High diversity and new species of meiofaunal Nerillidae (Annelida) in subtidal sediments and anchialine caves of the East China Sea

1 European Journal of Taxonomy 1021: 1–54 https://doi.org/10.5852/ejt.2025.1021.3075 europeanjournaloftaxonomy.eu ISSN 2118-9773 2025 · Worsaae K.et al. This work is licensed under a Creative Commons Attribution License (CC BY 4.0) Received: 5 January 2025 • Accepted: 22 May 2025 • Published: 26 September 2025 Topic editor: Magalie Castelin • Section editor: Nataliya Budaeva • Desk editor: Pepe Fernández Monograph urn:lsid:zoobank.org:pub:07E3FF98-E70A-4E83-94EA-1FBCF60236D5 High diversity and new species of meiofaunal Nerillidae (Annelida) in subtidal sediments and anchialine caves of the East China Sea Katrine WORSAAE 1,* , Malte J. HANSEN 2 , Éloïse DEFOURNEAUX 3 , Jørgen OLESEN 4 , Jiseon PARK 5 , Taeseo PARK 6 & Yoshihisa FUJITA 7 1,2,3 Marine Biological Section, Department of Biology, University of Copenhagen, Universitetsparken 4, 2100-DK Copenhagen, Denmark. 4 Natural History Museum of Denmark, University of Copenhagen, Universitetsparken 15, 2100 Copenhagen Ø, Denmark. 5 Institute for Data Innovation in Science, Seoul National University, Seoul, 08826, Republic of Korea. 6 Biodiversity Research Department, National Institute of Biological Resources, Incheon, 22689, Republic of Korea. 7 Okinawa Prefectural University of Arts, 1-4 Shuri-Tounokura, Naha, Okinawa 903-8602, Japan. * Corresponding author: [email protected] 2 Email: [email protected] 3 Email: [email protected] 4 Email: [email protected] 5 Email: [email protected] 6 Email: [email protected] 7 Email: [email protected] Abstract. Nerillidae is the most species-rich, meiofaunal, annelid family, but little is known about its diversity and distribution in the Northwest Pacific. Four sampling campaigns to Jeju Island, South Korea, and the Ryukyu Islands, Japan, retrieved an unexpectedly high diversity of about 17 nerillid species in subtidal and submarine cave localities of the East China sea, with only Nipponerilla irabuensis Worsaae, Hansen & Fujita in Worsaae et al., 2021 previously described. Bayesian inference and maximum likelihood methods were performed on datasets of concatenated gene sequences (18S rRNA, 28S rRNA, COI, and H3) comprising a total of 55 terminals from 11 different genera of Nerillidae. Integrating detailed morphological assessments (light-, scanning electron-, and confocal laser scanning microscopy) with molecular analyses, we here describe seven new species and a new genus, Cirrinerilla gen. nov. None of the species show geographical overlap between South Korea and the Ryukyu Islands, possibly due to oceanographic and anchialine dispersal barriers and poor dispersal capabilities of Nerillidae. However, two congeneric terminals of Meganerilla and two of Leptonerilla from different islands of the Ryukyus show relatively high molecular similarity, suggesting recent vicariance of these populations (or species). The anchialine caves hold a remarkably high diversity of nerillids compared to coastal subtidal localities, supporting a preadaptation of Nerillidae to these isolated habitats under freshwater influence. This study underlines the need for further exploration of the unique anchialine habitats as well European Journal of Taxonomy 1021: 1–54 (2025) 2 as additional subtidal meiofauna surveys in the East China Sea, for shedding further light on benthic diversifications and colonizations in this region. Keywords. Interstitial, hidden biodiversity, Stygobiota, molecular phylogeny, evolution. Worsaae K., Hansen M.J., Defourneaux É., Olesen J., Park J., Park T. & Fujita Y. 2025. High diversity and new species of meiofaunal Nerillidae (Annelida) in subtidal sediments and anchialine caves of the East China Sea. European Journal of Taxonomy 1021: 1–54. https://doi.org/10.5852/ejt.2025.1021.3075 Introduction The East China Sea covers an area of about 770 000 km2 and extends from Taiwan in the south to the Korean Peninsula in the north (Liu 2013; Wang et al. 2014). The shallow continental shelf of East China and Korea extends across most of the East China Sea, but to the southeast, it transitions into the Okinawa Trough along the Ryukyu Islands, where depths reach down to 2700 meters (Wang et al. 2014; Gallagher et al. 2015). Within the limits of the Okinawa Trough flows the Kuroshio Current, a warm water western boundary current which enters the East China Sea east of Taiwan and exits west of South Korea (Veron 1992; Liu 2013; Wang et al. 2014). While rocky coastline and tidal flats occur along the south coast of South Korea (Chough et al. 2000; Saito & Alino 2008; Eisma 2010), the Japanese coastline bordering the East China Sea is somewhat different, mostly with cliffs on the western coast of Kyushu Island and fringing reefs being common in the Ryukyu Islands (Veron 1992; Fujikura et al. 2010; Koike 2010; Nakae et al. 2018; Reimer et al. 2019). Mangrove forests also occur in the Ryukyu Archipelago, along with tidal flats, estuaries, small coves, and sandy beaches (Koike 2010; Fujita et al. 2015; Nakae et al. 2018). Limestone formations are common throughout the Ryukyu Archipelago (Takayasu 1978; Fujita et al. 2015), and the dissolution of this limestone has created submarine cave systems in many of the islands. Exploration of these caves and the associated fauna has mostly been performed in the central and southern regions of the archipelago (e.g., Hayami & Kase 1993; Shimomura et al. 2012; Fujimoto & Miyazaki 2013; Fujimoto 2015; Naruse & Fujita 2015; Chiu et al. 2017; Shimomura & Fujita 2017, 2021; Kakui & Fujita 2018, 2022; Komai & Fujita 2018; Okanishi & Fujita 2018; Osawa & Fujita 2019, 2022; Saito & Fujita 2022; Ise et al. 2023; Shimada et al. 2023; Fujita & Naruse 2024), covering a variety of simple euhaline to more complex anchialine cave systems (Hayami & Kase 1993; Osawa & Fujita 2019). Meiobenthic diversity and taxonomic studies have historically been mostly focused on European and North American waters (Giere 2009). South Korean and Japanese meiobenthos studies have mainly examined hard-bodied ecdysozoans such as nematodes, harpacticoid copepods, and ostracods, presumably due to better preservation in bulk fixed samples and their high densities and diversity in meiofaunal communities (Kim et al. 2000; Shimada et al. 2009; Pavlyuk & Trebukhova 2011; Shimada & Kajihara 2014; Motokawa & Kajihara 2017; Lee et al. 2019; Atherton & Jondelius 2020; Kang & Kim 2020). Soft-bodied annelids have received less attention, even though they are highly abundant in most meiofauna samples (Giere 2009). Up to this day, only two species belonging to the exclusively meiofaunal families of Annelida Lamarck, 1802 are recorded from South Korea, Pharyngocirrus uchidai Sasaki, 1981 and Polygordius pacificus Uchida, 1935 (Uchida 1935; Sasaki 1981; Di Domenico et al. 2014). However, a recent PhD study indicates a much higher diversity of interstitial annelids in this area (Park 2023). Japan has more records and several descriptions of meiofaunal annelids, primarily from the intertidal and supratidal zones of the larger islands (i.e., Hokkaido, Honshu, and Kyushu). These include species of Aricidea Webster, 1879, Dimorphilus Worsaae, Kerbl, Vang & Gonzalez, 2021, Diurodrilus Remane, 1925, Dorvillea Parfitt, 1866, Goniadides Hartmann-Schröder, 1960, Hesionides Friedrich, 1937, Hesionura Hartmann-Schröder, 1958, Microphthalmus Mecznikow, 1865, Ophryotrocha WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 3 Claparède & Mecznikow, 1869, Pharyngocirrus Di Domenico, Martínez, Lana & Worsaae, 2014, Pisione Grube, 1857, Polygordius Schneider, 1868, Protodrilus Hatschek, 1881, Trilobodrilus Remane, 1925, Ctenodrilus Claparède, 1863, and Stygocapitella Knöllner, 1934 (see Yamanishi 1983; Jimi 2024 and references therein). Still, the most species-rich meiofaunal family, Nerillidae Levinsen, 1883, has not been reported from South Korea except in the PhD study by Park (Park 2023), and only two nerillids have so far been found in Japanese waters (Worsaae et al. 2021a). The recently discovered cave species and genus, Nipponerilla irabuensis Worsaae, Hansen & Fujita, 2021 from the Miyako Islands (Ryukyu Archipelago) is the only nerillid described from Japan (Worsaae et al. 2021b). Moreover, the European Nerilla mediterranea Schlieper, 1925 has been reported from Japan (Yamanishi 1983); however, the exact species identity warrants further examination. Additionally, Nerillidium orientalis (Tzetlin & Larionov, 1988) (original genus name Akessoniella) is described from Sakhalin and Kunashir Island near Hokkaido (Tzetlin & Larionov 1988; Worsaae 2005a) and Nerilla jouini Saphonov & Tzetlin, 1988 from Popov Island in Peter the Great Gulf, Sea of Japan (Saphonov & Tzetlin 1988). Nerillidae consists of 61 species in 15 genera (Worsaae 2020; Worsaae et al. 2021a, 2021b; Mendes et al. 2024). All nerillids are marine or brackish, except for a single limnic species (Troglochaetus beranecki Delachaux, 1921). The family is distributed worldwide, with species recorded from supratidal pools to the deep-sea. Most species live in the interstices of coarse subtidal sediment in coastal areas, while some prefer muddy or silty sediments. Others have been found in bacterial mats and diatom carpets on lapilli, and one species is even associated with hydrothermal vent areas (Worsaae & Kristensen 2005; Worsaae & Rouse 2009; Worsaae 2020, 2021). Anchialine cave systems have been documented to house a remarkable diversity of nerillids (Worsaae et al. 2004, 2009, 2019a, 2019b, 2021a, 2021b; CuriniGalletti et al. 2012; Martínez et al. 2019; Gonzalez et al. 2021). Species distributions are usually limited (sometimes to the type locality) due to their small size and lack of dormant or larval dispersal stages (except in Paranerilla Jouin & Swedmark, 1965) (Worsaae 2005a, 2021). Climatic conditions, special habitat demands, or isolation may also affect the distribution of Speleonerilla Worsaae, Sterrer & Iliffe, 2018 and Nipponerilla Worsaae, Hansen & Fujita, 2021, only found in anchialine caves, and similar to Leptonerilla Westheide & Purschke, 1996 only recorded from tropical and subtropical localities (Worsaae 2021). Exceptionally, Nerilla antennata Schmidt, 1848 has been reported from both sides of the Atlantic and the Pacific Oceans, as well as from the Indian Ocean (Worsaae 2021 and references therein). However, for nerillids, such extensive reported geographical ranges generally reflect a lack of detailed morphological examinations or cryptic diversity (Schmidt & Westheide 1998; Worsaae et al. 2019a, 2021a; Worsaae 2021). Nerillids have seven to nine segments, simple or compound chaetae, and single or double interramal parapodial cirri, the interramal cirri being an autapomorphy of the family. Paired pigmented eyes can be found on the prostomium, which furthermore carries up to three antennae and two palps or horns. The pygidium usually carries two cirri and sometimes additional pygidial lobes. The size and shape of cirri, antennae and palps vary significantly within the family. The exact combination of these traits is used to diagnose the genera (Worsaae 2021; Worsaae et al. 2021a, 2021b). Nerillid body length ranges from 0.3 mm (Bathychaetus heptapous Faubel, 1978) to 2.1 mm (Meganerilla swedmarki Boaden, 1961). A locomotory midventral ciliary band extending from the mouth to the pygidium facilitates gliding over surfaces, whereas longitudinal muscles and other ciliary bands may facilitate swimming. Additional ciliary groups (tufts, bands, bandlets, fields or patches) of potential systematic significance may be found on the dorsal, ventral and lateral surfaces of the head and body, typically at the level of parapodia or between parapodia, accompanied by discrete ciliation on cirri and palps and pygidial lobes (Worsaae 2005a, 2021; Westheide 2008). External ciliation and openings are best observed using scanning electron European Journal of Taxonomy 1021: 1–54 (2025) 4 microscopy. Nerillids can be gonochoristic or hermaphroditic and all examined species exhibit direct development (except for Paranerilla) (Jouin & Swedmark 1965; Jouin 1968; Worsaae & Müller 2004; Westheide 2008; Worsaae 2021). One pair of oviducts and one to three pairs of spermioducts have been detected, with either separate or common gonopores (Worsaae & Müller 2004). External brooding is seen in Mesonerilla Remane, 1949, Nerillidium Remane, 1925 and Nerillidopsis Jouin, 1967, with Mesonerilla intermedia Wilke, 1953 and M. laerkae Worsaae, Mikkelsen & Martínez, 2019 additionally possessing a protective brooding hood (Jouin 1968; Westheide 2008; Worsaae et al. 2019a). The configuration of the ciliated gonoducts can be species or clade-specific and can best be examined with confocal laser scanning microscopy of cilia labelled with immunostaining against tubulin (Worsaae & Müller 2004). Our study unveils a high diversity of Nerillidae in the East China Sea, collected during expeditions between 2015 and 2019 to Jeju Island in South Korea and several localities of the Ryukyu Islands, Japan. Light-, scanning electronand confocal laser scanning microscopy, as well as molecular data are used to morphologically and genetically describe seven new species, including one new genus. The lack of well-preserved material prevented a full description of nine additional, potentially new species; however, genetic data (in addition to sparse morphological information) were obtained from these individual populations for later reference. The interrelationship of all species from the East China Sea was assessed through phylogenetic analyses of four gene markers (18S rRNA, 28S rRNA, COI and H3), including a total of 55 terminals (and 11 genera) of Nerillidae. Morphological and molecular phylogenetic data are discussed in relation to the diversification and biogeography of Nerillidae in the East China Sea. Material and methods Sampling Specimens were collected between 2015 and 2019 in the northern and southern regions of the East China Sea, south of Jeju Island, South Korea and around Iriomote, Miyako and Okinawa Islands of the Ryukyu Archipelago, Japan (see Fig. 1 for map of sampling localities). Samples of fine sand to coral rubble were collected by scuba divers in the subtidal zones of coral reefs as well as in anchialine caves. In the caves, meiofauna was further collected by towing of a 30 cm wide conical 63 or 100 µm plankton net close to the bottom and through the water column, sometimes while stirring up the upper layers of fine, silty sediment. Additionally, a slurp gun was used for sampling in crevicular spaces. Animals were extracted from sediment samples using the MgCl2 decantation technique and a 63 µm mesh (Higgins & Thiel 1988), sorted out alive using an Olympus SZX16 or SZ51 dissecting scope and, when possible, photographed via mounted cameras (IDS UI-3140CP-C-HQ Rev.2 or an iPhone X combined with iDu Optics LabCam™ microscope adapter). Samples collected by plankton towing and slurp gun were sorted out directly without prior MgCl2 decantation. Sorted animals were subsequently anesthetized with a 1:1 isotonic MgCl 2 /seawater solution and fixed for their respective microscopic or molecular analytical purposes: i) 2–4% trialdehyde solution (0.1 M cacodylate buffer with 5–7% sucrose) for 24 hrs at 4°C (stored in 0.1 M cacodylate buffer; for SEM), ii) 2% paraformaldehyde solution (in PBS (phosphate buffered saline) with 5–7% sucrose) for 18–24 h at 4°C or for 30 min–2 h at room temperature, followed by up to six rinses in PBS (stored in PBS with 0.05% NaN3; for CLSM), or iii) stored in 99% ethanol (for DNA extraction). Molecular analyses Genetic datasets include 55 terminals belonging to 11 different genera of Nerillidae, resulting in the most comprehensive phylogeny of the family to date. Selection of terminals was based on the availability of complete or partial sequences of at least two out of the following four genes: the nuclear gene markers 18S rRNA (1800 bp), 28S rRNA (1100 bp) and H3 (330 bp), and the mitochondrial gene marker COI (650 