Full text
377 Two new species of the Drawida japonica species complex (Oligochaeta, Moniligastridae) from East Asia delimited by integrative taxonomic methods Min Liu1,2* , Pu Miao3*, Zheng Liu1, Nonillon M. Aspe4, Yufeng Zhang1, Huifeng Zhao1 1 Hebei Key Laboratory of Animal Diversity, College of Life Science, Langfang Normal University, Langfang 065000, China 2 College of Life Science, Shenyang Normal University, Shenyang 110034, Liaoning, China 3 Henan Province Tobacco Company, Luoyang 471000, China 4 College of Environment and Life Sciences, Mindanao State University at Naawan, Naawan 9023, Misamis Oriental, Philippines Corresponding authors: Huifeng Zhao ([email protected]); Yufeng Zhang ([email protected]) Copyright: © Min Liu et al. This is an open access article distributed under terms of the Creative Commons Attribution License (Attribution 4.0 International – CC BY 4.0). Research Article Abstract The Drawida japonica (Michaelsen, 1892) species complex is a cosmopolitan earthworm group that is widely distributed throughout Asia, and has a high degree of diversity. Nonetheless, the species composition of this species complex remains ambiguous due to limited taxonomic investigation. An integrative taxonomic approach, incorporating both morphological and molecular datasets, is herein applied to elucidate the D. japonica species complex across East Asia, with the objective of delimiting putative new species. External and internal morphological characters were examined for taxonomic identification. For molecular phylogenetic analysis, one mitochondrial marker, the cytochrome c oxidase subunit I (COI), and three nuclear loci, namely 28S rRNA (28S), A-kinase anchor protein 17A (AKAP17), and flavin adenine dinucleotide synthetase 1 (FLAD1) were used. Species delimitation was performed using three complementary methodological frameworks: Assemble Species by Automatic Partitioning (ASAP), the Generalized Mixed Yule Coalescent (GMYC) phylogenetic approach, and Bayesian Phylogenetics and Phylogeography (BPP). Congruent species boundaries were recovered across all analyses, with the single exception of the GMYC model applied to the mitochondrial COI data set. Furthermore, the interspecific K2P genetic distance exceeded 15%. This study has delimited two new species, namely D. henanensis sp. nov. and D. sinensis sp. nov. The two new species represent the first additions to the species complex in the past decade, thereby significantly contributing to our understanding of Drawida earthworm diversity in Asia. Key words: Earthworm, molecular delimitation, Moniligastridae, phylogeny, taxonomy Introduction Earthworms play a pivotal role in maintaining soil health. They facilitate aeration, increase porosity, expedite nutrient cycling, and preserve the functionality of soil ecosystems, thereby contributing to environmental integrity (Scullion and Malik 2000). However, earthworm taxonomy is constrained by limited Academic editor: Samuel James Received: 2 September 2025 Accepted: 1 December 2025 Published: 19 December 2025 ZooBank: https://zoobank. org/9FEAE5B6-BAE5-4EBD-9DA8238CA41F1707 Citation: Liu M, Miao P, Liu Z, Aspe NM, Zhang Y, Zhao H (2025) Two new species of the Drawida japonica species complex (Oligochaeta, Moniligastridae) from East Asia delimited by integrative taxonomic methods. ZooKeys 1264: 377–402. https://doi.org/10.3897/ zookeys.1264.170881 ZooKeys 1264: 377–402 (2025) DOI: 10.3897/zookeys.1264.170881 * These authors contributed equally to this work.
378 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex morphological diagnostic characters and the widespread occurrence of pronounced morphological conservatism among congeneric or even confamilial taxa—an issue exemplified within the family Moniligastridae Claus, 1880 (Pérez-Losada et al. 2009; Blakemore et al. 2014; Liu et al. 2025). The scientific investigation of Moniligastridae commenced with the initial description of Moniligaster deshyaesi Perrier, 1872. According to the most recent literature, 181 valid species in five genera have been recorded in this family (Narayanan et al. 2024a, 2024b, 2025; Liu et al. 2025). However, the taxonomy of this family is often problematic because of the presence of numerous visually similar species groups (Blakemore and Kupriyanova 2010; Blakemore et al. 2014; Liu et al. 2025). Moreover, certain species within Moniligastridae are characterized by ambiguous boundaries, with numerous species grouped into species complexes such as the Drawida ghilarovi Gates, 1969 species complex, which either regarded as divergent morphological manifestations of a singular nepalensis species or possess ambiguous taxonomic status, introducing complexity to the taxonomy of this family (Gates 1972; Blakemore et al. 2014; Liu et al. 2025). Furthermore, inadequate morphological descriptions of moniligastrids in earlier and current literatures coupled with persistent synonymy issues, have further exacerbated the challenges of species identification (Blakemore and Kupriyanova 2010; Blakemore et al. 2014; Narayanan et al. 2024a). Thus, the incorporation of molecular data, such as the mitochondrial genome (mitogenome) and nuclear marker 28S rRNA (28S), can facilitate the identification of morphologically similar species, as well as the reconstruction of the phylogenetic relationships of target taxa (Blakemore and Kupriyanova 2010; Bernt et al. 2013; Osigus et al. 2013; Narayanan et al. 2024b; Liu et al. 2025). Moreover, it can facilitate the investigation of the processes underlying earthworm species diversification and dispersion (Marchán et al. 2022). The genus Drawida Michaelsen, 1900 is characterized by its notable species richness and wide distribution within the Moniligastridae (Gates 1972; Jamieson 1977). To date, Drawida comprises 151 valid species (Narayanan et al. 2024a, 2024b; Liu et al. 2025), with its natural distribution encompassing regions extending from southern to southeastern and eastern Asia (Gates 1936, 1972; Easton 1981; Blakemore 2012; Anderson et al. 2017; Narayanan et al. 2017, 2023; Zhang et al. 2020). Among these species, D. japonica sensu lato (Michaelsen, 1892) is one of the most widely distributed species, with a broad range that encompasses nearly the entire distribution of Drawida (Misirlioğlu et al. 2023; Narayanan et al. 2024a). Blakemore et al. (2014) posited that D. japonica falls within the scope of a species complex, akin to the D. nepalensis Michaelsen, 1907 species complex and D. ghilarovi species complex (Liu et al. 2025). This assertion is supported by substantial evidence from both morphological and molecular data, which collectively suggests the potential existence of numerous unidentified species or subspecies within D. japonica (Blakemore et al. 2014). In accordance with the observation of similar distribution range and comparable morphological characteristics, the D. japonica species complex may encompass the known species that belong to this group, which include D. japonica sensu stricto (s. s.), D. calebi Gates, 1945; D. koreana Kobayashi, 1938; D. siemsseni Michaelsen, 1910; D. jeholensis Kobayashi, 1940; D. moriokaensis Ohfuchi, 1938, D. keikiensis Kobayashi, 1938
