scieee AI-readable full text Open interactive document viewer

Molecular and morphological insights into Phaeoceros himalayensis (Notothyladaceae) and related species: evidence for two new species from Thailand

Suwanmala, Orawanya; Villarreal A., Juan Carlos; Chantanaorrapint, Sahut

Abstract

The hornwort genus Phaeoceros is morphologically diverse, particularly in sporophyte and spore characters. Among its members, P. himalayensis and P. kashyapii, two previously known species from the Himalayan region, are distinct in their stalked tuber thalli, dark brown sporophytes with valves apically adherent at maturity, and vermiculate spores with or without hump-like projections or verrucae on the distal face. In this study, we combine detailed morphological and molecular evidence to investigate species boundaries within the group of species possessing these traits, comprising P. himalayensis, P. kashyapii, and related taxa. Within Phaeoceros, two fully supported clades were recovered, here recognized as subgenus Phaeoceros and subgenus Himalayanus, subgen. nov. Molecular and morphological data also support the recognition of two new species, P. aequatus and P. stenothallus, both from northern Thailand. The new species are distinguished by unique spore ornamentation together with the production of tubers. These findings support the ancient evolutionary divergence of the Himalayan Phaeoceros lineage and underscore the taxonomic significance of spore features and tuber formation. This study adds valuable information to our knowledge of hornwort diversity and evolution, providing a foundation for future systematic and evolutionary studies.

Full text

1 Molecular and morphological insights into Phaeoceros himalayensis (Notothyladaceae) and related species: evidence for two new species from Thailand Orawanya Suwanmala1, Juan Carlos Villarreal A.2, Sahut Chantanaorrapint1 1 PSU Herbarium, Division of Biological Science, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla 90110, Thailand 2 Département de Biologie, Pavillon C.-E. Marchand Université Laval, Québec, Canada Corresponding author: Sahut Chantanaorrapint ([email protected]) Copyright: This is an open access article distributed under the terms of the CC0 Public Domain Dedication. Research Article Abstract The hornwort genus Phaeoceros is morphologically diverse, particularly in sporophyte and spore characters. Among its members, P. himalayensis and P. kashyapii, two previously known species from the Himalayan region, are distinct in their stalked tuber thalli, dark brown sporophytes with valves apically adherent at maturity, and vermiculate spores with or without hump-like projections or verrucae on the distal face. In this study, we combine detailed morphological and molecular evidence to investigate species boundaries within the group of species possessing these traits, comprising P. himalayensis, P. kashyapii, and related taxa. Within Phaeoceros, two fully supported clades were recovered, here recognized as subgenus Phaeoceros and subgenus Himalayanus, subgen. nov. Molecular and morphological data also support the recognition of two new species, P. aequatus and P. stenothallus, both from northern Thailand. The new species are distinguished by unique spore ornamentation together with the production of tubers. These findings support the ancient evolutionary divergence of the Himalayan Phaeoceros lineage and underscore the taxonomic significance of spore features and tuber formation. This study adds valuable information to our knowledge of hornwort diversity and evolution, providing a foundation for future systematic and evolutionary studies. Key words: Anthocerotophyta, conservation status, Himalayan region, hornworts, spore ornamentation, sporophytes, tubers Introduction The genus Phaeoceros Prosk. (Notothyladaceae, Anthocerotophyta) is a cosmopolitan group of hornworts that is defined by the absence of internal schizogenous cavities in the thallus, a single chloroplast per cell, the presence of a pyrenoid, antheridia with a non-tiered jacket cell arrangement, the presence of stoma along the sporophyte, and yellow to brownish spores when completely mature (Proskauer 1951; Renzaglia et al. 2009; Villarreal et al. 2010; Suwanmala et al. 2024). The genus represents the largest genus in the family Notothyladaceae, containing some 34 accepted species (Söderström et al. 2016). Of these, P. himalayensis (Kashyap) Prosk. and P. kashyapii A.K. Asthana & S.C. Srivast. are particularly interesting among the species in this genus, as they Academic editor: Matthew Renner Received: 23 September 2025 Accepted: 24 November 2025 Published: 15 December 2025 Citation: Suwanmala O, Villarreal A. JC, Chantanaorrapint S (2025) Molecular and morphological insights into Phaeoceros himalayensis (Notothyladaceae) and related species: evidence for two new species from Thailand. PhytoKeys 268: 1–32. https://doi.org/10.3897/ phytokeys.268.172910 PhytoKeys 268: 1–32 (2025) DOI: 10.3897/phytokeys.268.172910 2 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis have restricted distribution in the Himalayan region and exhibit distinct morphological traits (Asthana and Srivastava 1991; Asthana et al. 2005). The gametophytes of these two species produce long-stalked tubers, and their sporophyte structures differ from those of other Phaeoceros species by having yellowish brown to dark brown sporophytes with an adherent tip upon dehiscence and yellowish brown to dark brown mature spores and pseudoelaters. The spores also have irregular verrucae on the distal face. Based on recent molecular studies (Suwanmala et al. 2024; Peñaloza-Bojacá et al. 2025), P. himalayensis and P. kashyapii are closely related and separated from the major group of Phaeoceros. During the study of Phaeoceros in Asia, several morphologically variable populations were discovered that share key gametophytic and sporophytic characters with P. himalayensis and P. kashyapii, especially their yellowish brown to dark brown sporophytes and adherent