bp). New sequences were obtained from 17 potentially new species of Nerillidae collected from WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 5 Fig. 1. Map of sampling localities in the East China Sea. A. Overview map, red and blue circles indicating study areas in Japan and South Korea (modified from Weese et al. 2016). B. Map of the Ryukyu Islands (Japan), red dots showing sampling localities (modified from Weese et al. 2016). C. Map of Jeju Island (South Korea), blue dots showing sampling localities (modified from Chan et al. 2018). European Journal of Taxonomy 1021: 1–54 (2025) 6 the East China Sea and two additional species from Trinidad and Tobago (Aristonerilla sp. 1) and Italy (Micronerilla sp. 1). These data were combined with available nerillid data from GenBank, including Nipponerilla irabuensis from Japan (Worsaae et al. 2021b). Collection sites and available sequences of the included terminals are listed in Table 1. DNA of specimens fixed in 99% ethanol was extracted using the Qiagen DNeasy® Blood and Tissue kit, following the manufacturer’s instructions. DNA elution was performed twice with 80 µl elution buffer into two separate extraction samples. Polymerase chain reaction (PCR) solutions consisted of a total volume of 25 µl with 1–1.5 µl DNA template, 4–5 µl HOT FIREPol ® Blend Master Mix (Solis Biodyne, 04-25-00115), 1–1.5 µl of each primer (10 µm) and 15–17 µl UV-sterilized Milli-Q (adjusted to DNA template and primer volume). PCR protocols were performed on a Bio-Rad S100 Thermal Cycler with reaction solutions first being heated to 94°C for 13 min, followed by 35–42 cycles of denaturation (94°C for 30–40 s), annealing (45–55°C (depending on primer specificity, see Table 2) for 30–40 s) and extension (68–72°C for 45–90 s). Subsequently, a final extension phase at 72°C for 5 min was carried out. Single primer pairs were used to amplify the selected fragments of 28S rDNA, COI and H3, while two and sometimes three overlapping fragments were needed to amplify the 18S rDNA fragment. Details of primers are described in Table 2. Gel electrophoresis (1% agarose with GelRed® (Biotium, 41003)) was used to check for contamination and assess amplicons, and amplified sequences were afterwards purified with an E.Z.N.A.® Cycle Pure Kit (Omega Bio-tek). Sequencing was performed by Macrogen Europe (Amsterdam, Netherlands). Sequences were processed and examined for chromatogram misreads and contamination in Sequencher ver. 4.10.1 (GeneCodes Corporation, Ann Arbor, MI, USA) or Geneious Prime ver. 2021.2.2 (Dotmatics) (https://www.geneious.com). Consensus sequences were verified for contamination on the NCBI Standard Nucleotide Blast online platform, using the BLAST tool (Basic Local Alignment Search Tool). All newly generated sequences were deposited in GenBank®. Sequences were aligned using MAFFT ver. 7.450 (Katoh et al. 2002; Katoh & Standley 2013) as implemented in Geneious. The E-INS-i algorithm was selected for nuclear markers (18S rDNA and 28S rDNA), while the G-INS-I one was used for the protein-coding genes (COI and H3). Default parameters were applied for all alignments (Gap open penalty: 1.53, Offset value: 0.123, Scoring matrix: 200 PAM/k = 2). As they show no variation in length, protein-coding gene alignments were trivial. However, to verify the presence of stop codons and indels, they were translated to amino acid sequences in Geneious. Alignments for each gene marker were edited and trimmed before being concatenated using the ‘Concatenate Sequences or Alignments’ tool in Geneious. The third codon of the COI alignment was excluded in the phylogenetic analyses shown in Fig. 2, due to genetic saturation, which was tested with the program DAMBE ver. 7.2.25 (Xia 2017). Phylogenetic tree reconstructions were performed using both Maximum Likelihood (ML) and Bayesian Inference (BI) methods. ML analyses were conducted with IQ-TREE 2 ver. 2.2.6 (Minh et al. 2020), while BI analyses were executed using MrBayes ver. 3.2.7a (Ronquist & Huelsenbeck 2003) via the CIPRES Science Gateway online platform (Miller et al. 2010). To determine the most suitable nucleotide substitution models, jModelTest (Posada 2008) integrated in IQ-TREE was employed, with model selection based on the Bayesian Information Criterion (BIC), choosing the GTR+F+I+G4 model. Nodal support was calculated by ultrafast bootstrapping with 1500 replicates (Hoang et al. 2018). MrBayes was run twice for 15 million generations, with tree-sampling every 1000 generations and 3.75 million generations discarded as burn-in, using one cold and three heated chains. The GTR+I+ Γ model was selected. Proper convergence and parameter mixing were found using Tracer ver. 1.7.1 (Rambaut et al. 2018). Unrooted trees were generated and subsequently edited using FigTree ver. 1.4.4. The pairwise sequence similarity of individual gene fragments, trimmed before primers, was calculated with MEGA X ver. 10.1.18 (Kumar et al. 2018). The Kimura 2-parameter distance model (Kimura 1980) WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 7 Table 1 (continued on next page). Molecular data of nerillid species used in phylogenetic analyses and morphological techniques used to investigate each species. New sequences marked in bold. Species ID extraction Cave Locality GenBank accession numbers LM SEM CLSM 18S rRNA 28S rRNA COI H3 Aristonerilla brevis KW019 Düsseldorf Aquarium, Germany AY859530 MK579428 MK579454 MK579473 x x x Aristonerilla sp. 1 KW138 Tobago, Trinidad & Tobago PQ149833 PQ149815 PQ570583 – – – – Cirrinerilla sulcipalpata gen. et sp. nov. KW820 ‘Unnamed Cave’ Ie Isl. (island), Okinawa, Japan PQ149834 PQ149816 PQ570584 PQ421127 x x x Cirrinerilla sulcipalpata gen. et sp. nov. KW826 ‘Unnamed Cave’ Ie Isl., Okinawa, Japan PQ149835 PQ149817 PQ570585 PQ421126 x x x Leptonerilla westheidei sp. nov. KW708 Beomseom Isl., Jeju Isl., South Korea PQ149836 – PQ570586 PQ421134 x x – Leptonerilla diatomeophaga KW228 Jameos del Agua Lanzarote, Spain MK579404 MK579429 MK579455 MK579474 x – – Leptonerilla prospera KW018 Walsingham Cave Bermuda MH395342 MH395352 MH395369 MH395358 x – x Leptonerilla sp. 1 KW158 Scripps Aquarium, San Diego, USA MH395340 MH395353 MH395370 MH395361 – – – Leptonerilla sp. 2 KW779 Devil’s Hole Cave Shimoji Isl., Miyako Isl. Group, Japan PQ149837 PQ149818 PQ570587 PQ421129 – – – Leptonerilla sp. 3 KW815 ‘Unnamed Cave’ Ie Isl., Okinawa, Japan PQ149838 PQ149819 PQ570588 PQ421128 – – – Leptonerilla purschkei sp. nov. KW783 Devil’s Hole Cave Shimoji Isl., Miyako Isl. Group, Japan PQ149839 PQ149820 PQ570589 PQ421135 x x x Meganerilla cesari KW270 Túnel de la Atlántida Lanzarote, Spain MK579405 MK579431 – MK579475 x x x Meganerilla iensis sp. nov. KW816 Ie Isl., Okinawa, Japan PQ149840 PQ149821 PQ570590 PQ421132 x x – Meganerilla sp. 1 KW782 Irabu Isl., Miyako Isl. Group, Japan PQ149841 PQ149822 PQ570591 PQ421131 – – – Meganerilla sp. 2 KW823 Munseom Isl., Jeju Isl., South Korea PQ149842 PQ149823 PQ570592 PQ421133 – – – Mesonerilla armoricana KW250 Grotta di Nereo West Sardinia, Italy MH395337 MH395351 – MH395359 x x – Mesonerilla aryae KW342 Punta del Hidalgo, Tenerife, Spain MK579419 MK579445 MK579466 MK579489 – x x Mesonerilla biantennata KW244 Sardinia, Italy MK579421 MK579446 MK579468 MK579491 x x x Mesonerilla cf. luederitzi KW247 Tenerife, Spain MK579417 MK579443 MK579465 MK579487 x x x Mesonerilla cf. luederitzi KW227 Gran Canaria, Spain MK579412 MK579438 MK579460 MK579482 – x x Mesonerilla cf. luederitzi KW240 Mala, Lanzarote, Spain MK579414 MK579440 MK579462 MK579484 x x x Mesonerilla cf. luederitzi KW056 Marie Celeste Wreck, Bermuda MK579408 – MK579458 MK579478 x – x Mesonerilla fagei KW291 Primel, Roscoff, France MH395336 MH395350 – MH395360 x x – Mesonerilla gamaglandulata sp. nov. KW811 ‘Unnamed Cave’ Ie Isl., Okinawa, Japan PQ149843 PQ149824 PQ570593 PQ421136 x x x Mesonerilla harubangi sp. nov. KW714 Seopseom Isl., Jeju Isl., South Korea PQ149844 – PQ570594 – – x – Mesonerilla intermedia KW229 Sardinia, Italy MK579413 MK579439 MK579461 – – x x Mesonerilla