379 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex and D. companio Blakemore, 2014 (Stephenson 1923; Kobayashi 1940a; Blakemore et al. 2014; Narayanan et al. 2024a). Drawida japonica s. s. share certain similarities with these closely related regional congeners, such as D. koreana, D. siemsseni, D. companio, D. moriokaensis and D. keikiensis with clitellum in X–XIII; D. koreana, D. jeholensis and D. moriokaensis with two or three gizzards. The precise taxonomic identification and geographical distribution of D. japonica species complex remain ambiguous. Gates (1972) initially proposed that D. japonica originated from the Indian Himalayas, as well as regions of Southwest China. Subsequently, Easton (1981) documented the occurrence of specimens in Japan and Korea, which were identified within the distribution range of this taxon. The presence of the complex has also been documented in a large area of mainland China (Michaelsen 1927; Chen 1933, 1936, 1946; Gates 1935, 1939; Kobayashi 1940b; Zhang et al. 2012, 2016; Bi et al. 2025), and Blakemore (2012) proposed that it may have originated from Taiwan and subsequently spread to Japan. Additionally, the minimal morphological variations exhibited in the D. japonica species complex render taxonomic analyses based exclusively on morphological evidence as a highly taxing task (Blakemore et al. 2014). This underscores the necessity of incorporating additional taxonomic methodologies, including molecular or ecological data, to facilitate the discovery of new species. However, the scope of molecular study on D. japonica has been limited in previous studies. Notably, only studies from India, Japan, South Korea, and China have provided a modest amount of molecular data (Huang et al. 2007; Blakemore and Kupriyanova 2010; Blakemore et al. 2014), of which are primarily restricted to the mitochondrial marker cytochrome c oxidase subunit I (COI). On the other hand, 16S rRNA (16S) data for India was provided by Kumari et al. (2021). Mitochondrial DNA has been extensively utilized in taxonomic studies, especially COI (Thakur et al. 2021; Marchán et al. 2023; Seesamut et al. 2024; Aspe et al. 2025). However, it is inherited as a maternal evolutionary and rapid genetic marker, providing only a single estimate of the species tree. Consequently, it may not accurately reflect the evolutionary history of species (Hurst and Jiggins 2005; White et al. 2008; Ballard and Whitlock 2022; Chen et al. 2023). In contrast, nuclear markers are universal and composed of highly conserved and variable regions that reflect parental genetic backgrounds, and evolve comparatively more slowly than mitochondrial markers (Patwardhan et al. 2014). This attribute renders them more precise than mitochondrial markers in determining the trajectory of species diversification, and their application in numerous molecular species delimitation studies of earthworms has been well documented in the literatures (James and Davidson 2012; Aspe and James 2018; Plytycz et al. 2018; Liu et al. 2025). This study employs an integrative taxonomy approach, analyzing the specimens of the D. japonica species complex collected from Central China using morphological and molecular data. In addition to the use of the mitochondrial COI gene fragment, three nuclear gene fragments [28S, A-kinase anchor protein 17A (AKAP17), and flavin adenine dinucleotide synthetase 1 (FLAD1)] were also utilized. The application of molecular species delimitation methods, including the Assemble Species by Automatic Partitioning (ASAP), Generalized Mixed Yule Coalescent (GMYC), and the Bayesian Phylogenetics and Phylogeography (BPP), in conjunction with the phylogenetic method, has enabled the delimitation of putative species in the D. japonica species complex.
380 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Materials and methods Sampling The collection of earthworm samples was conducted in May 2023 in Luoning County, Luoyang Prefecture, Henan Province, China (34.4364°N, 111.6368°E). The samples were obtained by digging and hand-sorting. Following collection, the samples were preserved in 100% ethanol for subsequent morphological and molecular analyses. A total of 45 samples were deposited in the Hebei Key Laboratory of Animal Diversity, Langfang Normal University, Langfang, China (C-HLU). Morphological examination and taxonomic identification A total of 14 clitellate samples were examined using a stereomicroscope (ZEISS) and ZEN 3.3.pro software to capture images and examine the detail of both external and internal characteristics. The examination of adult earthworms was chiefly based on body length, width, and color; prostomium type; arrangement of setae; position and morphology of the clitellum; male pores; spermathecal pores; genital markings; and internal organs, including testis sacs, spermathecae, ovisacs, prostates, and gizzards. The generic diagnoses and taxonomic assignments follow Blakemore et al. (2014), Michaelsen (1892) and Xu and Xiao (2011). All measures are based on the materials that preserved in alcohol. The comparison of key morphological characteristics of the D. japonica species complex is shown in Table 1. DNA extraction, amplification, and sequencing The total genomic DNA of the samples was extracted from the posterior part using the TIANamp Genomic DNA Kit (TIANGEN, Beijing, China) following the manufacturer’s instructions. The quantification of DNA concentrations was conducted using a BIO DL MicroDrop spectrophotometer (Beijing, China). The COI and 28S were amplified using polymerase chain reaction (PCR). Another two nuclear genes, AKAP17 and FLAD1, were amplified using nested PCR. The mixture (total volume of 25 μl) contained 1 μl of DNA and 24 μl of PCR mix, which consisted of 17.25 μl of sterile ddH2O, 2.5 μl of Easy Taq Buffer, 0.25 μl of Easy Taq Polymerase (TransGen Biotech Co., Ltd, Beijing, China), 1 μl of each forward and reverse primer (10 μM), and 2.0 μl of dNTPs. The primers utilized are listed in Table 2. Notably, in the context of nested PCR, the second-round reactions utilized 1 μl of PCR products derived from the first round as DNA templates. The PCR protocol for COI includes an initial denaturation step at 95 °C for 5 min, followed by 35 cycles at 95 °C for 30 sec, an annealing step at 51 °C for 30 sec, an extension step at 72 °C for 45 sec, and a final extension step at 72 °C for 5 min. The annealing temperature of 28S was 54 °C, and the annealing temperature was 48 °C for both AKAP17 and FLAD1. The PCR products were examined by electrophoresis in a 1% agarose gel and sent to Tianyi Huiyuan Biotechnology Co., Ltd. (Beijing, China) for sequencing. The sequences were aligned and edited using MEGA 5 (Tamura et al. 2011). All sequences and annotations were submitted to GenBank and the accession numbers are shown in Table 3.
