI: subependymal left heterotopia, steep tentorium, small posterior fossa, compressed 4th ventricle, flattened skull on the right
TTLL4 NM_014640.5:c.2401C>Gp.(Leu801Val) NM_014640.5:c.2692G>Ap.(Glu898Lys) AR_comphet 4.1 comphet maternal& paternal 3 Neuro Multifocal cerebral white matter abnormalities, Leukoencephalopathy, Migraine, Abnormal cerebellum morphology, Gait disturbance, Gait imbalance FBN3 NM_032447.5:c.6184G>Ap.(Ala2062Thr) NM_032447.5:c.4370A>Gp.(Asn1457Ser) AR_comphet 3.5 comphet maternal& paternal 3 Neuro Multifocal cerebral white matter abnormalities, Leukoencephalopathy, Migraine, Abnormal cerebellum morphology, Gait disturbance, Gait imbalance HIRA NM_003325.4:c.194A>Gp.(Gln65Arg) AD_inherited Chet maternal 2 Fehlbildung en Non-midline cleft lip and palate RGMB NM_001012761.3:c.863C>Tp.(Thr288Ile) AD_inherited Chet maternal 2 Fehlbildung en Non-midline cleft lip and palate STARD8 NM_001142503.2:c.2248C>Ap.(Leu750Ile) XL 4.0 hemi maternal 1 NDD + Epilepsy EEG with burst suppression, Epileptic encephalopathy, Global developmental delay, Intellectual disability, Seizure KDR NM_002253.3:c.3161_3162insAAp.(Tyr1054*) AD_unknown Bhet unknown 1 congenital heart defects Abnormal aortic morphology, Abdominal aortic aneurysm, Descending thoracic aorta aneurysm, Cerebral arterial thrombosis FAM199X NM_207318.4:c.932T>Gp.(Met311Arg) AD_denovo Chemi de novo 2 Connective Tissue Recurrent fractures, Patellar dislocation, Recurrent infections, Migraine, Asthma LIMD1 NM_014240.3:c.1669C>Tp.(His557Tyr) NM_014240.3:c.1532C>Tp.(Ala511Val) AR_comphet Acomphet maternal& paternal 2 Connective Tissue Recurrent fractures, Patellar dislocation, Recurrent infections, Migraine, Asthma FBXW7 NM_033632.3:c.23_24delp.(Val8Glyfs*14) AD_unknown Bhet unknown 1 other (+) Brain neoplasm,(+) Ewing sarcoma ATR NM_001184.4:c.2419G>Ap.(Gly807Arg) AR_homo 8.8 homo maternal& paternal 3 NDD + Epilepsy Global developmental delay, Microcephaly, Seizures CDK12 NM_016507.4:c.4237C>Tp.(His1413Tyr) AR_homo 7.2 homo maternal& paternal 3 NDD + Epilepsy Global developmental delay, Microcephaly, Seizures SLC18B1 NM_052831.3:c.821G>Tp.(Gly274Val) NM_052831.3:c.654T>Ap.(Asn218Lys) AR_comphet 3.7 comphet maternal& paternal 3 NDD + Epilepsy Global developmental delay, Microcephaly, Seizures ZFYVE9 NM_004799.3:c.3220C>Ap.(Leu1074Met) NM_004799.3:c.4124A>Tp.(Tyr1375Phe) AR_comphet 5.3 comphet maternal& paternal 2 NDD + Epilepsy Neonatal hypoglycemia, Seizure, Global developmental delay LANCL3 NM_001170331.2:c.1037G>Ap.(Ser346Asn) XL 3.2 hemi maternal 2 NDD + Epilepsy Neonatal hypoglycemia, Seizure, Global developmental delay LOXL4 NM_032211.6:c.396C>Ap.(Cys132*) AD_unknown Chet unknown 1 Growth, Skeletal (+) Small for gestational age,(+) Mild short stature,(+) Attention deficit hyperactivity disorder,(+) Delayed skeletal maturation,(+) Intrauterine growth retardation,(+) Mild intrauterine growth retardation NKTR NM_005385.4:c.3076delp.(Glu1026Argfs*26) AD_denovo 10.4 het de novo 1 NDD + Epilepsy Myoclonic spasms, Seizure, EEG abnormality DPYSL2 ENST00000311151.5:c.1544C>T p.Pro515Leu AD_unknown 7.2 het unknown 2 NDD Cognitive impairment, Global developmental delay, Tall stature, Obesity DGCR2 ENST00000263196.7:c.998T>C p.Leu333Pro AD_unknown 4.6 het unknown 2 NDD Cognitive impairment, Global developmental delay, Tall stature, Obesity KIF5B NM_004521.3:c.135_136dupp.(Tyr46Phefs*67) AD_unknown Bhet unknown 1 Fehlbildung en Macrodactyly, Upper limb asymmetry, Hemihypertrophy of upper limb, Hyperextensible thumb NRCAM NM_001193582.1:c.3362C>Gp.(Pro1121Arg) AD_unknown 6.3 het unknown 1 NDD + Epilepsy Hypospadias, Microcephaly, Atypical absence seizure, Bilateral tonic-clonic seizure, Intellectual disability, Premature birth, Patent ductus arteriosus, Hearing impairment PSMB10 NM_002801.4:c.56+1G>Ap.? AR_homo 8.5 homo unknown 1 NDD (+) Global developmental delay,(+) Intellectual disability, borderline,(+) Intellectual disability, mild,(+) Short stature,(+) Microcephaly,(+) Bird-like facies TOPAZ1 NM_001145030.1:c.481A>Tp.(Ser161Cys) AD_denovo 4.6 het de novo 1 NDD + Epilepsy Focal-onset seizure, Focal sensory seizure ARHGEF38 NM_001242729.2:c.1363_1365delACGinsGCAp.( Thr455Ala) NM_001242729.2:c.2122G>Ap.(Asp708Asn) AR_comphet Ccomphet maternal& paternal 1 Metabolis m Diabetes insipidus, Central diabetes insipidus, Panhypopituitarism, Short stature, Proportionate short stature ATP8B4 NM_024837.3:c.2698-2A>Gp.? AD_denovo 5.2 het de novo 2 NDD + Epilepsy mild global developmental delay, febrile seizure (within the age range of 3 months to 6 years)
MYO5B NM_001080467.2:c.1624C>Tp.(Arg542Cys) AD_denovo 6.3 het de novo 2 NDD + Epilepsy mild global developmental delay, febrile seizure (within the age range of 3 months to 6 years) PTPRT NM_133170.4:c.3039+1G>Ap.? AD_unknown Bhet unknown 2 Leukodystr ophy (+) Cerebral vasculitis,(+) Ischemic stroke,(+) Moyamoya disease,(+) Leukoencephalopathy XPOT NM_007235.6:c.1516_1517delp.(Val506Cysfs*2) AD_unknown 7.7 het unknown 2 Neuro (+) Cerebral vasculitis,(+) Ischemic stroke,(+) Moyamoya disease,(+) Leukoencephalopathy TMEM35B NM_001195156.1:c.289+2delp.? AR_homo Ahomo unknown 1 other +) Elevated serum alanine aminotransferase,(+) Elevated serum aspartate aminotransferase,(+) Abnormality of the liver,(+) Splenomegaly,(-) Wilson disease,(-) Niemann-Pick disease type D HSPH1 NM_006644.4:c.515delp.(Asn172Metfs*3) AD_unknown 6.5 het unknown 2 NDD + Epilepsy (+) Seizure,(+) Global developmental delay,(+) Stereotypical hand wringing,(+) Muscular hypotonia ZBTB21 NM_001098402.2:c.2088delp.(Lys696Asnfs*5) AD_unknown 6.1 het unknown 2 NDD + Epilepsy (+) Seizure,(+) Global developmental delay,(+) Stereotypical hand wringing,(+) Muscular hypotonia SVEP1 NM_153366.4:c.6371T>Cp.(Ile2124Thr) AR_homo 5.5 homo maternal& paternal 3 NDD + Epilepsy atypic absence seizure, strartle-induced seizure, attention deficit hyperactivity disorder, seizure ALS2CL NM_147129.5:c.1109+5G>Ap.? AD_denovo 5.0 het de novo 3 NDD + Epilepsy atypic absence seizure, strartle-induced seizure, attention deficit hyperactivity disorder, seizure CENPI NM_006733.3:c.652C>Tp.(Arg218Cys) XL 5.8 hemi maternal 3 NDD + Epilepsy atypic absence seizure, strartle-induced seizure, attention deficit hyperactivity disorder, seizure FAT3 NM_001008781.2:c.763C>Gp.(His255Asp) NM_001008781.2:c.11140A>Gp.(Lys3714Glu) AR_comphet 5.4 comphet maternal& paternal 1 NDD + Epilepsy Atypical absence seizure, Myoclonic seizure, Epileptic encephalopathy, Myoclonus, EEG abnormality, Hyperammonemia, Abnormal vitamin B12 level, normal development USP34 NM_014709.4:c.7561G>Cp.(Val2521Leu) NM_014709.4:c.4229C>Tp.(Ala1410Val) AR_comphet 5.5 comphet maternal& paternal 1 NDD (+) Intellectual disability,(+) Hyperactivity,(+) Autistic behavior ANKDD1A NM_182703.5:c.1470G>Cp.(Arg490Ser) AD_denovo 5.4 het de novo 1 NDD (+) Delayed speech and language development,(+) Diminished ability to concentrate,(+) Cognitive impairment,(+) Hearing impairment KLHL29 NM_052920.2:c.797C>Tp.(Pro266Leu) AD_denovo 4.1 het de novo 1 Neuro Behavioral abnormality, Frontotemporal dementia ACTR1A NM_005736.3:c.715G>Cp.(Ala239Pro) AD_unknown 4.6 het unknown 1 NDD + Epilepsy Generalized-onset motor seizure, Spastic tetraplegia, Intellectual disability, severe, Cataract, Pes planus ZCCHC14 NM_015144.2:c.52C>Tp.(Gln18*) AD_denovo 8.5 het de novo 1 NDD motor delay, proximal muscle weakness, makrozephalia, epicanthus med., frontal blossing SEZ6L2 NM_001243332.1:c.910A>Gp.(Thr304Ala) AD_inherited 5.4 het maternal 3 NDD Autism (Asperger), Autistic behavior, Depressivity, Macrocephaly GLRA2 NM_002063.4:c.1334G>Ap.(Arg445Gln) XL 7.5 hemi maternal 1 NDD + Epilepsy (+) Tonic seizure,(+) Bilateral tonic-clonic seizure with generalized onset,(+) Intellectual disability,(+) Global developmental delay,(+) Cognitive impairment POU2F1 NM_002697.4:c.318G>Cp.(Gln106His) AD_inherited 3.8 het paternal 3 NDD Autism (Asperger), Autistic behavior, Depressivity, Macrocephaly SEMA4C NM_017789.4:c.2077_2078delGAinsTTp.(Glu693 Leu) NM_017789.4:c.517+3G>Ap.? AR_comphet 4.4 comphet maternal& paternal 1 NDD + Epilepsy At the age of 7-8 months tonic stiffnesses for a few seconds every few weeks, later on big-ger seizures, MRI without findings, no motor delay, increased levels of serum lactate, glutaric aciduria POU3F2 NM_005604.4:c.664C>Tp.(Pro222Ser) AD_inherited 5.4 het paternal 1 Neuro Leukodystrophy, Leukoencephalopathy, Attention deficit hyperactivity disorder, Neurological speech impairment, Neonatal asphyxia, Gait disturbance MAST3 NM_015016.2:c.3367C>Tp.(Arg1123*) AD_unknown 5.5 het unknown 1 NDD + Epilepsy Abnormal morphology of the limbic system,Seizure, Focal-onset seizure, Focal impaired awareness motor seizure, Bilateral tonic-clonic seizure with focal onset, Global developmental delay, Mild global developmental delay, Intellectual disability, Intellectual disability, mild, EEG with focal slow activity PHLPP1 NM_194449.3:c.3756-2A>Gp.? AD_denovo 10.2 het de novo 3 NDD + Epilepsy therapy-resistant epilepsy SRRM4 NM_194286.3:c.1295C>Tp.(Ser432Phe) NM_194286.3:c.1172G>Ap.(Arg391His) AR_comphet 5.5 comphet maternal& paternal 3 NDD + Epilepsy therapy-resistant epilepsy
CANX NM_001024649.1:c.143A>Tp.(Asp48Val) NM_001024649.1:c.1102G>Ap.(Val368Ile) AR_comphet 7.4 comphet maternal& paternal 3 NDD + Epilepsy therapy-resistant epilepsy H2AC8 NM_021052.2:c.107G>Ap.(Arg36His) AD_denovo 4.5 het de novo 1 NDD (+) Arachnoid cyst,(+) Headache,(+) Hallucinations,(+) Visual hallucinations,(+) Auditory hallucinations,(+) Delayed speech and language development,(+) Global developmental delay,(+) Intellectual disability,(+) Obesity TMEM61 NM_182532.2:c.101G>Cp.(Cys34Ser) NM_182532.2:c.583G>Ap.(Ala195Thr) AR_comphet Ccomphet maternal& paternal 2 Wachstum, Skelett Hypoterlorism, Trigonocephaly TRPC5 NM_012471.2:c.280G>Ap.(Val94Met) XL 7.2 hemi maternal 2 NDD (+) Global developmental delay,(+) Hyperactivity,(+) Delayed speech and language development,(+) Hypertelorism,(+) Depressed nasal ridge,(+) Low-set ears,(+) Muscular hypotonia, lateral fallende Lidachsen HIVEP1 NM_002114.3:c.4588T>Cp.(Ser1530Pro) NM_002114.3:c.1916T>Cp.(Val639Ala) AR_comphet 3.8 comphet maternal& paternal 2 NDD (+) Global developmental delay,(+) Hyperactivity,(+) Delayed speech and language development,(+) Hypertelorism,(+) Depressed nasal ridge,(+) Low-set ears,(+) Muscular hypotonia, lateral fallende Lidachsen ZNF384 NM_001135734.2:c.459delp.(Gly154Alafs*15) AD_denovo 9.1 het de novo 2 NDD (+) Global developmental delay,(+) Scotoma,(+) Intellectual disability, mild,(+) Intellectual disability, borderline,(+) Myopia,(+) Depressivity,(+) Anxiety,(+) Motor delay,(+) Retinal atrophy SLC25A6 NM_001636.3:c.239G>Ap.(Arg80His) AD_denovo 7.2 het de novo 2 NDD (+) Global developmental delay,(+) Scotoma,(+) Intellectual disability, mild,(+) Intellectual disability, borderline,(+) Myopia,(+) Depressivity,(+) Anxiety,(+) Motor delay,(+) Retinal atrophy NIN NM_020921.3:c.4760A>Cp.(Gln1587Pro) NM_020921.3:c.446C>Tp.(Thr149Met) AR_comphet Ccomphet maternal& paternal 2 Wachstum, Skelett Hypoterlorism, Trigonocephaly ZDHHC2 NM_016353.5:c.47_52delp.(Arg16_Val17del) AD_denovo 5.2 het de novo 2 NDD + Epilepsy (+) Myoclonic seizure,(+) EEG with spike-wave complexes, suspected focal cortical dysplasia frontal right KALRN NM_001024660.4:c.3534G>Tp.(Arg1178Ser) NM_001024660.4:c.5176+21733A>Gp.(=) AR_comphet 7.0 comphet maternal& paternal 2 NDD + Epilepsy (+) Myoclonic seizure,(+) EEG with spike-wave complexes, suspected focal cortical dysplasia frontal right TRHDE NM_013381.2:c.1050_1052delTGTinsGGGp.(Val3 51Gly) AD_denovo Bhet de novo 1 Wachstum, Skelett +) Arthrogryposis multiplex congenita,(+) Plagiocephaly,(+) Congenital finger flexion contractures,(+) Wrist flexion contracture,(+) Elbow flexion contracture,(+) Shoulder flexion contracture,(+) Adducted thumb,(+) Respiratory failure PTPRS NM_002850.3:c.4810G>Ap.(Ala1604Thr) NM_002850.3:c.4453G>Ap.(Ala1485Thr) AR_comphet 5.8 comphet maternal& paternal 1 NDD (+) Short stature,(+) Global developmental delay,(+) Intellectual disability,(+) Microcephaly ABCB5 NM_001163941.1:c.2867_2867+1delp.(Ile956Lysf s*43) AD_denovo 7.7 het de novo 1 NDD (+) Mild global developmental delay,(+) Muscular hypotonia RASA2 NM_006506.3:c.1591-2A>Gp.? AD_denovo 8.0 het de novo 1 NDD (+) Periventricular leukomalacia,(+) Global developmental delay,(+) Cerebral palsy,(+) Elevated hepatic transaminase,(+) Muscular hypotonia,(+) Small for gestational age GRAMD1C NM_017577.4:c.168C>Ap.(Ser56Arg) NM_017577.4:c.557A>Gp.(Glu186Gly) AR_comphet 3.7 comphet maternal& paternal 2 NDD + Epilepsy (+) Complex febrile seizure,(+) Simple febrile seizure,(+) Seizure,(-) Motor delay,(-) Intellectual disability
STARD9 NM_020759.2:c.4693A>Gp.(Ser1565Gly) NM_020759.2:c.5795A>Gp.(Asn1932Ser) AR_comphet 3.7 comphet maternal& paternal 2 NDD + Epilepsy (+) Complex febrile seizure,(+) Simple febrile seizure,(+) Seizure,(-) Motor delay,(-) Intellectual disability NLRP5 NM_153447.4:c.1846_1849delp.(Lys616Glyfs*17 )AR_homo 8.0 homo maternal& paternal 2 NDD + Epilepsy (+) Dravet syndrome,(+) Seizure,(+) Myoclonic seizure,(+) Myoclonic absence seizure,(+) Global developmental delay,(+) Intellectual disability CCDC136 NM_022742.4:c.1018C>Tp.(Arg340Trp) NM_022742.4:c.1079G>Ap.(Ser360Asn) AR_comphet 4.9 comphet maternal& paternal 2 NDD + Epilepsy (+) Intellectual disability,(+) Arthrogryposis multiplex congenita,(+) Polymicrogyria,(+) Seizure MDN1 NM_014611.3:c.11732G>Cp.(Ser3911Thr) AD_denovo 7.4 het de novo 1 NDD Global developmental delay, Delayed gross motor development, Macrocephaly, Patent foramen ovale SUPV3L1 NM_003171.4:c.1931G>Ap.(Arg644Gln) NM_003171.4:c.2358C>Gp.(Asp786Glu) AR_comphet 5.6 comphet maternal& paternal 1 NDD + Epilepsy (+) Global developmental delay,(+) Focal-onset seizure,(+) Abnormality of the nasal alae,(+) Poor eye contact RYR2 NM_001035.3:c.6202C>Tp.(Arg2068*) AD_denovo 11.5 het de novo 2 NDD + Epilepsy (+) Dravet syndrome,(+) Seizure,(+) Myoclonic seizure,(+) Myoclonic absence seizure,(+) Global developmental delay,(+) Intellectual disability RHBDL1 NM_001318733.1:c.1127C>Ap.(Ala376Glu) AD_denovo 5.6 het de novo 1 NDD + Epilepsy Focal-onset seizure, Seizure, Encephalopathy, Focal cortical dysplasia ATP6AP2 NM_005765.3:c.858G>Ap.(Ala286=) AD_denovo 8.0 het de novo 1 NDD (+) Moderate global developmental delay,(+) Muscular hypotonia,(+) Dysgenesis of the hippocampus,(+) Aggressive behavior,(+) Impulsivity,(+) Low frustration tolerance,(+) Pes planus,(+) Synophrys,(-) Seizure,(- ) Ataxia DNAH3 NM_017539.2:c.7420A>Tp.(Lys2474*) NM_017539.2:c.5287G>Ap.(Val1763Met) AR_comphet 5.8 comphet maternal& paternal 1 NDD (+) Global developmental delay,(+) Delayed speech and language development,(+) Autistic behavior,(+) Hearing impairment,(+) Developmental regression PCDH11X NM_032968.4:c.1688A>Gp.(Gln563Arg) XL 5.9 hemi maternal 1 NDD + Epilepsy (+) Febrile seizure (within the age range of 3 months to 6 years),(+) Short attention span,(+) Specific learning disability,(+) Generalized non-motor (absence) seizure,(+) Headache,(+) Recurrent infections PNCK NM_001135740.1:c.643C>Gp.(Leu215Val) XL 4.6 hemi maternal 1 NDD (+) Neurodevelopmental delay,(+) Mild expressive language delay,(+) Morphological central nervous system abnormality,(+) Hydromyelia,(+) Achilles tendon contracture,(+) Testicular torsion,(+) Syringomyelia,(+) Sleep disturbance,(+) Limited hip extension,(+) Spastic paraplegia,(+) Motor delay ZBTB45 NM_001316978.2:c.976G>Ap.(Gly326Arg) AR_homo 4.0 homo maternal& paternal 2 NDD + Epilepsy (+) Focal-onset seizure,(+) Brain imaging abnormality NOMO1 NM_014287.4:c.2173G>Ap.(Gly725Ser) AR_homo 4.4 homo maternal& paternal 2 NDD + Epilepsy (+) Focal-onset seizure,(+) Brain imaging abnormality PLXNA3 NM_017514.5:c.1015C>Gp.(Leu339Val) XL 6.1 hemi maternal 2 NDD + Epilepsy (+) Infantile encephalopathy,(+) Microcephaly,(+) Short stature,(+) Muscular hypotonia,(+) Micropenis,(+) Global developmental delay,(+) Abnormal facial shape,(+) Cerebral ischemia,(+) Focal-onset seizure,(+) Epicanthus,(+) Decreased body weight,(+) Oxycephaly,(+) Hypospadias,(+) Cryptorchidism SMYD5 NM_006062.3:c.100A>Gp.(Lys34Glu) NM_006062.3:c.833G>Ap.(Arg278His) AR_comphet 4.2 comphet maternal& paternal 2 NDD + Epilepsy (+) Infantile encephalopathy,(+) Microcephaly,(+) Short stature,(+) Muscular hypotonia,(+) Micropenis,(+) Global developmental delay,(+) Abnormal facial shape,(+) Cerebral ischemia,(+) Focal-onset seizure,(+) Epicanthus,(+) Decreased body weight,(+) Oxycephaly,(+) Hypospadias,(+) Cryptorchidism GIGYF1 NM_022574.4:c.1778A>Tp.(Asp593Val) AD_denovo Bhet de novo 2 Wachstum, Skelett (+) Cleft soft palate,(+) Cleft hard palate MAP3K6 NM_004672.4:c.3789-5C>Tp.? NM_004672.4:c.1733T>Ap.(Val578Asp) AR_comphet Ccomphet maternal& paternal 2 Wachstum, Skelett (+) Cleft soft palate,(+) Cleft hard palate MAGIX NM_024859.3:c.851C>Tp.(Pro284Leu) XL 3.0 hemi maternal 2 NDD (+) Abnormal macular morphology,(+) Subretinal deposits,(+) Motor delay,(+) Global developmental delay,(+) Attention deficit hyperactivity disorder
ZNF283 NM_181845.1:c.1927G>Tp.(Val643Phe) NM_181845.1:c.1342C>Ap.(Gln448Lys) AR_comphet 2.2 comphet maternal& paternal 2 NDD (+) Abnormal macular morphology,(+) Subretinal deposits,(+) Motor delay,(+) Global developmental delay,(+) Attention deficit hyperactivity disorder TMEM143 NM_018273.3:c.1022T>Cp.(Met341Thr) AD_denovo 4.4 het de novo 3 NDD + Epilepsy (+) Focal tonic seizure,(+) EEG with focal sharp waves,(+) Nocturnal seizures,(-) Brain imaging abnormality FAM214B NM_001317991.1:c.1012C>Gp.(Pro338Ala) AR_homo 5.6 homo maternal& paternal 3 NDD + Epilepsy (+) Focal tonic seizure,(+) EEG with focal sharp waves,(+) Nocturnal seizures,(-) Brain imaging abnormality STX4 NM_004604.4:c.118_120delp.(Glu40del) AR_homo 5.6 homo maternal& paternal 3 NDD + Epilepsy (+) Focal tonic seizure,(+) EEG with focal sharp waves,(+) Nocturnal seizures,(-) Brain imaging abnormality SEMA5A NM_003966.3:c.2123C>Tp.(Thr708Met) AR_homo 8.3 homo maternal& paternal 6 NDD (+) Severe global developmental delay,(+) Intellectual disability,(+) Feeding difficulties,(+) Muscular hypotonia ATP6V0A1 NM_001130021.3:c.2219G>Ap.(Arg740Gln) AD_unknown 5.3 het unknown 1 NDD + Epilepsy (+) Seizure,(+) Large for gestational age,(+) Microcephaly,(+) Global developmental delay,(+) Muscular hypotonia ADGRD2 NM_001161808.1:c.1068C>Ap.(Cys356*) AD_denovo 5.0 het de novo 1 NDD (+) Global developmental delay,(+) Motor delay,(+) Neonatal asphyxia,(+) Neonatal seizure,(+) Hypertonia,(+) Dysphagia,(+) Tongue fasciculations,(+) Microcephaly,(+) Infantile encephalopathy AHNAK NM_001620.2:c.11743G>Ap.(Asp3915Asn) AR_homo 6.4 homo maternal& paternal 3 NDD (+) Global developmental delay,(+) Motor delay,(+) Cleft palate,(+) Cleft lip,(+) Cerebellar hypoplasia DHRS3 NM_004753.6:c.730G>Cp.(Glu244Gln) AR_homo 5.6 homo maternal& paternal 3 NDD (+) Global developmental delay,(+) Motor delay,(+) Cleft palate,(+) Cleft lip,(+) Cerebellar hypoplasia TRPM2 NM_003307.3:c.2392G>Tp.(Val798Phe) AR_homo 5.6 homo maternal& paternal 3 NDD (+) Global developmental delay,(+) Motor delay,(+) Cleft palate,(+) Cleft lip,(+) Cerebellar hypoplasia MAGEA10 NM_001011543.2:c.229G>Tp.(Asp77Tyr) XL Chemi maternal 2 Wachstum, Skelett (+) Trigonocephaly OAS3 NM_006187.3:c.101G>Ap.(Gly34Asp) NM_006187.3:c.1443C>Ap.(Asn481Lys) AR_comphet Ccomphet maternal& paternal 1 Wachstum, Skelett (+) Trigonocephaly POLR3E NM_018119.3:c.437A>Gp.(Asp146Gly) AD_denovo Ahet de novo 2 Stoffwechs el (+) Low levels of vitamin A,(+) Low levels of vitamin D,(+) Leukopenia,(+) Thrombocytopenia,(+) Hepatosplenomegaly,(+) Portal vein thrombosis TENM2 NM_001122679.1:c.3262A>Tp.(Ile1088Phe) NM_001122679.1:c.6169C>Tp.(Arg2057Trp) AR_comphet Ccomphet maternal& paternal 2 Stoffwechs el (+) Low levels of vitamin A,(+) Low levels of vitamin D,(+) Leukopenia,(+) Thrombocytopenia,(+) Hepatosplenomegaly,(+) Portal vein thrombosis ZFHX3 NM_006885.3:c.5449G>Tp.(Val1817Leu) NM_006885.3:c.2321C>Tp.(Ala774Val) AR_comphet 5.4 comphet maternal& paternal 2 NDD + Epilepsy (+) Intellectual disability,(+) Seizure,(+) Polymicrogyria,(+) Arthrogryposis multiplex congenita PTPRH NM_002842.4:c.1324G>Ap.(Ala442Thr) NM_002842.4:c.683G>Ap.(Trp228*) AR_comphet Bcomphet maternal& paternal 1 Auge (+) Optic neuropathy,(+) Amblyopia,(+) Nystagmus,(+) Strabismus,(+) Mixed astigmatism,(+) Protanomaly BTBD18 ENST00000422652.1:c.1236dup, p.Arg413* AD_denovo Ahet de novo 2 Fehlbildung en Cleft palate, renal agnesia left PLEKHB2 ENST00000409158.1:c.83C>T p.Ser28Leu AR_homo Chomo maternal& paternal 2 Fehlbildung en (+) Cleft lip,(+) Cleft palate,(+) Unilateral renal agenesis HDAC6 ENST00000334136.5:c.3248G>A p.Gly1083Asp XL Chemi maternal 2 Wachstum, Skelett Trigonocephaly, Abnormality of calvarial morphology ZBTB12 ENST00000375527.2:c.583G>A p.Glu195Lys AD_denovo 5.0 het de novo 2 NDD + epilepsy (+) Seizure,(+) Global developmental delay,(+) Intellectual disability ADI1 ENST00000327435.6:c.214G>A p.Asp72Asn ENST00000327435.6:c.166C>T p.Arg56* AR_comphet 4.9 comphet maternal& paternal 2 NDD + Epilepsy (+) Seizure,(+) Global developmental delay,(+) Intellectual disability PPP2R5C ENST00000422945.2:c.1341A>T p.Lys447Asn AD_unknown 5.5 het unknown 1 NDD + epilepsy (+) Seizure,(+) Global developmental delay,(+) Hemimegalencephaly