intermedia KW243 Cueva del Palo Mallorca, Spain MK579415 MK579441 MK579463 MK579485 x x x Mesonerilla katharinae KW246 Bocas, Panama MK579416 MK579442 MK579464 MK579486 x x x Mesonerilla laerkae KW380 Massachusetts, USA MK579420 – MK579467 MK579490 x x x Mesonerilla peteri KW024 Tobago, Trinidad & Tobago – MK579433 MK579457 MK579477 – – x Mesonerilla roscovita KW084 Trezen ar Skoden, Roscoff, France MK579422 – – MK579492 x – – Mesonerilla runae KW271 Túnel de la Atlántida Lanzarote, Spain – MK579444 PQ570595 MK579488 x x x Mesonerilla xurxoi KW086 Jameos del Agua Lanzarote, Spain MK579410 MK579436 – MK579480 x x x Mesonerilla sp. 1 KW057 Lizard Isl., Australia MK579409 – MK579459 MK579479 x – x European Journal of Taxonomy 1021: 1–54 (2025) 8 Species ID extraction Cave Locality GenBank accession numbers LM SEM CLSM 18S rRNA 28S rRNA COI H3 Mesonerilla sp. 2 KW023 Roscoff, France MK579406 MK579432 MK579456 MK579476 – – x Mesonerilla sp. 3 KW814 Iriomote Isl., Okinawa, Japan PQ149845 PQ149825 PQ570596 PQ421139 – – – Mesonerilla sp. 4 KW827 Ie Isl., Okinawa, Japan PQ149846 PQ149826 PQ570597 PQ421138 – – – Mesonerilla dannyi sp. nov. KW824 Munseom Isl., Jeju Isl., South Korea PQ149847 PQ149827 PQ570598 – – – – Micronerilla minuta KW022 Roscoff, France AY859533 PQ149828 PQ570599 PQ421130 – – – Micronerilla sp. 1 KW550 Punta Campanella, Napoli, Italy PQ149848 PQ149829 PQ570600 – – – – Nerillidium gracile KW145 Gullmarsfjorden, Kristineberg, Sweden MK579426 MK579451 MK579470 MK579495 x x – Nerillidium sp. 2 KW813 Ie Isl., Okinawa, Japan PQ149849 PQ149830 PQ570601 PQ421140 x – – Nerillidium troglochaetoides KW151 Bonden Isl., Kristineberg, Sweden MK579427 MK579452 MK579471 MK579496 x x – Nerillidium sp. 1 KW825 Munseom Isl., Jeju Isl., South Korea PQ149850 PQ149831 PQ570602 – – – – Nipponerilla irabuensis KW772 Devil’s Hole Cave Shimoji Isl., Miyako Isl. Group, Japan MW691176 MW691180 MW691186 MW691188 x x x Paranerilla sp. KW030 Disko Isl., Greenland AY859539 – – MK579497 x x x Speleonerilla calypso KW058 Cherokee Road Exten Abaco, Bahamas MH395335 MH395345 MH395365 MH395355 x x x Speleonerilla isa KW362 Túnel de la Atlántida Lanzarote, Spain MH395341 MH395346 MH395366 MH395357 x x x Speleonerilla salsa KW713 Ciénaga de Zapata South Cuba MH395343 MH395349 MH395362 MW691189 x x x Speleonerilla saltatrix KW017 Roadside Cave Bermuda MH395334 MH395344 MH395363 MH395354 x x x Speleonerilla sp. A KW624 Hoyo Verde Cave Holguin, Northeast Cuba MH395339 MH395348 MH395367 MH395356 x x – Speleonerilla sp. B KW530 Taj Mahal & 27 Steps Cenotes Akumal, México MH395338 MH395347 MH395364 MW691190 x – x Speleonerilla sp. C KW775 Conch Bar Cave Middle Caicos, Turks & Caicos MW691177 MW691179 MW691184 MW691191 x x x Trochonerilla mobilis KW031 Denmark’s Aquarium, Denmark AY834759 MK579453 MK579472 – – – – Trochonerilla sp. 1 KW821 ‘Unnamed Cave’ Ie Isl., Okinawa, Japan PQ149851 PQ149832 PQ570603 PQ421137 x – – Table 1 (continued). Molecular data of nerillid species used in phylogenetic analyses and morphological techniques used to investigate each species. New sequences marked in bold. WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 9 was employed, with nucleotide substitution rates following a gamma distribution and deletion of pairwise gaps (see Supp. file 1). No DNA voucher material is available since the DNA was extracted from whole specimens collected at the new species’ type locality. Morphological examination Light microscopy examinations of preserved specimens were done irrespective of their fixation and storage medium. Specimens were mounted on slides before being examined on an Olympus IX70 inverted compound microscope with CellSens Entry ver. 1.9 software and photographed with a mounted Olympus DP73 camera. Preparation for scanning electron microscopy (SEM) involved post-fixation of trialdehyde-fixed specimens in 1% osmium tetroxide in demineralized water for 1 h, several rinses in Milli-Q water, dehydration through an ascending ethanol series to 100% and transfer of specimens to 100% acetone. Specimens were then critical point-dried and mounted on aluminium stubs before being sputter coated with platinum-palladium and imaged with a JEOL JSM-6335F field emission scanning electron microscope at the Natural History Museum of Denmark (NHMD), University of Copenhagen. Immunolabelling of paraformaldehyde-fixed specimens for confocal laser scanning microscopy (CLSM) was performed by preincubating specimens in PTA (PBS rinsing buffer with 0.1% Triton X-100, 0.25% bovine serum albumin and 0.05% NaN3) for 2 h followed by incubation in the primary antibody (monoclonal mouse anti-acetylated α-tubulin (Sigma-Aldrich, T6793; dilution 1:400) for 36 h. Specimens were then rinsed at least 4–6 times over a span of 4 hrs in PBS and incubated in secondary antibodies anti-mouse cyanamine (CY5, Jackson Immunoresearch, 115-175-062; dilution 1:800) and phalloidin (Alexa Flour 488; 0.33 μM) in the dark for 16 h. All antibodies and phalloidin were diluted in PTA. Specimens were then rinsed four times over 4 h in PBS rinsing buffer, taken through a series Table 2. List of primers used in PCR amplification of 18S rRNA, 28S rRNA, COI and H3 fragments. Gene Primer name Dir. Primer sequence (5′→3′) Annealing temp. (°C) References 18S 18S1F F TACCTGGTTGATCCTGCCAGTAG 49 Giribet et al. 1996 18S5R R CTTGGCAAATGCTTTCGC Giribet et al. 1996 G51 F GGTTGATCCTGCCAGTAG Hillis & Dixon 1991 G747 R CGGTATCTGATCGTCTTCGA Ibrahim et al. 2011 G950 F GTTCGATTCCGGAGAGGGA Giribet et al. 1996 G951 R GAGTCTCGTTCGTTATCGGA Cohen et al. 2004 G952 F GCGAAAGCATTTGCCAAGMA Cohen et al. 2004 G944 R TGATCCTTCTGCAGGTTCACCTAC Cohen et al. 2004 28S G758 F ACCCGCTGAATTTAAGCAT 53 Brown et al. 1999 D3 R GACGATCGATTTGCACGTCA Vonnemann et al. 2005 COI dgLCO1490 F GGTCAACAAATCATAAAGAYATYGG 45 Meyer 2003 dgHCO2198 R TAAACTTCAGGGTGACCAAARAAYCA Meyer 2003 COI19f F CWAATCAYAAAGATATTGGAAC Colgan et al. 2001 COI726R R AATATAWACTTCWGGGTGACC Colgan et al. 2001 H3 af F ATGGCTCGTACCAAGCAGACVGC 53–55 Colgan et al. 1998 ar R ATATCCTTRGGCATRATRGTGAC Colgan et al. 1998 European Journal of Taxonomy 1021: 1–54 (2025) 16 Table 3. Selected character comparison of Cirrinerilla sulcipalpata gen. et sp. nov. with species of closely related genera from the phylogenetic analysis (Fig. 2). Asterisk (*), measurements obtained from illustrations in references 5–6; two asterisks (**), measurements estimated from photos of live specimens, relative to known body length of fixed specimen. Measurements of new species are based on all available specimens, including type material and live observations. Abbreviations: A = absent; ant = antenna; C = compound chaetae; excl. = excluding; G = gonochoristic; H = hermaphroditic; L = length; Lat = lateral; max = maximum; med = median; no. = number; P = present; para. = parapodia; S = simple chaetae; Segm = segment; W = width; ? = unknown. References: 1 = Müller 2002; 2 = Worsaae & Müller 2004; 3 = Swedmark 1959; 4 = Saphonov & Tzetlin 1997; 5 = Müller & Worsaae 2006; 6 = Tzetlin & Saphonov 1992. Species Body Antennae Palps Eyes Parapodial cirri Chaetae Reproduction No. segm Max L Max W excl. para. Wrinkled Med ant, max L Lat ant, max L Max L Segm I Max L Double Type Segm I, max no. Segm I, max L Segm II–VIII, max no. Segm II–VIII, max L Cirrinerilla sulcipalpata gen. et sp. nov. 8 684 127 A ? 