381 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Table 1. Key morphological characteristics of the Drawida japonica species complex (NA: not available). Characteristic D. japonica s. s. D. henanensis sp. nov. D. sinensis sp. nov.D. koreana D. siemsseni D. calebi D. jeholensis D. companio D. moriokaensis D. keikiensis Color Grey/Pale Grey Grey Dark blue buff Unpigmented Whitish grey Dark bluish Grey Grey Length (mm) 28–70 24–47 41.8–52 63–100 110 35–83 52–66 80+ 65–100 40–54 Width (mm) 2–4.5 1.8–3 3.5–4 ≤ 4 2–4 2–4.5 ≤ 3.5 NA ≤ 3.9 ≤ 2.5 Genital markings 7–13, unpaired 7–11, unpaired 7–11, unpaired 7–12, irregular 7–12, irregular 7–13, variously 7–11 8 None None Clitellum 9,10–13,½14 10–13; light grey 10–13; grayish white 10–13; pinkish 10–13 NA 9–14 10–13 10–13 10–13 Sperm ducts Long coiled Medium coiled Tight coiled Short less coiled Long coiled Long coiled Convoluted Moderately long Medium coiled Long coiled Sperm atrium thumb-like and relatively large in 8 Long sac-like and small in 8 Long sac-like and small in 8 Short, sac-like in 7 Present in 8 Conical in 8 Large in 7/8 Small Small in 7/8 7/8 Form of male pores Stubby flab on 10 near 10/11 Penis-like overhanging on 10/11 Raised on the 10/11 Penis-like on 10 near10/11 10/11 Short penis at 10/11 10/11 10/11 Short and stout Penis in pouch in 10/11 Penis in pouch in 10/11 Female pore 11/12; near b-line Absent Absent 12; in b-line NA NA 12; in ab-line 12; in b-line 12,near 11/12 11/12; in b-line Ovisacs 11/12–16 12–20 12–15 12–18, seldom 22 or 23 NA Extend to 20 Extend to 16–20 Extend to 14 Ovarian chamber in 10/11/12 with egg sacs 10/11/12–16 or 22 Gizzard segments 2 or 3; (11)12– 13,14 2 or 3; (11)12– 13,14 (16) 2; 11–13 2 or 3; 12–14 62–4; 12–17 2 or 3; 12–13 or 11–13 3; 12–14 2–3; 10, 11–12? 3–4; 12,13–15 Vas deferens Coiled and twisted Slender and less coiled Long coiled Loosely twisted NA Short coiled Short Coiled Coiled Short coiled Prostate Club-shaped and erect Elliptical white and thick discshaped Long white and thick Thumbshaped NA Sessile and smooth Small and rugose Small and white NA Small and short, but broad and warty on surface
382 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Molecular species delimitation analyses Sequences of closely related taxa included in the molecular analyses were obtained from GenBank (Table 3). Genetic distances were calculated using the Kimura-2-Parameter (K2P) model (Kimura 1980) (Table 4). A comparison of molecular species delimitation with the results of the morphological identification was performed using Assemble Species by ASAP (Puillandre et al. 2021), GMYC (Fujisawa and Barraclough 2013), and BPP (Yang and Rannala 2010). The results of these methods can be cross-verified to improve the accuracy of species delimitation (Gao et al. 2021). The ASAP and GMYC methods were applied to COI and 28S separately to preliminarily infer species hypotheses. ASAP is an automatic program based on DNA barcode gaps that uses the principle that the intraspecific variation is usually smaller than the interspecific variation. It defines species by observing the divergence between DNA sequences. ASAP was performed at the online portal (https://bioinfo.mnhn.fr/abi/public/asap). The GMYC analysis was executed using split v. 1.0-19 package (Ezard et al. 2017) in R, with the objective of delineating independently evolving species through the utilization of single-locus data. The BEAST analysis was conducted using the BEAST v. 1.7.5 package (Drummond et al. 2012), and the input file was prepared in BEAUTi, incorporating the Yule Process tree prior and a lognormal relaxed clock model. Subsequently, newick-formatted ultrametric, bifurcated, and rooted trees were generated by TreeAnnotator (included in the BEAST package) as inputs for the GMYC analysis. The final tree was visualized in FigTree v. 1.4.4 (Rambaut 2022). The BPP method was executed based on the four loci (COI, 28S, AKAP17 and FLAD1) to verify the putative species. This approach is well suited for analyzing multi-locus sequence data under the multispecies coalescent model (MSC), which employs trans-model Markov chain Monte Carlo (MCMC) to calculate posterior probabilities of various species trees (Yang 2002, 2015; Rannala and Yang 2003; Flouri et al. 2018). Two analyses were conducted in BPP v. 4.7. The first analysis, designated as A00, involved the estimation of parameters under the MSC on a fixed species phylogeny. This analysis was used to generate the posterior distribution of the parameters, which included the population size paTable 2. Primers used for PCR and sequencing. Marker Primer Sequence (5’-3’) Round Source COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) HCO2198 TAAACTTCAGGGTGACCAAAAAATCA COIE TATACTTCTGGGTGTCCGAAGAATCA Bely and Wray (2004) 28S 28sF1 GAGTACGTG AAACCGTCTAG Pérez-Losada et al. (2009) 28sR1 CGTTTCGTCCCCAAGGCCTC AKAP17 AKAP17-F1 AAYTGGGARGTNATGGARAA Round 1 Liu et al. (2025) AKAP17-R1 TCYTTRAACATNARYTTCAT AKAP17-F2 AARATGATHAARCCNGAYCARTT Round 2 AKAP17-R2 GCYTTNACRAANCCCATRTAYTC FLAD1 FLAD1-F1 GGNCCNACNCAYGAYGAYAT Round 1 FLAD1-R1 TTNGGRTGNGTRTTYTCCAT FLAD1-F2 TGYAARGCNTTYTTYGGNACNGA Round 2 FLAD1-R2 TTNACNCKCATRAAYTCNGGCCA
383 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Table 3. Information on Drawida species included in this analysis. Specimen ID Species Location GPS coordinates Accession Number COI 28S AKAP17 FLAD1 HNLN-GR-I1_02 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288546 PQ432438 PQ452820 – HNLN-GR-I2_23 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288549 PQ432440 PQ452819 PQ452822 HNLN-GR-I2_19 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288547 – – – HNLN-GR-I2_20 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288548 – – – HNLN-GR-I2_24 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288550 – – – HNLN-GR-I2_25 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288551 – – – HNLN-GR-I2_26 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288552 PQ432439 PQ452818 PQ452823 HNLN-GR-I2_27 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288553 PQ432436 PQ452817 PQ452824 HNLN-GR-I2_28 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288554 – – – HNLN-GR-I2_29 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288555 PQ432437 PQ452816 PQ452825 HNLN-GR-I2_30 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288556 – – – HNLN-GR-I2_31 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288557 – – – HNLN-GR-I2_32 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288558 – – – HNLN-GR-I2_44 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288562 – – – HNLN-GR-I2_45 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288563 – – – HNLN-GR-I2_46 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288564 – – – HNLN-GR-I2_47 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288565 – – – HNLN-GR-I2_48 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288566 – – – HNLN-GR-I2_49 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288567 – – – HNLN-GR-I2_50 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288568 – – – HNLN-GR-I2_51 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288569 PQ432444 – – HNLN-GR-I2_52 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288570 – – – HNLN-GR-I2_53 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288571 PQ432445 PQ452812 – HNLN-GR-I2_54 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288572 PQ432446 PQ452811 PQ452821 HNLN-GR-I2_55 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288573 – – – HNLN-GR-I2_56 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288574 – – – HNLN-GR-I2_57 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288575 – – – HNLN-GR-I2_58 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288576 – – –