sporophyte valves at maturity. The thalli frequently produce the long-stalked tubers. Such morphological variations can lead to misunderstandings of species delimitation. However, differences in spore ornamentation can distinguish these populations and serve as key features for species delimitation, although sometimes it is challenging to ascertain details of spore ornamentation at magnifications available using light microscopy. Additionally, maturity of spores can influence ornamentation patterns, which must be considered during identification. Some recent collections from northern Thailand revealed populations with a novel spore type characterized by rounded spores without protuberances on the distal face, suggesting previously unreported morphological diversity within the genus. Furthermore, some populations exhibited a Phymatoceros-like appearance, particularly in gametophytic characters, raising further questions about the boundaries and morphological plasticity within the genus Phaeoceros. Therefore, the aim of this study is to establish a molecular phylogenetic framework to investigate species boundaries within P. himalayensis and its related species and to clarify their taxonomic status through an integrative approach combining morphological and molecular evidence. Here, we also describe two new species of hornwort from Thailand based on morphological and molecular evidence. Materials and methods Taxon sampling and morphological investigation This study is based on recent collections from Thailand as well as herbarium specimens housed in LWG, LWU, QFA, and PSU herbaria. Forty samples of Phaeoceros spp. were included in our molecular dataset. Notothylas breutelii (Gottsche) Gottsche, N. javanica (Sande Lac.) Gottsche, N. levieri Schiffn. ex Steph., N. orbicularis (Schwein.) Sull., Notothylas sp., Paraphymatoceros diadematus Hässel, and Paraphymatoceros sp. were selected as outgroup taxa. In total, 47 accessions were sampled for phylogenetic analysis, including ten newly generated from recent collections, GenBank sequences retrieved from Suwanmala et al. (2024), and 18 samples from a previously published dataset. The latter were generated using a target enrichment probe technique and published by Breinholt et al. (2021), Bechteler et al. (2023), and Peñaloza-Bojacá et al. (2025). These sequences are available on Dryad (https://doi.org/10.5061/dryad.7pvmcvdqg; Breinholt et al. 2021; https://doi. 3 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis org/10.5061/dryad.3j9kd51qm; Bechteler et al. 2023) and GitHub (https:// github.com/gpenalozabojaca/Hornwort-diversification-.git; Peñaloza-Bojacá et al. 2025). Voucher specimen details, the GenBank accession numbers of newly generated DNA, and the published sequences together with their original sources are provided in Suppl. material 1 (Suppl. material 1: table S1). Morphological and anatomical characters of P. himalayensis and related species were studied using stereoand compound microscopes. Morphological measurements were taken from fresh collections upon receipt, while herbarium specimens required rehydration before measurement and dissection. Plants were photographed using an Olympus BX51 microscope equipped with a DP74 digital camera and illustrated with the aid of an Olympus drawing tube. In addition, mature sporophytes were selected and air-dried before dissection and deposition of their spores on double-sided adhesive tape attached to aluminum stubs. The stubs with mature spores were coated with a thin layer of gold and examined under an FEI Quanta 400 scanning electron microscope operating at 20 kV. The preliminary conservation status was evaluated based on the International Union for Conservation of Nature (IUCN) Red List criteria (IUCN 2024), using GeoCAT (Bachman et al. 2011) to calculate the area of occupancy (AOO) and extent of occurrence (EOO). DNA extraction, amplification, and sequencing Total genomic DNA of silica gel-dried sporophytes was extracted using the E.Z.N.A. Plant DNA kit (Omega Bio-Tek, USA) following the manufacturer’s protocols. We used four molecular markers, comprising one chloroplast marker (rbcL) and three hornwort-specific low-copy nuclear markers (L138, L178, and L315) as described in Suwanmala et al. (2024) (Table 1). PCR protocols are listed in Table 2. Table 1. Primer sequences used for PCR amplification and sequencing. Region Sequence 5’-3’ Reference rbcL rbcL2_16F GAGACTAAAGCAGGTGTTGGA Duff et al. (2004) rbcL_976R ACACGAAAGTGAATACCATG Duff et al. (2004) L138 Phaeoceros_L138_58F TTGTCCTGAATTCACGTG GT Suwanmala et al. (2024) Phaeoceros_L138_607R GCTTTGCTAGGGTCTGGTAAG A Suwanmala et al. (2024) L178 Phaeoceros_L178_232F CTCGGGGATGAGCGGGAC Suwanmala et al. (2024) Phaeoceros_L178_1088R GCTTCAAGAGATGGCTCCTT Suwanmala et al. (2024) L315 Phaeoceros_L315_676F GGATTTTGGGGACTTGCACA Suwanmala et al. (2024) Phaeoceros_L315_1325R CTTCTGCCCAACAACAGGAG Suwanmala et al. (2024) Table 2. PCR conditions for each of the primer sets. Primer PCR conditions rbcL, L138, and L315 94 °C for 3 min; 94 °C for 1 min; 55 °C for 30 s, 72 °C for 1 min (35 cycles from 94 °C for 1 min); 72 °C for 10 min. L178 94 °C for 3 min; 94 °C for 1 min; 58 °C for 30 s, 72 °C for 1 min (35 cycles from 94 °C for 1 min); 72 °C for 10 min. 4 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Phylogenetic analysis Nucleotide sequences were aligned and assembled using Geneious Prime v.2021.1.1(https://www.geneious.com). All forward and reverse sequences were edited and assembled separately using the Geneious alignment tool at a cost matrix of 93% similarity. All sequences of each region, including available sequences from previous publications (see Suppl. material 1: table S1), were aligned separately using the Geneious alignment algorithm with default settings and a cost matrix at 65% similarity. The resulting alignments were adjusted manually and then concatenated. Ambiguous positions were excluded from the alignment, and missing parts of sequences were treated as missing data. The final