FAM171A2 ENST00000293443.7:c.1170del p.Glu391Argfs*67 AR_homo 8.2 homo maternal& paternal 2 NDD (+) Intellectual disability,(+) Microcephaly JMJD1C ENST00000399262.2:c.1372G>A p.Glu458Lys AR_homo 7.6 homo maternal& paternal 2 NDD (+) Intellectual disability,(+) Microcephaly RC3H2 ENST00000373670.1:c.382C>A p.Arg128Ser AD_unknown 4.1 het unknown 1 NDD + epilepsy (+) Focal tonic seizure,(+) Focal myoclonic seizure,(+) Atypical absence seizure,(+) Intellectual disability, mild PHF20 ENST00000374012.3:c.1300A>G p.Lys434Glu AD_unknown 3.6 het unknown 2 NDD (+) Microcephaly,(+) Plagiocephaly,(+) Ventricular septal defect,(+) Short palpebral fissure,(+) Smooth philtrum,(+) Thin upper lip vermilion,(+) Short stature,(+) Absent speech,(+) Motor delay FAT3 ENST00000298047.6:c.5027A>G p.Tyr1676Cys ENST00000298047.6:c.10393A>G p.Ile3465Val AR_comphet 4.7 comphet ? unknown 2 NDD (+) Microcephaly,(+) Plagiocephaly,(+) Ventricular septal defect,(+) Short palpebral fissure,(+) Smooth philtrum,(+) Thin upper lip vermilion,(+) Short stature,(+) Absent speech,(+) Motor delay NEFM ENST00000221166.5:c.446C>G p.Ala149Gly AD_denovo 7.1 het de novo 1 NDD + epilepsy (+) Global developmental delay,(+) Intellectual disability,(+) Behavioral abnormality,(+) Short stature,(+) Focal motor seizure,(+) Focal-onset seizure,(+) Bilateral tonic-clonic seizure with focal onset PTPN21 ENST00000556564.1:c.1675C>T p.Arg559Trp ENST00000556564.1:c.2269A>T p.Ile757Phe AR_comphet 2.5 comphet maternal& paternal 2 epilepsy Seizure, abnormality of metabolism, epileptic encephalopathy AWAT1 ENST00000374521.3:c.273C>G p.Asp91Glu XL 3.2 hemi maternal 3 epilepsy intellecutal disability, focal onset seizur, cortical dysplasia, brain atrophy FAM171A1 ENST00000378116.4:c.364T>C p.Ser122Pro ENST00000378116.4:c.1418A>G p.Glu473Gly AR_comphet 3.4 comphet maternal& paternal 3 epilepsy intellecutal disability, focal onset seizur, cortical dysplasia, brain atrophy ZNRF4 ENST00000222033.4:c.1135C>G p.His379Asp AD_denovo 4.5 het de novo 3 epilepsy intellecutal disability, focal onset seizur, cortical dysplasia, brain atrophy DCBLD1 ENST00000296955.8:c.1178G>A p.Arg393Gln AR_homo 4.8 homo maternal& paternal 6 NDD Severe global developmental delay, Feeding difficulties, Muscular hypotonia NCOA7 ENST00000368357.3:c.1396G>A p.Ala466Thr AR_homo 3.3 homo maternal& paternal 6 NDD Severe global developmental delay, Feeding difficulties, Muscular hypotonia SLC27A4 ENST00000300456.4:c.1462+5_1462+9del None AR_homo 4.9 homo maternal& paternal 6 NDD Severe global developmental delay, Feeding difficulties, Muscular hypotonia MTUS2 ENST00000431530.3:c.2752C>T p.Arg918Trp AR_homo 4.3 homo maternal& paternal 6 NDD Severe global developmental delay, Feeding difficulties, Muscular hypotonia STXBP4 ENST00000376352.2:c.866G>C p.Cys289Ser AR_homo 3.9 homo maternal& paternal 6 NDD Severe global developmental delay, Feeding difficulties, Muscular hypotonia GRIPAP1 ENST00000376441.1:c.1007A>G p.Asn336Ser XL 5.9 hemi maternal 2 NDD (+) Intellectual disability,(+) Global developmental delay,(+) Abnormality of movement,(+) Dystonia,(+) Spasticity H1FOO ENST00000324382.2:c.863C>T p.Ala288Val AD_denovo 4.2 het de novo 2 NDD (+) Intellectual disability,(+) Global developmental delay,(+) Abnormality of movement,(+) Dystonia,(+) Spasticity NKPD1 ENST00000317951.4:c.1076A>G p.Tyr359Cys AD_denovo 5.4 het de novo 1 NDD Caudal regression syndrome, Currarino Triad, Global developmental delay HTR4 ENST00000360693.3:c.721C>T p.Gln241* AD_unknown 6.8 het unknown 2 NDD + epilepsy Intellectual disability,(+) Atypical absence seizure,(+) Generalized tonic seizure,(+) Generalized-onset epileptic spasm,(+) Myoclonus,(+) Generalized atonic seizure,(+) Bilateral tonic-clonic seizure with generalized onset NSD3 ENST00000317025.8:c.3725G>A p.Arg1242Gln AD_unknown 5.7 het unknown 2 NDD + epilepsy Intellectual disability,(+) Atypical absence seizure,(+) Generalized tonic seizure,(+) Generalized-onset epileptic spasm,(+) Myoclonus,(+) Generalized atonic seizure,(+) Bilateral tonic-clonic seizure with generalized onset ARHGEF2 ENST00000361247.4:c.355C>T p.Arg119Trp ENST00000361247.4:c.415C>T p.Arg139Cys AR_comphet 7.1 comphet maternal& paternal 1 NDD + muscle (+) Muscular hypotonia, (+) Increased serum lactate, (+) Motor delay, (+) Strabismus, (+) Reduced visual acuity, (+) Visual impairment
SHANK1 ENST00000293441.1:c.4932C>G p.Asp1644Glu AD_unknown 7.1 het unknown 1 NDD + Epilepsy Typical absence seizure,(+) Myoclonic seizure,(+) Bilateral tonic-clonic seizure,(+) Intellectual disability, mild,(+) Intellectual disability, borderline,(+) EEG with spike-wave complexes (2.5-3.5 Hz) NCKAP1 ENST00000360982.2:c.3366_3369del p.Tyr1122* AD_denovo 11.7 het de novo 1 NDD + Epilepsy (+) Epicanthus,(+) Narrow face,(+) Anteverted nares,(+) High palate,(+) Global developmental delay,(+) Focal-onset seizure NRXN3 NM_001330195.2(NRXN3):c.3985C>T AD_inherited 8.4 het maternal 1 NDD + Epilepsy (+) Generalized non-motor (absence) seizure,(+) Attention deficit hyperactivity disorder,(+) Talipes cavus equinovarus,(+) Global developmental delay,(+) Low-frequency hearing loss AFF3 ENST00000356421.2:c.3181G>A p.Val1061Ile ENST00000356421.2:c.3632G>A p.Arg1211Gln AR_comphet 4.9 comphet maternal& paternal 1 NDD + epilepsy (+) Epileptic encephalopathy,(+) Agenesis of corpus callosum,(+) Abnormal cortical gyration, (+) Hypomyelination CPSF4 ENST00000292476.5:c.655C>T p.Pro219Ser AD_denovo 7.0 het de novo 10 NDD + Epilepsy (+) Microcephaly,(+) Intellectual disability,(+) Cognitive impairment,(+) Seizure PCDH1 ENST00000287008.3:c.3698G>A p.Arg1233His AR_homo 5.0 homo maternal& paternal 10 NDD + Epilepsy (+) Microcephaly,(+) Intellectual disability,(+) Cognitive impairment,(+) Seizure ADNP2 ENST00000262198.4:c.422T>G p.Ile141Ser AR_homo 6.0 homo maternal& paternal 10 NDD + Epilepsy (+) Microcephaly,(+) Intellectual disability,(+) Cognitive impairment,(+) Seizure HTR3B ENST00000260191.2:c.550G>A p.Asp184Asn AR_homo 5.3 homo maternal& paternal 10 NDD + Epilepsy (+) Microcephaly,(+) Intellectual disability,(+) Cognitive impairment,(+) Seizure PPFIBP1 NM_177444.3:c.1197+1G>A, p.? AR_homo 8.2 homo maternal& paternal 10 NDD + Epilepsy (+) Microcephaly,(+) Intellectual disability,(+) Cognitive impairment,(+) Seizure ARHGEF12 ENST00000397843.2:c.3460_3462del p.Asn1154del AR_homo 5.4 homo maternal& paternal 10 NDD + Epilepsy (+) Microcephaly,(+) Intellectual disability,(+) Cognitive impairment,(+) Seizure ASUN ENST00000261191.7:c.341G>A p.Arg114Gln AR_homo 4.2 homo maternal& paternal 10 NDD + Epilepsy (+) Microcephaly,(+) Intellectual disability,(+) Cognitive impairment,(+) Seizure TNRC18 ENST00000430969.1:c.4261_4262delinsGG p.Leu1421Gly AR_homo 5.4 homo maternal& paternal 10 NDD + Epilepsy (+) Microcephaly,(+) Intellectual disability,(+) Cognitive impairment,(+) Seizure CDC25C ENST00000323760.6:c.1129T>C p.Cys377Arg AR_homo 6.1 homo maternal& paternal 10 NDD + Epilepsy (+) Microcephaly,(+) Intellectual disability,(+) Cognitive impairment,(+) Seizure HEXIM2 AR_homo 7.0 homo maternal& paternal 10 NDD + Epilepsy (+) Microcephaly,(+) Intellectual disability,(+) Cognitive impairment,(+) Seizure KANK1 ENST00000382303.1:c.3733G>A p.Gly1245Arg ENST00000382303.1:c.1652G>A p.Cys551Tyr AR_comphet 6.3 comphet maternal& paternal 3 NDD + Epilepsy (+) Global developmental delay,(+) Infantile spasms,(+) Generalized-onset seizure,(+) Hearing impairment,(+) Epileptic encephalopathy DRP2 ENST00000395209.3:c.575A>C p.Gln192Pro XL 4.6 hemi maternal 3 NDD + Epilepsy (+) Global developmental delay,(+) Infantile spasms,(+) Generalized-onset seizure,(+) Hearing impairment,(+) Epileptic encephalopathy RNF113A ENST00000371442.2:c.265_270del p.Glu89_Glu90del XL 5.0 hemi maternal 3 NDD + Epilepsy (+) Global developmental delay,(+) Infantile spasms,(+) Generalized-onset seizure,(+) Hearing impairment,(+) Epileptic encephalopathy TSSC1 ENST00000382125.4:c.514G>A p.Val172Met AD_denovo 5.2 het de novo 3 Muskel Motor delay, Muscular hypotonia, Skeletal muscle atrophy RFX7 NM_022841.5 :c.3083C>T p.(Pro1028Leu) AD_denovo 6.7 het de novo 1 NDD + Epilepsy Congenital cataract, Optic nerve hypoplasia, Delayed speech and language development, Intellectual disability, Seizures, Apnea, Generalized myoclonic seizures, Abnormality of the basal ganglia, Delayed CNS myelination, Sleep disturbance, Focal seizures with impairment of consciousness or awareness, Abnormality of brain morphology, Abnormal myelination, Delayed myelination, Infantile spasms, Abnormality of movement NKTR ENST00000232978.8:c.2511_2514del p.Gln838Lysfs*23 AD_denovo 10.2 het de novo 3 Muskel Motor delay, Muscular hypotonia, Skeletal muscle atrophy DRP2 ENST00000395209.3:c.2438C>T p.Ala813Val XL 4.9 hemi maternal 3 Muskel Motor delay, Muscular hypotonia, Skeletal muscle atrophy KCNRG ENST00000312942.1:c.394dup, p.Thr132Asnfs*3 AR_homo 8.0 homo maternal& paternal 1 NDD (+) Global developmental delay,(+) Cognitive impairment,(+) Autism,(+) Autistic behavior ERVMER34-1 ENST00000443173.1:c.936A>T p.Lys312Asn AD_denovo Bhet de novo 1 other (+) Intrauterine growth retardation,(+) Oligohydramnios CELSR3 ENST00000164024.4:c.5751+1G>C None AR_homo 11.2 homo maternal& paternal 1 (+) Focal-onset seizure,(+) Generalized-onset seizure,(+) Global developmental delay,(+) Dystonia,(+) Cerebral white matter agenesis,(+) Microcephaly
ITGAM ENST00000544665.3:c.2923C>T p.Pro975Ser AD_denovo 6.5 het de novo 1 NDD + Wachstum Failure to thrive, Short stature, Feeding difficulties, Hepatomegaly, Atrial septal defect, Ab-dominal distention, Global developmental delay, Congenital microcephaly, Plagiocephaly, Dysmorphic facial features ALDH3B2 ENST00000349015.3:c.505G>A p.Val169Ile ENST00000349015.3:c.635G>A p.Arg212Gln AR_comphet Ccomphet maternal& paternal 1 congenital heart defects Unbalanced atrioventricular canal defect, Anomalous pulmonary venous return, Congenital malformation of the great arteries, Bradycardia NME4 ENST00000219479.2:c.1A>T p.Met1? AR_homo 7.78 homo unknown 1 NDD + Epilepsy Moderate intellectual disability, delayed speech and language development, absence seizure, focal impaired awareness motor seizure, bilateral tonic-clonic seizure with generalized onset, muscular hypotonia, joint laxity, abnormal facial shape, temporal lobe sclerosis right (Hippocampectomy 01/2005), hypogonadotropic hypogonadism YWHAB ENST00000372839.3:c.637T>C p.Tyr213His AD_denovo 7.2 het de novo 1 NDD + Epilepsy (+) Seizure,(+) Global developmental delay DNAH6 ENST00000237449:c.11360G>A p.Gly3787Asp AD_inherited 5.0 het maternal 1 Epilepsy (+) Generalized-onset seizure,(+) Focal motor seizure,(+) EEG abnormality,(+) Mild short stature,(+) Microcephaly,(+) Decreased glucose-6-phosphate dehydrogenase level in blood CGB1 ENST00000301407.7:c.290T>C p.Val97Ala ENST00000301407.7:c.401A>G p.Gln134Arg AR_comphet 2.33 comphet maternal& paternal 1 NDD + epilepsy (+) Ataxia,(+) Intellectual disability,(+) Myoclonic spasms,(+) Epileptic spasm,(+) Seizure,(-) Abnormality of the face ALS2CL ENST00000318962.4:c.893C>T p.Ala298Val ENST00000318962.4:c.2704G>A p.Glu902Lys AR_comphet 3.3 comphet maternal& paternal 1 epilepsy (+) Myoclonic seizure,(+) Generalized myoclonic-tonic-clonic seizure,(+) Ataxia,(+) Suicidal ideation WDFY4 ENST00000325239.5:c.3175+2del None AD_unknown 6.2 het unknown 1 NDD (+)Global developmental delay,(+) Delayed speech and language development,(+) Muscular hypotonia,(+) Anal atresia,(+) Perineal fistula,(+) Atrial septal defect,(+) Dextrocardia,(+) Hearing impairment,(+) Unilateral ptosis,(+) Posterior plagiocephaly,(+) Scoliosis,(+) Low-set ears,(+) Retrognathia,(+) Abnormality of the philtrum,(+) Bilateral single transverse palmar creases,(+) Abnormality of toe GRIK3 ENST00000373091.3:c.176C>T p.Ala59Val AD_unknown 5.44 het unknown 1 NDD (+) Global developmental delay,(+) Ataxia,(+) Muscular hypotonia,(+) Macrocephaly,(+) Tall stature,(+) Obesity CHD8 ENST00000399982.2:c.4418G>T p.Arg1473Leu AD_unknown 6.61 het unknown 1 NDD + Epilepsy (+) Tonic seizure,(+) Intellectual disability, severe,(+) Kyphoscoliosis,(+) Hyperlordosis,(+) Focal polymicrogyria,(+) Frontoparietal polymicrogyria,(+) Global brain atrophy,(+) EEG with focal epileptiform discharges,(+) Bilateral tonic-clonic seizure,(+) Absent speech EHMT2 ENST00000375537.4:c.912_914del p.Glu323del ENST00000375537.4:c.1509G>A p.Ala503= AR_comphet 6.33 comphet maternal& paternal 1 NDD (+) Intellectual disability,(+) Global developmental delay,(+) Microcephaly,(+) Behavioral abnormality,(+) 2-3 toe syndactyly FADS1 ENST00000350997.7:c.238G>A p.Asp80Asn AR_homo Bhomo maternal& paternal 4 NDD (+) Double outlet right ventricle,(+) Pulmonic stenosis,(+) Failure to thrive,(+) Frontal hirsutism,(+) Lowset ears,(+) Narrow face,(+) Hearing impairment RCOR2 ENST00000301459.4:c.1376C>T p.Thr459Met AR_homo Bhomo maternal& paternal 4 NDD (+) Double outlet right ventricle,(+) Pulmonic stenosis,(+) Failure to thrive,(+) Frontal hirsutism,(+) Lowset ears,(+) Narrow face,(+) Hearing impairment SRGAP1 ENST00000355086.3:c.1421A>G p.Glu474Gly ENST00000355086.3:c.1217G>A p.Arg406His AR_comphet 4.8 comphet maternal& paternal 1 Epilepsy Generalized-onset seizure, Bilateral tonic-clonic seizure, Focal-onset seizure, EEG with spike-wave complexes
GAL3ST4 ENST00000360039.4:c.1207_1208insC p.Leu403Profs*10 AR_homo 8.0 homo maternal& paternal 1 NDD (+) Profound global developmental delay,(+) Muscular hypotonia,(+) Abnormality of the Achilles tendon,(+) Abnormal foot morphology,(+) Increased lactate dehydrogenase level,(+) Increased serum lactate,(+) Delayed CNS myelination,(+) Hypoplasia of the corpus callosum,(+) Abnormal macular morphology,(-) Abnormal facial shape PER1 ENST00000317276.4:c.694G>C p.Val232Leu ENST00000317276.4:c.3373G>A p.Val1125Met AR_comphet Ccomphet maternal& paternal 4 NDD (+) Double outlet right ventricle,(+) Pulmonic stenosis,(+) Failure to thrive,(+) Frontal hirsutism,(+) Lowset ears,(+) Narrow face,(+) Hearing impairment HECTD1 ENST00000399332.1:c.5140C>T p.Arg1714Cys ENST00000399332.1:c.6725C>T p.Thr2242Met AR_comphet Ccomphet maternal& paternal 4 NDD (+) Double outlet right ventricle,(+) Pulmonic stenosis,(+) Failure to thrive,(+) Frontal hirsutism,(+) Lowset ears,(+) Narrow face,(+) Hearing impairment TNRC18 ENST00000430969.1:c.690G>T p.Glu230Asp ENST00000430969.1:c.5525C>T p.Ala1842Val AR_comphet 4.4 comphet maternal& paternal 3 Neuro Leukodystrophy, Leukoencephalopathy, Strabismus (normal development) NCOR1 ENST00000268712.3:c.3360G>C p.Glu1120Asp ENST00000268712.3:c.5240G>A p.Arg1747Gln AR_comphet 5.7 comphet maternal& paternal 3 Neuro Leukodystrophy, Leukoencephalopathy, Strabismus (normal development) TMEM205 ENST00000354882.5:c.326G>A p.Arg109His AR_homo 3.8 homo maternal& paternal 3 Neuro Leukodystrophy, Leukoencephalopathy, Strabismus (normal development) CROCC ENST00000375541.5:c.5585G>A p.Arg1862Gln ENST00000375541.5:c.736G>C p.Ala246Pro AR_comphet 4.8 comphet ? unknown 4 NDD + Epilepsy Bilateral tonic-clonic seizure with focal onset, Hypothyroidism, Hepatosplenomegaly, Intellectual disability, Global developmental delay, EEG abnormality, EEG with focal sharp waves, Cranial hyperostosis, Poor speech USP21 ENST00000368002.3:c.935G>A p.Arg312Gln ENST00000368002.3:c.112C>T p.Arg38Cys AR_comphet 2.9 comphet ? unknown 4 NDD + Epilepsy Bilateral tonic-clonic seizure with focal onset, Hypothyroidism, Hepatosplenomegaly, Intellectual disability, Global developmental delay, EEG abnormality, EEG with focal sharp waves, Cranial hyperostosis, Poor speech KIAA1407 ENST00000295878.3:c.89A>C p.Lys30Thr ENST00000295878.3:c.1035dup, p.Lys346Glufs*7 AR_comphet 4.3 comphet ? unknown 4 NDD + Epilepsy Bilateral tonic-clonic seizure with focal onset, Hypothyroidism, Hepatosplenomegaly, Intellectual disability, Global developmental delay, EEG abnormality, EEG with focal sharp waves, Cranial hyperostosis, Poor speech RBM19 ENST00000545145.2:c.520T>G p.Ser174Ala ENST00000545145.2:c.1247A>G p.Glu416Gly AR_comphet 4.6 comphet ? unknown 4 NDD + Epilepsy Bilateral tonic-clonic seizure with focal onset, Hypothyroidism, Hepatosplenomegaly, Intellectual disability, Global developmental delay, EEG abnormality, EEG with focal sharp waves, Cranial hyperostosis, Poor speech TRIM14 ENST00000341469.2:c.1104C>A p.Asp368Glu AD_inherited Bhet maternal 1 Immunolog ie (+) Recurrent infections,(+) Sepsis,(+) Affected mother SCAF8 ENST00000367186.4:c.119dup, p.Leu41Profs*14 AD_unknown 6.06 het unknown 1 NDD + epilepsy (+) Intellectual disability, severe,(+) Severe global developmental delay,(+) Bilateral tonic-clonic seizure with focal onset,(+) Cataract,(+) Abnormality of the kidney,(+) EEG abnormality
PRKRIR ENST00000260045.3:c.2274_2275delinsCT p.Glu759* AD_unknown Bhet unknown 1 Muskel Maligne Hyperthermie TRANK1 ENST00000429976.2:c.4634A>G p.Asn1545Ser AR_homo Bhomo maternal& paternal 4 other Precocious puberty, Tremor, Hypertrichosis, Hirsutism, Increased head circumference, Increased body weight, Acne MAP7D1 ENST00000373151.2:c.2003A>C p.Glu668Ala AR_homo Bhomo maternal& paternal 4 other Precocious puberty, Tremor, Hypertrichosis, Hirsutism, Increased head circumference, Increased body weight, Acne NME6 ENST00000421967.1:c.548A>T p.His183Leu AR_homo Bhomo maternal& paternal 4 other Precocious puberty, Tremor, Hypertrichosis, Hirsutism, Increased head circumference, Increased body weight, Acne PHC3 ENST00000495893.2:c.959A>G p.His320Arg AR_homo Bhomo maternal& paternal 4 other Precocious puberty, Tremor, Hypertrichosis, Hirsutism, Increased head circumference, Increased body weight, Acne GPR124 ENST00000412232.2:c.1579C>T p.Leu527Phe AD_denovo 5.9 het de novo 1 NDD + epilepsy Intellectual disability, moderate, Global developmental delay, Focal-onset seizure, Generalized-onset seizure, Abnormality of brain morphology in MRI , Muscle weakness of the right side of the body TIMP1 ENST00000218388:c.224T>C p.Leu75Ser XL 4.33 hemi maternal 2 NDD Mental retardation SEMA4B ENST00000411539:c.1044-8C>T None ENST00000411539:c.2320G>A p.Gly774Ser AR_comphet 3.78 comphet maternal& paternal 2 NDD Mental retardation GOLGA2 ENST00000421699:c.2414del p.Met805Argfs*18 AD_unknown 8.8 het unknown 1 NDD Intellectual disability, Abnormal facial shape ATP13A3 ENST00000439040.5:c.2638A>T p.(Met880Leu) AD_unknown Chet unknown 1 Wachstum, Skelett (+) Mild short stature SMARCA1 ENST00000371122:c.2402A>G p.Glu801Gly XL 7.67 hemi unknown 1 NDD + Epilepsy Intellectual disability, severe,(+) Severe global developmental delay,(+) EEG abnormality,(+) Generalized tonic seizure,(+) Bilateral tonic-clonic seizure with generalized onset,(+) Status epilepticus,(+) Spastic tetraparesis,(+) Bilateral talipes equinovarus,(+) Pilomatrixoma SPRED3 ENST00000338502:c.1210C>T p.Arg404Cys AD_denovo 5.4 het de novo 2 NDD + epilepsy (+) Atonic seizure,(+) Generalized clonic seizure,(+) Generalized tonic seizure,(+) Intellectual disability, mild,(+) Gastroesophageal reflux,(+) Postnatal microcephaly PIPOX ENST00000323372.4:c.28G>T p.Ala10Ser ENST00000323372.4:c.514G>A p.Gly172Arg AR_comphet 4.3 comphet maternal& paternal 2 NDD + epilepsy (+) Atonic seizure,(+) Generalized clonic seizure,(+) Generalized tonic seizure,(+) Intellectual disability, mild,(+) Gastroesophageal reflux,(+) Postnatal microcephaly CCDC180 ENST00000375202:c.820C>T p.Arg274* ENST00000375202:c.4179+5G>C None AR_comphet 3.8 comphet ? unknown 1 NDD Global developmental delay, Aggressive behavior NSF ENST00000398238:c.2218C>A p.Pro740Thr AD_unknown 6.09 het unknown 1 NDD + Epilepsy myoklonische Anfälle, komplexe Partialanfälle sekundärer Generalisierung, V.a. Absencen, schwere Intelligenzminderung, Entwicklungsstörung keine Kontaktaufnahme, Strabismus divergens, Nystagmus, Okulomotoriusparese, beginnende Cerebralparese, muskuläre Hypotonie, Optikusatrophie bei Netzhautdystrophie, komplexe Hirnfehlbildungen: Aphasie des Nucleus caudatus und Potamen rechts, Hypoplasie des Balkens, Polygyrie, höhergradige Atrophie der linken Kleinhirnhemisphäre ITPK1 ENST00000267615:c.899_900insGA p.Gly301Lysfs*6 AD_unknown 6.1 het unknown 1 Epilepsy fokale Epilepsie refraktär auf Levetiracetam und Valproat, bislang unauffällige Entwicklung EIF5B ENST00000289371:c.1360del p.Ile454Tyrfs*5 AD_unknown 6.8 het unknown 2 NDD + Epilepsy (+) Intellectual disability, severe,(+) Stereotypical hand wringing,(+) Self-injurious behavior,(+) Obsessivecompulsive behavior,(+) Seizure,(+) Scoliosis MARK2 ENST00000402010:c.1934+1G>A None AD_unknown 7.6 het unknown 2 NDD + Epilepsy (+) Intellectual disability, severe,(+) Stereotypical hand wringing,(+) Self-injurious behavior,(+) Obsessivecompulsive behavior,(+) Seizure,(+) Scoliosis NRCAM ENST00000379028:c.2738G>A p.Gly913Asp ENST00000379028:c.2491C>A p.Pro831Thr AR_comphet 7.8 comphet ? unknown 1 NDD + Epilepsy (+) Intellectual disability,(+) Global developmental delay,(+) Seizure,(+) Motor delay,(+) EEG abnormality,(+) Poor coordination,(+) Delayed speech and language development,(+) Cafe-au-lait spot,(+) Autism