384 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Specimen ID Species Location GPS coordinates Accession Number COI 28S AKAP17 FLAD1 HNLN-GR-I3_03 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288579 – – – HNLN-GR-I3_06 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288580 – – – HNLN-GR-I3_29 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288581 PQ432449 – – HNLN-GR-I3_43 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288582 – – – HNLN-GR-I3_46 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288583 – – – HNLN-GR-I4_14 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288585 – – – HNLN-GR-I4_17 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288588 – – – HNLN-GR-I4_18 D. henanensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288589 – – – EF077597 D. henanensis sp. nov. China, Huang et al. 2007 –EF077597 – – – EF077598 D. henanensis sp. nov. China, Huang et al. 2007 –EF077598 – – – EF077599 D. henanensis sp. nov. China, Huang et al. 2007 –EF077599 – – – EF077600 D. henanensis sp. nov. China, Huang et al. 2007 –EF077600 – – – w13 D. sinensis sp. nov. South Korea, Blakemore et al. 2014 –w13 – – – HNLN-GR-I2_40 D. sinensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288561 PQ432443 PQ452813 PQ452830 HNLN-GR-I2_34 D. sinensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288559 PQ432441 PQ452815 PQ452828 HNLN-GR-I3_47 D. sinensis sp. nov. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288584 – – – HNLN-GR-I4_20 D. japonica s. s. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288590 – – – HNLN-GR-I4_15 D. japonica s. s. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288586 – – – HNLN-GR-I4_16 D. japonica s. s. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288587 – – – HNLN-GR-I3_02 D. japonica s. s. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288578 PQ432448 PQ452809 PQ452827 HNLN-GR-I2_36 D. japonica s. s. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288560 PQ432442 PQ452814 PQ452829 HNLN-GR-I3_01 D. japonica s. s. China: Henan: Luoyang: Luoning 34.4364°N, 111.6368°E PQ288577 PQ432447 PQ452810 PQ452826 GQ500902 D. japonica s. s. Japan: Shiga-ken: Hikone-shi 35.16°N, 136.16°E GQ500902 – – – JET101_11 D. japonica s. s. Japan, Blakemore et al. 2014 –JET101_11 – – – JET116_11 D. japonica s. s. Japan, Blakemore et al. 2014 –JET116_11 – – – JET117_11 D. japonica s. s. Japan, Blakemore et al. 2014 –JET117_11 – – – KF205976 D. japonica s. s. China: Shanghai 31.1477°N, 121.3613°E KF205976 – – – LFSF_003 D. gisti China: Hebei: Langfang 39.5222°N, 116.6644°E PQ675805 PQ675807 PQ683865 PQ683867 E07_01 D. gisti China: Tianjin: Binhai 39.0800°N, 117.6963°E PQ675804 PQ675808 PQ683864 PQ683866 rameters (θs) and the species divergence times (τs) (Yang 2002; Rannala and Yang 2003; Burgess and Yang 2008). The second analysis, designated as A10, involved the species delimitation using a fixed guide tree. The within-model parameter posterior was generated by running A00 (Yang and Rannala 2010; Rannala and Yang 2013). The measurement of both the θs and τs parameters
385 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex was achieved through the utilization of the sequence distance or the expected number of mutations or substitutions per site (Flouri et al. 2018). The inverse-gamma prior IG (3, 0.005) was assigned for θs and the divergence time at the root of the species tree (τ0), with a mean of 0.005/(3 - 1) = 0.0025. Moreover, priors for the remaining τ parameters estimated for internal nodes were specified by a uniform Dirichlet distribution (Yang and Rannala 2010). Phylogenetic analysis The maximum likelihood (ML) and Bayesian inference (BI) methods were employed to construct phylogenetic trees, with analyses based on mitochondrial (COI), and the mito-nuclear combined dataset (COI, 28S, AKAP17 and FLAD1). Drawida gisti was designated as the outgroup. The determination of the most suitable substitution model for each gene employed in phylogenetic analysis was performed using jModelTest 2.1 (Darriba et al. 2012) based on the Akaike Information Criterion: TPM3uf+I+G for COI, and GTR+I+G for the combined dataset. ML analysis was executed using the RAxML 8.0 software (Stamatakis 2014), with 1,000 bootstrapping replicates and default parameter settings. The optimal tree was constructed through the use of the RAxML program, with the GTRGAMMA model. BI analysis was performed using MrBayes v. 3.2.6 (Ronquist et al. 2012), and run for two million generations, with a sampling frequency of 1,000 generations, to ensure that the average standard deviation of split frequencies was less than 0.01. The results of the p-files of BI were examined in Tracer v. 1.7.2 (Rambaut et al. 2018), and effective sampling size (ESS) values larger than 200 were accepted. The resulting trees were then subjected to visual analysis and subsequent editing using FigTree v. 1.4.4. Abbreviations ag accessory gland; gm genital markings; amp ampulla; vd vas deferens; ts testis sacs; sp spermathecal pore; mp male pore; prg prostate gland; cl clitellum; oc ovary chamber; p prostomium; os ovisacs; fp female pore. Table 4. The genetic distance of K2P of the species of Drawida (values in %, indicating intra-species genetic distance in parentheses). Species 1 2 3 4 5 6 7 8 9 1D. henanensis sp. nov. (0–6.5) 2D. japonica s. s. 15.4–18.0 (0–9.6) 3D. sinensis sp. nov. 15.4–18.8 15.1–17.1 (0.5–9.8) 4D. gisti 19.3–22.1 18.5–20.0 17.0–17.9 (0.2) 5D. hattamimizu 19.3–22.3 18.1–20.5 18.1–20.2 19.1–19.7 (0.2) 6D. ghilarovi 18.1–21.4 18.7–20.5 16.4–19.3 17.6–18.7 14.5–16.5 (2.1) 7D. ganini 18.7–20.2 21.7–22.7 20.2–23.6 22.7–23.7 18.5–19.7 14.0–15.1 (0.9) 8D. koreana 17.1–18.4 7.4–8.3 14.5–15.7 18.3 19.6–19.9 18.5–19.1 20.2–20.8 (0.5) 9D. barwelli 21.8–25.0 22.3–23.6 18.5–20.6 20.4 20.6–20.9 19.6–20.0 20.6–0.9 22.6–22.9 (0)
392 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Figure 4. Drawida japonica sensu stricto (Michaelsen, 1892). Luoning, Chinese sample (HNLN-GR-I3_02). A. Ventral view of the prostomium; B. Dorsal view of clitellum region; C1, C2. Ventral view of male pores, genital markings, and spermathecal pores; D1, D2. Ventral view of gizzards; E1, E2. Ventral view of ovary chamber and ovisacs; F1, F2. Right testis sac, vas deferens, and prostate gland; G1, G2. Ventral view of spermathecae. Scale bars: 0.5 mm. specimens. A comprehensive morphological description of the D. japonica s. s. specimens from Japan, along with relevant supplementary information is provided in Blakemore and Kupriyanova (2010) and Blakemore et al. (2014).