alignments were uploaded to CIPRES Science Gateway servers (http://www.phylo.org) (Miller et al. 2010) to perform maximum likelihood (ML) and Bayesian inference (BI) analyses. The ML analysis was conducted using RAxML HPC BlackBox v.8.2 (Stamatakis 2014) with the GTR+I+GAMMA substitution model, following default settings with 1,000 bootstrap replications. Datasets of each single-locus and concatenated sequence were analyzed. A branch with bootstrap support of 70% or higher was considered well supported. The BI analysis was implemented using MrBayes on ACCESS (3.2.7a) (Ronquist et al. 2012) with Markov chain Monte Carlo (MCMC) searches using two simultaneous and independent runs and four chains (one cold and three heated) of 10,000,000 generations. Trees were sampled every 10,000 generations, and the first 10% of sampled trees were discarded as burn-in to ensure convergence of the analyses. Prior to the analyses, the dataset was partitioned by marker into four partitions corresponding to each region (rbcL, L138, L178, and L315). The best-fitting model scheme of each region for BI analysis was identified using PartitionFinder 2 (Lanfear et al. 2016). Tracer 1.7.2 (Rambaut et al. 2018) was used to estimate the suitable burn-in and to check the MrBayes output for proper convergence and effective sample sizes (ESS), all of which were >200. Posterior probability (PP) values greater than 0.95 were considered strong support (Erixon et al. 2003). FigTree v.1.4.4 (Rambaut 2017) was used to graph and edit both the maximum likelihood tree and the Bayesian tree. Results Phylogenetic reconstructions The combined dataset of forty-seven taxa produced a matrix of 2,817 characters, of which 617 were parsimony-informative characters (20.90%). The phylogenetic tree topology obtained from the ML analysis corresponds to that of the BI analysis without any significant conflicts. Therefore, only the topology from the BI consensus tree is shown here along with the bootstrap support values and posterior probabilities (Fig. 1). The phylogenetic reconstruction shows the monophyletic lineage of the genus Phaeoceros with strong support (BS = 100%, PP = 1). In addition, the genus Paraphymatoceros was placed as a sister to Phaeoceros, with strong support (BS = 88%, PP = 1). There are two main clades within the genus Phaeoceros, both strongly supported (BS = 100%, PP = 1). Clade A consists of P. carolinianus, P. engelii, P. evanidus, P. laevis, P. mohrii, P. parvulus, and P. perpusillus, with strong support 5 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis (BS = 100%, PP = 1). Clade B is formed by P. himalayensis, P. kashyapii, and two undescribed species (P. aequatus and P. stenothallus) (BS = 100%, PP = 1). The two undescribed species, P. aequatus and P. stenothallus, are nested within a clade comprising P. himalayensis and P. kashyapii, together forming a well-supported monophyletic group. The five accessions of P. stenothallus are grouped together with strong support (BS = 99%, PP = 1) and are in a well-supported sister Figure 1. Majority rule consensus tree of phylogenetic relationships of Phaeoceros in Asia inferred from rbcL, L138, L178, and L315 genes. The two integers above branches represent ML bootstrap support and posterior probability, respectively. 6 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis relationship to P. kashyapii. They are nested within a clade that includes species producing long-stalked tubers (P. himalayensis, P. kashyapii, and P. stenothallus) (BS = 81%, PP = 0.51). All three assemblages together form a sister group with a well-supported clade of two accessions of P. aequatus (BS = 100%, PP = 1). Morphological study The most informative features of this group are found in the sporophyte. The species have green to yellowish green capsules at a young stage, which become dark brown from the top down and include the base when completely mature. When the sporophytes dehisce, capsules start twisting and form two longitudinal slits along the capsule length. The valves are generally adherent at the tip, rarely opening widely. During the developmental stage, the capsule apex often bends and curves, with a maximum length of up to 15 mm. Members of subgen. Himalayanus often have irregularly dichotomous branching. Their thallus is more likely to grow scattered as the tips spread out in various directions and typically form dense mats or patches with lingulate or elongated thalli, although they may occasionally grow in obcordate or fan-shaped forms. Except for P. aequatus, the latter three species have long-stalked tuber formation. The tubers can grow up to 5 mm long, ending in a globose node or rounded tip, and are sometimes branched. This type of tuber is distributed along the thallus apex, margin, and ventral surface. Due to the unique morphological traits of these four species, we here propose the new subgenus Himalayanus to accommodate them. Morphological examination and comparison of P. aequatus and P. stenothallus reveal that they do not belong to any known species. However, the two new species are morphologically aligned with Phaeoceros subgen. Himalayanus, which has been reported from the Himalayan region. The inclusion of P. aequatus and P. stenothallus in the Himalayan Phaeoceros is also supported by molecular evidence, as discussed in the following section. Below, we provide descriptions of four species of the subgenus Himalayanus. A comparison of these species is summarized in Table 3. Table 3. Comparisons of characters between Phaeoceros aequatus, P. himalayensis, P. kashyapii, and P. stenothallus. Characters P. aequatus P. himalayensis P. kashyapii P. stenothallus Shape of thalli/ colonies lingulate to obovate/ irregular patches lingulate to obovate/ irregular patches lingulate to obovate/irregular patches lingulate to strapshaped/irregular patches Thallus width (mm) 3–7 1–5 2–6 0.8–3 Tuber type absent apical, marginal, ventral; long stalk apical, marginal, ventral; long stalk apical, marginal, densely ventral; long