BZRAP1 ENST00000343736:c.5540G>A p.Ser1847Asn ENST00000343736:c.4348G>T p.Gly1450Cys AR_comphet 5.1 comphet ? unknown 1 NDD + epilepsy (+) Autism,(+) Delayed speech and language development,(+) Bilateral tonic-clonic seizure,(+) Mild global developmental delay ARHGDIB ENST00000228945:c.239C>T p.Pro80Leu AR_homo 4.22 homo maternal& paternal 5 Neuro (-) Abnormality of brain morphology,(+) Lower limb spasticity NAP1L1 ENST00000261182:c.1058_1059+1dup AD_unknown 6.3 het unknown 2 Epilepsy + ASD (+) Tall stature,(+) Autistic behavior,(+) Short attention span,(+) Delayed speech and language development,(+) Generalized non-motor (absence) seizure,(+) Diminished ability to concentrate HTR3E ENST00000440596:c.1031T>C p.Leu344Pro AD_denovo 4.4 het de novo 3 NDD (+) Intellectual disability,(+) Cortical dysplasia,(+) Focal-onset seizure XIRP2 ENST00000409195:c.5646G>A p.Trp1882* ENST00000409043:c.*1158G>A p.Gly810Glu AR_comphet 5.1 comphet maternal& paternal 3 NDD (+) Intellectual disability,(+) Cortical dysplasia,(+) Focal-onset seizure OGFR ENST00000290291:c.398+7T>G None ENST00000290291:c.1108G>A p.Gly370Arg AR_comphet 2.3 comphet maternal& paternal 3 NDD (+) Intellectual disability,(+) Cortical dysplasia,(+) Focal-onset seizure KCP ENST00000476647:n.4653C>T None ENST00000476647:n.1049+2T>G None AR_comphet Bcomphet maternal& paternal 3 Fehlbildung en hypotrophes Neugeborenes (Gewicht 5P, Länge 1P, Kopf 50P, 1z), Plagiozephalus DD Brachyzephalus, präaxiale Polydaktylie Typ 1 mit biphalangealem Daumen rechts, V.a. bikuspide Aortenklappe, Harntransprotströrung I-II° rechts und I° links, Neugeborenen-Hörscreening auffällig, Rektumstenose (Stoma), V.a. VACTERL-Assoziation (4/7 Symptomen), Körpermaße zur Vorstellung: Gewicht 52P, Größe 23P, Kopfumfang 10P KCNG2 ENST00000316249:c.11G>A p.Trp4* AD_unknown 4.8 het unknown 1 NDD (+) Obsessive-compulsive behavior,(+) Global developmental delay,(+) Obesity,(+) Postural instability,(+) Sleep disturbance,(+) Highly arched eyebrow,(+) Polyphagia,(+) Poor fine motor coordination,(+) Dyslexia CDC42BPG ENST00000342711:c.1289G>A p.Ser430Asn AD_denovo 4.7 het de novo 1 Epilepsy (+) Bilateral tonic-clonic seizure with focal onset,(+) Focal motor seizure,(+) Autonomic epileptic aura TOP2B ENST00000435706:c.3360A>T p.Gln1120His AD_unknown 5.4 het unknown 1 NDD (+) Delayed speech and language development,(+) Episodic hemiplegia PBRM1 ENST00000394830:c.233G>A p.Arg78Gln AD_unknown 4.5 het unknown 1 NDD (+) Autism,(+) Intellectual disability,(+) Seizure,(+) Scoliosis,(+) Severe global developmental delay HDAC1 ENST00000373548:c.1322A>G p.Lys441Arg AD_unknown 5.4 het unknown 1 NDD + epilepsy (+) Intellectual disability,(+) Focal-onset seizure,(+) Myoclonic absence seizure,(+) Moderate global developmental delay,(+) Mild malformation of cortical development HUWE1 ENST00000342160:c.12115C>T p.Pro4039Ser XL Bhemi maternal 1 Fehlbildung en (+) Renal insufficiency,(+) Aortic valve stenosis,(+) Respiratory insufficiency,(+) Hyperechogenic kidneys,(+) Elevated C-reactive protein level PRKCB ENST00000303531:c.1810G>C p.Asp604His AD_unknown 5.0 het unknown 1 NDD (+) Microcephaly,(+) Short stature,(+) Moderate global developmental delay SIPA1L1 ENST00000555818:c.5402T>C p.Ile1801Thr AD_unknown 4.33 het unknown 1 NDD + epilepsy (+) Cleft palate,(+) Seizure,(+) Ataxia,(+) Spasticity,(+) Short stature,(+) Severe global developmental delay,(+) Cleft lip ANKRD28 ENST00000399451:c.3065C>G p.Pro1022Arg AD_denovo 4.9 het de novo 4 NDD (+) Wide mouth,(+) Coarse facial features,(+) Autism,(+) Intellectual disability,(+) Moderate global developmental delay USP39 ENST00000323701:c.1498A>C p.Ile500Leu AD_denovo 5.9 het de novo 4 NDD (+) Wide mouth,(+) Coarse facial features,(+) Autism,(+) Intellectual disability,(+) Moderate global developmental delay CAPN8 ENST00000366872:c.34C>T p.Arg12Trp AR_homo 3.6 homo maternal& paternal 4 NDD (+) Wide mouth,(+) Coarse facial features,(+) Autism,(+) Intellectual disability,(+) Moderate global developmental delay SLC44A2 ENST00000335757:c.1060G>A p.Val354Met ENST00000335757:c.1061T>C p.Val354Ala AR_comphet 3.7 comphet maternal& paternal 4 NDD (+) Wide mouth,(+) Coarse facial features,(+) Autism,(+) Intellectual disability,(+) Moderate global developmental delay NCKAP1 ENST00000360982:c.1138G>T p.Ala380Ser AD_unknown 6.0 het unknown 1 NDD + epilepsy (+) Microcephaly,(+) Behavioral abnormality,(+) Seizure,(+) Moderate global developmental delay,(+) Dissociative reaction PITPNM2 ENST00000320201:c.643+2T>C None AD_unknown 5.94 het unknown 1 NDD + epilepsy (+) Coarse facial features,(+) Aggressive behavior,(+) Seizure,(+) Obesity,(+) Moderate global developmental delay
ASTN1 ENST00000361833:c.3622C>T p.Arg1208* AD_denovo Ahet de novo 1 Neuro (+) Depression,(+) Headache,(+) Progressive neurologic deterioration,(+) Nonprogressive cerebellar ataxia,(+) Anti-Yo antibody EP400 ENST00000389561:c.2665C>T p.Gln889* AD_unknown 6.5 het unknown 2 NDD (+) Global developmental delay,(+) Agenesis of corpus callosum ZBTB10 ENST00000430430:c.2203C>T p.Arg735* AD_unknown 5.0 het unknown 2 NDD (+) Global developmental delay,(+) Agenesis of corpus callosum UBR2 ENST00000372899:c.4319G>A p.Gly1440Glu AD_denovo 7.4 het de novo 1 NDD (+) Abnormal lip morphology,(+) Thick lower lip vermilion,(+) Open mouth,(+) Coarse facial features,(+) Intellectual disability,(+) Global developmental delay,(+) Abnormal facial shape,(+) Thick vermilion border ST3GAL2 ENST00000393640:c.420del p.Tyr141Thrfs*37 AD_unknown 5.6 het unknown 1 NDD + epilepsy (+) Seizure,(+) Neonatal hypoglycemia,(+) Generalized non-motor (absence) seizure,(-) EEG abnormality,(+) Proportionate short stature,(-) Abnormal cardiac MRI CPSF3 ENST00000238112:c.1147C>A p.Pro383Thr AD_unknown Chet unknown 1 immunolog ie (+) Episodic abdominal pain,(+) Periodic fever ANXA11 ENST00000438331:c.1403A>G p.Asp468Gly AD_denovo 4.86 het de novo 2 NDD (+) Behavioral abnormality,(+) Dementia,(+) Intellectual disability, mild,(+) Motor delay,(+) Neurological speech impairment,(+) Global brain atrophy,(+) Sleep disturbance,(+) Encephalitis,(+) Pica MRPL42 ENST00000549982:c.143A>G p.Glu48Gly AD_denovo 4.9 het de novo 2 NDD (+) Behavioral abnormality,(+) Dementia,(+) Intellectual disability, mild,(+) Motor delay,(+) Neurological speech impairment,(+) Global brain atrophy,(+) Sleep disturbance,(+) Encephalitis,(+) Pica ARFGEF1 ENST00000262215:c.1028-2A>T None AD_unknown 7.9 het unknown 1 NDD + epilepsy (+) Intellectual disability,(+) Focal-onset seizure HSPA4 ENST00000304858:c.1450G>C p.Val484Leu AR_homo 7.8 homo unknown 3 NDD (+) Intellectual disability,(+) Hypotonia,(+) Mild global developmental delay,(+) Abnormal ear morphology GPR84 ENST00000551809:c.895del p.Gln299Serfs*19 AR_homo 8.4 homo unknown 3 NDD (+) Intellectual disability,(+) Hypotonia,(+) Mild global developmental delay,(+) Abnormal ear morphology MYO1A ENST00000442789:c.2827del p.Val943Cysfs*15 AR_homo 8.6 homo unknown 3 NDD (+) Intellectual disability,(+) Hypotonia,(+) Mild global developmental delay,(+) Abnormal ear morphology TMEM131L ENST00000409959:c.1226G>A p.Trp409* AD_unknown 5.3 het unknown 1 NDD (+) Torticollis,(+) Nystagmus,(+) Behavioral abnormality,(+) Intellectual disability,(+) Global developmental delay,(+) Scoliosis,(+) Abducens palsy AGAP2 ENST00000257897:c.52C>T p.Arg18* AD_unknown 7.1 het unknown 1 neuro +) Episodic ataxia KCNG1 ENST00000371571:c.59C>T p.Ser20Leu AD_unknown 3.46 het unknown 1 NDD + epilepsy (+) Epileptic encephalopathy TLN2 ENST00000561311:c.4308_4309del p.Cys1436Trpfs*17 AD_unknown 6.3 het unknown 2 NDD + epilepsy (+) Focal-onset seizure,(+) EEG with focal epileptiform discharges,(+) EEG with generalized epileptiform discharges,(+) Mild global developmental delay MCMBP ENST00000360003:c.1110A>G p.Ile370Met AD_denovo 4.7 het de novo 1 NDD (+) Trigonocephaly,(+) Hypertelorism,(+) Upslanted palpebral fissure,(+) Autism,(+) Delayed speech and language development,(+) Hypotonia,(+) Clinodactyly of the 5th finger,(+) Moderate global developmental delay,(+) Epicanthus palpebralis SYMPK ENST00000245934:c.226-7_226-2del None AD_unknown Bhet unknown 1 Muskel (+) Motor delay,(+) Muscle weakness,(+) Lower limb muscle weakness,(+) Infantile muscular hypotonia CHD1L ENST00000369258:c.1086-2A>G None AD_unknown 6.7 het unknown 1 epilepsy (+) Generalized non-motor (absence) seizure DENR ENST00000280557:c.426_429del p.Glu143Hisfs*15 AD_unknown 5.9 het unknown 1 NDD + epilepsy (+) Open mouth,(+) Abnormality of the face,(+) Hypomimic face,(+) Intellectual disability,(+) Spastic diplegia,(+) Aphasia,(+) Focal-onset seizure,(+) Severe global developmental delay,(+) Happy demeanor PTBP1 ENST00000356948:c.8+2T>G AD_unknown 8.3 het inherited 1 Epilepsy (+) Hydrocephalus,(+) Macrocephaly,(+) Headache,(+) Focal-onset seizure,(+) Episodic hemiplegia PTPRN ENST00000295718:c.1237A>G p.Thr413Ala AD_denovo 5.8 het de novo 1 NDD (+) Epicanthus,(+) Depressed nasal ridge,(+) Upslanted palpebral fissure,(-) Intellectual disability,(+) Hypotonia,(+) Motor delay,(+) Expressive language delay,(+) Aplastic/hypoplastic toenail,(+) Oligodactyly,(+) Clinodactyly WEE1 ENST00000450114:c.848G>A p.Arg283Lys AD_unknown 4.0 het unknown 1 NDD (+) Low-set, posteriorly rotated ears,(+) Abnormality of skin pigmentation,(+) Specific learning disability,(+) Mutism,(+) Intellectual disability, borderline,(+) Mild global developmental delay LRRC37A2 ENST00000576629:c.4967C>G p.Pro1656Arg AD_denovo 4.2 het de novo 2 NDD (+) Autism,(+) Intellectual disability,(+) Global developmental delay PLXND1 ENST00000324093:c.5657C>T p.Pro1886Leu ENST00000324093:c.2668G>A p.Ala890Thr AR_comphet 5.6 comphet maternal& paternal 2 NDD (+) Autism,(+) Intellectual disability,(+) Global developmental delay ABLIM1 ENST00000277895:c.688G>A p.Gly230Arg AD_denovo 6.9 het de novo 2 Wachstum, Skelett (+) Abnormal thumb morphology,(+) Preaxial hand polydactyly,(+) Vertebral segmentation defect,(+) Pilonidal sinus,(+) Muscular ventricular septal defect,(+) Perimembranous ventricular septal defect
MYO7B ENST00000428314:c.2349C>G p.Phe783Leu ENST00000428314:c.6250-1G>A None AR_comphet 4.2 comphet maternal& paternal 2 Wachstum, Skelett (+) Abnormal thumb morphology,(+) Preaxial hand polydactyly,(+) Vertebral segmentation defect,(+) Pilonidal sinus,(+) Muscular ventricular septal defect,(+) Perimembranous ventricular septal defect FASTKD3 ENST00000264669:c.1634C>T p.Thr545Ile AD_denovo 5.4 het de novo 2 NDD + epilepsy (+) Hemangioma,(+) Seizure,(+) Global developmental delay,(+) Abnormal facial shape,(+) Spastic paraparesis,(+) Abnormality of brain morphology,(+) Cerebral palsy TIMM8A ENST00000372902:c.62A>G p.His21Arg AD_denovo 7.27 het de novo 2 NDD + epilepsy (+) Hemangioma,(+) Seizure,(+) Global developmental delay,(+) Abnormal facial shape,(+) Spastic paraparesis,(+) Abnormality of brain morphology,(+) Cerebral palsy ARPC4 ENST00000397256:c.331C>T p.Arg111Cys AD_denovo 6.4 het de novo 1 NDD (+) Microcephaly,(+) Hypotonia,(+) Global developmental delay GSG1L ENST00000447459:c.184A>G p.Asn62Asp AD_denovo 4.6 het de novo 1 NDD + epilepsy (+) Focal clonic seizure,(+) Dyslexia,(+) Mild global developmental delay,(+) Focal impaired awareness tonic seizure DIP2C ENST00000280886:c.2216C>T p.Ala739Val AD_unknown 4.8 het unknown 1 NDD Moderate global developmental delay BTBD18 ENST00000422652:c.1398del p.Tyr467Metfs*45 AD_unknown Bhet unknown 1 other Hypotonia,(+) Vocal cord paralysis,(+) Dyspnea DHX8 ENST00000262415:c.1239A>T p.Lys413Asn AD_denovo Bhet de novo 1 Stoffwechs el at the time of testing at 4 months of age: premature birth, (+) Inguinal hernia,(+) Jaundice,(+) Cholestasis,(+) Organic aciduria,(+) Hyperbilirubinemia,(+) Elevated circulating alanine aminotransferase concentration at age 2 years: good development PLXNC1 ENST00000258526:c.3505A>C p.Asn1169His AD_unknown 3.1 het unknown 1 NDD (+) Tall stature,(+) Polyuria,(+) Autism,(+) Hyperactivity,(+) Global developmental delay,(+) Obesity,(+) Polydipsia HMX3 ENST00000357878:c.1031C>A p.Ser344* AD_unknown 5.9 het unknown 2 NDD (+) Autism,(+) Delayed speech and language development,(+) Absent speech,(+) Sleep-wake cycle disturbance,(+) Toe walking TAOK2 ENST00000308893:c.2811dup p.Cys938Leufs*56 AD_unknown 7.2 het unknown 2 NDD (+) Autism,(+) Delayed speech and language development,(+) Absent speech,(+) Sleep-wake cycle disturbance,(+) Toe walking LRP8 ENST00000306052:c.497-1G>C None AD_unknown 8.5 het unknown 1 NDD (+) Autism,(+) Delayed speech and language development,(+) Developmental regression,(+) Mild global developmental delay STAM ENST00000377524:c.265del p.Ser89Alafs*6 AD_unknown 7.7 het unknown 1 epilepsy (-) Intellectual disability,(+) Focal-onset seizure RBBP7 ENST00000380084:c.89_99del p.His30Profs*15 AD_unknown 7.1 het unknown 2 epilepsy (+)atypical absence seizure NAP1L2 ENST00000373517:c.700G>T p.Glu234* AD_unknown 5.0 het unknown 1 epilepsy (+) focal myoclonic seizure (+) generalzied tonic-clonic seizure with focal onset MAGEB5 ENST00000602297:c.770dup p.Tyr257* AR_homo 4.0 homo unknown 1 epilepsy (+) Absence seizures HDAC3 ENST00000305264:c.1076G>A p.Arg359His AD_unknown 5.7 het unknown 2 NDD (+) Autistic behavior,(+) Moderate global developmental delay OTOP1 ENST00000296358:c.803A>G p.Tyr268Cys AR_homo 5.3 homo unknown 2 NDD (+) Autistic behavior,(+) Moderate global developmental delay UNC13A ENST00000519716:c.1597-4_1597-3delinsAA None AD_denovo 7.1 het de novo 1 NDD + epilepsy (+) Hydrocephalus,(+) Decreased response to growth hormone stimuation test,(+) Seizure,(+) Cerebral hemorrhage,(+) Premature birth,(+) Intellectual disability, moderate,(+) Scoliosis,(+) Lymphoma,(+) Immunodeficiency,(+) Short stature,(+) Moderate global developmental delay LAMTOR1 ENST00000278671:c.3G>T p.Met1? AD_unknown 5.9 het unknown 2 NDD (+) Delayed puberty,(+) Obesity,(+) Moderate global developmental delay SUSD4 ENST00000343846:c.26A>G p.Asn9Ser AD_denovo 4.8 het de novo 6 NDD (+) Autism,(+) Intellectual disability,(+) Global developmental delay CWC22 ENST00000410053:c.1633C>T p.Arg545* AD_denovo 7.9 het de novo 6 NDD (+) Autism,(+) Intellectual disability,(+) Global developmental delay PTPRN ENST00000295718:c.2766C p.Ile922Met ENST00000295718:c.2766C>G p.Ile922Met AR_comphet 4.1 comphet maternal& paternal 6 NDD (+) Autism,(+) Intellectual disability,(+) Global developmental delay KIAA0947 ENST00000296564:c.1718C>T p.Thr573Ile ENST00000296564:c.6464A>G p.His2155Arg AR_comphet 3.6 comphet maternal& paternal 6 NDD (+) Autism,(+) Intellectual disability,(+) Global developmental delay RGS20 ENST00000276500:c.113C>A p.Pro38His ENST00000276500:c.154G>A p.Gly52Arg AR_comphet 2.9 comphet maternal& paternal 6 NDD (+) Autism,(+) Intellectual disability,(+) Global developmental delay
CASKIN1 ENST00000343516:c.1709T>C p.Ile570Thr ENST00000343516:c.246C>T p.Gly82= AR_comphet 5.5 comphet maternal& paternal 6 NDD (+) Autism,(+) Intellectual disability,(+) Global developmental delay TENT4A ENST00000230859:c.398C>G p.(Ser133Cys) AR_homo 4.8 homo unknown 7 NDD (+) Delayed speech and language development,(+) Intellectual disability,(+) Global developmental delay,(+) Absent speech,(+) Asymmetric ventricles RASSF10 ENST00000340901:c.899A>C p.(Glu300Ala) AR_homo 3.4 homo maternal& paternal 7 NDD (+) Delayed speech and language development,(+) Intellectual disability,(+) Global developmental delay,(+) Absent speech,(+) Asymmetric ventricles KLHL36 ENST00000564996:c.169G>C p.Val57Leu AR_homo 4.2 homo maternal& paternal 7 NDD (+) Delayed speech and language development,(+) Intellectual disability,(+) Global developmental delay,(+) Absent speech,(+) Asymmetric ventricles KIAA0100 ENST00000528896:c.5345G>A p.Gly1782Glu AR_homo 5.4 homo maternal& paternal 7 NDD (+) Delayed speech and language development,(+) Intellectual disability,(+) Global developmental delay,(+) Absent speech,(+) Asymmetric ventricles CPD ENST00000225719:c.691G>A p.Ala231Thr AR_homo 4.5 homo maternal& paternal 7 NDD (+) Delayed speech and language development,(+) Intellectual disability,(+) Global developmental delay,(+) Absent speech,(+) Asymmetric ventricles SLFN13 ENST00000285013:c.2666C>A p.Ala889Glu AR_homo 4.4 homo maternal& paternal 7 NDD (+) Delayed speech and language development,(+) Intellectual disability,(+) Global developmental delay,(+) Absent speech,(+) Asymmetric ventricles MICALL2 ENST00000297508:c.1336G>A p.Asp446Asn ENST00000297508:c.1987C>T p.Arg663Cys AR_comphet 3.5 comphet maternal& paternal 7 NDD (+) Delayed speech and language development,(+) Intellectual disability,(+) Global developmental delay,(+) Absent speech,(+) Asymmetric ventricles SF3A2 ENST00000221494:c.1354G>T p.Glu452* AD_unknown 5.0 het unknown 1 epilepsy (+) Bilateral tonic-clonic seizure,(+) Generalized-onset seizure LRP1B ENST00000389484:c.7366G>A p.Val2456Ile AR_homo 5.9 homo maternal& paternal 1 NDD + epilepsy (+) Hypermetropia,(+) Autism,(+) Intellectual disability,(+) Seizure MAP4K4 ENST00000347699:c.123+2T>C None AD_unknown 7.3 het unknown 2 NDD (+) Delayed speech and language development,(+) Global developmental delay,(+) Motor tics,(+) Phonic tics TFDP2 ENST00000489671:c.44_47del p.Val15Glufs*4 AD_unknown 5.2 het unknown 2 NDD (+) Delayed speech and language development,(+) Global developmental delay,(+) Motor tics,(+) Phonic tics RBL2 ENST00000262133:c.3G>T p.Met1? AD_unknown 7.3 het unknown 1 NDD (+) Strabismus,(+) Autistic behavior,(+) Hypotonia,(+) High myopia,(+) Mild global developmental delay BAI3 ENST00000370598:c.1516C>T p.Arg506* AD_unknown 6.0 het unknown 1 NDD (+) Intellectual disability,(+) Moderate global developmental delay, large ears, synophris, downslanted palprebal fissures MINK1 ENST00000355280:c.3199C>T p.His1067Tyr AD_unknown 4.2 het unknown 1 NDD + epilepsy (+) Psychosis,(+) Intellectual disability,(+) Focal tonic seizure,(+) Focal hyperkinetic seizure,(+) Focal cortical dysplasia PDS5A ENST00000303538:c.1231C>T p.Arg411Trp AD_denovo 8.1 het de novo 1 Wachstum, Skelett (+) Retrognathia,(+) Epicanthus,(+) Protruding ear,(+) Hypotonia,(+) Short stature GPHN ENST00000478722:c.1332_1346del p.His445_Ser449del AD_unknown 6.4 het unknown 1 NDD + epilepsy (+) Febrile seizure (within the age range of 3 months to 6 years),(+) Mild global developmental delay,(+) Bilateral tonic-clonic seizure with generalized onset PLXNB2 ENST00000449103:c.5455C>A p.Gln1819Lys AD_unknown 5.1 het unknown 1 NDD + epilepsy (+) Microcephaly,(+) Abnormality of the face,(+) Behavioral abnormality,(+) Intellectual disability, mild XPO7 ENST00000252512:c.1994G>A p.Arg665Gln AD_unknown 3.6 het unknown 1 NDD + epilepsy (+) Intellectual disability,(+) Hemiplegia,(+) Elevated circulating creatine kinase concentration,(+) Severe global developmental delay,(+) Infantile spasms,(+) Eyelid laxity ACTN1 ENST00000394419:c.1870C>T p.Arg624* AD_unknown 6.6 het unknown 2 NDD (+) Delayed puberty,(+) Obesity,(+) Moderate global developmental delay TCF7L2 ENST00000543371:c.407C>T p.Ala136Val AD_denovo 8.5 het de novo 1 NDD + epilepsy (+) Hypotonia,(+) Motor delay,(+) Dystonia,(+) Generalized-onset seizure,(+) Severe global developmental delay BTAF1 ENST00000265990:c.4437T>A p.Ser1479Arg AD_unknown 4.7 het unknown 1 NDD + epilepsy (+) Intellectual disability, mild,(+) Bilateral tonic-clonic seizure,(+) Focal myoclonic seizure,(+) Mild global developmental delay ZNF827 ENST00000379448:c.292C>T p.Gln98* AD_unknown 5.6 het unknown 1 NDD (+) Microcephaly,(+) Global developmental delay,(+) Short stature MRP63 ENST00000309594:c.-5-2A>G None AR_homo 8.9 homo unknown 2 (+) Generalized-onset seizure SMG1 ENST00000446231:c.5213A>T p.Asp1738Val AD_unknown 5.8 het unknown 2 (+) Generalized-onset seizure CLUH ENST00000570628:c.1654A>T p.Lys552* AD_unknown Bhet unknown 2 Metabolis m (+) Tall stature,(+) Precocious puberty,(+) Obesity,(+) Hypertriglyceridemia,(+) Accelerated skeletal maturation SEMA3F ENST00000002829:c.1093G>A p.Val365Met AD_denovo 7.6 het de novo 4 Muskel Motor delay, Muscular hypotonia, Skeletal muscle atrophy ADCY9 ENST00000294016:c.2727C>G p.Tyr909* AD_unknown 5.8 het unknown 1 NDD + epilepsy (+) Intellectual disability,(+) Seizure,(+) Dystonia,(+) Severe global developmental delay RAB11FIP3 ENST00000262305:c.1116-2A>G None AD_unknown 6.0 het unknown 1 epilepsy Generalized non-motor (absence) seizure
GPC1 ENST00000264039:c.1268+4G>A None AD_denovo 5.2 het de novo 3 NDD Trigonocephaly, Epicanthus,Hypertelorism,Short chin, Retinal coloboma, Astigmatism, Hypermetropia, Iris coloboma, Motor delay, Patent foramen ovale, EEG abnormality, Depressed nasal bridge, Vertical nystagmus, Perimembranous ventricular septal defect, Anisometropia SGK223 ENST00000520004:c.3247del p.Gln1083Argfs*52 AD_denovo 5.0 het de novo 3 NDD Trigonocephaly, Epicanthus,Hypertelorism,Short chin, Retinal coloboma, Astigmatism, Hypermetropia, Iris coloboma, Motor delay, Patent foramen ovale, EEG abnormality, Depressed nasal bridge, Vertical nystagmus, Perimembranous ventricular septal defect, Anisometropia CHAF1A ENST00000301280:c.829G>T p.Glu277* AD_denovo 10.1 het de novo 3 NDD Trigonocephaly, Epicanthus,Hypertelorism,Short chin, Retinal coloboma, Astigmatism, Hypermetropia, Iris coloboma, Motor delay, Patent foramen ovale, EEG abnormality, Depressed nasal bridge, Vertical nystagmus, Perimembranous ventricular septal defect, Anisometropia TSC22D4 ENST00000300181:c.1A>G p.Met1? AD_unknown 5.1 het unknown 1 NDD (+) Abnormality of the face,(+) Intellectual disability,(+) Short stature,(+) Moderate global developmental delay,(+) Primary microcephaly TUBA1B ENST00000336023:c.362G>A p.Arg121Gln AD_unknown 4.9 het unknown 3 NDD + epilepsy (+) Intellectual disability,(+) Generalized non-motor (absence) seizure,(+) Moderate global developmental delay CHD9 ENST00000566029:c.4967G>C p.Ser1656Thr AD_unknown 4.4 het unknown 3 NDD + epilepsy (+) Intellectual disability,(+) Generalized non-motor (absence) seizure,(+) Moderate global developmental delay XKR3 ENST00000331428:c.614T>A p.Leu205* AR_homo 7.0 het unknown 3 NDD + epilepsy (+) Intellectual disability,(+) Generalized non-motor (absence) seizure,(+) Moderate global developmental delay CUL2 ENST00000537177:c.571G>C p.Val191Leu AD_unknown 4.4 het unknown 1 epilepsy Focal-onset seizure DAPK1 ENST00000408954:c.2980G>A p.Asp994Asn AD_unknown 3.7 het unknown 1 NDD (+) Intellectual disability,(+) Obesity TRA2B ENST00000453386:c.151A>G p.Arg51Gly AD_unknown 5.0 het unknown 1 NDD (+) Psychosis,(+) Intellectual disability, mild TRA2B ENST00000453386:c.151A>G p.Arg51Gly AD_unknown 5.0 het unknown 1 NDD (+) Downslanted palpebral fissures,(+) Autism,(+) Global developmental delay RALGPS1 ENST00000259351:c.1544C>A p.Pro515His AD_unknown 3.2 het unknown 2 NDD + epilepsy (+) Aggressive behavior,(+) Focal clonic seizure,(+) Expressive language delay,(+) Focal tonic seizure,(+) Severe global developmental delay,(+) Focal atonic seizure,(+) Impulsivity TRA2B ENST00000453386:c.266_280del p.Asp90_Tyr94del AD_denovo 6.9 het de novo 1 NDD + epilepsy (+) Microcephaly,(+) Delayed speech and language development,(+) Hypotonia,(+) Status epilepticus,(+) Generalized tonic seizure,(+) Atonic seizure UBE2Q1 ENST00000292211:c.946C>G p.Leu316Val AD_unknown 3.3 het unknown 1 NDD + epilepsy (+) Intellectual disability, mild,(+) Generalized myoclonic-atonic seizure CHD9 ENST00000566029:c.7499_7501del p.Gly2500del AD_unknown 3.5 het unknown 4 NDD (+) Hearing impairment,(+) Obesity,(+) Mild global developmental delay FBXL19 ENST00000380310:c.431G>C p.Arg144Pro AD_unknown 3.0 het unknown 4 NDD (+) Hearing impairment,(+) Obesity,(+) Mild global developmental delay BRPF3 ENST00000357641:c.2228A>C p.Glu743Ala AD_unknown 4.0 het unknown 4 NDD (+) Hearing impairment,(+) Obesity,(+) Mild global developmental delay GMPPB ENST00000321599:c.764_765delinsTT p.Thr255Ile AD_unknown 4.3 het unknown 4 NDD (+) Hearing impairment,(+) Obesity,(+) Mild global developmental delay TNRC6A ENST00000395799:c.4677_4680del p.Trp1559Cysfs*30 AD_unknown 7.5 het unknown 1 NDD (+) Autism,(+) Impaired social interactions,(+) Obesity,(+) Moderate global developmental delay SEC24A ENST00000398844:c.1642A>G p.Thr548Ala AD_denovo 5.9 het de novo 2 NDD microcephaly, congenital diaphragmatic hernia, pectus excavatum of inferior sternum, motor delay, failure to thrive in infancy, patent ductus arteriosus mild global developmental delay CUL1 ENST00000325222:c.2137G>A p.Ala713Thr AD_denovo 8.2 het de novo 2 NDD microcephaly, congenital diaphragmatic hernia, pectus excavatum of inferior sternum, mo-tor delay, failure to thrive in infancy, patent ductus arteriosus, mild global developmental delay CLOCK ENST00000309964:c.1599dup p.Thr534Aspfs*55 AD_unknown 7.9 het unknown 1 NDD (-) Microcephaly,(+) Delayed speech and language development,(-) Seizure,(+) Global developmental delay,(+) Motor delay,(+) Muscular hypotonia of the trunk ZNF611 ENST00000543227:c.1319C>T p.Ser440Phe AD_denovo 3.5 het de novo 1 NDD Aggressive behavior, Global developmental delay, Developmental regression, Self-injurious behavior RAB11A ENST00000261890:c.335A>G p.His112Arg AD_denovo 9.8 het de novo 1 NDD + epilepsy (+) Coarse facial features,(+) Delayed speech and language development,(+) Intellectual disability, mild,(+) EEG abnormality,(+) Precocious puberty in females,(+) Delayed fine motor development,(+) Primary microcephaly CT47B1 ENST00000371311:c.622C>T p.Pro208Ser AD_denovo 4.2 het de novo 1 NDD + epilepsy osteopenia, intellectual disability, seizure, global developmental delay SNW1 ENST00000261531:c.182_187del p.Gly61_Gly62del AD_denovo 5.9 het de novo 2 NDD + epilepsy microcephaly, visual impairment, delayed speech and language development, anemia, bilateral tonicclonic seizure, abnormal cortical gyration, hip dislocation, thoracolumbar scoliosis, focal-onset seizure, intellectual disability, severe, cerebral palsy ZNF768 ENST00000380412:c.1511A>G p.His504Arg AD_denovo 5.4 het de novo 2 NDD + epilepsy microcephaly, visual impairment, delayed speech and language development, anemia, bilateral tonicclonic seizure, abnormal cortical gyration, hip dislocation, thoracolumbar scoliosis, focal-onset seizure, intellectual disability, severe, cerebral palsy