400** 121 A A 310** A C 10 149 12 138 H Aristonerilla brevis,1, 2 7 670 100 A/P 330 320 60 A/P A 175 A C 12 200 16 190 G Micronerilla minuta1, 2, 3, 4 8 600 90 P 150 175 80 P A/P 150 A/P C ? ? ? ? G Trochonerilla mobilis, 2, 5, 6 8 620 150 A 5 5 50*5P A 110*6A S 15 100*69 105*6G WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 17 anterior ciliated ‘funnel’ and separate ventral openings (Figs 3H, 4E). Mature egg and many oocytes observed in a single specimen in segments IV–VI (Fig. 3B). Distribution and habitat ‘Unnamed Cave (or ‘Sho-doukutsu’)’, northeastern reef of Ie Island, Okinawa Prefecture, Ryukyu Islands, Japan. Marine anchialine cave with entrance from the reef slope at 17 meters depth and main tube penetrating about 50 meters under land (see Osawa & Fujita 2019 for the description of the cave). Specimens collected at 5–17 meters depth from plankton tow and sediment samples from the main tube and the anchialine right hall of the cave. Associated nerillids from the cave include Leptonerilla sp. 3, Mesonerilla gamaglandulata sp. nov. and Trochonerilla sp. 1. Molecular information Cirrinerilla sulcipalpata gen. et sp. nov. is nested within a fully supported larger clade comprising the sevento eight-segmented genera Trochonerilla, Micronerilla, and Aristonerilla (Fig. 2). Within this clade, Cirrinerilla gen. nov. is sister group to Aristonerilla (PP/BS: 1/92), together with Micronerilla constituting a fully supported subclade, sister to Trochonerilla. The phylogenetic analyses (Fig. 2) include two terminals of C. sulcipalpata found to represent identical haplotypes. Pairwise comparison of C. sulcipalpata gen. et sp. nov. sequence similarity to phylogenetic closely related species: 18S rRNA – 100% intraspecific similarity between the two C. sulcipalpata sequences – 89.28–93.59% similar to its sister group (Aristonerilla brevis (Saphonov & Tzetlin, 1997) and A. sp. 1); 28S rRNA – 100% intraspecific similarity – 66.21–66.38% similar to its sister group; COI – 100% intraspecific similarity – 74.67–80.44% similar to its sister group; H3 – 100% intraspecific similarity – 96.65% similar to its sister group. Remarks (see also Table 3 for genus comparisons) Cirrinerilla sulcipalpata gen. et sp. nov. shows closest morphological and molecular similarity to species of Aristonerilla and Micronerilla, and to a lesser degree to species of Trochonerilla. Species of all four genera have less than nine segments, three antennae, relatively long parapodial cirri, and are of similar small size. However, Cirrinerilla sulcipalpata differs from all species of these closely related genera by being hermaphroditic, having a cigar-shaped body narrowing in width anteriorly and posteriorly, and by having significantly longer and straighter palps with a dorsal longitudinal furrow. Moreover, it differs from species of Trochonerilla by having compound rather than capillary chaetae and by lacking dense transverse segmental ciliary bands. It also differs from species of Aristonerilla by having eight rather than seven segments and from species of Micronerilla by having only single rather than double parapodial cirri on each parapodium as well as only a single rather than two pairs of spermioducts. Therefore, we choose to erect the new genus Cirrinerilla gen. nov., since a designation of the new species to Aristonerilla, Micronerilla or Trochonerilla would otherwise result in a considerable ambiguity of their diagnostic genus characters (e.g., reproductive mode, segment number, chaetal type), generally assumed to be constant within the genera of Nerillidae (Jouin 1971; Tzetlin & Larionov 1988; Worsaae 2021; Worsaae et al. 2021a). Additionally, Cirrinerilla sulcipalpata gen. et sp. nov. differs from the closely related species of Aristonerilla and Micronerilla by having longer and straight (rather than wrinkled) antennae, lacking eyes, and having relatively longer parapodial cirri, especially on segment V. Noticeably, A. brevis is reported to sometimes possess comparatively much longer parapodial cirri on segment VII (Müller 2002). European Journal of Taxonomy 1021: 1–54 (2025) 18 Genus Leptonerilla Westheide & Purschke, 1996 Leptonerilla purschkei sp. nov. urn:lsid:zoobank.org:act:CAD96362-1FDA-4243-813E-4F2FBE68AA5E Figs 5–6; Table 4 Diagnosis A nine-segmented Leptonerilla diagnosed by a combination of following characteristics: three long antennae all distally wrinkled, median antenna shorter than lateral antennae. Segment I with cirriform, relatively short cirri and chaetae. Trunk segments with long, double parapodial cirri and long pygidial cirri, exceeding half of body length. Gonochoristic with one pair of oviducts in segment VIII, males not observed. Etymology The species is named in recognition of the annelid researcher Günter Purschke, who erected the genus Leptonerilla and described the morphologically highly similar L. diplocirrata Westheide & Purschke, 1996. The Japanese name for this new species is given here as ‘Shimoji-doukutsu-usamimi-gokai’ (meaning ‘Shimoji Island-cave dwelling-rabbit ear-bristle worm’ in English). Type material Holotype JAPAN • ♀ adult; Miyako Islands, Shimoji Island, ‘Akuma-no-yakata’ (Devil’s Hole); 24.82291° N, 125.13551° E; rubble at 22 meters depth; 26 Oct. 2018; Y. Fujita, M. Mizuyama, P.R. Møller and K. Worsaae leg.; NHMD 1842016 mounted on SEM stub. Paratype JAPAN • 1 ♀ adult; same data as for holotype; NHMD 1842017 as permanent whole mount. Representative DNA sequences GenBank accession numbers PQ149839 (nuclear 18S rRNA), PQ149820 (nuclear 28S rRNA), PQ570589 (nuclear H3) and PQ421135 (mitochondrial COI); from specimen with same collection data as holotype (Table 1). Description Measurements are based on LM of holotype, counts and ciliation from SEM; values for paratype are given in parentheses. Body with nine chaetigerous segments (Fig. 5A), total length about 940 µm (745 µm, n = 1). Segment lengths of holotype 97, 90, 104, 123, 115, 103, 101, 77, 68 µm, pygidium 37 µm long. Maximum width about 195 µm including parapodia (165 µm, n = 1), about 145 µm excluding parapodia (115 µm, n = 1). Max length of parapodium on segment I, 41 µm (38, n = 1), on segments II–IX, 45 µm (53 µm, n = 1). Prostomium with three long antennae wrinkled distally (Fig. 5C), often lost during fixation. Lateral antenna estimated length up to 485 µm (n = 1) (la, Fig. 5A, C), median antenna shorter than lateral antennae (ma, Fig. 5C) with estimated length up to 370 µm from photos of live specimen (n = 1). Prostomium with two club-shaped palps up to 78 µm long (65 µm, n = 1) and 31 µm wide (20 µm, n = 1), inserted ventrally on prostomium (pa, Figs 5A, C, 6A–B) with distinct ventral and frontal ciliation. Two dorsal eyes. Paired nuchal organs laterally between prostomium and peristomium (no, Fig. 6B). WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 19 Fig. 5. Leptonerilla purschkei sp. nov. A–B. Holotype, ♀ (NHMD 1842016), light microscopy (LM), dorsal view. A. Overview showing one lateral antenna and antennae scars (indicated by arrowheads). B. Parapodia on one side of the posterior segments showing compound chaetae and joints (indicated by arrowheads), along with cylindrical double interramal cirri. C. Live animal dissecting scope image, showing intact antennae and pygidial cirri (indicated by a dashed line), dorsal view. D–E. Paratype, ♀ (NHMD 1842017), confocal laser microscopy (CLSM) labeled with anti-acetylated α-tubulin, maximum intensity projections of z-stack, ventral view. D. Posterior end, oviducts opening in segment VIII. E. Right side of specimen showing four segmental nephridia opening in segments IV–VII. Abbreviations: bc = buccal cirrus; ch = chaetae; e = eye; la = lateral antenna; ma = median antenna; mo = mouth opening; n4–7 = nephridia in segments IV–VII; ov = oviduct; pa = palp; py = pygidium; pyc = pygidial cirrus; vnc = ventral nerve cord; I–IX = segments I–IX. European Journal of Taxonomy 1021: 1–54 (2025) 20 Segment I with a single, up to 73 µm long, cylindrical (cirriform) cirrus per parapodium (Figs 5A, 6B). Segments II–IX carrying double, cylindrical interramal parapodial cirri (pc, Figs 5B, 6A), up to 336 µm long, lengths seemingly increasing in posterior segments. Cylindrical pygidial cirri up to 590 µm long (pyc, Fig. 5C), estimated relative to body length from live specimen images. Compound chaetae in all segments (cc, Fig. 5B). Segment I with one bundle of up to 18 posteriorly pointing chaetae (up to 148 µm long) per parapodium (Fig. 6A–B). Following segments with dorsal and ventral bundles of chaetae; up to 20 chaetae per parapodia (up to 236 µm long) (Fig. 6A). Shaft up to 169 µm long, blade up to 82 µm long, distal extension on shaft at joint up to 15 µm long (Fig. 6C–D). Prostomium with anterior and