stalk Sexuality monoicous monoicous monoicous dioicous Number of antheridia per chamber 2–6 2n/a 2–3 Capsule length (mm) up to 13 up to 12 up to 15 5–10 (–12) Distal face of spore without hump-like structure, finely vermiculate without hump-like structure, irregular verrucose projections, sometimes with aggregation in center without hump-like structure, irregular verrucose projections, sometimes with aggregation in center with hump-like structure, finely vermiculate throughout Proximal face of spore finely vermiculate finely vermiculate with a central depression finely vermiculate, with minutely papillae on the center of each facet finely vermiculate Spore diameter (µm) 30–38 27–35 30–38 29–38 7 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Discussion The resulting topology (Fig. 1) shows that species of Phaeoceros fall into two main assemblages (Clade A and Clade B) related to disparate sporophyte and spore morphology. These are Clade A (subgen. Phaeoceros), with yellowish sporophytes having widely opened valves and most species having the spinose spore, and Clade B (subgen. Himalayanus), with yellowish brown to dark brown mature sporophytes having adhering valves and the non-spinose spore. Separation of the clades according to molecular evidence corresponds to different categories of Bharadwaj’s (1981) spore architectures. In his study of Asian hornworts, three types of Phaeoceros were grouped based on spore ornamentation, including 1) spinose type, 2) mounded type, and 3) foveate type. Later, the foveate species were transferred to the genus Phaeomegaceros (Duff et al. 2007). Clade A, subgen. Phaeoceros, contains taxa from Asia, America, Australia, and Europe. Species in this clade share similar morphological traits, such as rosette thallus growth, undeveloped tubers (either absent or short-stalked), yellowish capsules with widely spread valves at dehiscence, and spinose spore ornamentation, except for P. perpusillus var. scabrellus spores. Furthermore, all species in this subgenus have a wide distribution range, except P. perpusillus. Although this species is abundant where it occurs, its distribution is limited to the northern part of Thailand. Clade B, subgen. Himalayanus, accommodates all species with irregular patches of thalloid gametophytes, dehiscent sporophytes with an adhering tip of the valves, yellowish brown to dark brown sporophytes at maturity, and distally large verrucae or rounded protuberances on the spores. The strong support across the analysis (BS = 100%, PP = 1) indicates that this group is sister to the other lineage comprising Phaeoceros (Clade A). This clade contains four species, P. aequatus, P. himalayensis, P. kashyapii, and P. stenothallus, which are restricted to the Himalayan region and northern Thailand. In the field, these species seem to belong to a single variable species, as morphological differences are barely discernible; however, the spores of each differ. The spore ornamentation correlates with each of the four clades in the phylogeny, indicating that morphological and molecular data are congruent. Within the clade of subgen. Himalayanus, analyses of molecular data from five accessions of P. stenothallus support the genetic distinctness of this species, consistent with its morphological characteristics, including a dioicous sexual system, round protuberance on the distal face of the spore surface, narrow thalli with dense tubers, and significantly thick thalli, up to 16 cells thick in cross-section in the middle region. Phaeoceros stenothallus is sister to P. kashyapii, and together they form a sister clade to P. himalayensis with weak support. All three species share the diagnostic characteristic of tuber production. These three lineages together form a sister lineage, with strong support, to P. aequatus, which has no tubers on its thalli. Currently, P. aequatus is known only from its type locality; however, future investigation may uncover additional populations, which could lead to a better understanding of tuber development in this species. Based on morphology, Phaeoceros subgen. Himalayanus corresponds to members of Paraphymatoceros, the American genus separated from Phaeoceros by Hässel de Menéndez (2006). Most species of Paraphymatoceros share similar sporophyte characteristics and spore morphology with Phaeoceros subgen. 8 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Himalayanus. However, the chloroplasts of Phaeoceros have pyrenoids, whereas Paraphymatoceros is pyrenoidless. The separation of these two assemblages is also consistent with geographic distribution, as Phaeoceros subgen. Himalayanus occurs in Asia, whereas Paraphymatoceros occurs in North and South America. In the following section, we discuss the distinctive morphological traits of subgen. Himalayanus based on our phylogenetic results. Tubers Tubers are small outgrowths developed from the thallus and are related to survival mechanisms, as they can help hornworts survive unfavorable conditions. Many hornwort species develop nutrient-filled tubers as perennating structures, allowing them to germinate in the following season (Renzaglia 1978; Renzaglia et al. 2009). The ability to form tubers has been gained and lost many times during the evolution of hornworts. A sister genus to all Phaeoceros species, Paraphymatoceros, which has apical flattened and disk-shaped tubers (Hässel de Menéndez 2006; Crandall-Stotler et al. 2008; Renzaglia et al. 2009), suggests that the existence of tubers is the ancestral condition in Phaeoceros. Phaeoceros clades with tuber-bearing species have higher species numbers than the clade lacking tubers, which comprises only P. aequatus and P. carolinianus. Phaeoceros has been reported to produce short ventral or marginal tubers (Renzaglia et al. 2009; Villarreal et al. 2010), but P. himalayensis, P. kashyapii, and P. stenothallus show tuber morphology similar to the elongated stalked tubers found in Phymatoceros (Stotler et al. 2005; Crandall-Stotler et al. 2006). This may be a case of