TNPO1 ENST00000337273:c.2438G>C p.Arg813Thr AD_unknown Chet unknown 1 Wachstum, Skelett (+) Renal duplication,(+) Cleft palate,(+) Abnormality of the ribs,(+) Glandular hypospadias,(+) Atopic dermatitis,(+) Premature birth,(+) Neutropenia,(+) Scoliosis,(+) Cleft lip WDR13 ENST00000218056:c.194G>A p.Arg65His XL 5.2 hemi maternal 3 NDD (+) Hearing impairment,(+) Abnormality of refraction,(+) Seizure,(+) Hypotonia,(+) Global developmental delay,(+) Motor delay,(+) Holoprosencephaly,(+) Failure to thrive,(+) Muscular dystrophy,(+) Abnormality of temperature regulation,(+) Secondary microcephaly,(+) Bilateral cryptorchidism RBM10 ENST00000377604:c.308G>A p.Arg103Gln XL 7.0 hemi maternal 3 NDD (+) Hearing impairment,(+) Abnormality of refraction,(+) Seizure,(+) Hypotonia,(+) Global developmental delay,(+) Motor delay,(+) Holoprosencephaly,(+) Failure to thrive,(+) Muscular dystrophy,(+) Abnormality of temperature regulation,(+) Secondary microcephaly,(+) Bilateral cryptorchidism CCAR2 ENST00000308511:c.2627G>C p.Arg876Pro AD_denovo 6.1 het de novo 3 NDD (+) Hearing impairment,(+) Abnormality of refraction,(+) Seizure,(+) Hypotonia,(+) Global developmental delay,(+) Motor delay,(+) Holoprosencephaly,(+) Failure to thrive,(+) Muscular dystrophy,(+) Abnormality of temperature regulation,(+) Secondary microcephaly,(+) Bilateral cryptorchidism DBN1 ENST00000292385:c.1333_1334insGCCACGGAGA TCC p.Ala445Glyfs*13 AD_unknown 7.9 het unknown 1 NDD (+) Obesity,(+) Intellectual disability, borderline INTS6 ENST00000420668:c.498C>G p.Tyr166* AD_denovo 9.9 het de novo 1 NDD (+) Global developmental delay,(+) Motor delay,(+) Agenesis of corpus callosum,(+) Morphological central nervous system abnormality,(+) Cerebellar dysplasia,(+) Muscular hypotonia of the trunk,(+) Schizencephaly,(+) Abnormal nervous system morphology,(+) Abnormal subarachnoid space morphology,(+) Interhemispheric cyst,(+) Paroxysmal tonic upgaze TSPAN18 ENST00000340160:c.275T>C p.Leu92Pro AR_homo 5.2 homo unknown 2 NDD (+) Behavioral abnormality,(+) Global developmental delay,(+) Intellectual disability, borderline NOVA2 ENST00000263257:c.571A>G p.Lys191Glu AD_unknown 4.8 het unknown 2 NDD (+) Behavioral abnormality,(+) Global developmental delay,(+) Intellectual disability, borderline SLC17A7 ENST00000221485:c.170T>C p.Phe57Ser AD_unknown 7.5 het unknown 1 epilepsy + ataxia (+) Generalized myoclonic seizure,(+) Episodic ataxia,(+) Generalized tonic seizure,(+) Generalized clonic seizure NSD1 ENST00000347982:c.5468C>T p.Thr1823Met AD_unknown Bhet unknown 2 Obesity (+) Tall stature,(+) Precocious puberty,(+) Obesity,(+) Hypertriglyceridemia,(+) Accelerated skeletal maturation DUSP26 ENST00000256261:c.56G>T p.Arg19Leu AD_denovo 6.1 het de novo 2 epilepsy epilepsy with focal and generalized components, microcephaly, MRI unremarkable, psychosomatic development unremarkable, seizure-free under Sultiam, EEG with rolando-focus and generalization tendency B4GALNT4 ENST00000329962:c.2232C>G p.Asn744Lys AD_denovo 5.3 het de novo 2 epilepsy epilepsy with focal and generalized components, microcephaly, MRI unremarkable, psychosomatic development unremarkable, seizure-free under Sultiam, EEG with rolando-focus and generalization tendency ARMCX4 ENST00000423738:c.2150A>G p.Gln717Arg XL 4.0 hemi unknown 1 NDD + epilepsy (+) Intellectual disability,(+) Seizure,(+) Global developmental delay DENND1C ENST00000381480:c.1241C>T p.Ala414Val AD_denovo Bhet de novo 1 Wachstum, Skelett bei U3 auffällige Kopfform festgestellt, Sagittalnahtsynostose, keine neurologischen Auffälligkeiten GPN1 ENST00000264718:c.982T>A p.Ser328Thr AD_denovo 4.8 het de novo 2 epilepsy bilateral tonic-clonic seizure with generalized onset TNKS2 ENST00000371627:c.1901A>G p.Asp634Gly AD_denovo 7.1 het de novo 2 epilepsy bilateral tonic-clonic seizure with generalized onset PITRM1 ENST00000224949:c.2263C>T p.(Arg755Trp) AD_denovo Bhet de novo 1 congenital heart defects (+) Dilated cardiomyopathy,(+) Abnormal left ventricle morphology,(+) Primum atrial septal defect,(+) Multiple muscular ventricular septal defects DPP6 ENST00000332007:c.1075A>C p.Lys359Gln AD_denovo 9.4 het de novo 1 epilepsy (+) Abnormality of the pinna,(+) Generalized non-motor (absence) seizure,(+) Focal clonic seizure,(+) 2-3 toe syndactyly,(+) Focal tonic seizure ZFP36 ENST00000248673:c.708del p.Gly237Alafs*129 AD_unknown 5.8 het unknown 1 Epilepsy (+) Strabismus,(-) Global developmental delay,(+) Generalized non-motor (absence) seizure,(+) Status epilepticus,(+) Focal-onset seizure,(+) EEG with focal spikes,(+) EEG with focal spike waves ITGB1 ENST00000302278:c.1844G>A p.Cys615Tyr AD_denovo Ahet de novo 1 Leukodystr ophy (+) Gliosis,(+) Cerebral ischemia,(+) Cerebral vasculitis,(+) Perivascular spaces,(+) Arterial stenosis ZFYVE9 ENST00000287727:c.3217C>T p.Arg1073Cys AD_denovo 6.5 het de novo 1 epilepsy bilateral tonic-clonic seizure, myoclonic seizure, epileptic encephalopathy PAXBP1 ENST00000290178:c.437C>A p.Ser146* AD_inherited 5.9 het paternal 1 Neuro (+) Macrocephaly,(+) Seizure,(+) Global developmental delay,(+) Leukoencephalopathy CCNL1 ENST00000295926:c.1134-2A>C None AD_unknown 5.5 het unknown 1 NDD (+) Microcephaly,(+) Mild global developmental delay RBBP9 ENST00000337227:c.136G>A p.Asp46Asn AR_homo 4.4 homo maternal& paternal 3 NDD + epilepsy aggressive behavior, global developmental delay, bilateral tonic-clonic seizure, expressive language delay, atonic seizure, impulsivity TERF1 ENST00000518874:c.319G>A p.Asp107Asn AR_homo 6.4 homo maternal& paternal 3 NDD + epilepsy aggressive behavior, global developmental delay, bilateral tonic-clonic seizure, expressive language delay, atonic seizure, impulsivity CILP2 ENST00000291495:c.2162T>A p.Ile721Asn AR_homo 4.8 homo maternal& paternal 4 NDD + epilepsy aggressive behavior, global developmental delay, bilateral tonic-clonic seizure, expressive language delay, atonic seizure, impulsivity
PUS7L ENST00000344862:c.749A>C p.Asn250Thr AD_denovo 4.6 het de novo 3 NDD + epilepsy aggressive behavior, global developmental delay, bilateral tonic-clonic seizure, expressive language delay, atonic seizure, impulsivity SH3RF3 ENST00000309415:c.221A>G p.Gln74Arg AD_denovo 5.8 het de novo 1 Epilepsy seizure, two suspected episodes of seizures LAMB2 ENST00000305544:None None AD_unknown Chet unknown 2 Stoffwechs el obesity, insuline resistance, hyperuricemia PTPN1 ENST00000371621:c.794A>G p.Asp265Gly AD_unknown Bhet unknown 2 Stoffwechs el obesity, insuline resistance, hyperuricemia KALRN ENST00000291478:c.1714_1715del p.Val572Serfs*14 AD_unknown Bhet unknown 2 Stoffwechs el (+) Hypertension,(+) Insulin resistance,(+) Striae distensae,(+) Slender finger,(+) Overgrowth,(+) Pes planus,(+) Asthma,(+) Hyperuricemia,(+) Hypertriglyceridemia,(+) Genu valgum,(+) Hyperglycemia,(+) Abnormal oral glucose tolerance,(+) Accelerated skeletal maturation,(+) Class II obesity WHSC1L1 ENST00000316985:c.1603A>C p.Ile535Leu AD_unknown Chet unknown 2 Stoffwechs el (+) Hypertension,(+) Insulin resistance,(+) Striae distensae,(+) Slender finger,(+) Overgrowth,(+) Pes planus,(+) Asthma,(+) Hyperuricemia,(+) Hypertriglyceridemia,(+) Genu valgum,(+) Hyperglycemia,(+) Abnormal oral glucose tolerance,(+) Accelerated skeletal maturation,(+) Class II obesity TM9SF4 ENST00000217315:c.1366C>T p.Arg456* AD_unknown 5.0 het unknown 2 NDD + epilepsy (+) Narrow forehead,(+) Short neck,(+) Strabismus,(+) Aggressive behavior,(+) Intellectual disability,(+) Plagiocephaly,(+) Short stature,(+) Focal-onset seizure,(+) Short phalanx of finger,(+) Small hand LEF1 ENST00000265165:c.695C>G p.Ser232* AD_unknown 6.9 het unknown 2 NDD + epilepsy (+) Narrow forehead,(+) Short neck,(+) Strabismus,(+) Aggressive behavior,(+) Intellectual disability,(+) Plagiocephaly,(+) Short stature,(+) Focal-onset seizure,(+) Short phalanx of finger,(+) Small hand ACLY ENST00000352035:c.1587_1596del p.Met529Ilefs*18 ENST00000352035:c.616+4A>T None AR_comphet 9.1 comphet maternal& paternal 1 NDD epicanthus, upslanted palpebral fissure, hypotelorism, hyperactivity, global developmental delay, absent speech, primary microcephaly MYCBP2 ENST00000357337:c.7210G>A p.Val2404Ile AD_unknown 5.5 het unknown 1 NDD (+) Tall stature,(+) Synophrys,(+) Autistic behavior,(+) Expressive language delay,(+) Increased body weight FRY ENST00000380250:c.3235G>A p.Glu1079Lys AD_unknown 4.6 het unknown 1 NDD (+) Muscular hypotonia of the trunk,(+) Moderate global developmental delay SH3BP4 ENST00000344528:c.119-2A>G None AR_homo 8.6 homo unknown 1 NDD (+) Hypospadias,(+) Buphthalmos,(+) Developmental glaucoma,(+) Atrial septal defect,(+) Short stature,(+) Bilateral cryptorchidism,(+) Moderate global developmental delay INPP5D ENST00000359570:c.3440G>C p.Arg1147Pro AD_unknown 4.3 het unknown 1 NDD (+) Brachycephaly,(+) Triangular face,(+) High forehead,(+) Low-set ears,(+) Congenital strabismus,(+) Downslanted palpebral fissures,(+) Hypermetropia,(+) Hypotelorism,(+) Sacral dimple,(+) Hypotonia,(+) Premature birth,(+) Frontal bossing,(+) Intestinal obstruction,(+) Depressed nasal bridge,(+) Moderate global developmental delay,(+) Midface retrusion PROX1 ENST00000261454:c.1394A>C p.His465Pro AD_unknown 5.5 het unknown 3 NDD + epilepsy (+) Autism,(+) Stereotypy,(+) Intellectual disability,(+) Global developmental delay,(+) Bilateral tonicclonic seizure,(+) Hypoplasia of the corpus callosum,(+) Febrile seizure (within the age range of 3 months to 6 years),(+) Hyperventilation,(+) Thoracolumbar scoliosis,(+) Generalized tonic seizure,(+) Generalized atonic seizure,(+) Epileptic encephalopathy U2SURP ENST00000397933:c.842T>A p.Val281Asp AD_unknown 5.2 het unknown 3 NDD + epilepsy (+) Autism,(+) Stereotypy,(+) Intellectual disability,(+) Global developmental delay,(+) Bilateral tonicclonic seizure,(+) Hypoplasia of the corpus callosum,(+) Febrile seizure (within the age range of 3 months to 6 years),(+) Hyperventilation,(+) Thoracolumbar scoliosis,(+) Generalized tonic seizure,(+) Generalized atonic seizure,(+) Epileptic encephalopathy UNC5A ENST00000261961:c.995C>T p.Thr332Ile AD_unknown 5.6 het unknown 3 NDD + epilepsy (+) Autism,(+) Stereotypy,(+) Intellectual disability,(+) Global developmental delay,(+) Bilateral tonicclonic seizure,(+) Hypoplasia of the corpus callosum,(+) Febrile seizure (within the age range of 3 months to 6 years),(+) Hyperventilation,(+) Thoracolumbar scoliosis,(+) Generalized tonic seizure,(+) Generalized atonic seizure,(+) Epileptic encephalopathy OTUD4 ENST00000296579:None None AR_homo 4.3 homo unknown 1 Neuro (+) Oculomotor apraxia,(+) Spastic tetraparesis,(+) Dysphagia,(+) Cerebral atrophy,(+) Anarthria,(+) Peripheral neuropathy,(+) Peripheral demyelination,(+) Speech apraxia,(+) Cognitive impairment PTAFR ENST00000305392:c.736G>A p.Val246Met AD_denovo 5.2 het de novo 2 NDD delayed speech and language development, intellectual disability, mild, EEG abnormality, poor fine motor coordination, decreased head circumference COBL ENST00000265136:c.735_737del p.Lys247del AD_denovo 5.5 het de novo 2 NDD delayed speech and language development, intellectual disability, mild, EEG abnormality, poor fine motor coordination, decreased head circumference UBR4 NM_020765.3(UBR4):c.13049T>C AD_unknown 7.5 het unknown 1 NDD (+) Hydrocephalus,(+) Spasticity,(+) Focal-onset seizure,(+) Mild global developmental delay
CLEC18C ENST00000314151:c.208C>T p.Arg70Trp AD_denovo 4.7 het de novo 1 NDD delayed speech and language development (first words with 20 month, so far no simple sentences), motor delay (walking with over 18 month) PLEKHA7 ENST00000355661:c.2203C>T p.Gln735* AR_homo 8.5 homo maternal& paternal 1 NDD myopia, seizure (doubtful), intellectual disability (borderline, IQ 84), mild global developmental delay, hearing impairment DPYSL2 ENST00000311151:c.1562C>T p.Thr521Met AD_unknown 7.3 het unknown 2 NDD (+) Hypotonia,(+) Motor delay,(+) Elevated circulating creatine kinase concentration CXXC1 ENST00000285106:c.171C>G p.Ile57Met AD_unknown 6.0 het unknown 2 NDD (+) Hypotonia,(+) Motor delay,(+) Elevated circulating creatine kinase concentration DNAH12 ENST00000351747:c.5656A>T p.Lys1886* AD_denovo 5.4 het de novo 1 Epilepsy macrocephaly, behavioral abnormality, affect spasms with 14 month until third year of life, focal-onset seizure since the age of four CNTRL ENST00000373855:c.1187A>G p.Asn396Ser ENST00000373855:c.3160G>C p.Gly1054Arg AR_comphet 5.2 comphet ? unknown 1 NDD + epilepsy (+) Intellectual disability, mild,(+) Global developmental delay,(+) Focal-onset seizure ELOB ENST00000262306:c.245-2_251del None AD_denovo 6.6 het de novo 1 NDD (+) Intellectual disability,(+) Global developmental delay,(+) Headache,(+) Dyscalculia,(+) Dyslexia,(+) Abnormality of movement CCZ1B ENST00000316731:c.1106+1G>A None AR_homo 8.1 homo unknown 1 NDD (+) Abnormality of the dentition,(+) Hypoplasia of the maxilla,(+) Abnormal cornea morphology,(+) Oligodontia,(+) Delayed speech and language development,(+) Ectodermal dysplasia,(+) Poor wound healing,(+) Absent distal phalanges,(+) Decreased corneal reflex FAM71C ENST00000329257:c.1272+6290C>G Non AD_denovo 5.9 het de novo 2 NDD hypothyroidism, motor delay with hypotonia, congenital ptosis, removal phacomatous choriostoma right lower eyelid NXPE4 ENST00000375478:c.437C>A p.Ala146Glu AD_denovo 3.9 het de novo 2 NDD hypothyroidism, motor delay with hypotonia, congenital ptosis, removal phacomatous choriostoma right lower eyelid NRXN2 ENST00000265459:c.3457C>T p.Pro1153Ser AD_unknown 8.7 het unknown 1 NDD + epilepsy brachycephaly, microcephaly, epicanthus, hypertelorism, global developmental delay, absent speech, bilateral tonic-clonic seizure, hair-pulling, self-injurious behavior SOCS7 ENST00000331159:c.1453C>T p.Gln485* AD_unknown 5.8 het unknown 1 NDD (+) Delayed speech and language development,(+) Global developmental delay,(+) Hypoglycemia RNPS1 ENST00000301730:c.128C>G p.Ser43* AD_denovo 10.2 het de novo 2 NDD initial global developmental delaynow on the mend, intrauterine growth retardation (length -3.43 SD, weight -3.45 SD until birth), primary microcephaly (-4.2 SD), turricephaly, epicanthus, proptosis right side, temporary hyperinsulinemia, sacral dimple, umbilical hernia, broad thumb, wide nasal base, preaxial polydactyly UBR4 ENST00000375254:c.12665G>A p.Ser4222Asn ENST00000375254:c.12379T>G p.Phe4127Val AR_comphet 6.7 comphet maternal& paternal 2 NDD initial global developmental delaynow on the mend, intrauterine growth retardation (length -3.43 SD, weight -3.45 SD until birth), primary microcephaly (-4.2 SD), turricephaly, epicanthus, proptosis right side, temporary hyperinsulinemia, sacral dimple, umbilical hernia, broad thumb, wide nasal base, preaxial polydactyly DENND1A ENST00000373618:c.452_454del p.Asn151del AD_denovo 4.3 het de novo 3 Epilepsy since several years suspected focal-onset seizure DD parasomnia, episodic visual impairment and vomiting, suspected migraine, since 2020 poor fine motor coordination, episodic ataxia, fatigue DHX34 ENST00000328771:c.1715C>T p.Ala572Val ENST00000328771:c.3190C>T p.Arg1064* AR_comphet 5.4 comphet maternal& paternal 3 Epilepsy since several years suspected focal-onset seizure DD parasomnia, episodic visual impairment and vomiting, suspected migraine, since 2020 poor fine motor coordination, episodic ataxia, fatigue CACNA2D1 ENST00000356860:c.2950G>A p.Asp984Asn ENST00000356860:c.2804C>G p.Thr935Ser AR_comphet 5.7 comphet maternal& paternal 3 Epilepsy since several years suspected focal-onset seizure DD parasomnia, episodic visual impairment and vomiting, suspected migraine, since 2020 poor fine motor coordination, episodic ataxia, fatigue TP53BP1 seq[GRCh37] 15q15.2q15.3(43378488x2,43398090_43785291x 1,43803137x2) AD_unknown 8.5 het unknown 1 Epilepsy Bilateral tonic-clonic seizure with focal onset
PCDHGA12 ENST00000252085:c.211_218del p.Arg71Alafs*40 ENST00000252085:c.334G>A p.Asp112Asn AR_comphet 4.5 comphet maternal& paternal 1 NDD + epilepsy precocious puberty, intellectual disability, seizure, Arnold-Chiari malformation, myelomeningocele DPYSL3 ENST00000343218:c.571C>T p.Gln191* AD_unknown Ahet unknown 1 Stoffwechs el (+) Fasting hypoglycemia,(+) Ketotic hypoglycemia ABHD3 ENST00000289119:c.293dup p.Ile99Hisfs*12 AD_denovo 5.6 het de novo 2 NDD + epilepsy delayed speech and language development, global developmental delay, motor delay, seizure-free since 03/2020, abnormal facial shape, ventriculomegaly, hypoplasia of the corpus callosum, feeding difficulties TPR ENST00000367478:c.6626G>A p.Arg2209Gln ENST00000367478:c.3358G>A p.Ala1120Thr AR_comphet 6.2 comphet maternal& paternal 2 NDD + epilepsy delayed speech and language development, global developmental delay, motor delay, seizure-free since 03/2020, abnormal facial shape, ventriculomegaly, hypoplasia of the corpus callosum, feeding difficulties PDE4D ENST00000340635:c.809-1G>C None AD_unknown Ahet unknown 1 Fehlbildung en (+) Pulmonic stenosis,(+) Transposition of the great arteries,(+) Delayed gross motor development (very mild),(+) Perimembranous ventricular septal defect BICRA ENST00000396720:c.3390C>G p.Tyr1130* AD_denovo 8.2 het de novo 2 NDD delayed speech and language development, global developmental delay, EEG abnormality, no seizures, periventricular leukomalacia of both lateral ventricles, stereotypy (turn of the head), decreased head circumference PIK3C3 ENST00000262039:c.1916A>G p.Asp639Gly AD_denovo 8.2 het de novo 2 NDD delayed speech and language development, global developmental delay, EEG abnormality, no seizures, periventricular leukomalacia of both lateral ventricles, stereotypy (turn of the head), decreased head circumference NAA35 ENST00000361671:c.1702_1705del p.Lys568Phefs*4 AD_unknown 6.6 het unknown 1 NDD (+) Autism,(+) Intellectual disability, mild,(+) Disproportionate tall stature,(+) Scoliosis,(+) Skeletal muscle atrophy YTHDC1 ENST00000344157:c.2171G>A p.Arg724Gln AD_denovo 6.0 het de novo 1 NDD + epilepsy seizure, global developmental delay TRAPPC1 ENST00000303731:c.293A>C p.His98Pro ENST00000303731:c.215A>G p.His72Arg AR_comphet 6.3 comphet maternal& denovo 1 NDD + epilepsy seizure since the age of 13 month, global developmental delay since the age of three month, progressive brain atrophy, secondary microcephaly RSBN1L ENST00000334955:c.250G>C p.Ala84Pro AD_denovo 4.6 het de novo 6 Epilepsy seizure, suspected tuberous sclerosis, cortical tubers in MRI, ash-leaf spot HIC1 ENST00000263073:c.545C>A, p.(Thr182Lys) AD_denovo 6.9 het de novo 6 Epilepsy seizure, suspected tuberous sclerosis, cortical tubers in MRI, ash-leaf spot EMILIN1 ENST00000260598:c.1370G>C, p.(Cys457Ser) AR_homo 4.9 homo maternal& paternal 6 Epilepsy seizure, suspected tuberous sclerosis, cortical tubers in MRI, ash-leaf spot CKAP5 ENST00000312055:c.2915C>G p.Thr972Ser AR_homo 7.4 homo maternal& paternal 6 Epilepsy seizure, suspected tuberous sclerosis, cortical tubers in MRI, ashleaf spot AHNAK ENST00000378024:c.342+11553G>A p.Gly3656Asp ENST00000378024:c.342+11132G>A p.Asp3516Asn AR_comphet 4.0 comphet maternal& paternal 6 Epilepsy seizure, suspected tuberous sclerosis, cortical tubers in MRI, ash-leaf spot ZNF106 ENST00000263805:c.1370G>C p.Cys457Ser ENST00000263805:c.2776A>G p.Arg926Gly AR_comphet 4.1 comphet maternal& paternal 6 Epilepsy seizure, suspected tuberous sclerosis, cortical tubers in MRI, ash-leaf spot ZMYM4 ENST00000314607:c.1414T>G p.Phe472Val AD_unknown 4.5 het not maternal 1 NDD + Auge (+) Retrognathia,(+) Astigmatism,(+) Hypermetropia,(+) Retinal dystrophy,(+) Optic atrophy,(+) Horizontal nystagmus,(+) Delayed speech and language development,(+) Global developmental delay,(+) Pes planus,(+) Supernumerary nipple,(+) Scapular winging,(+) Reduced visual acuity ESPL1 ENST00000257934:c.4922+5G>A None AD_unknown Ahet unknown 1 Auge (+) Strabismus,(+) Hypermetropia,(+) Amblyopia,(+) Depression,(+) Visual field defect,(+) Headache,(+) Borderline personality disorder,(+) Abnormal retinal nerve fiber layer morphology,(+) Abnormal eating behavior