393 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Molecular species delimitation The molecular species delimitation analyses were conducted using three approaches: ASAP, GMYC, and BPP. The results obtained from ASAP and GMYC analyses based on COI and 28S were consistent with the morphological data identifying D. henanensis sp. nov., D. japonica s. s., and D. sinensis sp. nov. as valid species, except for the GMYC analysis based on COI, which oversplit D. henanensis sp. nov. and D. sinensis sp. nov. (Fig. 5). Furthermore, the BPP analyses of the dataset combining all the gene fragments (COI, 28S, AKAP17 and FLAD1) revealed that three of the delimited species exhibited posterior probabilities of 1.0 or close, aligning with the described morphospecies. In addition, the intraand inter-specific sequence divergences of the D. japonica species complex was calculated using the K2P model based COI (see Table 3). The results indicate that the inter-specific sequence divergence exceeds 15%, and the intra-specific sequence divergence for D. henanensis sp. nov., D. japonica s. s., and D. sinensis sp. nov. ranged from 0–6.5%, 0–9.6%, and 0.5–9.8%, respectively. Phylogenetic relationship of D. japonica species complex The integration of available data from GenBank and relevant literature was employed to reconstruct the phylogenetic relationships of 55 COI sequences of the D. japonica species complex, using the ML and BI methods. The phylogenetic tree of COI (Fig. 6) demonstrated that the earthworm samples of this study collected from Luoning (Henan, China) are primarily scattered into three well-supported clades, with a strongly supported bootstrap value (BV) above 85% and a posterior probability (PP) of 100%. The known samples from China (EF077597–EF077600) Figure 5. Species delimitation of the Drawida japonica species complex. The vertical bar shows the number of species delimited by morphological characteristics and molecular data. 0.002 MORPHO ABGD GMYC BPP COI ABGD 28S 28SCOI GMYC D. japonica s. s. D. henanensis sp. nov. D. sinensis sp. nov. HNLN_GR_I2_40 HNLN_GR_I2_34 HNLN_GR_I3_02 HNLN_GR_I3_01 HNLN_GR_I2_36 HNLN_GR_I2_51 HNLN_GR_I2_53 HNLN_GR_I3_29 HNLN_GR_I2_54 HNLN_GR_I2_26 HNLN_GR_I2_27 HNLN_GR_I2_23 HNLN_GR_I2_29 HNLN_GR_I1_02
394 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex (Huang et al. 2007), Lake Biwa (JET101, JET116, JET117) (Blakemore et al. 2014) and Hikone (GQ500902) (Blakemore and Kupriyanova 2010) in Japan, as well as the samples from Gyungsanbuk in South Korea (w13) (Blakemore et al. 2014), are scattered in three clades: D. henanensis sp. nov., D. japonica s. s., and D. sinensis sp. nov., respectively (Fig. 6). Furthermore, the results of the phylogenetic analyses provided substantial support, with the BV exceeding 95% and the PP reaching 100% in the combined dataset based on COI, 28S, AKAP17, and FLAD1 (Fig. 7). Discussion Drawida is the most widely distributed genus in the family Moniligastridae, with most of its species confined to their areas of origin in the Indo-Asian region (Narayanan et al. 2024a). Among the various Drawida species, D. japonica s. l., D. barwelli, and D. nepalensis are classified as peregrine species (Misirlioğlu et al. 2023; Narayanan et al. 2024a). The distribution of the D. japonica species complex has been documented in South and East Asia (Zhang et al. 2012; Kumari et al 2021; Narayanan et al. 2024a; Bi et al. 2025). However, D. japonica s. l. possesses one of the weakest locomotive abilities among earthworms, as evidenced by extensive fieldwork conducted by researchers that indicates the possibility of undiscovered species within this species complex. Figure 6. Likelihood tree based on the COI of the Drawida japonica species complex using the Maximum Likelihood method and Bayesian Inference. Samples collected in China, South Korea and Japan are highlighted in color; sequences newly generated in this study are indicated by a yellow background. Node labels show maximum-likelihood bootstrap percentages (left slash) and Bayesian posterior probabilities (right slash). Values below 50% for bootstrap and 80% for posterior probability are considered weak support and have been omitted. 0.08 JET101_11 PQ288552 (HNLN-GR-I2_26) EF077599 PQ675805 (LFSF_003) PQ288562 (HNLN-GR-I2_44) GQ500902 PQ288547 (HNLN-GR-I2_19) PQ288565 (HNLN-GR-I2_47) PQ288549 (HNLN-GR-I2_23) PQ288568 (HNLN-GR-I2_50) JET116_11 PQ288573 (HNLN-GR-I2_55) PQ288555 (HNLN-GR-I2_29) EF077598 PQ288579 (HNLN-GR-I3_03) PQ288557 (HNLN-GR-I2_31) PQ288590 (HNLN-GR-I4_20) PQ288575 (HNLN-GR-I2_57) PQ288587 (HNLN-GR-I4_16) PQ288554 (HNLN-GR-I2_28) PQ288567 (HNLN-GR-I2_49) PQ675804 (E07_01) PQ288548 (HNLN-GR-I2_20) PQ288569 (HNLN-GR-I2_51) PQ288586 (HNLN-GR-I4_15) EF077597 PQ288589 (HNLN-GR-I4_18) PQ288581 (HNLN-GR-I3_29) PQ288559 (HNLN-GR-I2_34) PQ288588 (HNLN-GR-I4_17) w13 PQ288563 (HNLN-GR-I2_45) PQ288583 (HNLN-GR-I3_46) PQ288572 (HNLN-GR-I2_54) PQ288558 (HNLN-GR-I2_32) PQ288580 (HNLN-GR-I3_06) JET117_11 PQ288553 (HNLN-GR-I2_27) PQ288550 (HNLN-GR-I2_24) PQ288578 (HNLN-GR-I3_02) PQ288561 (HNLN-GR-I2_40) EF077600 PQ288574 (HNLN-GR-I2_56) PQ288546 (HNLN-GR-I1_02) PQ288582 (HNLN-GR-I3_43) KF205976 PQ288577 (HNLN-GR-I3_01) PQ288584 (HNLN-GR-I3_47) PQ288556 (HNLN-GR-I2_30) PQ288570 (HNLN-GR-I2_52) PQ288560 (HNLN-GR-I2_36) PQ288583 (HNLN-GR-I3_46) PQ288566 (HNLN-GR-I2_48) PQ288576 (HNLN-GR-I2_58) PQ288585 (HNLN-GR-I4_14) PQ288571 (HNLN-GR-I2_53) PQ288551 (HNLN-GR-I2_25) D. gisti Drawida japonica species complex D. henanensis sp. nov. D. japonica s. s. D. sinensis sp. nov. 100/100 89/100 100/100 -/86 95/100 66/- China: Purple Korea: Orange Japan: Blue
395 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Traditionally, D. japonica s. l. has been considered as a single species, likely due to its extremely similar external morphology and small size, as well as the lack of detailed differentiation in morphological characteristics, leaving its taxonomic status unresolved (Blakemore and Kupriyanova 2010; Blakemore et al. 2014; Kumari et al. 2021; Bora et al. 2024). The use of an integrative taxonomy approach, characterized by the careful examination of both the external and internal morphological characteristics of the species complex in conjunction with the integration of molecular data (including mitochondrial and nuclear markers), facilitates the delineation of more differentiated lineages or species. Meticulous documentation of external characteristics is imperative. Such examination must include the shape of male pores and spermathecal pores, the presence or absence of penis and female pore, the location of the clitellum, and the number of genital markings. Moreover, certain features, such as setae, male pores, and genital markings, are challenging to discern under a stereomicroscope. For example, in the work of Qin et al. (2025) on the description of new subspecies of Eisenia nordenskioldi (Eisen, 1978) from northeastern China, the distance between setae at different body segment positions was explored and showed to be a very useful character for species delimitation. These features may require the use of an electron microscope to obtain clearer images. The Figure 7. Phylogeny of the Drawida japonica species complex reconstructed from the concatenated COI, 28S, AKAP17 and FLAD1 datasets. Node labels show maximum-likelihood bootstrap percentages (left slash) and Bayesian posterior probabilities (right slash). Bootstrap values < 50% and posterior probabilities < 80% are omitted. 