convergent evolution. Abundant tubers with long stalks are morphological traits found in Phaeoceros subgen. Himalayanus, but this trait is likely lost in P. aequatus. It is possible that tuber expression may be triggered by environmental factors such as high light intensity and low soil humidity. Individuals of P. aequatus at the type locality inhabit a more stable, moist, and shaded environment, which may not induce tuber formation. Thus, having longer tubers possibly enables them to reach deeper soil and access more favorable conditions. Furthermore, the production of long-stalk tubers in P. himalayensis, P. kashyapii, and P. stenothallus might be a response to water stress in somewhat open and dry habitats. Additionally, attenuated thalli or apical tendrils can be found in response to relatively drought-like conditions across different species. Like other hornwort species, the morphology of tubers can vary among Phaeoceros species and sometimes can serve as a useful taxonomic characteristic. Sporophyte dehiscence Most species of Paraphymatoceros, a sister genus to all Phaeoceros species, share sporophyte morphology similar to Phaeoceros subgen. Himalayanus, suggesting that the adherent tip of the capsule may represent the ancestral condition within the genus. However, further research is needed to establish the actual ancestral state of sporophytes in early Phaeoceros. In Phaeoceros, capsule dehiscence typically occurs along two longitudinal lines originating near the apex of the sporophyte and proceeding downward (Renzaglia 1978; Renzaglia et al. 2017). 9 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis The species of Phaeoceros subgen. Phaeoceros all have yellowish sporophytes splitting into two free valves when they dehisce. These valves tend to twist, especially in the long-sporophyte species such as P. carolinianus and P. laevis. The occurrence of twisted valves in certain species relates to capsule length and is probably an adaptation to increase spore dispersal. However, within subgen. Himalayanus, sporophytes of the species are characterized by the following features: 1) adherent valves at the apex, 2) a color transition from green at the young stage to yellow at the middle stage and finally dark brown at maturity, and 3) an identical capsule size of approximately 1.2 cm long. The sporophytes are more uniformly short. However, the twisted capsules and unexposed slits suggest that the species is capable of gradual spore dispersal. This strategy might help spore dispersal by water rather than wind, or it may be induced by internal pressure and triggered by environmental changes—particularly the contrast between dry and wet conditions—indicating a more compact and specialized dispersal mechanism. Spore morphology Morphology of spores has been used as a key feature for species delimitation in many hornwort taxa such as Anthoceros, Dendroceros, Notothylas, and Phaeoceros (Hässel de Menéndez 1989, 1990; Chantanaorrapint 2015; Peñaloza-Bojacá et al. 2019; Cargill et al. 2022). However, this structure is conserved in some genera, such as Nothoceros (Villarreal et al. 2010). In this study, detailed spore ornamentation is a diagnostic character and useful to define infrageneric taxa within Phaeoceros. Within Notothyladaceae, spores of Notothylas, Paraphymatoceros, and Phaeoceros subgen. Himalayanus have distally large verrucose or rounded protuberances. Thus, this type of spore is considered the ancestral condition in Phaeoceros, and spinose spores are a derived state. However, the transition from spiny to smooth architecture occurs at least once in P. perpusillus var. scabrellus and perhaps in other Phaeoceros species from other regions reported by Renzaglia et al. (2009). Despite Phaeoceros traditionally being recognized for having spiny spores (Renzaglia 1978), species of subgen. Himalayanus exhibits vermiculate ornamentation with or without hump-like projections or large verrucose coverings on the distal surface and therefore extends the diversity of spore morphologies possessed by Phaeoceros. Although the spore architecture and various features such as the sexual system and tuber morphology of Phaeoceros stenothallus resemble those of Phymatoceros bulbiculosus (Brot.) Stotler, W.T. Doyle & Crand.-Stotl., molecular phylogeny reconstructions (Fig. 1) unambiguously place P. stenothallus within Phaeoceros. The size of Phaeoceros stenothallus spores ranges from 29–38 µm in diameter, which is smaller than that of Phymatoceros bulbiculosus at (49–) 52–64 (–69) µm in diameter (Crandall-Stotler et al. 2006). These two species are morphologically similar and might reflect convergent evolution. Spore color in Phaeoceros ranges from yellow to dark brown. This color is considered a plesiomorphic trait in hornworts and appears in the genus Phaeoceros (Renzaglia et al. 2009). Species of subgen. Phaeoceros possess yellow spores, while in subgen. Himalayanus mature spores are yellowish brown to dark brown. The spore color is related to the thickness of the spore walls, 16 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Figure 4. Phaeoceros himalayensis (Kashyap) Prosk. ex Bapna & G.G. Vyas. A. Plant in its natural habitat; B, C. Gametophytes and sporophytes; D. Cross section of thallus; E. Dorsal epidermal cells of thallus; F. Cross section of capsule wall; G. Epidermal cells of capsule and stoma; H. Innermost cells of capsule wall; I. Distal view of spore (LM); J. Proximal view of spore (LM); K. Pseudoelaters. Photographed by O. Suwanmala; based on S. Chantanaorrapint & O. Suwanmala 3880A (A), 3877 (B–F, I–K) and 4079 (G, H). 17 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Figure 5. Phaeoceros himalayensis (Kashyap) Prosk. ex Bapna & G.G. Vyas. A. Gametophyte and sporophytes; B. Cross section of thallus; C. Dorsal epidermal cells of thallus; D. Cross section of capsule; E. Epidermal cells of capsule and stoma; F. Innermost cells of capsule wall; G. Distal view of spore; H. Proximal view of spore; I. Pseudoelaters. Drawn by O. Suwanmala; based on S. Chantanaorrapint & O. Suwanmala 3877. 