SLC41A2 ENST00000258538:c.880+2T>C None AD_unknown 6.4 het unknown 1 NDD Aarskog-Scott-Syndrom KIAA1244 ENST00000251691:c.4984C>T p.Arg1662* AD_unknown 6.5 het unknown 1 NDD (+) Hypospadias,(+) Single transverse palmar crease,(+) Moderate global developmental delay CROCC ENST00000375541:c.1992-3C>T None ENST00000375541:c.3544C>T p.Arg1182Cys AR_comphet 4.8 comphet maternal& paternal 2 NDD + epilepsy (+) Hypotonia,(+) Generalized-onset seizure,(+) Hypothalamic hamartoma,(+) Focal-onset seizure,(+) Moderate global developmental delay,(+) Abnormality of brain morphology ZNF275 ENST00000370251:c.21_22del p.Leu9Phefs*30 XL 6.2 hemi maternal 2 NDD + epilepsy (+) Hypotonia,(+) Generalized-onset seizure,(+) Hypothalamic hamartoma,(+) Focal-onset seizure,(+) Moderate global developmental delay,(+) Abnormality of brain morphology LMTK2 ENST00000297293:c.2792C>A p.Ser931* AD_inherited 5.7 het paternal 3 NDD (+) Moderate global developmental delay ASAP2 ENST00000281419:c.346-2A>G None AD_inherited 6.8 het maternal 3 NDD (+) Moderate global developmental delay SLC2A5 ENST00000377414:c.475C>T p.Arg159Trp AR_homo 4.3 homo maternal& paternal 3 NDD + epilepsy global developmental delay, motor delay, absent speech, generalized-onset seizure, hypotonia alternating with increased muscle tone, high palate, trigonocephaly, epicanthus, ptosis, synophrys, frontal bossing, bifid tongue, wide nasal base, pulmonary artery stenosis, coronal craniosynostosis (cranioplastic 12/2018) EXOSC10 ENST00000304457:c.191G>A p.Arg64Gln AR_homo 6.3 homo maternal& paternal 3 NDD + epilepsy global developmental delay, motor delay, absent speech, generalized-onset seizure, hypotonia alternating with increased muscle tone, high palate, trigonocephaly, epicanthus, ptosis, synophrys, frontal bossing, bifid tongue, wide nasal base, pulmonary artery stenosis, coronal craniosynostosis (cranioplastic 12/2018) TMEM66 ENST00000256255:c.890C>T p.Pro297Leu AR_homo 5.0 homo maternal& paternal 3 NDD + epilepsy global developmental delay, motor delay, absent speech, generalized-onset seizure, hypotonia alternating with increased muscle tone, high palate, trigonocephaly, epicanthus, ptosis, synophrys, frontal bossing, bifid tongue, wide nasal base, pulmonary artery stenosis, coronal craniosynostosis (cranioplastic 12/2018) PRDM2 ENST00000235372:c.4641del p.Ser1548Profs*16 AD_unknown 7.3 het unknown 1 NDD + epilepsy (+) Short attention span,(+) Hypotonia,(+) Generalized-onset seizure,(+) Focal-onset seizure,(+) Moderate global developmental delay,(+) Abnormal social behavior,(+) Abnormal emotion/affect behavior TULP4 ENST00000367094:c.3439C>T, p.(Pro1147Ser) AR_homo 6.0 homo maternal& paternal 5 NDD + epilepsy autistic behavior, intellectual disability, mild, global developmental delay, absent speech, failure to thrive, bilateral tonic-clonic seizure, expressive language delay,abnormality of the urinary system FUT11 ENST00000339365:c.638A>G, p.(Tyr213Cys) AR_homo 6.9 homo maternal& paternal 5 NDD + epilepsy autistic behavior, intellectual disability, mild, global developmental delay, absent speech, failure to thrive, bilateral tonic-clonic seizure, expressive language delay,abnormality of the urinary system MAP4K2 ENST00000312049:c.286G>T, p.(Gly96Cys) AR_homo 5.3 homo maternal& paternal 5 NDD + epilepsy autistic behavior, intellectual disability, mild, global developmental delay, absent speech, failure to thrive, bilateral tonic-clonic seizure, expressive language delay,abnormality of the urinary system FOLR2 ENST00000298229:c.257T>C, p.(Met86Thr) AR_homo 6.4 homo maternal& paternal 5 NDD + epilepsy autistic behavior, intellectual disability, mild, global developmental delay, absent speech, failure to thrive, bilateral tonic-clonic seizure, expressive language delay,abnormality of the urinary system RTDR1 ENST00000216036:c.115G>A p.Asp39Asn AR_homo 4.5 homo maternal& paternal 5 NDD + epilepsy autistic behavior, intellectual disability, mild, global developmental delay, absent speech, failure to thrive, bilateral tonic-clonic seizure, expressive language delay,abnormality of the urinary system PRICKLE1 seq[GRCh37] 12q12(41463887x2,41464388_43527312x1,4374 7962x2) AD_denovo 12.0 het de novo 2 NDD + epilepsy transient postnatal growth retardation, microcephaly in U5, percentiles currently back in normal range, language delay improving since tympanic tube, pectus excavatum, pulmonic stenosis, suspected atonic seizure (EEG 06/2020 unremarkable) YAF2 seq[GRCh37] 12q12(41463887x2,41464388_43527312x1,4374 7962x2) AD_denovo 7.6 het de novo 2 NDD + epilepsy transient postnatal growth retardation, microcephaly in U5, percentiles currently back in normal range, language delay improving since tympanic tube, pectus excavatum, pulmonic stenosis, suspected atonic seizure (EEG 06/2020 unremarkable) CELF3 NM_007185.7:c.82G>A AD_inherited 5.8 het maternal 1 NDD intellectual disabillity, behavioural abnormality, abnormality of the face RC3H2 ENST00000335387:c.1A>G p.Met1? AD_denovo 8.7 het de novo 1 NDD intellectual disability, developmental delay, generalized dystonia B3GALT2 ENST00000367434:c.429del p.Glu144Lysfs*10 AD_unknown 7.1 het unknown 1 NDD (+) Brachycephaly,(+) Microcephaly,(+) Retrognathia,(+) Low-set ears,(+) Macrotia,(+) Motor delay,(+) Lacrimal duct stenosis,(+) Abnormal ossification of the pubic bone,(+) Severe hearing impairment,(+) Arachnoid cyst SKIDA1 ENST00000444772:c.2427G>A p.Trp809* AD_denovo 8.4 het de novo 2 NDD + epilepsy intellectual disability, seizure, MRI: heterotopia and abnormal cortical gyration GPC5 ENST00000377067:c.647G>A p.Gly216Glu AD_denovo 5.8 het de novo 2 NDD + epilepsy intellectual disability, seizure, MRI: heterotopia and abnormal cortical gyration
DIP2C ENST00000280886:c.1303G>A p.Gly435Arg AD_denovo 7.9 het de novo 1 NDD + epilepsy seizure, moderate global developmental delay, ataxia, spasticity, hypotonia, oculomotor apraxia, abnormality of brain morphology, small stature ZFR ENST00000265069:c.3G>A p.Met1? AD_unknown 7.8 het unknown 1 NDD + epilepsy (+) Intellectual disability, mild,(+) Generalized-onset seizure DNAH6 ENST00000237449:c.11225T>C p.Leu3742Pro AD_denovo 7.0 het de novo 5 NDD + epilepsy focal autonomic seizure with epigastric sensation/nausea/vomiting/other gastrointestinal phenomena, focal tonic seizure, generalized tonic seizure, simple febrile seizure, mild glo-bal developmental delay, mild ataxia SOX1 ENST00000330949:c.684_692del p.Ala229_Pro231del AD_denovo 6.9 het de novo 5 NDD + epilepsy focal autonomic seizure with epigastric sensation/nausea/vomiting/other gastrointestinal phenomena, focal tonic seizure, generalized tonic seizure, simple febrile seizure, mild glo-bal developmental delay, mild ataxia OTOP1 ENST00000296358:c.318G>A p.Trp106* AR_homo 8.3 homo maternal& paternal 5 NDD + epilepsy focal autonomic seizure with epigastric sensation/nausea/vomiting/other gastrointestinal phenomena, focal tonic seizure, generalized tonic seizure, simple febrile seizure, mild glo-bal developmental delay, mild ataxia FSTL4 ENST00000265342:c.784G>A p.Val262Met AR_homo 5.0 homo maternal& paternal 5 NDD + epilepsy focal autonomic seizure with epigastric sensation/nausea/vomiting/other gastrointestinal phenomena, focal tonic seizure, generalized tonic seizure, simple febrile seizure, mild glo-bal developmental delay, mild ataxia ZNF236 ENST00000253159:c.281C>T p.Thr94Ile AR_homo 5.3 homo maternal& paternal 5 NDD + epilepsy focal autonomic seizure with epigastric sensation/nausea/vomiting/other gastrointestinal phenomena, focal tonic seizure, generalized tonic seizure, simple febrile seizure, mild glo-bal developmental delay, mild ataxia BRWD1 ENST00000333229:c.1840T>C p.Ser614Pro AD_denovo 6.9 het de novo 1 epilepsy Seizures with abscences and myoclonias since 18 months of age CNTN5 ENST00000524871:c.264_265insAACTGAGGAACC AGGCATTATTTTGTCGATAGATCCAAAATTGACAAA GGTAGACAACATCTAGAAAATATTA p.Phe89Asnfs*2 AD_denovo 7.4 het de novo 1 NDD moderate global developmental delay, absent speech, autism, hypotonia, restlessness, joint hypermobility, clinodactyly of the 5th finger, hypertrichosis, facial dysmorphism (epi-canthus, depressed nasal ridge, upslanted palpebral fissure, synophrys) PAXIP1 ENST00000397192:c.2177T>C p.Leu726Ser AD_denovo 7.0 het de novo 2 NDD profound global developmental delay, developmental regression, hypotonia, hypoplasia of the corpus callosum, delayed CNS myelination, abnormal macular morphology, abnormal foot morphology, abnormality of the Achilles tendon, increased serum lactate, increased circulating lactate dehydrogenase concentration PCM1 ENST00000325083:c.3391A>C p.Asn1131His ENST00000325083:c.131C>T p.Ser44Leu AR_comphet 6.2 comphet maternal& paternal 2 NDD profound global developmental delay, developmental regression, hypotonia, hypoplasia of the corpus callosum, delayed CNS myelination, abnormal macular morphology, abnormal foot morphology, abnormality of the Achilles tendon, increased serum lactate, increased circulating lactate dehydrogenase concentration GRPEL1 ENST00000264954:c.238C>T p.Arg80* ENST00000264954:c.613A>G p.Thr205Ala AR_comphet 6.1 comphet maternal& paternal 1 NDD + epilepsy Pachygyria,(+) Generalized-onset seizure,(+) Focal-onset seizure MARCH7 ENST00000259050:c.393del p.Gly133Aspfs*7 AD_inherited 7.0 het unknown 1 NDD Arachnodactyly,(+) Intellectual disability, moderate,(+) Long toe SLIT2 ENST00000273739:c.2820del p.Pro941Glnfs*38 AD_unknown 8.7 het unknown 1 NDD (+) Hearing impairment,(+) Cholelithiasis,(+) Exocrine pancreatic insufficiency,(+) Spontaneous pneumothorax,(+) Mild global developmental delay GRM5 ENST00000305432:c.2446T>C p.Cys816Arg AD_unknown 10.5 het unknown 1 NDD moderate bis schwere Entwicklungsverzögerung, Sprachstörung, große Ohren LRFN4 ENST00000309602:c.1160C>T p.Ser387Leu AR_homo 6.0 homo maternal& paternal 2 NDD + epilepsy febrile status epilepticus, EEG abnormality, encephalopathy, reduced consciousness, global developmental delay, absent speech, spasticity, respiratory insufficiency, venous thrombosis internal jugular vein, microcephaly, poor eye contact, mask-like facies, elevated hepatic transaminase, increased body weight, increased blood pressure PLXNA2 ENST00000367033:c.2594C>T p.Thr865Met AR_homo 8.0 homo maternal& paternal 1 NDD + epilepsy (+) Microcephaly,(+) Global developmental delay,(+) Encephalopathy,(+) Increased body weight,(+) Febrile status epilepticus ADGRF4/GPR11 5 ENST00000283303:c.1860del p.Phe620Leufs*3 AR_homo 8.5 homo maternal& paternal 4 NDD + epilepsy (+) Hypothyroidism,(+) Seizure,(+) Intellectual disability, mild,(+) Global developmental delay,(+) Gliosis EPHB1 ENST00000398015:c.2204T>C p.Leu735Pro AD_denovo 7.8 het de novo 4 NDD + epilepsy (+) Hypothyroidism,(+) Seizure,(+) Intellectual disability, mild,(+) Global developmental delay,(+) Gliosis DOP1A/DOPEY1 ENST00000237163:c.5210A>T p.Glu1737Val AR_homo 5.4 homo maternal& paternal 4 NDD + epilepsy (+) Hypothyroidism,(+) Seizure,(+) Intellectual disability, mild,(+) Global developmental delay,(+) Gliosis PHTF2 ENST00000248550:c.2122C>T p.Leu708Phe AD_denovo 5.4 het de novo 4 NDD + epilepsy (+) Hypothyroidism,(+) Seizure,(+) Intellectual disability, mild,(+) Global developmental delay,(+) Gliosis BSN ENST00000296452:c.8746_8749del p.Gln2916Cysfs*11 AD_unknown 9.5 het unknown 1 NDD + epilepsy (+) Intellectual disability,(+) Seizure,(+) Global developmental delay,(+) Postural instability,(+) Tetraparesis
MYCBP2 ENST00000357337:c.8674A>T p.Ser2892Cys AD_unknown 6.3 het unknown 1 Epilepsy (+) Migraine,(+) EEG abnormality,(+) Focal-onset seizure,(+) Generalized tonic seizure,(-) Abnormality of brain morphology,(+) Seizure precipitated by febrile infection TPR ENST00000367478:c.2943+2T>C None AD_unknown 9.0 het unknown 1 NDD (+) Autism,(+) Delayed speech and language development,(+) Global developmental delay,(+) EEG abnormality,(+) Tip-toe gait PRMT9 ENST00000322396:c.1144C>A p.Gln382Lys AR_homo 4.24 homo maternal& paternal 3 NDD + Epilepsy Intellectual disability, dyslexia, Pes planus, Focal tonic seizure, Cognitive impairment LAMA5 ENST00000252999:c.5408C>T p.Ser1803Phe AR_homo 6.07 homo maternal& paternal 3 NDD + Epilepsy Intellectual disability, dyslexia, Pes planus, Focal tonic seizure, Cognitive impairment DBN1 ENST00000292385:c.1663_1664delinsCT p.Ser555Leu ENST00000292385:c.1452C>G p.Asn484Lys AR_comphet 5.18 comphet maternal& paternal 3 NDD + Epilepsy Intellectual disability, dyslexia, Pes planus, Focal tonic seizure, Cognitive impairment ARSF ENST00000359361:c.1156C>T p.Arg386* XL 6.24 hemi maternal 1 NDD suspected neurodegenerative disease, leukoencephalopathy, horizontal nystagmus, slowed slurred speech, respiratory distress PLCH1 ENST00000334686:c.2813del p.Asn938Thrfs*24 AD_unknown 5.55 het unknown 1 NDD + epilepsy (+) Microcephaly,(+) Seizure,(+) Short stature,(+) Severe global developmental delay DIP2B ENST00000301180:c.3346C>T p.Arg1116* AD 7.63 het maternal 2 Epilepsy (+) Generalized non-motor (absence) seizure PLXNA1 ENST00000251772:c.4817C>T p.Thr1606Met AD_denovo 6.43 het de novo 1 NDD leukoencephalopathy SVEP1 ENST00000401783:c.2708T>A p.Leu903* ENST00000401783:c.9653G>A p.Cys3218Tyr AR_comphet 5.32 comphet maternal& paternal 3 NDD + epilepsy Structural epilepsy with epileptic spasms since the age of 10 months, bilateral extensive gyration disorder, severe developmental disorder, macrocephaly, former twin premature baby of 33+1 SSW, condition after hydrops fetals of unclear aetiology. ATP13A4 ENST00000295548:c.826G>A p.Glu276Lys AR_homo 6.18 homo maternal& paternal 3 NDD + epilepsy Structural epilepsy with epileptic spasms since the age of 10 months, bilateral extensive gyration disorder, severe developmental disorder, macrocephaly, former twin premature baby of 33+1 SSW, condition after hydrops fetals of unclear aetiology. CFAP57/WDR65 ENST00000372492:c.176G>A p.Gly59Asp AD_denovo 5.46 het de novo 3 NDD + epilepsy Structural epilepsy with epileptic spasms since the age of 10 months, bilateral extensive gyration disorder, severe developmental disorder, macrocephaly, former twin premature baby of 33+1 SSW, condition after hydrops fetals of unclear aetiology. LPIN3 ENST00000373257:c.254A>G p.Glu85Gly AD_denovo 5.9 het de novo 1 Epilepsy epileptic encephalopathy MKRN1 ENST00000480552:c.262A>G p.Thr88Ala AD_denovo 5.81 het de novo 2 NDD severe global developmental delay, autism, periventricular white matter hypodensities HDAC9 ENST00000441542:c.800G>A p.Arg267His ENST00000441542:c.2917G>C p.Val973Leu AR_comphet 6.2 comphet maternal& paternal 2 NDD severe global developmental delay, autism, periventricular white matter hypodensities EGFL6 ENST00000361306:c.954T>G p.Tyr318* XL 5.54 hemi maternal 2 NDD + epilepsy epileptic encephalopathy, generalized non-motor (absence) seizure, mild intellectual disability, behavioral abnormality, myoclonus, excessive salivation TAOK2 ENST00000279394:c.2529C>A p.Tyr843* AD_unknown 7.51 het unknown 1 NDD+epile psy (+) Global developmental delay,(+) Obesity,(+) Focal-onset seizure KCNC2 ENST00000549446:c.1412T>C p.Val471Ala AD_denovo 8.66 het de novo 2 NDD + epilepsy epileptic encephalopathy, generalized non-motor (absence) seizure, mild intellectual disability, behavioral abnormality, myoclonus, excessive salivation HIP1 ENST00000336926:c.2377_2378del p.Ala793Tyrfs*2 AD_denovo 9.5 het de novo 1 NDD + epilepsy (+) Focal-onset seizure,(+) Mild global developmental delay ARID3B ENST00000346246:c.593G>A p.Arg198Gln AD_denovo 5.08 het de novo 1 NDD severe global developmental delay, autism ARHGAP21 ENST00000320481:c.806C>T p.Thr269Met AD_denovo 6.64 het de novo 1 NDD developmental delay, macrocephalus, muscular hypotonia, strabismus convergens, obesity, tall stature TCERG1 ENST00000296702:c.592C>T p.Gln198* AD_unknown 7.43 het unknown 1 NDD (+) Behavioral abnormality,(+) Osteoporosis,(+) Intellectual disability,(+) Global developmental delay,(+) Spondylitis HDAC2 ENST00000368632:c.88G>T p.Ala30Ser AR_homo 7.72 homo maternal& paternal 2 Epilepsy ventriculomegaly, apneic episodes in infancy, cerebral hypomyelination, focal-onset seizure ARHGAP21 ENST00000320481:c.2132C>T p.Ser711Phe AD_denovo 5.77 het de novo 2 Epilepsy ventriculomegaly, apneic episodes in infancy, cerebral hypomyelination, focal-onset seizure ELFN2 ENST00000402918:c.221C>A p.Ser74* AD_unknown Bhet unknown 1 Amyotrophic lateral sclerosis
EPHA1 ENST00000275815:c.1245C>A p.Tyr415* AD_denovo 6.93 het de novo 1 NDD + epilepsy generalized-onset seizure, focal-onset seizure, profound global developmental delay, ab-normal cerebellum morphology, hypoplasia of the cerebellar vermis, spastic tetraparesis, flexion contractu GAK ENST00000314167:c.3742C>T p.Arg1248Cys ENST00000314167:c.986_989del p.Thr329Serfs*90 AR_comphet 7.8 comphet maternal& paternal 1 NDD Intrauterine growth retardation, developmental delay emphasising speech, short stature, relative macrocephaly, benign enlargement of the external cerebrospinal fluid spaces, high hairline INHBA ENST00000242208:c.188T>C p.Leu63Ser AD_denovo 5.67 het de novo 3 NDD + epilepsy Global developmental delay,(+) EEG with spike-wave complexes,(+) Nocturnal seizures CKAP5 ENST00000312055:c.1157A>G p.Asp386Gly AD_denovo 8.85 het de novo 3 NDD + epilepsy Global developmental delay,(+) EEG with spike-wave complexes,(+) Nocturnal seizures CROCC ENST00000375541:c.949del p.Thr317Leufs*26 ENST00000375541:c.3394G>A p.Ala1132Thr AR_comphet 5.96 comphet maternal& paternal 3 NDD + epilepsy Global developmental delay,(+) EEG with spike-wave complexes,(+) Nocturnal seizures AMOT ENST00000304758:c.401A>G p.Lys134Arg XL 5.47 hemi maternal 3 NDD Global developmental delay, autism KLHL23 ENST00000392647:c.1573C>T p.Gln525* AD_denovo 4.9 het de novo 3 NDD Global developmental delay, autism SLC4A5 ENST00000377634:c.3122G>T p.*1041Leuext*5 ENST00000377634:c.1486G>A p.Gly496Ser AR_comphet 5.28 comphet maternal& paternal 3 NDD Global developmental delay, autism SNAP91 ENST00000195649:c.2516del p.Pro839Leufs*8 AD_unknown 10.0 het unknown 1 Epilepsy (+) Focal-onset seizure ITPR2 ENST00000381340:c.6458G>A p.Arg2153Gln AD_denovo 8.81 het de novo 1 Epilepsy Since 01/2021, daily recurrent seizures with nocturnal frequency (5-15 times per day). According to the EEG, multifocal onset with secondary generalisation. Occasional slurred speech since onset of seizures. RNF2 ENST00000367509:c.442_443insC p.Met148Thrfs*5 AD_unknown 8.86 het unknown 1 NDD (+) Anal atresia,(+) Arnold-Chiari malformation,(+) Spina bifida,(+) Short stature,(+) Infantile muscular hypotonia,(+) Severe global developmental delay ESPL1 ENST00000257934:c.32del p.Thr11Ilefs*3 AD_unknown 8.45 het unknown 1 NDD + epilepsy (+) Intellectual disability, mild,(+) Bilateral tonic-clonic seizure,(+) Generalized myoclonic-atonic seizure,(+) Nocturnal seizures NOVA1 ENST00000267422:c.325C>T p.Arg109* AR_homo 11.3 homo unknown 1 NDD (+) Retrognathia,(+) Hyperreflexia,(+) Flexion contracture,(+) Small for gestational age,(+) Dysphagia,(+) Respiratory insufficiency,(+) Muscle stiffness,(+) Severe global developmental delay NRXN3 ENST00000281127:c.1030C>T p.Pro344Ser AD_unknown 8.32 het unknown 1 NDD + epilepsy (+) Autism,(+) Global developmental delay,(+) Pachygyria,(+) Polymicrogyria,(+) Status epilepticus,(+) Intellectual disability, moderate,(+) Focal myoclonic seizure,(+) Focal tonic seizure SNRNP70 ENST00000221448:c.1124G>A p.Gly375Asp AD_unknown 5.06 het unknown 1 NDD (+) Macrocephaly,(+) Optic atrophy,(+) Global developmental delay,(+) Dandy-Walker malformation TSKU ENST00000333090:c.188_189dup p.Asp64Trpfs*11 AD_unknown Ahet unknown 1 other (+) Leukoencephalopathy,(+) Cerebral ischemia,(+) Recurrent subcortical infarcts,(+) Subcortical cerebral atrophy MYO9B ENST00000595618:c.5551G>A p.Ala1851Thr AD_denovo 5.8 het de novo 1 NDD severe dystrophy (BMl 11), severe global developmental delay, dyskinetic-dystonic movement disorder, basal ganglia disease of unknown origin (not progressive, Segawa syndrome suspected), symmetric gliotic changes on both sides in globus pallidus, otherwise MRI without pathological findings, abnormal development since the 4th month of life until then normal development ARHGAP21 ENST00000396432:c.4871G>A p.Ser1624Asn AD_denovo 6.81 het de novo 3 NDD global developmental delay, hypotonia, pulmonic stenosis, bilateral single transverse palmar creases, microretrognathia, feeding difficulties NOC4L ENST00000330579:c.901G>T p.Gly301Trp AD_denovo 5.58 het de novo 3 NDD global developmental delay, hypotonia, pulmonic stenosis, bilateral single transverse palmar creases, microretrognathia, feeding difficulties CXorf36 ENST00000377934:c.233+4A>G None XL 8.17 hemi maternal 3 NDD global developmental delay, hypotonia, pulmonic stenosis, bilateral single transverse palmar creases, microretrognathia, feeding difficulties C9orf172 ENST00000436881:c.2006_2016del p.Arg669Hisfs*112 AD_unknown 6.38 het unknown 1 NDD (+) Moderate global developmental delay TEKT4 ENST00000295201:c.1101_1104del p.Ser367Argfs*5 AR_homo 8.39 homo unknown 1 NDD Delayed speech and language development