posterior fields of presumed sensory cilia and lateral rows of cilia extending between lateral antenna and palp insertion (Fig. 6B). Paired, densely ciliated nuchal organs on lateral border between prostomium and segment I. Palps with ventral longitudinal dense ciliary row from insertion point to tip of palps, dorsal row of minimum 4 ciliary tufts on distal half of palp (each tuft with > 15 cilia), and lateral row of indistinct small tufts of cilia (Fig. 6B). Segment I with paired dorsolateral transverse rows of each two ciliary tufts (each tuft with > 20 cilia) at the level of parapodia. Following trunk segments with dorsal transverse continuous row of up to 14 ciliary tufts at level of parapodia (tdc, Fig. 6A–B); tufts increasing in numbers, ciliary length and showing remarkable density in posterior segments. Segment II with an additional lateral pair of longitudinal ciliary bandlets (ldc, Fig. 6B). Ventral ciliation could not be observed. Four pairs of segmental nephridia positioned laterally, parallel to ventral nerve cord, opening in segments IV, V, VI and VII (n4–n7, Fig. 5E). Enteronephridia not distinguished. Gonochoristic reproduction; females with one pair of straight oviducts opening latero-ventrally just anterior to the segmental nerve in segment VIII (ov, Fig. 5D). Spermioducts unknown. A single mature egg (about 80 µm long) observed in segments VI–VII (n = 2). Distribution and habitat Devil’s Hole ‘Akuma-no-yakata’, northwestern coast of Shimoji Island, Ryukyu Islands, Miyako Islands, Japan. Anchialine cave located on coral reef slope. Specimen collected from rubble patches in middle zone of cave at about 22 meters depth (see Osawa & Fujita 2019 for the description of the cave). Associated nerillids from the cave include Mesonerilla sp. (Worsaae, unpubl. record and not sequenced), N. irabuensis and Leptonerilla sp. 2. Molecular information Leptonerilla purschkei sp. nov. constitutes a fully supported clade with L. westheidei sp. nov. and Leptonerilla sp. 1 (Fig. 2). The clade is sister to a larger clade comprising the remaining Leptonerilla spp. Pairwise comparison of L. purschkei sp. nov. sequence similarity to other Leptonerilla spp.: 18S rRNA – 99.43–99.89% similar to its sister group (clade comprising L. westheidei sp. nov and L. sp. 1) – 97.13– 98.24% similar to the remaining Leptonerilla spp.; 28S rRNA – 96.16% similar to its sister group – 79.30–82.72% similar to the remaining Leptonerilla spp.; COI – 88.62–89.57% similar to its sister group – 79.12–80.40% similar to the remaining Leptonerilla spp.; H3 – 96.59% similar to its sister group – 88.09–89.31% similar to the remaining Leptonerilla spp. Remarks (see also Table 4 for Leptonerilla spp. comparisons) Leptonerilla purschkei sp. nov. shows the greatest morphological and molecular similarity to L. westheidei sp. nov., but differs from it by a larger body size, segment I with much shorter cirri, and double as many chaetae. Both species share a small body size compared to L. diatomeophaga (Núñez in Núñez, Ocaña & Brito, 1997) and especially L. prospera Sterrer & Iliffe, 1982 (Sterrer & Iliffe 1982; WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 21 Fig. 6. Leptonerilla purschkei sp. nov., holotype, ♀ (NHMD 1842016), scanning electron micrographs. A. Overview of entire specimen, dorsal view. B. Close-up of prostomium and two anterior segments, showing one left palp and antennae scars. C. Close-up of segment IV, left side, showing interramal parapodial cirrus. D. Close-up of dorsal compound chaetae of segment IV. Abbreviations: acf = anterior ciliary field; bc = buccal cirrus; bcs = buccal cirrus scar; cb = chaetal blade; cc = compound chaetae; cj = chaetal joint; cje = chaetal joint extension; cs = chaetal shaft; dcb = dorsal chaetal bundle; las = lateral antenna scar; ldc = longitudinal dorsal bandlet of cilia; mas = median antenna scar; no = nuchal organ; pa = palp; pc = parapodial cirrus; pcf = posterior ciliary field; pr = prostomium; py = pygidium; tdc = transverse dorsal row of cilia; vcb = ventral chaetal bundle; I–IX = segments I–IX. European Journal of Taxonomy 1021: 1–54 (2025) 22 Table 4. Selected morphological characters comparison in species of Leptonerilla Westheide & Purschke, 1996. All measurements in µm. Asterisk (*), measurements estimated from photos of live specimens, relative to known body length of fixed specimen. Measurements of new species are based on all available specimens, including type material and live observations. Abbreviations: ant = antenna; excl. = excluding; L = length; Lat = lateral; max = maximum; med = median; para = parapodia; segm = segment; W = width; ? = unknown. References: 1 = Núñez et al. 1997; 2 = Westheide & Purschke 1996; 3 = Sterrer & Iliffe 1982; Worsaae et al. 2009. Species Body Antennae Palps Parapodial cirri Pygidial cirri Chaetae Max L Max W excl. para Med ant, max L Lat ant, max L Max L Segm I, max L Segm I, shape Segm II–IX (double), max L Max L Segm I, max no. Segm I, max L Segm II–VIII, max no. Segm II–VIII, max L Leptonerilla purschkei sp. nov. 940 145 370* 485 78 73 Cirriform 336 590* 18 148 20 236 L. westheidei sp. nov. 705 130 ? ? 48 123 Cirriform 263 ? 9 135 18 195 L. diatomeophaga11200 210 200 250 27 30 Short 260 262 12 260 24 250 L. diplocirrata2690 90 250 215 56 50 Cirriform 215 270 20 (in 2 bundles) ? 20 ? L. prospera32050 420 650 600 230 30 Short 550 120 20 215 20 310 WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 23 Núñez et al. 1997; Worsaae et al. 2009). Leptonerilla purschkei differs from these latter two species by having longer cirriform, cylindrical parapodial cirri on segment I, although these are similar in shape and relative length to those of L. diplocirrata. Leptonerilla purschkei differs from all other species of Leptonerilla by the very long pygidial cirri and by the very long antennae, more than half the body length, with a wrinkled appearance, otherwise only described for the distantly related Micronerilla and Aristonerilla (Swedmark 1959; Saphonov & Tzetlin 1997; Müller 2002). It thereby also differs from the only other described species of Leptonerilla from the West pacific region, L. diplocirrata found more than 1000 kilometres away, near Hainan, China. Leptonerilla purschkei also differs molecularly from both L. sp. 2 found within the same cave and L. sp. 3 found further North off Okinawa in ‘unnamed cave’ of Ie Island. Both two latter potential new cave species were only found as single specimens with very limited morphological information obtainable prior to DNA extraction of all their tissue. Leptonerilla westheidei sp. nov. urn:lsid:zoobank.org:act:756B9FFA-2D1E-49B3-AF75-7558EF2FA291 Fig. 7; Table 4 Diagnosis A Leptonerilla diagnosed by a combination of following characteristics: three antennae, two clubshaped palps. Segment I with relatively long, unpaired, cylindrical cirri and few chaetae. Following trunk segments with long, double parapodial cirri. Gonochoristic; females with one pair of oviducts in segment VIII, males not observed. Etymology The species is named in recognition of the annelid researcher Wilfried Westheide, who erected the genus Leptonerilla and described the morphologically highly similar L. diplocirrata. Type material Holotype SOUTH KOREA • adult; Jeju Island, Munseom Islet; 33.22772° N, 126.56330° E; sand and shell gravel around 25 meters depth; 21 Oct. 2015; K. Worsaae and T. Park leg.; NIBRIV0000927415 mounted on SEM stub. Paratype SOUTH KOREA • 1 adult; same data as for holotype; NIBRIV0000927416 mounted on SEM stub. Representative DNA sequences GenBank accession numbers PQ149836 (nuclear 18S rRNA), PQ570586 (nuclear H3) and PQ421134 (mitochondrial COI); from specimen collected near type locality: SOUTH KOREA • Jeju Island, Beomseom Islet; 33.22115° N, 126.51809° E; sand and shell gravel at around 20 meters depth; 23 Oct. 2015 (Table 1). Description Measurements are based on LM of holotype, counts and ciliation from SEM; values for paratype are given in parentheses. Body with nine chaetigerous segments (Fig. 7A–B), total length