18 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Distribution, habitat, and ecology. Phaeoceros himalayensis is currently known from India (Asthana and Srivastava 1991) and Thailand (Chantanaorrapint et al. 2015). It occurs on rocks and soil in open sites in grassland, pine-oak mixed montane deciduous, and subalpine forests at elevations between 1,000 and 2,200 m. It may grow associated with other bryophytes such as Asterella khasyana (Griff.) Pandé et al., Cyathodium aureonitens (Griff.) Mitt. and Fissidens spp. Conservation status. This species is not under immediate threat, due to many populations being found in India and northern Thailand, with the extent of occurrence (EOO) of over 900,000 km2 and its occurrence in protected areas. According to the IUCN criteria, the conservation status of P. himalayensis is classified as Least Concern (LC). Specimens examined. India • Himachal Pradesh: Shimla, Jakhu Tample, 2 Oct 2012, Duckett et al. IW1 (QFA); • Meghalaya: West Khasi Hills, Thipringsong Forest, Nongstoin, ca 1,636 m elev., 15 Sep 2000, A.P. Singh & M. Lal 208617 (LWG); • Uttarakhand: Almora, on way to Binsar, 1,969–2,272 m elev., 4 Oct 1991, V. Nath & A.K. Asthana 205348C, 205359B (LWG); Almora, on way to P. Nath, 2,500 m elev., 6 Oct 1991, V. Nath & A.K. Asthana 205380 (LWG); • Mussoorie, Dehra Dun, Wood Stock College, 2,121 m elev., 3 Oct 1977, S. Chandra 203378B (LWG); • Dhanaulti, 2,121 m elev., 3 Oct 1977, S. Chandra 203385 (LWG); • Nainital, on the way of Kilbury, 1,818 m elev., 12 Sep 2001, A.P. Singh & V. Sahu 208943 (LWG); • Uttarkashi, Silkiara, 1,818 m elev., 15 Sep 1977, S. Chandra 203229 (LWG); • West Bengal: Darjeeling, Himalayan Mountaineering Institute Road, ca 2,060 m elev., A.K. Asthana & V. Sahu 224004 (LWG). Thailand • Chiang Mai: Chiang Dao, Angsalung base camp, 19°23'51.56"N, 098°53'21.08"E, 2,191 m elev., 11 Nov 2016, S. Chantanaorrapint & O. Suwanmala 651 (PSU), 29 Aug 2017, S. Chantanaorrapint & O. Suwanmala 2024 (PSU), 9 Oct 2019, S. Chantanaorrapint & O. Suwanmala 3875, 3876, 3877 (PSU), 13 Nov 2020, S. Chantanaorrapint & O. Suwanmala 4079, 4080 (PSU), 24 Nov 2022, O. Suwanmala 854, 856, 857 (PSU); • Doi Luang Chiang Dao, 2,169 m elev., 19 Dec 2011, S. Chantanaorrapint 2540 (PSU), 1 Nov 2013, S. Chantanaorrapint & C. Promma 3123, 3126, 3215A (PSU); • the trail to Kew Lom, 19°23'33.36"N, 098°53'24.40"E, 1,937 m elev., 12 Nov 2016, S. Chantanaorrapint & O. Suwanmala 664, 695 (PSU), 28 Aug 2017, S. Chantanaorrapint & O. Suwanmala 2006 (PSU), 9 Oct 2019, S. Chantanaorrapint & O. Suwanmala 3880A (PSU), 13 Nov 2020, S. Chantanaorrapint & O. Suwanmala 4081, 4082 (PSU); • Lam Phun: Khun Tan National Park, 18°29'40.18"N, 099°17'17.45"E. 1,092 m elev., 20 Aug 2022, S. Chantanaorrapint & O. Suwanmala 4474 (PSU); • Tak: Umphang, Thung Yai Naresuan, 19 Sep 2014, S. Chantanaorrapint 2756 (PSU). Taxonomic notes. Phaeoceros himalayensis is characterized by 1) the presence of tubers at the ventral and apical regions of the thallus, 2) the distal face of the spore covered by irregular verrucose projections, 3) the presence of a central depression on each proximal face, and 4) yellowish brown to dark brown sporophytes at maturity. Phaeoceros himalayensis resembles P. kashyapii in having irregular verrucae on the distal face of the spore, but it differs from the latter by the presence of a central depression on each proximal face. The sexual condition of P. himalayensis has been subject to different interpretations. Kashyap (1915) first described Anthoceros himalayensis (= P. himalayensis) as a dioicous plant with male and female thalli differing in size. 19 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis However, Mehra and Handoo (1953) noted that it was monoicous but protandrous, based on their collections from Mussoorie, Simla, and Nainital in India. Proskauer (1967) and Asthana and Srivastava (1991) also stated that P. himalayensis was monoicous, while Chantanaorrapint et al. (2015) described it ambiguously as monoicous and dioicous. Based on specimens examined as part of this study, P. himalayensis is monoicous. Phaeoceros kashyapii A.K. Asthana & S.C. Srivast., Bryophyt. Biblioth. 42: 129, pl. 30, 48. 1991. Figs 6, 7, 11A, B Type. India • Western Himalayas: Deoban. 29 Sep 1976, D.K. Singh & J.C.J. 2170/76 (holotype: LWU!). Description. Thallus bright green to yellowish green in fresh samples, become yellowish green to dark brown when dry, growing prostrate with moderately adhering to substrate, forming irregular patches or fan-shaped colonies, irregularly branched into several lobes, thallus lobe lingulate to obovate, or fan-shaped, the base usually narrower than the apex, 7–20 mm long, 2–6 mm wide; margins nearly entire to irregularly crenulate, sometimes lobulate along the margin, flat, rarely ascending upward; apex generally lobulate, broad, occasionally attenuate into apical tuber, rarely curving upward; tubers frequently present, occurring at apex, along margin, or on ventral surface of thallus, with a stalk to 5 mm long, ovoid to subspherical. Thallus in cross section plano-convex to concave-convex, 4–8 cells thick in the middle region. Dorsal epidermal cells irregular pentagonal to heptagonal, 30–150 × 20–55 µm. Chloroplasts 1 per cell, expanded, occupying nearly entire to half of cell size, frequently contracted into round shape, pyrenoid smooth. Nostoc colonies scattered ventrally, appearing as dark spots. Rhizoids sparse, scattered mainly along the middle region of ventral surface, smooth in early stage, becomes pegged at maturity, hyaline to pale brown. Sexuality monoicous or strong protandrous, androecia and archegonia not seen. Involucres erect, conical-cylindrical, 1.2–1.7 mm long, 2–4 cells thick, mouth smooth to shallowly crenulate. Sporophytes frequent, capsules erect, cylindrical, up to 15 mm long at maturity; epidermal cells of capsule elongate-rectangular, 117– 300 × 10–28 µm; stomata 70–83 × 42–85 µm, surrounded by 5–6 