0.03 HNLN-GR-I3_29 HNLN-GR-I2_56 HNLN-GR-I2_50 HNLN-GR-I2_34 HNLN-GR-I2_36 LFSF-003 HNLN-GR-I4_16 HNLN-GR-I2_23 HNLN-GR-I2_48 HNLN-GR-I4_17 HNLN-GR-I4_15 HNLN-GR-I2_40 HNLN-GR-I2_51 HNLN-GR-I3_02 HNLN-GR-I2_49 HNLN-GR-I2_31 HNLN-GR-I3_01 HNLN-GR-I4_18 HNLN-GR-I4_20 HNLN-GR-I3_03 HNLN-GR-I2_28 HNLN-GR-I2_20 HNLN-GR-I2_46 HNLN-GR-I3_43 HNLN-GR-I2_55 HNLN-GR-I2_44 E07-01 HNLN-GR-I1-02 HNLN-GR-I3_47 HNLN-GR-I2_24 HNLN-GR-I2_27 HNLN-GR-I4_14 HNLN-GR-I2_52 HNLN-GR-I2_45 HNLN-GR-I2_54 HNLN-GR-I2_53 HNLN-GR-I2_25 HNLN-GR-I2_26 HNLN-GR-I2_30 HNLN-GR-I2_57 HNLN-GR-I2_32 HNLN-GR-I2_19 HNLN-GR-I3_06 HNLN-GR-I2_29 HNLN-GR-I3_46 HNLN-GR-I2_47 HNLN-GR-I2_58 D. gisti D. henanensis sp. nov. D. japonica s. s. D. sinensis sp. nov. 100/100 100/100 97/100 100/100 51/97 59/100 Drawida japonica in fieldwork, photoghraphed by Huifeng Zhao 100/100 species complex Drawida japonica
396 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex following internal characteristics are also of particular importance: the size and shape of the spermathecal ampulla; the length and coiling degree of spermathecal ducts and vas deferens; the shape, location, and size of the atrium; the location of the testis sacs and ovisacs; and the number and location of the gizzards. Notably, certain characteristics, including both external and internal morphological characteristics, are not clearly discernible under a stereomicroscope. Line drawings are employed to elucidate the essential characteristics, including the morphology of the male and spermathecal pores, the degree of coiling of the spermathecal ducts and the vas deferens of testis sacs, and the dimensions and configuration of the spermathecal atrium. Molecular species delimitation employs DNA data to objectively detect potential independent evolutionary lineages (candidate species) using distance-, monophylyor coalescent-based models, and then integrates morphological, ecological, and geographical evidence to reach a final taxonomic decision (Padial et al. 2010). This study combined ASAP, GMYC, and BPP for delimitation, revealing that GMYC based solely on COI exhibited excessive splitting (Fig. 5). This discrepancy can be attributed to that COI is a rapidly evolving marker prone to accumulating variation within populations, whereas GMYC relies on branch-length rate conversion, which often misinterprets population differentiation as speciation events rather than genuine species formation (Ballard and Whitlock 2004; Talavera and Vila 2011; Papadopoulou et al. 2013; Zhang et al. 2019). By contrast, 28S exhibits evolutionary conservation and exclusively captures species-level disparities, whereas ASAP utilizes genetic distance barcode gap analysis, a method less susceptible to influence by population-level variation, thereby yielding more robust delimitation outcomes (Carstens et al. 2013; Kapli et al. 2017). The COI sequences labeled as D. japonica which are obtained from China, Japan, and South Korea (Table 1) resolved into three well-supported, reciprocally monophyletic clades—D. sinensis sp. nov., D. japonica s. s., and D. henanensis sp. nov.—demonstrating that the name has been applied to a diversified assemblage rather than to a single species (Fig. 6). Pairwise K2P distances among these clades exceed 15%, a threshold widely regarded as indicative of interspecific divergence within Drawida (Huang et al. 2007; Thakur et al. 2021; Nguyen et al. 2022; Liu et al. 2025), and this molecular delimitation is corroborated by discrete morphological characters. Consequently, comprehensive integrative revision of the D. japonica species complex is urgently required to delimitate its constituent taxa and clarify their nomenclatural status. Figure 8. The spermathecal atrium of three species of Drawida japonica species complex. A. Drawida henanensis sp. nov. (HNLN-GR-I2_34); B. Drawida sinensis sp. nov. (HNLN-GR-I1_02); C. Drawida japonica (HNLN-GR-I3_02).
397 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Additional information Conflict of interest The authors have declared that no competing interests exist. Ethical statement No ethical statement was reported. Use of AI No use of AI was reported. Funding This research was funded by the Hebei Natural Science Foundation (C2025408018), the Program of Central Guidance Fund for Local Science and Technology Development (246Z2907G; 236Z3807G), by the China National Tobacco Corporation of Science and Technology Major Projects (110202201018 [LS-02]), and by the Langfang Science and Technology Support Program (2020013151). Author contributions Conceptualization, Liu M. and Zhao H.; specimen identification, Liu M. and Miao P.; methodology and experiments, Liu M. and Zhao H.; data analysis, Liu M., Miao P. and Zhao H.; writing – original draft preparation, Liu M., Miao P. and Zhao H.; writing – review and editing, Liu M., Aspe NM. Zhang Y. and Zhao H. Author ORCIDs Min Liu https://orcid.org/0009-0002-0090-6219 Zheng Liu https://orcid.org/0000-0002-2631-4302 Nonillon M. Aspe https://orcid.org/0000-0003-0025-6017 Yufeng Zhang https://orcid.org/0000-0002-4066-6355 Huifeng Zhao https://orcid.org/0000-0003-4243-9671 Data availability All of the data that support the findings of this study are available in the main text. References Anderson FE, Williams BW, Horn KM, Erséus C, Halanych KM, Santos SR, James SW (2017) Phylogenomic analyses of Crassiclitellata support major Northern and Southern Hemisphere clades and a Pangaean origin for earthworms. BMC Evolutionary Biology 17(1): 123. https://doi.org/10.1186/s12862-017-0973-4 Aspe NM, James SW (2018) Molecular phylogeny and biogeographic distribution of pheretimoid earthworms (Clitellata: Megascolecidae) of the Philippine archipelago. European Journal of Soil Biology 85: 89–97. https://doi.org/10.1016/j.ejsobi.2018.02.001 Aspe NM, Zhao H, Mapile MRF, Obusan MCM, Zhang Y, Castañares E, Florida EJD, Wu D (2025) Three new species and a new record of pheretimoid earthworms (Crassiclitellata, Megascolecidae) from Misamis Oriental, Philippines, with data from the mitochondrial genome. Zoosystematics and Evolution 101(1): 389–404. https:// doi.org/10.3897/zse.101.135702