about 705 µm (565–640 µm, n = 2). Segment lengths 54, 75, 91, 83, 81, 78, 74, 65, 63 µm. Maximum width about 180 µm including parapodia (140–145 µm, n = 2), about 130 µm excluding parapodia (90–95 µm, n = 2). European Journal of Taxonomy 1021: 1–54 (2025) 24 Prostomium with median and two lateral antennae (only scars visible) and two, ventrally inserted, short, club-shaped palps (47–50 µm long and 35–36 µm wide, n = 2) (las, mas, pa, Fig. 7A, D, F). Presence of eyes difficult to discern in fixed material. Parapodium of segment I uniramous with long, single, cylindrical (cirriform) cirrus, up to 120 µm long (85 µm, n = 1) and inserted ventral to the chaetal bundle (bc, Fig. 7B, D, F). All trunk segments with long, cylindrical, double, interramal cirri (Fig. 7A), up to 263 µm long (186–192 µm, n = 2). Parapodial cirri with few evenly scattered cilia. Pygidium with scars from two lost cirri and midterminal short, cirriform lobe (pyl, Fig. 7A). Compound chaetae in segments I–IX plus 1–2 short, dorsal, bent, simple chaetae in most trunk segments (n = 2). Up to nine posteriorly pointing compound chaetae in segment I (n = 3), maximum 135 µm long (Fig. 7A, D, F); up to 18 compound chaetae in segments II–IX (n = 3), maximum 195 µm long (blade up to 150 µm, shaft up to 54 µm, extension of shaft at chaetal joint up to 8 µm) (Fig. 7A); length of chaetae increasing posteriorly. Prostomium with anterior and posterior fields of presumed sensory cilia, lateral rows of cilia between lateral antenna and palp insertion, paired densely ciliated nuchal organs on lateral border between prostomium and segment I (Fig. 7D, F). Palps with ventral longitudinal dense ciliary row from insertion point to tip of palps (pvc, Fig. 7F), dorsal row of minimum 3 ciliary tufts on distal half of palp (each tuft with > 15 cilia) (ct, Fig. 7F), and lateral row of small tufts of cilia (sct, Fig. 7F). Segment I with paired dorsolateral transverse rows of each two ciliary tufts at the level of parapodia. Following trunk segments with dorsal transverse continuous row of up to 12 ciliary tufts at level of parapodia (tdc, Fig. 7A, C, E); tufts increasing in numbers, ciliary length, and density in posterior segments. Segment II with an additional lateral pair of longitudinal ciliary bandlets (ldc, Fig. 7E). Ventral ciliation not examined. Gonochoristic. Females with mature eggs (up to 110 µm long) and oocytes in segments VI–VIII (eg, Fig. 6B). Nephridia and gonoducts not examined. Distribution and habitat Western coast of Munseom Islet and northern coast of Beomseom Islet, south of Jeju Island, South Korea. Collected between 20–25 meters depth from sediment consisting of sand and shell gravel. Associated nerillids from the Munseom and Beomseom islets include Meganerilla sp. 2, Mesonerilla dannyi sp. nov. and Nerillidium sp. 1. Molecular information Leptonerilla westheidei sp. nov. always groups together with L. purschkei sp. nov. and L. sp. 1 in all phylogenetic analyses. Pairwise comparison of L. westheidei sp. nov. sequence similarity to other Leptonerilla spp.: 18S rRNA – 99.66% similar to its sister group (L. sp. 1) – 97.25–99.89% similar to the remaining Leptonerilla spp.; COI – 96.53% similar to its sister group (L. sp. 1) – 81.29–89.57% similar to the remaining Leptonerilla spp.; H3 – 98.66% similar to its sister group – 89.69–96.59% similar to the remaining Leptonerilla spp. Remarks (see also Table 4 for Leptonerilla spp. comparisons). The small sized Leptonerilla westheidei sp. nov. shows the greatest morphological and molecular similarity to the two geographically closest species L. purschkei sp. nov. from Japan and L. diplocirrata from Hainan, China. It differs, however, from both by its half number of chaetae in segment I, and from these and all other species of Leptonerilla by having much longer cirri on segment I and molecular differences (see also remarks of L. purschkei). WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 25 Fig. 7. Leptonerilla westheidei sp. nov., light (B) and scanning electron micrographs (A, C–F). A, E. Holotype (NIBRIV0000927415). B. Adult female (lost) with eggs. C–D, F. Paratype (NIBRIV0000927416). A. Overview of entire specimen, dorsal view. B. Dorsal view. C. Dorsal view of parapodia and chaetae of right side. D. Dorsal view of prostomium and first (buccal) segment. E. Close up of segments V–VI. F. Frontal view of prostomium. Abbreviations: acf = anterior ciliary field; bc = buccal cirrus; cb = chaetal blade; cc = compound chaetae; cje = chaetal joint extension; cs = chaetal shaft; ct = ciliary tuft; dcb = dorsal chaetal bundle; eg = egg; gp = glandular pore; hg = hindgut; las = lateral antenna scar; ldc = longitudinal dorsal bandlet of cilia; mas = median antenna scar; mg = midgut; no = nuchal organ; oo = oocyte; pa = palp; pc = parapodial cirrus; pcf = posterior ciliary field; pp3,5 = parapodium segment III, V; pr = prostomium; py = pygidium; pyl = pygidial median lobe; pvc = palp ventral ciliary row; sc = simple chaeta; sct = small ciliary tuft; tdc = transverse dorsal row of cilia; vcb = ventral chaetal bundle; I–IX = segments I–IX. European Journal of Taxonomy 1021: 1–54 (2025) 32 Fig. 10. Mesonerilla gamaglandulata sp. nov., paratypes, adult specimens. A–B, D. NHMD 1842021. C. NHMD 1842023. E–I. NHMD 1842020. A–D. Light microscopy (LM). E–I. Confocal laser scanning micrographs. A. LM of a specimen with long pygidial cirrus, dorsal view. B. LM of parapodial cirri, dorsal view. C. LM of dorsal view of median antenna. D. LM of head with palps and three groups of glands (indicated by dashed circles), dorsal view. E. Maximum intensity projection of z-stack of phalloidin of the head of specimen labelled with phalloidin, ventral view. F. Anti-acetylated α-tubulin immunoreactivity showing pairs of nephridia in segment III–V, ventral view. G. Maximum intensity projection of z-stack of specimen labelled with anti-acetylated α-tubulin, focusing on posterior segments in adult specimen with gonoducts. H. Acetylated α-tubulin immunoreactivity of dorsal enteronephridia. I. Acetylated α-tubulin immunoreactivity of lateral enteronephridia. Abbreviations: bc = buccal cirrus; en = enteronephridia; gl = gland; hg = hindgut; lam = lateral antenna muscle; ma = median antenna; mam = median antenna muscle; mo = mouth opening; n3–5 = nephridia in segments III–V; ov = oviduct; pa = palp; pam = palp muscle; pc = parapodial cirrus; phb = pharyngeal bulbous; pyc = pygidial cirrus; sp = spermioduct; vnc = ventral nerve cord; I–IX, segments I–IX. WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 33 Fig. 11. Mesonerilla gamaglandulata sp. nov., scanning electron micrographs (SEM), adult specimens. A–C, E–H. Holotype (NHMH 1842019). D. Paratype (NHMH 1842023). A. Overview of entire specimen, dorsolateral view. B. Peristomium and prostomium carrying palps and medium antenna, dorsal view. C. Lateral row of 4–6 glandular papillae interrupted by tufts of cilia, lateral view. D. Close-up of the midventral ciliary band and transverse rows of cilia, ventral view. E. Close-up of segments VI–VII from A, carrying the gonoducts opening, ventral view. F. Frontal view of prostomium. G. Peristomium and prostomium carrying the mouth, ventral view. H. Close-up of the gonoducts opening on segments VI– VII, lateral view. Abbreviations: acf = anterior field of sensory cilia; bc = buccal cirrus; cc = compound chaetae; ma = median antenna; no = nuchal organ; ovo = oviducts opening; pa = palp; pcf = posterior field of sensory cilia; pp1–8 = parapodium segment I–VIII; ppl = glandular papillae; pr = prostomium; so = spermioduct opening; tdc = transverse dorsal row of cilia; tvc = transverse ventral row of cilia; vc = midventral ciliary band; I–IX = segments I–IX. European Journal of Taxonomy 1021: 1–54 (2025) 34 on segment I and extending ventrally, ii) large, rounded, opening into mouth cavity, and iii) large group, dorsally in segment II (oesophageal?) (gl, Fig. 10D). Parapodial cirri in segment I short (bc, Figs 10D, 11A–B), 15–20 µm long (16–22 µm, n = 3). Trunk segments