ADRM1 ENST00000253003:c.1015-2A>G None AD_unknown 7.05 het unknown 1 NDD (+) Microcephaly,(+) Autism,(+) Mild global developmental delay MAP2K4 ENST00000353533:c.841C>T p.Arg281* AD_denovo 9.05 het de novo 1 NDD + epilepsy Seizure. Intellectual disability, joint laxity ATP8A2 ENST00000381655:c.560A>G p.Asp187Gly ENST00000381655:c.368C>T p.Pro123Leu AR_comphet 7.91 comphet maternal& paternal 2 NDD + epilepsy premature birth by sectio in breech presentation, severe mental retardation, no active speech, generalized ataxia, dystrophy (BMI 15.8), oculomotor dysfunction, dysphagia; significant developmental delay after first 6-vaccination, no head and trunk control, scoliosis, dystonia and spasticity, epilepsy with focal and generalized signs with tonic-clonic seizures. Human genetics (Spranger's practice, Bremen; 2018): Exclusion of SCN1A mutation and pathogenic CNV SULT2A1 ENST00000222002:c.371G>C p.Arg124Thr AD_denovo 5.28 het de novo 2 NDD + epilepsy premature birth by sectio in breech presentation, severe mental retardation, no active speech, generalized ataxia, dystrophy (BMI 15.8), oculomotor dysfunction, dysphagia; significant developmental delay after first 6-vaccination, no head and trunk control, scoliosis, dystonia and spasticity, epilepsy with focal and generalized signs with tonic-clonic seizures. Human genetics (Spranger's practice, Bremen; 2018): Exclusion of SCN1A mutation and pathogenic CNV ABCA13 ENST00000435803:c.13921G>A p.Gly4641Ser ENST00000435803:c.14182C>T p.Arg4728Ter AR_comphet 5.04 comphet maternal& paternal 2 NDD + epilepsy mild developmental delay, focal seizure, ganglioglioma (with 5 years) PDS5B ENST00000315596:c.30del p.Asp10Glufs*23 AD_denovo 10.7 het de novo 2 NDD + epilepsy mild developmental delay, focal seizure, ganglioglioma (with 5 years) CLASP2 ENST00000313350:c.170C>T p.Pro57Leu AD_unknown 6.28 het unknown 1 NDD + epilepsy (+) Autism,(+) Focal-onset seizure,(+) Moderate global developmental delay UBE2H ENST00000355621:c.449C>T p.Thr150Met AD_denovo 7.89 het de novo 1 NDD Developmental delay with autistic features, muscular hypotonia, strabismus divergens, hyperopia, exotropia GSE1 ENST00000253458:c.1921del p.Arg641Valfs*66 AD_unknown 7.04 het unknown 1 NDD (+) Autism,(+) Moderate global developmental delay DHX15 ENST00000336812:c.955G>A p.Val319Ile AD_denovo 7.28 het de novo 1 NDD moderate global developmental delay, absent speech, behavioral abnormality, autistic be-havior, growth delay RNF44 ENST00000274811:c.802C>A p.Pro268Thr AD_denovo 5.42 het de novo 1 NDD bilateral tonic-clonic seizure (first seizure 07/2017), autism, mixed hepatopathy of unclear etiology, abnormal circulating lipid concentration, left ventricular diastolic dysfunction KCTD16 ENST00000507359:c.521G>A p.Cys174Tyr AR_homo 5.18 homo maternal& paternal 3 NDD + epilepsy severe developmental delay, focal epilepsy PDLIM5 ENST00000317968:c.737G>T p.Arg246Leu AR_homo 5.64 homo maternal& paternal 3 NDD + epilepsy severe developmental delay, focal epilepsy MTRF1L ENST00000367230:c.641G>A p.Gly214Glu AD_denovo 6.56 het de novo 3 NDD + epilepsy severe developmental delay, focal epilepsy AGPAT3 ENST00000291572:c.250C>T p.Arg84Cys AR_homo 4.54 homo maternal& paternal 12 NDD + Epilepsy Seizures, Global developmental delay, Microcephaly, Hearing impairment, Visual impairment, Intellectual disability, AMY2B ENST00000361355:c.944A>T p.Asp315Val AR_homo 5.19 homo maternal& paternal 12 NDD + Epilepsy Seizures, Global developmental delay, Microcephaly, Hearing impairment, Visual impairment, Intellectual disability, GIMAP2 ENST00000223293:c.783C>A p.Cys261* AR_homo 6.97 homo maternal& paternal 12 NDD + Epilepsy Seizures, Global developmental delay, Microcephaly, Hearing impairment, Visual impairment, Intellectual disability, ARID5B ENST00000279873:c.1909G>T p.Asp637Tyr AR_homo 6.21 homo maternal& paternal 12 NDD + Epilepsy Seizures, Global developmental delay, Microcephaly, Hearing impairment, Visual impairment, Intellectual disability, YBX3 ENST00000228251:c.450G>T p.Lys150Asn AR_homo 5.18 homo maternal& paternal 12 NDD + Epilepsy Seizures, Global developmental delay, Microcephaly, Hearing impairment, Visual impairment, Intellectual disability, PTPRH ENST00000376350:c.655C>T p.Gln219* AR_homo 7.02 homo maternal& paternal 12 NDD + Epilepsy Seizures, Global developmental delay, Microcephaly, Hearing impairment, Visual impairment, Intellectual disability, KCNJ15 ENST00000328656:c.83G>A p.Arg28His AR_homo 5.74 homo maternal& paternal 12 NDD + Epilepsy Seizures, Global developmental delay, Microcephaly, Hearing impairment, Visual impairment, Intellectual disability, AGPAT3 ENST00000291572:c.250C>T p.Arg84Cys AR_homo 4.54 homo maternal& paternal 12 NDD + Epilepsy Seizures, Global developmental delay, Microcephaly, Hearing impairment, Visual impairment, Intellectual disability, GRINA ENST00000313269:c.967-6C>T None AR_homo 4.08 homo maternal& paternal 12 NDD + Epilepsy Seizures, Global developmental delay, Microcephaly, Hearing impairment, Visual impairment, Intellectual disability, MED16 ENST00000269814:c.1246G>T p.Glu416* AD_unknown 6.54 het unknown 1 NDD + Epilepsy Intellectual disability, tonic seizure, myoclonic-atonic seizure, tonic-clonic seizure with generalized onset, myoclonic seizure, periventricular heterotopia INPP5D ENST00000359570:c.919G>A p.Asp307Asn AR_homo 5.18 homo unknown 1 NDD + Epilepsy (+) Hypertension,(+) Global developmental delay,(+) Obesity,(+) Mitral regurgitation,(+) Bilateral tonicclonic seizure,(+) Intellectual disability, moderate WDFY4 ENST00000265453:c.3130G>A p.Val1044Met AD_unknown 5.83 het unknown 2 NDD+epile psy (+) Autism,(+) Gliosis,(+) Generalized-onset seizure,(+) Severe global developmental delay
PTPRCAP ENST00000326294:c.280C>T p.Arg94* AD_unknown 4.47 het unknown 2 NDD+epile psy (+) Autism,(+) Gliosis,(+) Generalized-onset seizure,(+) Severe global developmental delay CCDC121 ENST00000324364:c.816dup p.Ser273Ilefs*4 AD_denovo 7.02 het de novo 1 NDD early childhood autism with expressive language disorder, behavioural problems HECW1 ENST00000395891:c.2588C>T p.Ala863Val AD_unknown 5.16 het unknown 1 NDD+epile psy (+) Generalized non-motor (absence) seizure,(+) EEG with focal spike waves,(+) Mild global developmental delay IMPDH2 ENST00000326739:c.613A>G p.Lys205Glu AD_denovo 7.55 het de novo 1 NDD combined developmental delay, crawling at 13 months, walking at 20 months, first words approx. 11 months, incorrect pronunciation, small hands, small feet, body measurements within normal range APBB1 ENST00000299402:c.1781A>G p.Gln594Arg AD_denovo 7.83 het de novo 1 NDD+epile psy (+) Status epilepticus,(+) Focal-onset seizure THOC2 ENST00000245838:c.2062G>A p.Gly688Arg XL 8.77 het de novo 1 NDD + epilepsy Intellectual disability,(+) Brain very small,(+) Focal-onset seizure FAT3 ENST00000298047:c.656T>G p.Leu219* AD_denovo 8.99 het de novo 1 NDD+epile psy +) Global developmental delay,(+) Generalized-onset seizure,(+) Febrile seizure (within the age range of 3 months to 6 years) FBXL19 ENST00000338343:c.26_32dup p.Ala12Glyfs*20 AD_inherited 8.85 het paternal 1 NDD (+) Microcephaly,(+) Delayed speech and language development,(+) Hirsutism,(+) Intellectual disability,(+) Intellectual disability, mild,(+) Global developmental delay,(+) Absent speech,(+) Intellectual disability, moderate,(+) Poor speech,(+) Short stature,(+) Frontal hirsutism,(+) Cognitive impairment CAMSAP1 ENST00000312405:c.2749del p.Met917* AD_unknown 6.92 het unknown 1 Epilepsy generalized onset seizure NTRK2 ENST00000277120:c.2404A>T p.Met802Leu AD_denovo 11.5 het de novo 1 NDD global developmental delay, short stature, recurrent hypoglycaemia under growth hormone therapy, postprandial hyperglycemia, obesity, anterior pituitary dysgenesis, ectopic posterior pituitary, posterior pituitary hypoplasia, pituitary growth hormone deficiency, aqueductal stenosis, condition after arachnoid cyst with hydrocephalus occlusus, space-occupying structure in epipharynx DD sphenoid cephalocele with hamartomatous lesion in epipharynx, aplasia/hypoplasia of the cervical spine, atlas dislocation, dens aplasia, hypoplasia of the spinous process C4 and C5, severe thinning and caudal displacement of the chiasm into the hypophyseal fossa and elongation of the optic tract, hiatus hernia, abnormal stomach morphology, secondary spleen, recurrent iron deficiency anemia DLGAP2 ENST00000421627:c.1297C>A p.Gln433Lys AD_inherited 6.21 het paternal 2 NDD (+) Behavioral abnormality,(+) Autistic behavior,(+) Sleep disturbance,(+) Developmental regression DNAJC28 ENST00000314399:c.401G>A p.Arg134Gln AR_homo 4.68 homo maternal& paternal 2 NDD (+) Behavioral abnormality,(+) Autistic behavior,(+) Sleep disturbance,(+) Developmental regression AKAP7 ENST00000368123:c.611C>G p.Ser204* AR_homo 8.23 homo unknown 3 NDD+epile psy (+) Seizure,(+) Hypotonia,(+) Global developmental delay,(+) Intellectual disability, moderate,(+) Dystonic gait,(+) Periodic fever UBE2O ENST00000319380:c.3046C>T p.Pro1016Ser AD_unknown 5.7 het unknown 1 NDD (+) Profound global developmental delay RIMBP2 ENST00000261655:c.3121A>G p.Lys1041Glu ENST00000261655:c.824C>T p.Ala275Val AR_comphet 5.1 het maternal& paternal 1 NDD (+) Macrocephaly,(+) Abnormality of neuronal migration,(+) Cerebral white matter hypoplasia CLDN5 ENST00000403084:c.358T>C p.Phe120Leu AD_denovo 7.07 het de novo 1 NDD+epile psy (+) Microcephaly,(+) Global developmental delay,(+) Bilateral tonic-clonic seizure,(+) Generalized-onset seizure,(+) Abnormality of neuronal migration,(+) Motor seizure,(+) Decreased head circumference PTPRD ENST00000355233:c.1318_1319insAGGA p.Glu440Glyfs*4 AD_unknown 9.64 het unknown 2 epilepsy (+) Seizure,(+) Mild global developmental delay SIK2 ENST00000304987:c.1337dup p.Asn446Lysfs*8 AD_unknown 6.51 het unknown 2 epilepsy (+) Seizure,(+) Mild global developmental delay KIAA1217 ENST00000376454:c.2698T>C p.Ser900Pro AR_homo 5.23 homo maternal& paternal 3 epilepsy seizure, hypsarrhythmia, infantile spasms RNF123 ENST00000327697:c.79A>C p.Thr27Pro AD_denovo 6.33 het de novo 3 epilepsy seizure, hypsarrhythmia, infantile spasms DOCK5 ENST00000276440:c.1595G>A p.Arg532Gln ENST00000276440:c.3284-6_3284-2del None AR_comphet 5.3 comphet maternal& paternal 3 epilepsy seizure, hypsarrhythmia, infantile spasms PTBP3 ENST00000334318:c.1120_1121insACAC p.Thr374Asnfs*15 AD_unknown 5.72 het unknown 2 (+) Hydrocephalus,(+) Premature birth,(+) Generalized-onset seizure,(+) Focal-onset seizure,(+) Intraventricular hemorrhage HTR2C ENST00000276198:c.896C>T p.Thr299Ile XL 7.44 hemi maternal 1 epilepsy Therapy-resistant epilepsy (absence), intellectual disability
COPS2 ENST00000299259:c.784C>T p.His262Tyr AD_denovo 8.22 het de novo 2 NDD+epile psy (+) Microcephaly,(+) Abnormality of the face,(+) Strabismus,(+) 2-3 finger syndactyly,(+) Intellectual disability,(+) Severe global developmental delay MBOAT2 ENST00000305997:c.1027A>G p.Ile343Val AD_denovo 5.64 het de novo 2 NDD+epile psy (+) Microcephaly,(+) Abnormality of the face,(+) Strabismus,(+) 2-3 finger syndactyly,(+) Intellectual disability,(+) Severe global developmental delay DHX9 ENST00000367549:c.3787C>T p.Gln1263Ter AD_unknown 7.04 het unknown 2 (+) Hydrocephalus,(+) Premature birth,(+) Generalized-onset seizure,(+) Focal-onset seizure,(+) Intraventricular hemorrhage KLHL20 ENST00000209884:c.1211C>G p.Thr404Arg AD_unknown 4.77 het unknown 1 NDD+epile psy (+) Intellectual disability, moderate,(+) Focal-onset seizure PATL1 ENST00000300146:c.1031+1G>A None AD_unknown 7.55 het unknown 1 NDD+epile psy (+) Insulin resistance,(+) Obesity,(+) Generalized-onset seizure,(+) Severe global developmental delay FAM222A ENST00000358906:c.1231del p.Tyr411Ilefs*80 AD_unknown 6.31 het unknown 2 NDD (+) Hypotonia,(+) Growth delay,(+) Abnormality of acid-base homeostasis,(+) Relative macrocephaly,(+) Mild global developmental delay,(+) Feeding difficulties,(+) Vitamin B12 deficiency HELZ ENST00000358691:c.2117A>G p.Tyr706Cys AD_unknown 5.29 het unknown 2 NDD (+) Hypotonia,(+) Growth delay,(+) Abnormality of acid-base homeostasis,(+) Relative macrocephaly,(+) Mild global developmental delay,(+) Feeding difficulties,(+) Vitamin B12 deficiency HEATR1 ENST00000366581:c.360-1G>A None AD_unknown 7.44 het unknown 1 NDD + cardio (+) Microcephaly,(+) Short attention span,(+) Global developmental delay,(+) Tetralogy of Fallot DOCK11 ENST00000276202:c.1034A>G p.Gln345Arg XL 5.03 hemi maternal 1 NDD+epile psy (+) Focal-onset seizure,(+) Moderate global developmental delay,(+) Continuous spike and waves during slow sleep ASCC3 ENST00000369162:c.4658C>T p.Ser1553Phe AD_denovo 7.8 het de novo 1 NDD (+) Hearing impairment,(+) Poor eye contact,(+) Global developmental delay,(+) Expressive language delay,(+) No social interaction,(+) Receptive language delay FHIP2A ENST00000369248:c.1619T>C p.Leu540Ser AD_denovo 6.71 het de novo 2 NDD Macrocephaly, Autism, Hypotonia, Delayed gross motor development, Incoordination NOC4L ENST00000330579:c.901+2T>A AD_denovo 6.45 het de novo 2 NDD+epile psy Global developmental delay,(+) Infantile spasms,(+) Epileptic encephalopathy ZNF433 ENST00000344980:c.1809_1812delinsACAG p.Arg604Gln AD_denovo 3.51 mosaik de novo 2 NDD+epile psy Global developmental delay,(+) Infantile spasms,(+) Epileptic encephalopathy DSCAM AD_unknown het paternal 2 NDD Macrocephaly, Autism, Hypotonia, Delayed gross motor development, Incoordination MFSD14A ENST00000370152:c.1042A>G p.Ser348Gly AD_denovo 6.01 het de novo 2 NDD+epile psy Tall stature, Global developmental delay, Abnormal cerebellum morphology, Status epilepticus, Focal aware seizure, Scoliosis, Grade IV vesicoureteral reflux FAAH2 ENST00000374900: c.1362T>A p.His454Gln XL 4.76 hemi maternal 2 NDD+epile psy Tall stature, Global developmental delay, Abnormal cerebellum morphology, Status epilepticus, Focal aware seizure, Scoliosis, Grade IV vesicoureteral reflux PCDHGB2 ENST00000522605:c.1841C>T p.Pro614Leu AD_denovo 4.92 het de novo 2 NDD+epile psy Gliosis, EEG abnormality, Dyscalculia, Focal-onset seizure, Dyslexia, Impaired visuospatial constructive cognition, Mild global developmental delay PFAS ENST00000314666:c.1520A>G p.Lys507Arg ENST00000314666:c.2122G>A p.Val708Ile AR_comphet 5.61 comphet maternal& paternal 2 NDD+epile psy Gliosis, EEG abnormality, Dyscalculia, Focal-onset seizure, Dyslexia, Impaired visuospatial constructive cognition, Mild global developmental delay DSCAML1 ENST00000321322:c.4921T>C p.Ser1641Pro AD_denovo 7.64 het de novo 1 NDD Delayed speech and language development, Global developmental delay, Obesity, Simple febrile seizure RHOBTB3 ENST00000379982: c.520G>A p.Glu174Lys AD_denovo 6.46 het de novo 1 epilepsy (+) Pectus excavatum,(+) Striae distensae,(+) Joint laxity,(+) EEG abnormality,(+) Focal-onset seizure,(-) Abnormality of brain morphology EXOC4 ENST00000253861:c.1766A>T p.Asp589Val AD_denovo 8.22 het de novo 2 Muskel Hypotonia,(+) Flexion contracture,(+) Gowers sign,(+) Exercise-induced myalgia PTPRD AD_unknown het de novo 2 Muskel Hypotonia,(+) Flexion contracture,(+) Gowers sign,(+) Exercise-induced myalgia FRY ENST00000380217:c.104A>T p.His35Leu AD_denovo Bhet de novo 1 Fehlbildung en Hypertelorism, Low-set, posteriorly rotated ears, Broad neck, Downslanted palpebral fissures, Tetralogy of Fallot, Short stature SYTL5 ENST00000297875:c.2063G>A p.Gly688Glu XL 4.32 hemi maternal 4 NDD Renal insufficiency,(+) High palate,(+) Microretrognathia,(+) Hearing impairment,(+) Astigmatism,(+) Myopia,(+) Exotropia,(+) Delayed speech and language development,(+) Single transverse palmar crease,(+) Intellectual disability,(+) Hip dysplasia,(+) Pes planus,(+) Thrombocytopenia,(+) Anemia,(+) Fever,(+) Vomiting,(+) Respiratory insufficiency,(+) Delayed gross motor development,(+) Hypocalcemia,(+) Hypoalbuminemia,(+) 2-3 toe syndactyly,(+) Pes valgus,(+) Delayed fine motor development,(+) Abnormal circulating carnitine concentration,(+) Severe global developmental delay,(+) Tetralogy of Fallot with pulmonary stenosis,(+) Submucous cleft of soft and hard palate
FRA10AC1 ENST00000359204:c.481C>T p.Arg161* AR_homo 7.78 homo maternal& paternal 4 NDD Renal insufficiency,(+) High palate,(+) Microretrognathia,(+) Hearing impairment,(+) Astigmatism,(+) Myopia,(+) Exotropia,(+) Delayed speech and language development,(+) Single transverse palmar crease,(+) Intellectual disability,(+) Hip dysplasia,(+) Pes planus,(+) Thrombocytopenia,(+) Anemia,(+) Fever,(+) Vomiting,(+) Respiratory insufficiency,(+) Delayed gross motor development,(+) Hypocalcemia,(+) Hypoalbuminemia,(+) 2-3 toe syndactyly,(+) Pes valgus,(+) Delayed fine motor development,(+) Abnormal circulating carnitine concentration,(+) Severe global developmental delay,(+) Tetralogy of Fallot with pulmonary stenosis,(+) Submucous cleft of soft and hard palate DMXL1 ENST00000311085:c.7691G>C p.Gly2564Ala AR_homo 4.96 homo maternal& paternal 4 NDD Renal insufficiency,(+) High palate,(+) Microretrognathia,(+) Hearing impairment,(+) Astigmatism,(+) Myopia,(+) Exotropia,(+) Delayed speech and language development,(+) Single transverse palmar crease,(+) Intellectual disability,(+) Hip dysplasia,(+) Pes planus,(+) Thrombocytopenia,(+) Anemia,(+) Fever,(+) Vomiting,(+) Respiratory insufficiency,(+) Delayed gross motor development,(+) Hypocalcemia,(+) Hypoalbuminemia,(+) 2-3 toe syndactyly,(+) Pes valgus,(+) Delayed fine motor development,(+) Abnormal circulating carnitine concentration,(+) Severe global developmental delay,(+) Tetralogy of Fallot with pulmonary stenosis,(+) Submucous cleft of soft and hard palate FAM149B1 ENST00000242505:c.485C>G p.Pro162Arg AR_homo 4.28 homo maternal& paternal 4 NDD Renal insufficiency,(+) High palate,(+) Microretrognathia,(+) Hearing impairment,(+) Astigmatism,(+) Myopia,(+) Exotropia,(+) Delayed speech and language development,(+) Single transverse palmar crease,(+) Intellectual disability,(+) Hip dysplasia,(+) Pes planus,(+) Thrombocytopenia,(+) Anemia,(+) Fever,(+) Vomiting,(+) Respiratory insufficiency,(+) Delayed gross motor development,(+) Hypocalcemia,(+) Hypoalbuminemia,(+) 2-3 toe syndactyly,(+) Pes valgus,(+) Delayed fine motor development,(+) Abnormal circulating carnitine concentration,(+) Severe global developmental delay,(+) Tetralogy of Fallot with pulmonary stenosis,(+) Submucous cleft of soft and hard palate PLSCR1 ENST00000342435:c.881T>C p.Ile294Thr AR_homo 4.22 homo maternal& paternal 4 NDD Sensorineural hearing impairment,(+) Hypotonia,(+) Moderate global developmental delay PDLIM3 ENST00000284767:c.113C>T p.Ala38Val AR_homo 4.46 homo maternal& paternal 4 NDD Sensorineural hearing impairment,(+) Hypotonia,(+) Moderate global developmental delay NAA35 ENST00000361671:c.659A>G p.Asp220Gly AR_homo 4.95 homo maternal& paternal 4 NDD Sensorineural hearing impairment,(+) Hypotonia,(+) Moderate global developmental delay HABP4 ENST00000375249:c.401G>A p.Arg134His AR_homo 4.58 homo maternal& paternal 4 NDD Sensorineural hearing impairment,(+) Hypotonia,(+) Moderate global developmental delay KIF7 (TICRR) ENST00000394412:None None AD_denovo 8.87 het de novo 2 NDD+epile psy Generalized non-motor (absence) seizure,(+) Memory impairment,(+) Mild global developmental delay FAT3 ENST00000298047:c.11381G>A p.Gly3794Glu ENST00000298047:c.9731C>T p.Thr3244Met AR_comphet 4.64 comphet maternal& paternal 2 NDD+epile psy Generalized non-motor (absence) seizure,(+) Memory impairment,(+) Mild global developmental delay ATP2B4 ENST00000341360:c.2708G>A p.Arg903His AD_denovo 6.63 het de novo 2 NDD+epile psy Focal-onset seizure,(+) Cortical tubers,(+) Mild global developmental delay,(+) Simple renal cyst BIRC6 ENST00000421745:c.13G>A p.Gly5Ser ENST00000421745:c.10525G>A p.Val3509Ile AR_comphet 4.51 comphet maternal& paternal 2 NDD+epile psy Focal-onset seizure,(+) Cortical tubers,(+) Mild global developmental delay,(+) Simple renal cyst PGK2 ENST00000304801:c.1121G>A p.Gly374Glu AD_denovo 5.77 het de novo 1 Neuro Motor axonal neuropathy NRXN2 ENST00000265459:c.1579A>G p.Asn527Asp AD_unknown 8.35 het unknown 1 NDD (+) Delayed speech and language development,(+) Intellectual disability, mild LRRC8B ENST00000330947:c.1070del p.Ser357Metfs*40 AD_inherited 6.72 het maternal 1 NDD (+) Downslanted palpebral fissures,(+) Aggressive behavior,(+) Global developmental delay,(+) Abnormal nasal morphology,(+) Attention deficit hyperactivity disorder,(+) Skewfoot,(+) Finger clinodactyly DDX55 ENST00000238146:c.112G>A p.Ala38Thr AD_denovo 6.08 het de novo 2 epilepsy Anxiety,(+) Bilateral tonic-clonic seizure,(+) Generalized non-motor (absence) seizure SEZ6L ENST00000248933:c.2681G>A p.Gly894Glu AD_denovo 7.09 het de novo 2 epilepsy Anxiety,(+) Bilateral tonic-clonic seizure,(+) Generalized non-motor (absence) seizure CSMD1 AD_unknown het de novo 1 NDD+epile psy Focal-onset seizure,(+) Mild global developmental delay
KLHL12 ENST00000367258:c.335T>G p.Val112Gly AD_unknown 5.16 het unknown 1 NDD (+) Macrocephaly,(+) Seizure,(+) Hypotonia,(+) Dandy-Walker malformation,(+) Muscle weakness,(+) Distal lower limb amyotrophy,(+) Mild global developmental delay KCND1 NM_004979.5:c.343G>Ap.(Asp115Asn) AD_denovo 5.5 hemi de novo 1 NDD + Epilepsy Epilepsy with absences and eyelid myoclonias, normal cMRI, EEG abnormalities, IQ 85 (low normal), speech delay, obstipation HDAC3 ENST00000305264:c.277G>C p.Asp93His AD_denovo 8.86 het de novo 3 NDD Macrotia,(+) Hypotonia,(+) Moderate global developmental delay SP9 NM_001145250.1:c.1133A>Gp.(Glu378Gly) AD_denovo 5.5 het de novo 1 NDD + Epilepsy picanthus, Seizures, Global developmental delay, Abnormal facial shape, Generalized-onset seizure, Severe muscular hypotonia, Muscular hypotonia of the trunk, Infantile muscular hypotonia ADAMTS15 ENST00000299164:c.2820G>C p.Gln940His AD_denovo 5.22 het de novo 3 NDD Macrotia,(+) Hypotonia,(+) Moderate global developmental delay CNTNAP4 ENST00000307431:c.94G>C p.Asp32His AD_denovo 7.83 het de novo 3 NDD Macrotia,(+) Hypotonia,(+) Moderate global developmental delay CPZ ENST00000360986:c.602G>A p.Ser201Asn ENST00000360986:c.752C>T p.Ala251Val AR_comphet 4.23 comphet maternal& paternal 2 NDD Delayed speech and language development,(+) Motor delay,(+) Aplasia/Hypoplasia of the cerebellar vermis,(+) Severe global developmental delay CSPG4 ENST00000308508:c.1390C>T p.Arg464Cys AD_denovo 7.33 het de novo 2 NDD Delayed speech and language development,(+) Motor delay,(+) Aplasia/Hypoplasia of the cerebellar vermis,(+) Severe global developmental delay KCNAB2 ENST00000378083:c.989del p.Gly330Alafs*8 AD_denovo 12.0 het de novo 2 Epilepsy febrile seizure NOC4L ENST00000330579:c.884C>A p.Thr295Asn AD_denovo 5.71 het de novo 2 Epilepsy febrile seizure MTA1 ENST00000331320:c.1427C>T p.Thr476Met AD_unknown 5.3 het unknown 1 NDD+epile psy (+) Generalized-onset seizure,(+) Moderate global developmental delay ASTN1 ENST00000361833:c.797del p.Ser266Thrfs*32 AD_unknown Bhet unknown 1 Neuro (+) Headache,(+) Abnormal cerebral white matter morphology,(+) Paresthesia,(+) Abnormal central sensory function,(+) Hypoesthesia REV3L ENST00000358835:c.5617C>T p.Arg1873* AD_unknown 8.79 het unknown 1 NDD (+) Microcephaly,(+) Generalized-onset seizure,(+) Short stature,(+) Intellectual disability, severe CLHC1 ENST00000401408:c.1441A>T p.Thr481Ser ENST00000401408:c.499G>A p.Gly167Ser AR_comphet Bcomphet maternal& paternal 1 Stoffwechs el Childhood-onset truncal obesity C8orf76 (ZHX1C8orf76) ENST00000276704:c.357+1G>T None AR_homo 8.1 homo unknown 1 NDD (+) Intellectual disability, mild,(+) EEG abnormality C10orf10 (DEPP1) ENST00000298295:c.121G>T p.Val41Leu AD_denovo 5.66 het de novo 1 Epilepsy Atypical absence seizure,(+) Central nervous system cyst ENTPD6 ENST00000354989:c.747+1G>T None AD_denovo 5.46 het de novo 2 NDD Global developmental delay,(+) Abnormal facial shape,(+) Poor speech,(+) Intellectual disability, severe MAP3K15 ENST00000338883:c.1621C>T p.Gln541* AD_denovo 4.6 het de novo 2 NDD Global developmental delay,(+) Abnormal facial shape,(+) Poor speech,(+) Intellectual disability, severe CSMD3 ENST00000297405:c.7385G>A p.Arg2462Gln ENST00000297405:c.10088A>C p.Gln3363Pro AR_comphet 4.57 comphet maternal& paternal 1 NDD+epile psy Global developmental delay,(+) EEG abnormality,(+) Hypsarrhythmia,(+) Generalized tonic seizure,(+) Epileptic spasm PPP6R2 ENST00000216061:c.1602+1G>T None AD_unknown 6.22 het unknown 1 NDD (+) Macrocephaly,(+) Hypotonia,(+) Mild global developmental delay ENPP2 ENST00000075322:c.1388del p.Lys463Argfs*27 AD_denovo 6.64 het de novo 3 Neuro (+) Tall stature,(+) Hearing impairment,(+) Precocious puberty,(+) Joint swelling,(+) Ankle swelling,(+) Areflexia of lower limbs,(+) Sensory axonal neuropathy,(+) Limb muscle weakness,(+) Lower limb muscle weakness,(+) Lower limb pain,(+) Abnormality of movement,(+) Hyperesthesia GALNT9 ENST00000328957:c.1144A>T p.Arg382Trp AR_homo 5.32 homo maternal& paternal 3 Neuro (+) Tall stature,(+) Hearing impairment,(+) Precocious puberty,(+) Joint swelling,(+) Ankle swelling,(+) Areflexia of lower limbs,(+) Sensory axonal neuropathy,(+) Limb muscle weakness,(+) Lower limb muscle weakness,(+) Lower limb pain,(+) Abnormality of movement,(+) Hyperesthesia CA10 ENST00000285273:c.287G>A p.Gly96Glu AD_denovo 7.07 mosaik de novo 3 Neuro (+) Tall stature,(+) Hearing impairment,(+) Precocious puberty,(+) Joint swelling,(+) Ankle swelling,(+) Areflexia of lower limbs,(+) Sensory axonal neuropathy,(+) Limb muscle weakness,(+) Lower limb muscle weakness,(+) Lower limb pain,(+) Abnormality of movement,(+) Hyperesthesia