398 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Ballard JWO, Whitlock MC (2004) The incomplete natural history of mitochondria. Molecular Ecology 13(4): 729–744. https://doi.org/10.1046/j.1365-294X.2003.02063.x Ballard JWO, Whitlock MC (2022) The changing role of mitochondrial DNA in evolutionary studies. Trends in Ecology & Evolution 37(11): 989–998. Beddard FE (1893) On some new species of earthworms from various parts of the world. Proceedings of the Zoological Society of London, 690 pp. Bely AE, Wray GA (2004) Molecular phylogeny of naidid worms (Annelida: Clitellata) based on cytochrome oxidase I. Molecular Phylogenetics and Evolution 30(1): 50– 63. https://doi.org/10.1016/S1055-7903(03)00180-5 Bernt M, Bleidorn C, Braband A, Dambach J, Donath A, Fritzsch G, Golombek A, Hadrys H, Jühling F, Meusemann K, Middendorf M, Misof B, Perseke M, Podsiadlowski L, von Reumont B, Schierwater B, Schlegel M, Schrödl M, Simon S, Stadler P, Stöger I, Struck T (2013) A comprehensive analysis of bilaterian mitochondrial genomes and phylogeny. Molecular Phylogenetics and Evolution 69(2): 352–364. https://doi. org/10.1016/j.ympev.2013.05.002 Bi Y, Fan Y, Cheng X, Li N, Wang S, Zhang H, Zhang Y, Zhao H (2025) Earthworm Diversity of Tianjin, China. Chinese Journal of Soil Science 56(6): 1756–1763. Blakemore RJ (2012) Cosmopolitan Earthworms—an Eco-Taxonomic Guide to the Peregrine Species of the World. 5th Edition. Yokohama, 850 pp. https://doi. org/10.12651/JSR.2012.1.1.035 Blakemore RJ, Kupriyanova EK (2010) Unraveling some Kinki worms (Annelida: Oligochaeta: Megadrili: Moniligastridae) – Part I. Opuscula Zoologica Budapest 41: 3–18. https://doi.org/10.3897/zookeys.41.374 Blakemore RJ, Kupriyanova E, Grygier MJ (2010) Neotypification of Drawida hattamimizu Hatai, 1930 (Oligochaeta: Megadrili: Moniligastridae) as a model linking mtDNA (COI) sequences to an earthworm type, with a response to the ‘Can of Worms’ theory of cryptic species. ZooKeys 41: 1–29. Blakemore RJ, Lee S, Seo H-y (2014) Reports of Drawida (Oligochaeta: Moniligastridae) from far East Asia. Journal of Species Research 3(2): 127–166. https://doi. org/10.12651/JSR.2014.3.2.127 Bora S, Melkani DC, Kumar A, Arya M, Kumar K, Sharma NP, Bisht SS (2024) Earthworm (Oligochaeta) diversity of Kumaun Himalaya with a new record of Drawida japonica (Michaelsen, 1892) (Moniligastridae) from Nainital, Uttarakhand, India. Journal of Threatened Taxa 16(6): 25446–25452. https://doi.org/10.11609/jott.8102.16.6.25446-25452 Burgess R, Yang Z (2008) Estimation of hominoid ancestral population sizes under Bayesian coalescent models incorporating mutation rate variation and sequencing errors. Molecular Biology and Evolution 25(9): 1979–1994. https://doi.org/10.1093/ molbev/msn148 Carstens BC, Pelletier TA, Reid NM, Satler JD (2013) How robust is species delimitation using single-locus data? Systematic Biology 62(6): 951–963. https://doi.org/10.1093/ sysbio/syt046 Chen Y (1933) A preliminary survey of the earthworms of the lower Yangtze Valley. Contributions from the Biological Laboratory of the Science Society of China. Zoology: Analysis of Complex Systems, ZACS 9: 177–295. Chen Y (1936) On the terrestrial Oligochaeta from Szechuan II with the notes on Gates’ types. Contributions of Biological Laboratory of Science Society of China (Zoology) 11: 269–306. Chen Y (1946) On the terrestrial Oligochaeta from Szechwan III. Journal of the West China Border Research Society 16: 83–141.
399 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Chen Y, Li S, Zhang H (2023) Mitochondrial DNA limitations in resolving species boundaries and evolutionary histories. Molecular Phylogenetics and Evolution 185: 107892. https://doi.org/10.1016/j.ympev.2023.107892 Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: More models, new heuristics and parallel computing. Nature Methods 9(8): 772. https://doi.org/10.1038/nmeth.2109 Drummond A, Suchard M, Xie D, Rambaut A (2012) Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution 29(8): 1969–1973. https://doi. org/10.1093/molbev/mss075 Easton EG (1981) Japanese earthworms: A synopsis of the Megadrile species (Oligochaeta). Bulletin of the British Museum of Natural History 40: 33–65. Ezard TH, Fujisawa T, Barraclough TG (2017) split: Species Limits and Phylogenetic Analysis (Version 1.0-19) [R Package]. Flouri T, Jiao X, Rannala B, Yang Z (2018) Species Tree Inference with BPP Using Genomic Sequences and the Multispecies Coalescent. Molecular Biology and Evolution 35(10): 2585–2593. https://doi.org/10.1093/molbev/msy147 Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. Fujisawa T, Barraclough TG (2013) Delimiting species using single-locus data and the Generalized Mixed Yule Coalescent approach: A revised method and evaluation on simulated data sets. Systematic Biology 62(5): 707–724. https://doi.org/10.1093/sysbio/syt033 Gao Y, Zhang Y, Dietrich CH, Duan Y (2021) Phylogenetic analyses and species delimitation of Nephotettix Matsumura (Hemiptera: Cicadellidae: Deltocephalinae: Chiasmini) in China based on molecular data. Zoologischer Anzeiger 293: 202–214. https://doi.org/10.1016/j.jcz.2021.06.011 Gates GE (1935) On some Chinese earthworms. Lingnan Science Journal 14: 445–458. Gates GE (1936) On some earthworms from the Cameron Highlands, Pahang. Bulletin of Raffles Museum, Singapore 12: 87–117. Gates GE (1939) On some species of Chinese earthworms, with special reference to specimens collected in Szechwan by Dr. D.D. graham. Proceedings of the United States National Museum 86(3040): 405–507. https://doi.org/10.5479/si.00963801.3040.405 Gates GE (1972) Burmese earthworms. An introduction to the systematics and biology of megadrile oligochaetes with special reference to southeast Asia. Transactions of the American Philosophical Society 62(7): 1–326. https://doi.org/10.2307/1006214 Huang J, Xu Q, Sun Z, Tang GL, Su Z (2007) Identifying earthworms through DNA barcodes. Pedobiologia 51(4): 301–309. https://doi.org/10.1016/j.pedobi.2007.05.003 Hurst GD, Jiggins FM (2005) Problems with mitochondrial DNA as a marker in population, phylogeographic and phylogenetic studies: The effects of inherited symbionts. Proceedings. Biological Sciences 272(1572): 1525–1534. https://doi.org/10.1098/rspb.2005.3056 James S, Davidson S (2012) Molecular phylogeny of earthworms (Annelida : Crassiclitellata) based on 28S, 18S and 16S gene sequences. Invertebrate Systematics 26(2): 213–229. https://doi.org/10.1071/IS11012 Jamieson BGM (1977) On the phylogeny of the Moniligastridae, with description of new species of Moniligaster (Oligochaeta, Annelida). Evolutionary Theory 2: 95–114. Kapli P, Lutteropp S, Blaxter M (2017) DELINEATE: Species delimitation in the age of big data. Systematic Biology 66(5): 829–840. https://doi.org/10.1093/sysbio/syx015 Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16(2): 111–120. https://doi.org/10.1007/BF01731581