epidermal cells; assimilative layer 2–4 cells thick in cross section; the innermost capsule cells elongate rectangular to hexagonal, 37–155 × 7–28 µm, pale brown to brown; columella consisting of 4–8 cells in cross section, brown to dark brown. Spores yellowish brown to dark brown, 30–38 µm in equatorial diameter; distal face with irregular large verrucose confined to the center; proximal face with distinct thin triradiate mark, finely vermiculate along its length; each facet finely vermiculate, frequently with sparse papillae confined to the center of each facet. Pseudoelaters thin to thick-walled, occasionally branched, 1–3 cells long; pseudoelaters cells irregular rectangular, yellowish brown to dark brown, without helicoidal band. Distribution, habitat, and ecology. Phaeoceros kashyapii usually grows in open areas in pine-oak forests ranging from 900–2,200 m in elevation. Distribution. India and Thailand (Asthana and Srivastava 1991). 20 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Figure 6. Phaeoceros kashyapii A.K. Asthana & S.C. Srivast. A. Plant in its natural habitat; B, C. Gametophytes and sporophytes; D. Dorsal view of thallus showing antheridium chamber; E. Dorsal epidermal cells of thallus; F. Cross section of capsule; G. Epidermal cells of capsule and stoma; H. Innermost cells of capsule wall; I. Distal view of spore (LM); J. Proximal view of spore (LM); K. Pseudoelater. Photographed by O. Suwanmala; based on S. Chantanaorrapint & O. Suwanmala 3898 (B–D) and 3901 (A, E–K). 21 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Figure 7. Phaeoceros kashyapii A.K. Asthana & S.C. Srivast. A. Gametophyte and sporophytes; B. Cross section of thallus; C. Dorsal epidermal cells of thallus; D. Cross section of capsule; E. Epidermal cells of capsule and stoma; F. Innermost cells of capsule wall; G. Distal view of spore; H. Proximal view of spore; I. Pseudoelaters. Drawn by O. Suwanmala; based on S. Chantanaorrapint & O. Suwanmala 3901. 22 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Conservation status. Phaeocero kashyapii has an estimated EOO of 200,894 km2, suggesting a status of Least Concern (LC), while its area of occupancy (AOO) is 36 km2, which would place it in Endangered (EN). Indian populations are more widely distributed and can be found in disturbed areas, while Thai populations are rare and found alongside walking trails in the conservation areas. However, it is unclear whether the species continued occurrence at some of these sites. Its habitats are probably impacted by development and human disturbance. Therefore, P. kashyapii could be qualified as Endangered (EN) according to the IUCN Red List Criteria B2ab(iii) (IUCN 2024). Specimens examined. India • Uttarakhand: Mussoorie, Dehra Dun, Wood Stock College, 2,121 m elev., 3 Oct 1977, S. Chandra 203383 (LWG); Nainital, on the way to Kilbury, ca 1,818 m elev., 12 Sep 2001, A.P. Singh & V. Sahu 208947 (LWG); • Nainital, on the way to Tippin top, ca 2,181 m elev., 13 Sep 2001, A.P. Singh & V. Sahu 208975A (LWG); • Uttarkashi, Silkiara, 1,818 m elev., 15 Sep 1977, S. Chandra 203222, 203225B, 203225C (LWG); • Syana Chatti, Janki Chatti, 1,818 m elev., 20 Sep 1977, S. Chandra 203253A (LWG); • Western Himalayas: Deoban, 29 Sep 1976, D.K. Singh & J.C. Joshi 2170/76 (LWU). Thailand • Chiang Mai: Chiang Dao, Doi Sam Phe Nong, ca 1,500 m elev., 10 Oct 2019, S. Chantanaorrapint & O. Suwanmala 3898, 3900, 3901 (PSU); • Pang Woa, 19°24'33.05"N, 098°51'35.46"E, 1,178 m elev., 13 Nov 2016, S. Chantanaorrapint & O. Suwanmala 718A (PSU); • Lum Phun: Khun Tan National Park, 18°29'55.34"N, 099°16'43.92"E, 904 m elev., 11 Oct 2019, S. Chantanaorrapint & O. Suwanmala 3920 (PSU). Taxonomic notes. Phaeoceros kashyapii is similar to P. himalayensis in several morphological characters of the gametophyte and sporophyte. Both are monoicous and usually grow in irregular patches. The thallus frequently produces tubers with long stalks on the ventral side, margins, and apex. Sporophytes are no longer than 15 mm, turning yellowish brown at maturity with an adhering valve tip. However, P. kashyapii differs from P. himalayensis by its spores lacking a central hollow on the proximal facet and usually bearing a small cluster of minute papillae restricted to the central region of each facet. The examination of the holotype of P. kashyapii revealed that the spores of the type collection have a depression at the center of each facet, which morphologically resembles P. himalayensis. This indicates that the holotype of P. kashyapii is possibly mixed. The original publication of P. kashyapii also noted that it was found associated with P. himalayensis. Nevertheless, all specimens examined in this study display characteristics that belong to P. kashyapii, based on the first description and photographs provided by Asthana and Srivastava (1991). Based on collections from Thailand, gametophytes are strongly protandrous, with antheridia or antheridial chambers rarely found in sporophyte-bearing thalli. However, it is quite clear that the Indian population of P. kashyapii presents a monoicous plant producing male and female gametes on the same thallus. The proximal spore architecture of P. kashyapii is typically finely vermiculate, with sparse minute papillae limited to the center of each facet. However, the papillae may be present in small numbers or occasionally absent. In such cases, it is quite difficult to distinguish spores of P. himalayensis and P. kashyapii using a light microscope. Therefore, careful investigation of the proximal face of the spore is required for accurate species recognition. 