FMN1 ENST00000559047:c.1878dup p.Glu627* AD_unknown 7.16 het unknown 1 NDD (+) Conductive hearing impairment,(+) Delayed speech and language development,(+) Focal-onset seizure GIGYF2 ENST00000373563:c.713-1G>C None AD_unknown 10.5 het maternal 1 NDD (+) Hearing impairment,(+) Visual impairment,(+) Depression,(+) Intellectual disability,(+) Toe clinodactyly,(+) Scoliosis,(+) Thyroid hyperplasia,(+) Crohn's disease IRAK1 ENST00000369974:c.698del p.Asn233Thrfs*6 AD_unknown Chet maternal 1 Immundefe kt (+) Recurrent bacterial infections,(+) Neonatal sepsis ZFHX3 ENST00000268489:c.10129C>T p.Gln3377* AD_unknown 7.14 het unknown 1 NDD+epile psy (+) Long face,(+) Macrotia,(+) Autistic behavior,(+) Osteoporosis,(+) Intellectual disability,(+) Seizure,(+) Tremor,(+) Dysphagia,(+) Kyphosis,(+) Self-injurious behavior MYRIP ENST00000302541:c.86G>A p.Arg29His ENST00000302541:c.383G>A p.Arg128His AR_comphet 4.36 comphet maternal& paternal 2 NDD (+) Behavioral abnormality,(+) Global developmental delay,(+) Sleep disturbance,(+) Flat face SLITRK2 ENST00000370490:c.2485G>T p.Glu829* XL 8.04 hemi maternal 2 NDD (+) Behavioral abnormality,(+) Global developmental delay,(+) Sleep disturbance,(+) Flat face MAP4K4 ENST00000302217:c.1042-3A>G None AD_unknown Bhet unknown 1 Neuro (+) Dysarthria,(+) Cerebellar atrophy,(+) Gait disturbance,(+) Adenomatous colonic polyposis,(+) Kinetic tremor CRYBG3 ENST00000182096:c.2648G>A p.Arg883His AR_homo 4.41 homo maternal& paternal 5 NDD (+) Deeply set eye,(+) Intellectual disability,(+) Failure to thrive EPHA1 ENST00000275815:c.2884G>C p.Gly962Arg AR_homo 7.15 homo maternal& paternal 5 NDD (+) Deeply set eye,(+) Intellectual disability,(+) Failure to thrive PDP2 ENST00000311765:c.629G>A p.Arg210His AR_homo 5.39 homo maternal& paternal 5 NDD (+) Deeply set eye,(+) Intellectual disability,(+) Failure to thrive KCNG4 ENST00000308251:c.1022C>T p.Ala341Val AR_homo 5.57 homo maternal& paternal 5 NDD (+) Deeply set eye,(+) Intellectual disability,(+) Failure to thrive GSE1 ENST00000253458:c.2468G>A p.Arg823Gln AR_homo 4.41 homo maternal& paternal 5 NDD (+) Deeply set eye,(+) Intellectual disability,(+) Failure to thrive THOC1 ENST00000261600:c.189dup p.Ile64Tyrfs*7 AD_unknown 7.49 het unknown 1 NDD+epile psy (+) Intellectual disability,(+) Global developmental delay,(+) Absent speech,(+) Generalized-onset seizure,(+) Mutism,(+) Atypical absence seizure,(+) EEG with spike-wave complexes TUBA1B ENST00000336023:c.686G>A p.Arg229His AD_denovo 7.68 het de novo 1 (+) Brachyturricephaly,(+) Microcephaly,(+) Penoscrotal hypospadias,(+) Cutis marmorata,(+) Global developmental delay,(+) Craniosynostosis,(+) Abnormal facial shape,(+) Short stature,(+) Feeding difficulties in infancy,(+) Nasogastric tube feeding in infancy PBX3 ENST00000373483:c.649T>C p.Tyr217His AD_unknown 5.15 het unknown 2 NDD+epile psy (+) Seizure,(+) Intellectual disability, moderate,(+) Myoclonic seizure ATG13 ENST00000312040:c.898C>T p.Gln300* AD_unknown 7.23 het unknown 2 NDD+epile psy (+) Seizure,(+) Intellectual disability, moderate,(+) Myoclonic seizure DAAM1 ENST00000351081:c.692G>T p.Cys231Phe AD_denovo 7.22 het de novo 1 NDD (+) Open mouth,(+) Thin upper lip vermilion,(+) Webbed neck,(+) Motor delay,(+) Muscle weakness,(+) Ventricular septal defect,(+) Pes planus,(+) Recurrent fever,(+) Pes valgus,(+) Axial hypotonia,(+) Speech articulation difficulties,(+) Short finger,(+) Tip-toe gait,(+) Abnormal tendon morphology PBX2 ENST00000375050:c.391G>A p.Glu131Lys AD_denovo 6.04 het de novo 1 NDD (+) Global developmental delay,(+) Pes planus,(+) Abnormal form of the vertebral bodies WNK2 ENST00000297954:c.1693del p.Arg565Glyfs*11 AD_unknown 6.69 het unknown 1 Epilepsy (+) Generalized non-motor (absence) seizure // normal development, cMRI unremarkable CIZ1 ENST00000277465:c.2009G>A p.Arg670His AD_denovo 8.43 het de novo 2 NDD+epile psy (+) Focal-onset seizure,(+) EEG with focal epileptiform discharges,(+) EEG with generalized epileptiform discharges,(+) Mild global developmental delay KAT2A ENST00000225916:c.1111A>C p.Asn371His AD_unknown 6.62 het unknown 2 NDD+epile psy (+) Seizure,(+) Complex febrile seizure,(+) Mild global developmental delay UBE3C ENST00000348165:c.2600A>G p.Tyr867Cys AD_unknown 5.61 het unknown 2 NDD+epile psy (+) Seizure,(+) Complex febrile seizure,(+) Mild global developmental delay SIDT2 ENST00000278951:c.2122-2A>C None AD_denovo 5.77 het de novo 2 NDD+epile psy (+) Global developmental delay,(+) Developmental regression,(+) Aphasia,(+) Focal-onset seizure B9D1 (MAPK7) ENST00000477478:None None AR_homo 8.56 homo maternal& paternal 2 NDD+epile psy (+) Global developmental delay,(+) Developmental regression,(+) Aphasia,(+) Focal-onset seizure PODXL ENST00000322985:c.1216-3C>A None AD_unknown 7het unknown 1 NDD+epile psy (+) Absent speech,(+) Spastic tetraplegia,(+) Scoliosis,(+) Intellectual disability, severe,(+) Severe global developmental delay,(+) Multifocal seizures KIF3B ENST00000375712:c.1481del p.Gln494Argfs*58 AD_unknown Bhet unknown 1 Auge (+) Cone/cone-rod dystrophy GPR107 ENST00000347136:c.1316_1320del p.Asn439Serfs*21 AD_denovo 5.54 het de novo 1 NDD+epile psy (+) Autism,(+) Seizure,(+) Leukodystrophy,(+) Mild global developmental delay TCERG1 ENST00000296702:c.2273C>G p.Ser758* AD_unknown 7.58 het unknown 1 (+) Microcephaly,(+) Ptosis,(+) Psoriasiform dermatitis,(+) Short stature,(+) Epileptic encephalopathy NEURL4 ENST00000315614:c.4107C>A p.Cys1369* AD_unknown 7.12 het unknown 1 NDD+epile psy (+) Intellectual disability,(+) Focal-onset seizure,(+) Mild global developmental delay
JMJD1C ENST00000399251:c.168C>A p.Ser56Arg AD_unknown 5.42 het unknown 2 NDD+epile psy (+) Autism,(+) Intellectual disability,(+) Focal impaired awareness motor seizure AKAP8L ENST00000397410:c.310C>T p.His104Tyr AD_denovo 5.23 het de novo 1 epilepsy +) Status epilepticus,(+) Generalized-onset seizure,(+) Focal-onset seizure AFG3L2 ENST00000269143:c.851G>T p.Gly284Val AR_comphet 9.8 het maternal& denovo_o n_paternal _allele 1 NDD (+) Renal duplication,(+) Retrognathia,(+) Abnormal pinna morphology,(+) Global developmental delay,(+) Intrauterine growth retardation,(+) Cerebral atrophy,(+) Increased serum lactate,(+) Global brain atrophy,(+) EEG abnormality,(+) Neuronal loss in central nervous system,(+) Elevated hepatic transaminase,(+) Infantile muscular hypotonia,(+) Cerebral white matter atrophy,(+) Elevated gammaglutamyltransferase level,(+) Brain imaging abnormality TUBA1B ENST00000336023:c.878A>G p.Asn293Ser AD_denovo 7.92 het de novo 1 NDD+epile psy +) Hypospadias,(+) Delayed speech and language development,(+) Global developmental delay,(+) Short stature,(+) Delayed fine motor development,(+) Complex febrile seizure,(+) Feeding difficulties MEX3C ENST00000406189:c.1810C>T p.Arg604* AD_denovo 7.27 het de novo 3 NDD Behavioral abnormality,(+) Delayed speech and language development,(+) Umbilical hernia TENM1 ENST00000371130:c.1795C>T p.Pro599Ser XL 5.49 hemi maternal 3 NDD Behavioral abnormality,(+) Delayed speech and language development,(+) Umbilical hernia BRCC3 ENST00000330045:c.209G>C p.Arg70Thr XL 4.3 hemi maternal 3 NDD Behavioral abnormality,(+) Delayed speech and language development,(+) Umbilical hernia YWHAZ ENST00000353245:c.168_169insGTCATCTTGGAG GGTCG p.Ser57Valfs*40 AD_denovo 11.4 het de novo 2 NDD+epile psy (+) Intellectual disability, mild,(+) Generalized non-motor (absence) seizure,(+) Generalized-onset seizure,(+) Dyscalculia DGKI ENST00000288490:c.111C>A p.Cys37* AD_unknown 6.2 het unknown 2 NDD+epile psy (+) Intellectual disability, mild,(+) Generalized non-motor (absence) seizure,(+) Generalized-onset seizure,(+) Dyscalculia CTDSP1 ENST00000443891:c.67+1del None AD_unknown 6.88 het unknown 1 NDD+epile psy (+) Migraine,(+) Focal-onset seizure,(+) Moderate global developmental delay FURIN ENST00000268171:c.482C>T p.Pro161Leu AD_denovo 7.38 het de novo 1 NDD (+) Microcephaly,(+) Choanal stenosis,(+) Hand polydactyly,(+) Global developmental delay,(+) Failure to thrive,(+) Ventricular septal defect,(+) Patent ductus arteriosus,(+) Short stature,(+) Persistent left superior vena cava,(+) Feeding difficulties,(+) Dermoid cyst TAAR2 ENST00000275191:c.545G>A p.Gly182Glu AD_denovo 4.45 mosaik de novo 1 NDD+epile psy Autism,(+) Seizure,(+) Global developmental delay IAH1 ENST00000497473:c.1A>G p.Met1? AR_homo 6.7 homo unknown 1 NDD+epile psy (+) Intellectual disability, mild,(+) Bilateral tonic-clonic seizure,(+) Periventricular heterotopia,(+) Generalized-onset motor seizure LIMK1 ENST00000336180:c.1291C>T p.Gln431* AD_unknown 9.9 het maternal 2 NDD+epile psy (+) Autism,(+) Intellectual disability,(+) Focal impaired awareness motor seizure UNC79 ENST00000256339:c.1466T>A p.Met489Lys AD_unknown 6.32 het unknown 1 (+) Autism,(+) Intellectual disability, borderline,(+) Mild global developmental delay ARID4A ENST00000348476:c.469G>T p.Glu157* AD_unknown 7.24 het unknown 1 NDD (+) Delayed speech and language development,(+) Pectus excavatum,(+) Motor delay,(+) Basal cell carcinoma,(+) Odontoma,(+) Bone cyst USP34 ENST00000398571:c.6682-5T>G None AD_unknown 8.01 het unknown 1 NDD (+) Microcephaly,(+) Behavioral abnormality,(+) Autism,(+) Intellectual disability,(+) Absent speech UBQLN1 ENST00000257468:c.140del p.Lys47Argfs*32 AD_unknown 8.06 het unknown 1 (+) Generalized non-motor (absence) seizure,(+) Visually-induced seizure ST6GAL1 ENST00000169298:c.1193T>C p.Leu398Pro AD_denovo 5.82 het de novo 2 NDD (+) Dilated cardiomyopathy,(+) Neurodegeneration,(+) Muscle spasm,(+) Muscular dystrophy,(+) Short stature,(+) Infantile muscular hypotonia,(+) Severe global developmental delay KIAA1024 (MINAR1) ENST00000305428:c.2043G>T p.Trp681Cys AD_denovo 4.44 het de novo 2 NDD (+) Dilated cardiomyopathy,(+) Neurodegeneration,(+) Muscle spasm,(+) Muscular dystrophy,(+) Short stature,(+) Infantile muscular hypotonia,(+) Severe global developmental delay HECTD1 ENST00000399332:c.7789C>T p.Arg2597Cys AD_denovo 8.04 het de novo 1 NDD (+) Generalized hypotonia,(+) Mild global developmental delay SLC5A3 ENST00000381151:c.728del p.Pro243Leufs*6 AD_unknown 7.66 het unknown 1 NDD Intellectual disability, moderate,(+) Focal impaired awareness seizure,(+) Increased body weight,(+) Bilateral tonic-clonic seizure with focal onset,(+) Focal-onset seizure CEP89 ENST00000305768:c.304C>T p.Arg102Trp AR_homo 6.38 homo maternal& paternal 2 NDD+epile psy +) Intellectual disability,(+) Ataxia,(+) Gait disturbance,(+) Bilateral tonic-clonic seizure with focal onset,(+) Focal impaired awareness motor seizure KCNAB1 ENST00000302490:c.1063C>A p.Leu355Ile AD_denovo 7.14 het de novo 1 Fehlbildung (+) Oligohydramnios,(+) Abnormal heart morphology,(+) Morphological central nervous system abnormality,(+) Abnormality of bladder morphology C20orf194 (DNAAF9) ENST00000252032:c.1679-2A>C None ENST00000252032:c.1960_1961del p.Ser654Argfs*64 AR_comphet 8.05 comphet maternal& paternal 1 NDD+epile psy (+) Intellectual disability,(+) Global developmental delay,(+) Periventricular heterotopia,(+) Generalized myoclonic-atonic seizure,(+) Bilateral tonic-clonic seizure with generalized onset,(+) Tonic seizure,(+) Myoclonic seizure ROCK1 ENST00000399799:c.2489+3A>G None AD_unknown 8.04 het unknown 2 (+) Insulin resistance,(+) Obesity,(+) Hypertriglyceridemia,(+) Hypercholesterolemia UBR4 ENST00000375217:c.7720del p.Val2574* AD_unknown 9.9 het unknown 3 NDD +) Nevus flammeus,(+) Hypotonia,(+) Global developmental delay,(+) Abnormality of the voice,(+) Nasal speech,(+) Curly hair,(+) Depressed nasal bridge,(+) Prominent forehead
HMG20B ENST00000262949:c.562G>T p.Gly188* de_novo 7.63 het de novo 1 NDD+other Moderate global developmental delay, Protruding ear, Abnormal morphology of the nasal alae, Behavioral abnormality, Delayed speech and language development, Eczema, Prominent fingertip pads, Generalized hypotonia, Aortic valve stenosis, Inverted nipples, Pulmonary artery stenosis, Sparse lateral eyebrow BPIFC ENST00000300399:c.6T>A p.Cys2* unknown 4.28 het unknown 1 NDD (+) Abnormality of the face,(+) Intellectual disability,(+) Short stature TLX2 ENST00000233638:c.629C>T p.Thr210Ile de_novo 5.17 het de novo 1 focal epilepsy, ADHD GRIN3A ENST00000361820:c.1635C>A p.Asp545Glu de_novo 6.56 het de novo 2 NDD+epile psy seizure, global developmental delay, motor tics, epistaxis, abnormality of von Willebrandt factor TTYH2 ENST00000269346:c.728C>T p.Ala243Val de_novo 4.88 het de novo 2 NDD+epile psy seizure, global developmental delay, motor tics, epistaxis, abnormality of von Willebrandt factor SLC4A8 ENST00000358657:c.1745A>G p.Tyr582Cys unknown 4.45 het unknown Epilepsy, speech delay (+) Delayed speech and language development,(+) Generalized non-motor (absence) seizure,(+) Generalized-onset seizure SBNO1 ENST00000267176:c.1084T>A p.Leu362Ile unknown 4.86 het unknown Epilepsy, speech delay (+) Delayed speech and language development,(+) Generalized non-motor (absence) seizure,(+) Generalized-onset seizure KCNJ3 ENST00000295101:c.863T>C p.Met288Thr ad_inherited 6.63 het unknown 2 NDD (+) Intellectual disability,(+) Severe global developmental delay HECTD2 ENST00000298068:c.1523T>G p.Leu508Arg ad_inherited 4.65 het unknown 2 NDD (+) Intellectual disability,(+) Severe global developmental delay HECW1 ENST00000395891:c.4172T>C p.Leu1391Ser ad_inherited 5.59 het unknown 1 NDD (+) Delayed speech and language development,(+) Intellectual disability, mild,(+) Attention deficit hyperactivity disorde USP31 ENST00000219689:c.1240C>G p.His414Asp de_novo 4.71 het de novo 2 NDD+epile psy ataxia, progressive muscle weakness, slowed slurred speech, focal-onset seizure, mild global developmental delay, hemihypertrophy of lower limb ESYT1 ENST00000394048:c.2986C>T p.Arg996Trp de_novo 5.67 het de novo 1 Epilepsy tonic clonic seizures, eyelid myoclonia, absence seizures RECQL5 ENST00000317905:c.1235G>A p.Arg412His de_novo 6.2 het de novo 2 NDD+epile psy ataxia, progressive muscle weakness, slowed slurred speech, focal-onset seizure, mild global developmental delay, hemihypertrophy of lower limb PROKR1 ENST00000303786:c.731C>T p.Pro244Leu de_novo 4.43 het de novo 1 NDD+epile psy microcephaly, hypothyroidism, generalized-onset seizure, moderate global developmental delay TMF1 ENST00000398559:c.716G>A ENST00000398559:c.2716A>G comphet 4.4 comphet maternal/ paternal 1 NDD+epile psy Macrocephaly, seizure, hypotonia, Dandy-Walker malformation, muscle weakness, distal lower limb amyotrophy, mild global developmental delay CUL5 ENST00000393094:c.194T>C p.Leu65Ser unknown 5.75 het unknown 1 NDD/Spasti k Global developmental delay,(+) Spastic tetraparesis DRC3 ENST00000399182:c.205A>G p.Lys69Glu ENST00000399182:c.605A>G p.Glu202Gly comphet 4.88 comphet maternal/ paternal 2 NDD+epile psy moderate global developmental delay, focal epilepsy, intellectual impairment, autistic features, bilateral spastic cerebral palsy, visual impairment with bilateral optic atrophy, cerebral malformation PLXNB2 ENST000003593377:c.4580C>T p.Ser1527Leu ENST000003593377:c.2875A>G p.Met959Val comphet 5.67 comphet maternal/ paternal 2 NDD+epile psy moderate global developmental delay, focal epilepsy, intellectual impairment, autistic features, bilateral spastic cerebral palsy, visual impairment with bilateral optic atrophy, cerebral malformation HP1BP3 ENST00000312239:c.717_718del p.Lys240Ilefs*7 unknown 7.14 het unknown 1 NDD (+) Hypotonia,(+) Mild global developmental delay,(+) Abnormal myelination JRKL ENST00000332349:c.788G>A p.Arg263Gln de_novo 4.23 het de novo 1 NDD tall stature, macrocephaly, global developmental delay, sleep disturbance, obesity, autistic behavior FAM222A ENST00000538780:c.1231del p.Tyr411Ilefs*80 de_novo 7.81 het de novo 3 NDD hypotonia, abnormality of acid-base homeostasis, mild global developmental delay, feeding difficulties, vitamin B12 deficiency PSMD10 ENST00000217958:c.623C>A p.Pro208His de_novo 6.51 het de novo 3 NDD hypotonia, abnormality of acid-base homeostasis, mild global developmental delay, feeding difficulties, vitamin B12 deficiency PFAS ENST00000314666:c.1981G>A p.Val661Met, c.3072G>T p.Glu1024Asp AR_comphet 5.6 comphet maternal/ paternal 3 NDD hypotonia, abnormality of acid-base homeostasis, mild global developmental delay, feeding difficulties, vitamin B12 deficiency EPHA8 ENST00000166244:c.2388G>A p.Thr796= homo 9.13 homo maternal& paternal 3 NDD (+) Microcephaly,(+) Aggressive behavior,(+) Spasticity,(+) Intellectual disability, severe,(+) Crohn's disease,(+) Self-injurious behavior ADGRB2 NM_001703.2:c.4572+1G>A p.(?) Bhet unknown NDD (+) Personality changes,(+) Asthma,(+) Tetraparesis,(+) Sleep disturbance,(+) Falls,(+) Metachromatic leukodystrophy variant,(+) Poor fine motor coordination,(+) Chronic pain,(+) Short term memory impairment,(+) Erectile dysfunction
DIP2A ENST00000417564:c.1612C>T p.Arg538Trp ENST00000417564:c.1894A>G p.Met632Val comphet 5.74 comphet maternal/ paternal 2 NDD+epile psy bilateral tonic-clonic seizures, focal epilepsy, severe GDD, severe ID, bilateral spastic cerebral palsy, muscular hypotonia, microcephaly, short stature, dystrophia, coloboma, multiple malformations, anophthalmia, microphthalmia, Aicardi syndrome FRYL ENST00000358350:c.2021C>T p.Pro674Leu de_novo 6.74 het de novo 3 NDD (+) Autism,(+) Attention deficit hyperactivity disorder,(+) severe global developmental delay GCN1 ENST00000300648:c.689A>T p.Asn230Ile ENST00000300648:c.2044G>A p.Val682Met comphet 4.22 comphet maternal/ paternal 2 NDD moderate global developmental delay, intellectual disability, obesity AKAP13 ENST00000361243:c.3689T>C p.Leu1230Pro ENST00000361243:c.8030A>G p.Gln2677Arg comphet 4.36 comphet maternal/ paternal 2 NDD moderate global developmental delay, intellectual disability, obesity FIZ1 ENST00000221665:c.665A>C p.His222Pro de_novo Bhet de novo 2 other recurrent neuroinflammation, partial albinism, recurrent petechiae, optic atrophy, mild hypogammaglobulinemia PRR14L ENST00000327423:c.4908A>C p.Arg1636Ser de_novo Bhet de novo 2 other recurrent neuroinflammation, partial albinism, recurrent petechiae, optic atrophy, mild hypogammaglobulinemia CHST2 ENST00000309575:c.1124A>G p.Lys375Arg de_novo 5.11 het de novo 2 NDD mild intellectual disability, global developmental delay PLCB1 ENST00000338037:c.3298C>T p.Arg1100Trp de_novo 10.0 het de novo 2 NDD mild intellectual disability, global developmental delay RGPD2 ENST00000327544:c.2066_2070del p.Lys689Argfs*8 unknown 5.43 het unknown 1 NDD+epile psy Epilepsy with spasms, tonic seizure, complex seizure, GTKA, intellectual disability, ataxia KIF13A ENST00000259711:c.46A>C p.Asn16His de_novo 6.54 het de novo 2 NDD+other Microcephaly, Global developmental delay, Failure to thrive, constipation, infantile muscular hypotonia HEATR6 ENST00000184956:c.1311del p.Val438Phefs*24, c.3320T>C p.Leu1107Pro comphet 5.03 comphet maternal/ paternal 2 NDD+other Microcephaly, Global developmental delay, Failure to thrive, constipation, infantile muscular hypotonia ATRNL1 ENST00000355044:c.402del p.Arg134Serfs*26 unknown 7het unknown 2 NDD+Myop athy+Autist ic behavious (+) Atypical behavior,(+) Delayed speech and language development,(+) Enuresis,(+) Intellectual disability,(+) Hypotonia,(+) Motor delay,(+) Myopathy,(+) Peripheral neuropathy,(+) Severe global developmental delay PRMT9 ENST00000322396:c.734_735del p.Ile245Thrfs*41, c.792A>C p.Glu264Asp comphet 5.55 comphet paternal/ maternal 1 NDD Global developmental delay, hypotonia, plagiocephaly, hearing impairment, cow milk allergy INSYN1 ENST00000559817:c.182T>C de_novo 4.37 het de novo 1 NDD+other Leukoencephalopathy, developmental regression, moderate global developmental delay CASKIN2 ENST00000321617:c.3061_3068dup p.Ser1024Hisfs*99 unknown 7.03 het unknown 2 NDD (+) Obesity,(+) Intellectual disability, moderate,(+) Focal-onset seizure PLXNA4 ENST00000321063:c.5057G>A p.Gly1686Asp unknown 5.83 het unknown 2 NDD (+) Obesity,(+) Intellectual disability, moderate,(+) Focal-onset seizure LRFN1 ENST00000248668:c.1520C>A p.Thr507Lys unknown 4.74 het unknown 1 Epilespy (+) Bilateral tonic-clonic seizure with focal onset,(+) Focal-onset seizure PLXNA1 ENST00000393409:c.2225A>G p.Tyr742Cys unknown 5.27 het unknown 1 NDD+other Crohn's disease, Developmental delay, Intellectual disability, borderline, Feeding difficulties, Behavioral abnormality, Abnormal fear/anxiety-related behavior, Depression TMEM104 ENST00000335464:c.983G>T de_novo 4.54 het de novo 1 Epilepsy Generalized myoclonic-atonic seizure SPACA9 ENST00000350499:c.495+1G>A AR_homo 8.14 homo maternal/ paternal 3 NDD autism, moderate global developmental delay BCO2 ENST00000357685:c.709A>C p.Asn237His, comphet 3.69 comphet maternal/ paternal 3 NDD autism, moderate global developmental delay TSPYL2 ENST00000375442:c.815A>G p.Asn272Ser XL 4.91 hemi maternal 3 NDD autism, moderate global developmental delay DPYSL3 ENST00000343218:c.477del p.Ile159Metfs*5 unknown 8.45 het unknown 2 NDD (+) Microcephaly,(+) Short stature,(+) Mild global developmental delay KCNH4 ENST00000264661:c.908A>T p.His303Leu unknown 4.18 het unknown 2 NDD (+) Microcephaly,(+) Short stature,(+) Mild global developmental delay SYVN1 ENST00000294256:c.883C>T p.Arg295* unknown 6.74 het unknown Epilepsy (+) Generalized-onset seizure,(+) Continuous spike and waves during slow sleep CSTF3 ENST00000323959:c.203G>T p.Trp68Leu unknown 5het unknown Epilepsy (+) Generalized-onset seizure,(+) Continuous spike and waves during slow sleep GRN ENST00000053867:c.-9_-8+16dup None de_novo 8.03 het de novo 2 NDD+epile psy bilateral tonic-clonic seizures, focal epilepsy, severe global developmental delay, severe intellectual disability, bilateral spastic cerebral palsy, muscular hypotonia, microcephaly, short stature, dystrophia, iris and retinal coloboma, multiple malformations, dysphagia, anophthalmia, microphthalmia, Aicardi syndrome