400 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Kobayashi S (1940a) Terrestrial Oligochaeta from Manchoukuo. The Science Reports of the Tohoku Imperial University, Series 4 15: 261–315. Kobayashi S (1940b) The origin of Drawida japonica in Japan. Science, Tokyo 10: 504. [in Japanese] Kumari S, Kumari C, Narayanan SP, Dev K, Julka JM (2021) Phylogenetic relatedness of Drawida japonica (Michaelsen, 1892) and Drawida nepalensis Michaelsen, 1907 (Clitellata: Moniligastridae) from the Western Himalaya, India. Annals of Biology 37(1): 36–41. Liu M, Li J, Zhang Y, Aspe NM, Wu D, Zhao H, Zheng G (2025) A new species of the Drawida ghilarovi species complex (Oligochaeta, Moniligastridae) in Changbai Mountain, Northeast China. Zoosystematics and Evolution 101(2): 627–641. https:// doi.org/10.3897/zse.101.146587 Marchán DF, Decaëns T, Domínguez J, Novo M (2022) Perspectives in Earthworm molecular phylogeny: Recent advances in Lumbricoidea and standing questions. Diversity 14(1): 30. https://doi.org/10.3390/d14010030 Marchán DF, Navarro AM, Pinadero SJ, Gerard S, Hedde M, Domínguez J, Decaëns T, Novo M (2023) Understanding the diversification and functional radiation of Aporrectodea (Crassiclitellata, Lumbricidae) through molecular phylogenetics of its endemic species. European Journal of Soil Biology 119: 103559. https://doi.org/10.1016/j.ejsobi.2023.103559 Michaelsen W (1892) Terricolen der Berliner Zoologischen Sammlung. II. Archiv für Naturgeschichte 58(1): 209–261. [in german] https://doi.org/10.5962/bhl.part.8321 Michaelsen W (1900) Das Tierreich 10. Vermes, Oligochaeta. Friedländer & Sohn, Berlin, 575 pp. [in german] https://doi.org/10.5962/bhl.title.11605 Michaelsen W (1910) Oligochäten von verschiedenen gebieten. Mitteilungenausdem Naturhistorischen Museums in Hamburg. Beiheft zum Jahrbuch der Hamburgischen Wissenschaflichen Anstalten, 49 pp. [in German] Michaelsen W (1927) Oligochäten aus Yünnan gesammelt von Prof. F. Silvestri. Bollettino del laboratorio di Zoologia. Portici 21: 84–90. [in German] Michaelsen W (1931) The Oligochaeta of China. Peking Natural History Bulletin 5(3): 1–25. Misirlioğlu M, Reynolds JW, Stojanović M, Trakić T, Sekulić J, James SW, Csuzdi C, Decaëns T, Lapied E, Phillips HRP, Cameron EK, Brown GG (2023) Earthworms (Clitellata, Megadrili) of the world: An updated checklist of valid species and families, with notes on their distribution. Zootaxa 5255(1): 417–438. https://doi.org/10.11646/zootaxa.5255.1.33 Narayanan SP, Sathrumithra S, Christopher G, Julka JM (2017) New species and new records of earthworm of the genus Drawida from Kerala part of the Western Ghats biodiversity hotspot, India (Oligochaeta, Moniligastridae). ZooKeys 691: 1–18. https://doi.org/10.3897/zookeys.691.13174 Narayanan SP, Paliwal R, Kurien VT, Thomas AP, Julka JM (2023) Earthworms (Clitellata: Moniligastrida, Crassiclitellata) of India: distribution and status. 1st Edition. Department of Printing and Publishing, Mahatma Gandhi University, Kottayam, 378 pp. Narayanan SP, Paliwal R, Thomas AP, Julka JM (2024a) Catalogue of the moniligastrid earthworms (Clitellata, Moniligastrida, Moniligastridae) of the world. Zootaxa 5416(1): 1–66. https://doi.org/10.11646/zootaxa.5416.1.1 Narayanan SP, Jose D, Bijoy C, Kurien VT, Thomas AP (2024b) On three new species of the earthworm genus Drawida Michaelsen, 1900 (Clitellata: Moniligastridae) from south-western India. Zootaxa 5541(4): 563–581. https://doi.org/10.11646/zootaxa.5541.4.8 Narayanan SP, Ahmed S, Thomas AP (2025) Description of a new species of the earthworm genus Moniligaster Perrier, 1872 (Clitellata, Moniligastridae) from the Nilgiri Biosphere Reserve of Tamil Nadu State, India. Zootaxa 5589(1): 142–154. https://doi.org/10.11646/zootaxa.5589.1.12
401 ZooKeys 1264: 377–402 (2025), DOI: 10.3897/zookeys.1264.170881 Min Liu et al.: Two new species of Drawida japonica species complex Nguyen TT, Lam DH, Tran BTT, Nguyen AD (2022) Two new Drawida (Oligochaeta, Moniligastridae) earthworms from Vietnam. ZooKeys 1099: 41–56. https://doi. org/10.3897/zookeys.1099.72112 Osigus HJ, Eitel M, Bernt M, Donath A, Schierwater B (2013) Mitogenomics at the base of Metazoa. Molecular Phylogenetics and Evolution 69(2): 39–351. https://doi. org/10.1016/j.ympev.2013.07.016 Padial JM, Miralles A, De la Riva I, Vences M (2010) The integrative future of species delimitation. Trends in Ecology & Evolution 25(9): 531–539. https://doi.org/10.1016/j. tree.2010.05.009 Papadopoulou A, Anastasiou I, Vogler AP (2013) Species delimitation using GMYC and ABGD: A comparison using COI data from noctuid moths. Systematic Biology 62(6): 983–997. https://doi.org/10.1093/sysbio/syt059 Patwardhan A, Ray S, Roy A (2014) Molecular Markers in Phylogenetic Studies-A Review. Journal of Phylogenetics & Evolutionary Biology 2(2): 131. https://doi. org/10.4172/2329-9002.1000131 Pérez-Losada M, Ricoy M, Marshall JC, Domínguez J (2009) Phylogenetic assessment of the earthworm Aporrectodea caliginosa species complex (Oligochaeta: Lumbricidae) based on mitochondrial and nuclear DNA sequences. Molecular Phylogenetics and Evolution 52(2): 293–302. https://doi.org/10.1016/j.ympev.2009.04.003 Perrier E (1872) Recherche pour servir à l’historie des Lombriciensterrestres. Archives du Muséum d’Histoire Naturelle, Paris 8: 5–198. https://doi.org/10.5962/bhl.title.12201 Plytycz B, Bigaj J, Osikowski A, Hofman S, Falniowski A, Panz T, Grzmil P, Vandenbulcke F (2018) The existence of fertile hybrids of closely related model earthworm species, Eisenia andrei and E. fetida. PLOS ONE 13(1): e0191711. https://doi.org/10.1371/ journal.pone.0191711 Puillandre N, Lambert A, Brouillet S, Achaz G (2021) ASAP: Assemble species by automatic partitioning. Molecular Ecology Resources 21(2): 609–620. https://doi. org/10.1111/1755-0998.13281 Qin M, Zhao H, Zhang Y, Han ACN, Shehovtsov SV, Wu D, Aspe NM (2025) Description of three new subspecies of Eisenia nordenskioldi (Annelida: Crassiclitellata) from Northeastern China. Zootaxa 5642(3): 225–244. https://doi.org/10.11646/zootaxa.5642.3.2 Rambaut A (2022) Figtree 1.4.4. http://tree.bio.ed.ac.uk/software/figtree/ [accessed on 1 July 2022] Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA (2018) Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Systematic Biology 67(5): 901–904. https://doi.org/10.1093/sysbio/syy032 Rannala B, Yang Z (2003) Bayes estimation of species divergence times and ancestral population sizes using DNA sequences from multiple loci. Genetics 164(4): 1645–1656. Rannala B, Yang Z (2013) Improved Reversible Jump Algorithms for Bayesian Species Delimitation. Genetics 194(1): 245–253. https://doi.org/10.1093/genetics/164.4.1645 Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029 Scullion J, Malik A (2000) Earthworm activity affecting organic matter, aggregation and microbial activity in soils restored after opencast mining for coal. Soil Biology & Biochemistry 32(1): 119–126. https://doi.org/10.1016/S0038-0717(99)00142-X Seesamut T, Oba Y, Jirapatrasilp P, Martinsson S, Lindström M, Erséus C, Panha S (2024) Global species delimitation of the cosmopolitan marine littoral earthworm