23 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Phaeoceros stenothallus Suwanmala & Chantanaorr., sp. nov. Figs 8, 9, 11C–F Type. Thailand • Chiang Mai: Chiang Dao, Denya Khad, 1,413–1,500 m, 14 Nov 2020, S. Chantanaorrapint & O. Suwanmala 4086 (holotype: PSU!, isotype: NICH!, QFA!). Diagnosis. Phaeoceros stenothallus is similar to P. himalayensis and P. kashyapii but differs in dioicous sexuality, a narrow thallus never broader than 3 mm, wide and the vermiculate spore with hump-like projection on distal face. Description. Thallus bright to dark green in fresh material, becoming yellowish green to brown when dry, growing prostrate with loosely to moderately adhering to substrate, forming irregular patches or colonies, compactly, irregularly dichotomous branched into several lobes, thallus lobe strap-shaped, narrow, sometimes tapering toward apex, become boarder in sporophyte-bearing thalli, up to 12 mm long, 0.8–3 mm wide. margins entire to wavy, rarely crenulate, usually flat; apex usually attenuate, gradually tapering into apical tuber, sometimes shallowly lobulate; tubers always present, occurring at apex, along margins, and on the ventral surface, well-developed stalk, the tip with rounded end or ovoid to globose node, sometimes branched, up to 10 mm long. Thallus in cross section biconvex or plano-convex, with 6–16 cells thick in the middle region. Dorsal epidermal cells irregular pentagonal to heptagonal, 23–105 × 18–50 µm. Chloroplasts 1 per cell, occupying nearly entire to half of cell size, frequently contracted into round shape, occasionally folded at margin or starlike shape. Nostoc colonies irregularly distributed, sparse, appearing as dark spots. Rhizoids sparse to densely scattered along the middle region of ventral surface, hyaline to brown. Sexuality dioicous. Androecia abundant at the middle of thallus, distinctively raised over the dorsal surface of thallus, usually 2–3 antheridia per chamber; antheridia subglobose to globose, 2-tiered stalk with quadriseriate cells, 220–240 × 150–180 µm. Archegonia not seen. Involucres erect, conical-cylindrical, up to 2 mm long, 2–5 cells thick, mouth smooth to shallowly crenulate. Sporophytes often, capsules erect with slightly bending tip, cylindrical, 5–10(–12) mm long; epidermal cells of capsule elongate-rectangular, 80–207 × 10–31 µm, thick-walled; stomata 85–92 × 50–54 µm, surrounded by 6–7 cells; assimilative layer 3–5(–6) cells thick in cross section; the innermost capsule cells subquadrate to rectangular, 30–110 × 20–38 µm, brown to dark brown; columella consisting 8–16 cells in cross section, reddish brown to dark brown. Spores yellowish brown to dark brown, 29–38 µm in equatorial diameter; distal face hump-like projection without verrucose; proximal face with distinct thin triradiate mark; ornamentation finely vermiculate throughout the spore. Pseudoelaters thin to thick-walled, rarely branched, 1–2 celled; pseudoelaters cells rectangular, brown to dark brown, without helicoidal band. Etymology. The epithet “stenothallus” refers to the narrow thallus. Habitat and ecology. Phaeoceros stenothallus grows abundantly in open areas in mixed deciduous dipterocarp forest and pine-oak forest at elevations between 1,000 and 2,200 m in elevation. Distribution. Endemic to Thailand. Conservation status. Phaeoceros stenothallus has been found in the north to northwestern part of Thailand, with abundant populations in Chiang Dao Wildlife Sanctuary and spare populations in Mon Long, Doi-Suthep Pui National 24 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Figure 8. Phaeoceros stenothallus Suwanmala & Chantanaorr. A. Plant in its natural habitat; B, C. Female gametophytes and sporophytes; D. Male gametophyte with numerous tubers; E. Cross section of thallus; F. Dorsal epidermal cells of thallus; G. Cross section of capsule; H. Epidermal cells of capsule and stoma; I. Innermost cells of capsule wall; J. Distal view of spore (LM); K. Proximal view of spore (LM); L. Pseudoelater. Photographed by O. Suwanmala; based on S. Chantanaorrapint & O. Suwanmala 3453 (A), 3845 (F), 4048 (H, I) and 4086 (B–E, G, J–L). 25 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Figure 9. Phaeoceros stenothallus Suwanmala & Chantanaorr. A, B. Female thalli with apical tendrils and sporophytes; C. Male thallus with ventral tuber, showing antheridium chambers scattered on the dorsal surface; D. Cross section of thallus; E. Dorsal epidermal cells of thallus; F. Cross section of capsule; G. Epidermal cells of capsule and stoma; H. Innermost cells of capsule wall; I. Distal view of spore; J. Proximal view of spore; K. Pseudoelaters. Drawn by O. Suwanmala; based on S. Chantanaorrapint & O. Suwanmala 4086. 32 PhytoKeys 268: 1–32 (2025), DOI: 10.3897/phytokeys.268.172910 Orawanya Suwanmala et al.: Molecular and morphological insights into Phaeoceros himalayensis Renner MAM, Sass-Gyarmati A, Schäfer-Verwimp A, Segarra Moragues JG, Stotler RE, Sukkharak P, Thiers BM, Uribe J, Vána J, Villarreal JC, Wigginton M, Zhang L, Zhu RL (2016) World checklist of hornworts and liverworts. PhytoKeys 59: 1–828. https:// doi.org/10.3897/phytokeys.59.6261 Stamatakis A (2014) RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics (Oxford, England) 30(9): 1312–1313. https:// doi.org/10.1093/bioinformatics/btu033 Stotler RE, Doyle WT, Crandall-Stotler BJ (2005) Phymatoceros Stotler, W. T. Doyle & Crand.-Stotl., gen. nov. (Anthocerotophyta). Phytologia 87: 114–117. https://doi. org/10.5962/bhl.part.4031 Suwanmala O, Villarreal JC, Li FW, Chantanaorrapint S (2024) Phaeoceros perpusillus var. scabrellus (Notothyladaceae, Anthocerotophyta), a new taxon from northern Thailand. PhytoKeys 244: 271–283. https://doi.org/10.3897/phytokeys.244.124080 Villarreal JC, Cargill DC, Hagborg A, Söderström L, Renzaglia KS (2010) A synthesis of hornwort diversity: Patterns, causes and future work. Phytotaxa 9: 150–166. https:// doi.org/10.11646/phytotaxa.9.1.8 Supplementary material 1 List of specimens used in the phylogeny analysis Authors: Orawanya Suwanmala, Juan Carlos Villarreal A., Sahut Chantanaorrapint Data type: xlsx Explanation note: table S1. List of specimens used in the phylogeny analysis, including voucher information, GenBank accession numbers or the published sequences name together with original sources. newly generated sequences are bold. Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/phytokeys.268.172910.suppl1