JADE2 ENST00000282605:c.83C>G p.Ser28* de_novo 8.22 het de novo 1 NDD autism, severe global developmental delay RPS5 ENST00000196551:c.380G>A p.Arg127His de_novo 7.4 het de novo 1 NDD+epile psy Lennox-Gastaut-syndrome, moderate intellectual disability, autistic features, possible microcephaly, cerebellar atrophy, reflux oesophagitis, fT3/ fT4/ TSH in reference range, severe sensorimotor axonal and demyelinating polyneuropathy TRPC3 ENST00000264811:c.1694C>T p.Pro565Leu de_novo 8.43 het de novo 3 NDD + epilepsy (+) Strabismus,(+) Delayed speech and language development,(+) Global developmental delay,(+) Motor delay,(+) Gait ataxia,(+) Generalized-onset seizure,(+) Recurrent respiratory infections,(+) Secondary microcephaly,(+) Intracranial cystic lesion,(+) Complex febrile seizure,(+) Neonatal seizure,(+) Abnormality of movement ESRRG ENST00000408911:.550C>T p.Arg184Cys de_novo 7.08 het de novo 1 NDD+other Prolonged neonatal jaundice, Moderate global developmental delay, Upgaze palsy, Joint hyperflexibility, Growth delay, Ataxia, Hypotonia, Dysarthria, Atypical behavior RBM26 ENST00000267229:c.899dup p.Cys303Leufs*10 unknown 7.16 het paternal 3 NDD (+) High forehead,(+) Autism,(+) Delayed speech and language development,(+) Hyperactivity,(+) Pectus excavatum,(+) Global developmental delay,(+) Abnormal renal morphology,(+) Supravalvar pulmonary stenosis,(+) Self-injurious behavior PUM2 ENST00000319801:c.1534C>T p.Gln512* unknown 8.53 het maternal 3 NDD (+) High forehead,(+) Autism,(+) Delayed speech and language development,(+) Hyperactivity,(+) Pectus excavatum,(+) Global developmental delay,(+) Abnormal renal morphology,(+) Supravalvar pulmonary stenosis,(+) Self-injurious behavior LRRC1 ENST00000370882:c.206A>G p.Asn69Ser de_novo 5.56 het de novo 2 Epilepsy (+) Anxiety,(+) Seizure,(+) Attention deficit hyperactivity disorder,(+) Focal-onset seizure,(+) Panic attack,(+) Abnormal fear/anxiety-related behavior ADAMTS14 ENST00000373208:c.870+1G>A ENST00000373208:c.2106G>A comphet 4.39 homo maternal/ paternal 1 NDD+other microcephaly, hip dysplasia, short stature, attention deficit hyperactivity disorder, receptive language delay, growth delay, mild global developmental delay. CPO ENST00000272852:c.551G>A p.Arg184Gln ENST00000272852:c.484-365C>G comphet 3.28 comphet paternal/ maternal 3 NDD+Epile psy Hearing impairment, Obesity, Polymicrogyria, Spastic paraparesis, Intellectual disability (borderline), Moderate global developmental delay, Bilateral tonic-clonic seizure with generalized onset UBE2D2 ENST00000253815:c.284C>T p.Ala95Val unknown 5.53 het unknown 2 Epilepsy (+) Seizure,(+) Paroxysmal dyskinesia,(+) Focal-onset seizure IRF2BP1 ENST00000302165:c.1726A>G homo 3.96 homo maternal/ paternal 2 NDD + other Thin vermilion border, microcephaly, high forehead, plagiocephaly, failure to thrive, small for gestational age, expressive language delay, delayed fine motor development, midface retrusion DGCR8 ENST00000351989:c.805G>A homo 8.45 homo maternal/ paternal 2 NDD + other Thin vermilion border, microcephaly, high forehead, plagiocephaly, failure to thrive, small for gestational age, expressive language delay, delayed fine motor development, midface retrusion RASSF6 ENST00000307439:c.683C>T,p.Pro228Leu homo 4.58 homo maternal/ paternal 3 NDD+Epile psy Hearing impairment, Obesity, Polymicrogyria, Spastic paraparesis, Intellectual disability (borderline), Moderate global developmental delay, Bilateral tonic-clonic seizure with generalized onset TRAK1 ENST00000327628:c.2498A>C p.Gln833Pro de_novo 9.18 het de novo 3 NDD+Epile psy Hearing impairment, Obesity, Polymicrogyria, Spastic paraparesis, Intellectual disability (borderline), Moderate global developmental delay, Bilateral tonic-clonic seizure with generalized onset STAM ENST00000377524:c.1073C>G p.Ser358* unknown 8.34 het unknown 1 NDD (+) Narrow nose,(+) Synophrys,(+) Autism,(+) Impaired social interactions,(+) Pes planus,(+) Unsteady gait,(+) Supernumerary nipple NOC4L ENST00000330579:c.910del p.Leu304Serfs*6 ENST00000330579:c.1418T>C p.Leu473Pro comphet 6.08 comphet paternal/ maternal 2 NDD+epile psy neurodevelopmental delay, seizure ARSF ENST00000359361:c.784C>T p.Arg262* XL 5.97 hemi maternal 2 NDD+epile psy neurodevelopmental delay, seizure GRM5 ENST00000418177:c.-201+1G>C comphet 9.04 het paternal/ maternal 1 NDD + other hypotonia, bulbar palsy, respiratory insufficiency, myopathy, elevated circulating creatine kinase concentration, myalgia, fatigable weakness, mild global developmental delay. THBS2 ENST00000366787:c.2095G>A p.Gly699Ser de_novo 5.34 het paternal/ maternal 1 NDD + epilepsy + other seizure, global developmental delay, dilated cardiomyopathy, gastrointestinal hemorrhage, colitis, bilateral renal dysplasia, systemic autoinflammation, middle cerebral artery stroke DOPEY1/DOP1A ENST00000237163:c.2897T>C p.Leu966Pro unknown 5.3 het unknown NDD (+) Delayed speech and language development,(+) Moderate global developmental delay CSTF1 ENST00000217109:c.686G>A p.Gly229Glu unknown 4.4 het unknown Epilepsy (+) Generalized-onset seizure,(+) Focal-onset seizure,(+) Visually-induced seizure DSCAML1 ENST00000321322:c.2373C>A p.Asn791Lys unknown 5.37 het unknown 1 NDD+Epile psy (+) Seizure,(+) Abnormality of neuronal migration,(+) Intellectual disability, moderate,(+) Abnormal periventricular white matter morphology,(+) Typical absence seizure
LPHN3 ENST00000502815:c.772G>A p.Val258Met unknown 6.71 het unknown 1 NDD+Epile psy (+) Generalized-onset seizure,(+) Severe global developmental delay,(+) Infantile spasms CHD9 ENST00000398510:c.6361C>A p.Pro2121Thr de_novo 7.32 het de novo 1 NDD + other mild global developmental delay, short stature, growth hormone deficiency, glucose intolerance, hypoglycaemia, increased intracranial pressure, headache, atypical behaviour, patent ductus arteriosus after birth at term, hyperlordosis, cMRI: heterotopia TRIM71 ENST00000383763:c.2229_2230del p.Trp744Glufs*4 unknown 8.14 het unknown 1 Short stature (+) Hypospadias,(+) Multiple lentigines,(+) Preaxial hand polydactyly,(+) Disproportionate short stature GCN1L1 ENST00000300648:c.6478A>C p.Thr2160Pro unknown 5het unknown 2 NDD (+) Microcephaly,(+) Atypical behavior,(+) Intellectual disability,(+) Spasticity,(+) Global developmental delay,(+) Progressive neurologic deterioration,(+) Periventricular leukomalacia CELSR3 ENST00000164024:c.5791C>G p.Leu1931Val AD_unknown 6.28 het unknown 2 NDD (+) Microcephaly,(+) Atypical behavior,(+) Intellectual disability,(+) Spasticity,(+) Global developmental delay,(+) Progressive neurologic deterioration,(+) Periventricular leukomalacia MBP ENST00000354542:c.177+6378A>G None de_novo Bhet de novo 1 other congenital heart defect, functionally univentricular heart, dilated, non-contractile and non-perfused left ventricle, dysplastic aortic and mitral valves, multiple muscular ventricular septal defects, hypoplastic aortic arch; no other malformations known ANKRD23 ENST00000318357:c.748G>A p.Ala250Thr de_novo 5.34 het de novo 2 NDD + epilepsy + other premature birth at 25+2 weeks of gestational age, microcephaly, bilateral renal dysplasia, retinopathy, multiple hernias, 2-3 toe syndactyly, seizures, motor delay, delayed speech and language developmental, choroid plexus cysts, bronchodysplasia, hypospadias, big ears GABRE ENST00000370328.3:c.1148A>G p.Asn383Ser AD_denovo 4.9 het de novo 2 epilepsy Seizure, abnormality of metabolism, epileptic encephalopathy BCL2L11 ENST00000393256:c.268T>C p.Ser90Pro de_novo 6.11 het de novo 2 NDD + epilepsy + other premature birth at 25+2 weeks of gestational age, microcephaly, bilateral renal dysplasia, retinopathy, multiple hernias, 2-3 toe syndactyly, seizures, motor delay, delayed speech and language developmental, choroid plexus cysts, bronchodysplasia, hypospadias, big ears CRMP1 ENST00000324989:c.1234G>T p.Ala412Ser unknown 6.09 het unknown 1 NDD (+) Intellectual disability, moderate,(+) Short stature BIRC6 ENST00000421745:c.2213C>A p.Pro738His unknown 5.28 het unknown 2 NDD (+) Delayed speech and language development,(+) Mild global developmental delay TLN1 ENST00000314888:c.5672G>C p.Ser1891Thr unknown 5.06 het unknown 2 NDD (+) Delayed speech and language development,(+) Mild global developmental delay PNMA6F ENST00000436629 XL 3.34 het maternal 1 NDD Microcephaly, Syndactyly, Intellectual disability, Dandy-Walker malformation, Hip dysplasia, Polymicrogyria, Partial duplication of thumb phalanx, Severe intellectual disability, Epileptic spasm, Abnormal brain morphology UBE4B ENST00000253251:c.1885T>C p.Phe629Leu AD_unknown 5.69 het unknown 2 NDD + epilepsy + other (+) Autistic behavior,(+) Seizure,(+) Global developmental delay,(+) Hypoglycemia,(+) Hyponatremia,(+) Inappropriate antidiuretic hormone secretion ATRNL1 ENST00000355044:c.402del p.Arg134Serfs*26 unknown 7het unknown 1 NDD (+) Atypical behavior,(+) Developmental regression,(+) Aplasia/Hypoplasia of the corpus callosum,(+) Severe global developmental delay BAIAP2 ENST00000321280:c.1019C>T p.Thr340Ile de_novo 8.23 het de novo 1 NDD+ Epilepsy mild global developmental delay, generalized clonic seizure, EEG with spike-wave complexes DHX15 ENST00000336812:c.1277C>T p.Thr426Met unknown 5.68 het unknown 2 (+) Macrocephaly,(+) Global developmental delay,(+) Short stature USP3 ENST00000268049:c.615_616del p.Ala206Phefs*10 unknown 6.63 het unknown 2 (+) Macrocephaly,(+) Global developmental delay,(+) Short stature GALNT8 ENST00000252318:c.1431T>G p.Phe477Leu de_novo 4.49 het de novo 2 NDD + epilepsy Seizure, moderate global developmental delay, ataxia, dystonia, moderate intellectual disability, atypical behavior ADCY8 ENST00000286355:c.3523C>T p.Gln1175* de_novo 8.03 het de novo 2 NDD + epilepsy Seizure, moderate global developmental delay, ataxia, dystonia, moderate intellectual disability, atypical behavior FAM65A ENST00000042381:c.1855dup p.Ser619Phefs*84 unknown 6.97 het unknown 1 NDD + epilepsy (+) Atypical behavior,(+) Global developmental delay,(+) Expressive language delay,(+) Focal-onset seizure,(+) Abnormal eye contact PARP6 ENST00000260376:c.631dup p.Arg211Profs*74 unknown 6.54 het unknown 1 epilepsy (+) Bilateral tonic-clonic seizure with focal onset,(+) Focal-onset seizure,(+) Motor seizure JADE1 ENST00000226319:c.1546A>T p.Lys516* unknown 6.5 het unknown 1 NDD (+) Orofacial cleft,(+) Global developmental delay,(+) Metopic synostosis RANBP2 ENST00000283195:c.1684_1685del p.Leu562Lysfs*28 unknown 9.9 het unknown 1 Optic atrophy optic atrophy, myopia, ADHD, fine motor delay MAOB ENST00000378069:c.857T>G p.Ile286Ser homo 8.81 homo paternal/ maternal 3 NDD + epilepsy (-) Abnormality of the face,(+) Focal-onset seizure,(+) Moderate global developmental delay TRPC5 ENST00000262839:c.778C>G p.Arg260Gly x_linked 7.09 hemi maternal 1 NDD + other microcephaly, ataxia, cerebellar vermis hypoplasia, short stature, unilateral renal atrophy, mild global developmental delay
ASCC3 ENST00000369162:c.1597-2A>G None ENST00000369162:c.5996T>C p.Leu1999Pro comphet 7.22 comphet unknown 1 NDD (+) High palate,(+) Retrognathia,(+) Low-set ears,(+) Nystagmus,(+) Hypotonia,(+) Muscle weakness,(+) Talipes equinovarus,(+) Arthrogryposis-like hand anomaly,(+) Moderate global developmental delay SYMPK ENST00000245934:c.3027C>A p.Tyr1009* unknown 6.94 unknown 1 NDD (+) Glandular hypospadias,(+) Global developmental delay,(+) Umbilical hernia CEP170 ENST00000336415:c.4603G>T p.Glu1535* unknown 7.85 unknown 1 NDD (+) Glandular hypospadias,(+) Global developmental delay,(+) Umbilical hernia SCRIB ENST00000356994:c.1866C>T ENST00000356994:c.787+6T>C AR_comphet 7.51 comphet maternal& paternal 1 NDD+epile psy Microcephaly, focal-onset seizure, moderate global developmental delay GABRD ENST00000378585:c.1336T>C p.Tyr446His unknown 8.4 het unknown 1 NDD (+) High palate,(+) Brachycephaly,(+) Microcephaly,(+) Pointed chin,(+) Triangular face,(+) Low-set ears,(+) Hypotonia,(+) Failure to thrive,(+) Patent foramen ovale,(+) Iron deficiency anemia,(+) Moderate global developmental delay,(+) Feeding difficulties,(+) Tube feeding KALRN ENST00000291478:c.910C>T p.Gln304* unknown 9.49 het unknown 4 NDD (+) Intellectual disability,(+) Hip dysplasia,(+) Bilateral talipes equinovarus,(+) Mild global developmental delay,(+) Overweight,(+) Psychogenic non-epileptic seizure,(+) Reduced impulse control MAPK3 ENST00000263025:c.776-1G>A None unknown 10.0 het unknown 1 epilepsy (+) Focal-onset seizure,(+) Focal-onset epileptic spasm WIZ ENST00000389282:c.247dup p.Gln83Profs*10 unknown 7.05 het unknown 1 NDD +Autism (+) Autistic behavior,(+) Impaired social interactions,(+) Delayed speech and language development,(+) Intellectual disability, mild IKZF4 ENST00000262032:c.1487_1488del p.Lys496Argfs*29 unknown 6.04 het unknown 1 NDD + spastic tetraparesi (+) Seizure,(+) Spastic tetraparesis,(+) Severe global developmental delay,(+) Abnormal lateral ventricle morphology POLR2B ENST00000314595:c.1404+250A>G None unknown 3.06 het unknown 1 NDD + other mild global developmental delay, agenesis of corpus callosum, longitudinal callosal fasci-cles NXPH1 ENST00000405863:c.54+38925G>A None de_novo 5.5 het de novo 2 NDD + other small fiber neuropathy, ID, IQ 55, cerebral palsy, small intestinal perforation H4C6 ENST00000244537:c.3G>A p.Met1? ENST00000244537:c.195dup p.Val66CysfsTer15 AR_comphet 7.74 comphet maternal/ paternal 2 NDD + other small fiber neuropathy, ID, IQ 55, cerebral palsy, small intestinal perforation CRISPLD2 ENST00000262424:c.289T>C p.Cys97Arg de_novo 4.77 het de novo 2 NDD+epile psy Seizure, Global developmental delay, Atonic seizure, Generalized myoclonic-atonic seizure, Epileptic encephalopathy XRCC5 ENST00000392132:c.1113+141A>G de_novo 5.45 het de novo 2 NDD+epile psy Seizure, Global developmental delay, Atonic seizure, Generalized myoclonic-atonic seizure, Epileptic encephalopathy SIPA1L1 ENST00000358550:c.2428C>T p.Gln810Ter unknown 7.66 het unkown 1 NDD+epile psy (+) Microcephaly,(+) Hypotonia,(+) Spasticity,(+) Focal-onset seizure,(+) Severe global developmental delay,(+) Perisylvian polymicrogyria UBE4B ENST00000343090:c.979C>T p.Leu327Phe comphet 6.44 comphet paternal/d e novo 1 NDD (+) Cyanosis,(+) Seizure,(+) Global developmental delay,(+) Generalized hypotonia ADCY2 ENST00000338316:c.1026C>A p.Tyr342Ter unknown 7.97 het unkown 1 Epilepsy (+) Focal-onset seizure,(+) Focal sensory seizure SUGP1 ENST00000247001:c.1911+5G>T ENST00000247001:c.698A>G p.Tyr233Cys AR_comphet 7.57 comphet paternal/ maternal 1 NDD+epile psy High palate, Thin upper lip vermilion, Retrognathia, Broad philtrum, Posteriorly rotated ears, Delayed speech and language development, Intellectual disability, Febrile seizure (within the age range of 3 months to 6 years), Moderate global developmental delay, Finger clinodactyly CADPS ENST00000283269:c.969+4836A>G de_novo 6.43 het de novo 1 NDD+epile psy Intellectual disability, seizure, aphasia, restless legs WDR7 ENST00000254442:c.3451C>T p.Arg1151Ter unknown 6.41 het unknown 2 NDD+epile psy (+) Seizure,(+) Mild global developmental delay TERF2 ENST00000254942:c.1341-1G>C None unknown 8.21 het unknown 2 NDD+epile psy (+) Seizure,(+) Mild global developmental delay CSMD2 ENST00000373388:c.1111G>A p.Glu371Lys ENST00000373388:c.10310G>C p.Arg3437Thr AR_comphet 5.34 comphet paternal/ maternal 2 NDD+epile psy autism, global developmental delay, generalized-onset seizure, focal-onset seizure WDR13 ENST00000218056:c.1017G>C p.Lys339Asn XL 4.7 hemi maternal 2 NDD+epile psy autism, global developmental delay, generalized-onset seizure, focal-onset seizure
IGSF9B ENST00000321016:c.2549T>C p.Ile850Thr unknown 5.1 het unknown 1 Epilepsy (+) Seizure,(+) Specific learning disability,(+) Focal-onset seizure,(+) Mild global developmental delay CSNK1D ENST00000314028:c.581A>G p.Asp194Gly de_novo 8.71 het de novo 1 NDD + Epilepsy + other generalized-onset seizure, febrile seizure, frontotemporal cerebral atrophy, subdural hemorrhage, muscular hypotonia, mild global developmental delay, plagiocephaly SAP130 ENST00000259234:c.2134C>T p.Gln712Ter unknown 6.93 het unknown 2 NDD (+) Pancreatitis,(+) Eosinophilia,(+) Short stature,(+) Mild global developmental delay,(+) Esophagitis,(+) Food allergy SMAP1 ENST00000316999:c.52C>T p.Gln18Ter unknown 5.87 het unknown 2 NDD (+) Pancreatitis,(+) Eosinophilia,(+) Short stature,(+) Mild global developmental delay,(+) Esophagitis,(+) Food allergy YME1L1 ENST00000326799:c.955C>T p.Arg319Trp unknown 6.77 het unknown NDD (+) Hemangioma,(+) Abnormal cerebral cortex morphology,(+) Bilateral tonic-clonic seizure with focal onset,(+) Focal-onset seizure,(+) Mild global developmental delay,(+) Abnormality of brain morphology,(+) Perisylvian polymicrogyria,(+) Nevus sebaceus FBXO41 ENST00000295133:c.670G>T p.Glu224Ter unknown 8.41 het unkown Focal-onset seizure SLC4A8 ENST00000358657:c.1157del p.Gly386ValfsTer70 unknown 6.99 het unkown 1 NDD+ other (+) Hearing impairment,(+) Delayed speech and language development,(+) Motor delay,(+) Severe global developmental delay NAV3 ENST00000397909:c.6782G>A p.Trp2261Ter unknown 6.82 het unkown 3 NDD (+) Microcephaly,(+) Delayed speech and language development,(+) Moderate global developmental delay NCOR1 ENST00000268712:c.1279C>G p.Pro427Ala de_novo 8.27 het de novo 1 NDD + other myopia, behavioural abnormality, compulsive behaviour, pectus excavatum, ataxia, moderate intellectual disability, patellar dislocation FBH1 ENST00000362091:c.2474T>C p.Val825Ala de_novo B het de novo 1 other Fallot-Tetralogy, Ptosis, Anosmia CSMD1 ENST00000335551:c.2084T>C p.Leu695Pro de_novo 7.47 het de novo 3 NDD+epile psy Intellectual disability, Seizure, Global developmental delay, Generalized hypotonia, Bilateral tonic-clonic seizure, Neurodevelopmental delay, Epileptic encephalopathy, Intellectual disability, severe, Myoclonic absence seizure, Interictal epileptiform activity, EMG: myotonic discharges DPY19L4 ENST00000414645:c.1870C>T p.Arg624Ter ENST00000414645:c.1256C>T p.Ser419Phe AR_comphet 4.17 comphet paternal/ maternal 3 NDD+epile psy Intellectual disability, Seizure, Global developmental delay, Generalized hypotonia, Bilateral tonic-clonic seizure, Neurodevelopmental delay, Epileptic encephalopathy, Intellectual disability, severe, Myoclonic absence seizure, Interictal epileptiform activity, EMG: myotonic discharges MFAP1 ENST00000267812:c.88T>C p.Ser30Pro de_novo 6.45 het de novo 3 NDD+epile psy Intellectual disability, Seizure, Global developmental delay, Generalized hypotonia, Bilateral tonic-clonic seizure, Neurodevelopmental delay, Epileptic encephalopathy, Intellectual disability, severe, Myoclonic absence seizure, Interictal epileptiform activity, EMG: myotonic discharges ARHGAP23 ENST00000616767:c.1384C>T de_novo 5.35 het de novo 2 Epilepsy Generalized non-motor (absence) seizure GRM4 ENST00000374177:c.1302C>G p.Tyr434Ter unknown 8.34 het unkown 1 Epilepsy (+) Focal-onset seizure,(+) Focal cortical dysplasia type I ERG ENST00000288319:c.1338del p.Phe446LeufsTer59 de_novo 9.9 het de novo 1 NDD hypotonia, muscle weakness, progressive spastic paraplegia, pes cavus ARHGEF7 ENST00000218789:c.973C>T p.Leu325Phe unknown 6.58 het unknown NDD+Epile psy (+) Psychotic episodes,(+) Intellectual disability,(+) Focal-onset seizure,(+) Focal polymicrogyria,(+) Schizophrenia HDLBP ENST00000310931:c.1981C>A p.Pro661Thr unknown 6.23 het unknown NDD+ Adipositas (+) Abnormality of the face,(+) Abnormal repetitive mannerisms,(+) Intellectual disability,(+) Global developmental delay,(+) Overweight SUMO1 ENST00000392244:c.90+1G>A None unknown 8.07 het unknown NDD (+) Global developmental delay,(+) Neurodevelopmental delay,(+) Cognitive impairment PCSK5 ENST00000424854:c.3819C>A p.Cys1273Ter homo 9.06 homo unknown 1 NDD (+) Abnormality of the face,(+) Autism,(+) Sleep disturbance,(+) Supraventricular tachycardia,(+) Severe global developmental delay PUM2 ENST00000338086:c.3067C>G p.Arg1023Gly unknown 6.37 het unknown DLD (+) Tall stature,(+) Abnormal repetitive mannerisms,(+) Delayed speech and language development,(+) Overgrowth,(+) Moderate global developmental delay EP400 ENST00000389561:c.5512del p.Gln1838SerfsTer17 unknown 8.34 het maternal 1 NDD+Epile psy (+) Microcephaly,(+) Generalized non-motor (absence) seizure,(+) Intellectual disability, borderline,(+) Mild global developmental delay RNF157 ENST00000269391:c.721-1G>A homo 8.42 homo paternal/ maternal 1 NDD Macrocephaly, autistic behavior, absent speech, moderate global developmental delay PLXNA3 ENST00000369682:c.4372G>A p.Glu1458Lys XL 6.37 hemi maternal 1 NDD + epilepsy Microcephaly, absent speech, EEG abnormality, intellectual disability severe, severe global developmental delay, bilateral tonic-clonic seizure with generalized onset, arm dystonia PHACTR1 ENST00000332995:c.497-1G>C None unknown 8.23 het unknown 1 Epilepsy (+) Hypotonia,(+) Abnormal cerebral morphology,(+) Focal-onset seizure EPHB1 ENST00000398015:c.2570T>C p.Met857Thr de_novo 7.77 het de novo 2 NDD + epilepsy drug-resistant generalized-onset seizure, mild global developmental delay CELF2 ENST00000354897:c.604_624dup p.Ala202_Leu208dup ad_inherited 4.93 het maternal 1 NDD + epilepsy + other moderate global developmental delay, intellectual disability, autistic behaviour, peripheral axonal neuropathy, focal-onset seizure since age of 6
[Document text truncated for crawler view.]