with cylindrical cirri of similar length (pc, Figs 10A–B, 11A), maximum 55 µm (49–59 µm, n = 3). Pygidium with 216 µm long cylindrical cirrus (pyc, Fig. 10A). Straight to slightly curved compound chaetae in all segments. Parapodia with up to eight chaetae, maximum 75 µm long in segment I and maximum 120 µm long in trunk segments. Prostomium with anterior and posterior fields of sensory cilia extending between lateral antennae scars and palp insertions (acf, pcf, Fig. 11B, G). Paired densely ciliated nuchal organs on dorsolateral border between prostomium and segment I. Palps with ventral longitudinal dense ciliary row from insertion points to tip of palps, lined by dorsolateral row of five ciliary tufts present posteriorly (each tuft with up to 15 cilia). Segment I with paired dorsolateral transverse rows of each two ciliary tufts (each tuft with > 10 cilia) at the level of parapodia. Continuous transverse dorsolateral row with numerous cilia on all trunk segments, extending from basis of parapodia to about halfway to mid-dorsal line (tdc, Fig. 11A–B). Ventral ciliation consisting of i) densely ciliated mouth (mo, Fig. 11G), ii) midventral longitudinal ciliary band extending from mouth to pygidium (vc, Fig. 11E) and iii) transverse rows of up to five tufts of cilia on each parapodia (tvc, Fig. 11D, H). Additional ventral row intersegmentally with 2–6 tufts between segments I–VIII. Three pairs of discontinuous ciliated nephridia extending along segments and opening latero-ventrally in segments III, IV, V (n3–n5, Fig. 10F). About 14 enteronephridia extending along the hindgut (en, Fig. 10H–I), on the dorsal (4), lateral (6) and ventral (4) sides. Hermaphroditic with two pairs of slightly curved dorsoventrally extending spermioducts opening separately in segments VI and VII (sp, Figs 10G, 11E, H) and one pair of relatively straight oviducts opening in segment VIII (ov, Figs 10G, 11H). Distribution and habitat Unnamed Cave ‘Sho-doukutsu’, eastern reef of Ie Island, Okinawa Prefecture, Ryukyu Islands, Japan. Submarine cave located on the reef slope. Specimens collected from plankton tow and sediment samples from the anchialine right hall of the cave, at 5–17 meters of depth; see Osawa & Fujita (2019) for the description of the cave. Associated nerillids from the cave include Cirrinerilla sulcipalpata gen. et sp. nov., Leptonerilla sp. 3 and Trochonerilla sp. 1. Molecular information Mesonerilla gamaglandulata sp. nov. is found in both analyses (Fig. 2) as a sister taxon to M. armoricana Swedmark, 1954 and M. roscovita Levi, 1953, albeit with low support (PP/BS: 0.51/69). Together, this clade has a sister relationship to M. dannyi sp. nov. (PP/BS: 1/99). The hermaphroditic Mesonerilla spp. within clade C does not form a monophyletic sub-clade, as Nipponerilla irabuensis groups with the previously mentioned species of Mesonerilla, although with low support (PP/BS: 0.68/79), and this clade is itself sister to the hermaphroditic Mesonerilla fagei Swedmark, 1959 (PP/BS: 1/96). Morphologically, M. gamaglandulata sp. nov. has a strong resemblance to the three hermaphroditic Mesonerilla spp. and exhibits a high degree of similarity in 18S rRNA and 28S rRNA sequences. Pairwise comparison of M. gamaglandulata sp. nov. sequence similarity to other hermaphroditic Mesonerilla spp. and Nipponerilla irabuensis: 18S rRNA – 98.83–98.89% similar to its sister group (clade comprising M. armoricana and M. roscovita) – 98.88–99.14% similar to remaining hermaphroditic Mesonerilla spp. – 96.92% similar to N. irabuensis; 28S rRNA – 90.52% similar to its sister group – 89.42–91.37% similar to the remaining hermaphroditic Mesonerilla spp. – 84.89% similar WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 35 Table 6 (continued on next page). Selected morphological characters comparison of Mesonerilla Remane, 1949 with brooding hood, hermaphroditic Mesonerilla and Nipponerilla irabuensis Worsaae, Hansen & Fujita, 2021. All measurements are in µm. Asterisk (*) indicates measurements of species obtained from scanning electron microscopy (SEM). Measurements of new species are based on available specimens, including type material and live observations. Abbreviations: A = absent; ant = antenna; G = gonochoristic; H = hermaphroditic; L = length; max = maximum; med = median; segm = segment; P = present; para = parapodial; I–IX = segments I–IX; ? = unknown. References: 1 = Lévi 1953; 2 = Swedmark 1959; 3 = Westheide 2008; 4 = Wilke 1953; 5 = Worsaae et al. 2019a; 6 = Worsaae et al. 2021b. Species Body Antennae Palps Parapodial cirri Pygidial cirri Max L Trunk segm, relative size Shape Distinctly shorter med ant Max L Size along body Max L Shape Max L M. harubangi sp. nov.* 725 Equal Cylindrical ? 56 Increasing 152 Cylindrical; tapering 70 M. intermedia3,4 1645 Equal Cylindrical; tapering Yes 210 Increasing 360 Bottle-shaped 330 M. laerkae61170 Equal Bottle-shaped; tapering No 70 Equal 90 Bottle-shaped 170 M. gamaglandulata sp. nov. 785 Segment VII–IX smaller Cylindrical; slightly swollen ? 82 Equal 59 Cylindrical; tapering 216 M. dannyi sp. nov. 875 Equal Cylindrical; slightly swollen ? ? Equal 65 Cylindrical; tapering ? M. armoricana2,3 1100 Equal Cylindrical; slightly swollen Yes 80 Equal 50 Cylindrical 225 M. fagei2,3 1000 Equal Cylindrical Yes 175 Equal 100 Cylindrical 240 M. roscovita1,3 800 Equal Cylindrical Yes 100 Equal in segm II–VIII; longer in segm IX 45 Cylindrical 200 Nipponerilla irabuensis5616 Segment IV–V widest Cylindrical No 117 Slightly increasing 85 Cylindrical 28 (broken) European Journal of Taxonomy 1021: 1–54 (2025) 36 Species Chaetae Reproduction Segm lacking chaetae Segm I, max no. Segm I, max L Segm II–IX, max no. Segm II–IX, max L Brooding hood Max no. embryos Spermioducs opening M. harubangi sp. nov. * – 12 109 26 191 G P 2 ? M. intermedia3,4 – 13 195 16 345 G P 4 V + VI (fused) M. laerkae6–4 80 15 180 G P 6 ? M. gamaglandulata sp. nov. – 8 75* 8 120* H A ? VI + VII M. dannyi sp. nov. I – – 12 180 H A ? VI + VII M. armoricana2,3 I – – 9 80 H A ? VI + VII M. fagei2,3 – 9 100 10 160 H A ? VI + VII M. roscovita1,3 I – – 17 140 H A ? VI + VII Nipponerilla irabuensis5– 10 ? 12 141 H A ? VII + VIII Table 6 (continued). Selected morphological characters comparison of Mesonerilla Remane, 1949 with brooding hood, hermaphroditic Mesonerilla and Nipponerilla irabuensis Worsaae, Hansen & Fujita, 2021. All measurements are in µm. Asterisk (*) indicates measurements of species obtained from scanning electron microscopy (SEM). Measurements of new species are based on available specimens, including type material and live observations. Abbreviations: A = absent; ant = antenna; G = gonochoristic; H = hermaphroditic; L = length; max = maximum; med = median; segm = segment; P = present; para = parapodial; I–IX = segments I–IX; ? = unknown. References: 1 = Lévi 1953; 2 = Swedmark 1959; 3 = Westheide 2008; 4 = Wilke 1953; 5 = Worsaae et al. 2019a; 6 = Worsaae et al. 2021b. WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 37 to N. irabuensis; COI – 72.86% similar to the remaining hermaphroditic Mesonerilla spp. – 70.36% similar to N. irabuensis; H3 – 90.76–92.32% similar to its sister group – 86.72% similar to the remaining hermaphroditic Mesonerilla spp. – 91.97% similar to N. irabuensis. Remarks (see also Table 6 for comparisons of morphologically similar nerillids) With its nine segments, compound chaetae, spoon-shaped palps, three antennae, equally long parapodial cirri and configuration of gonoducts M. gamaglandulata sp. nov. bears most resemblance to the three hermaphroditic species of Mesonerilla (M. roscovita, M. fagei and M. armoricana) and Mesonerilla dannyi sp. nov. (Levi 1953; Swedmark 1959; Westheide 2008; Worsaae et al. 2019a, 2021a; Worsaae 2021). Mesonerilla gamaglandulata shares different characteristics with the three hermaphroditic Mesonerilla including the presence of chaetae and shorter cirri in segment I (also seen in M. fagei), ventrolateral rows of cilia, oesophageal glands and cylindrical pygidial cirri (also seen in M. roscovita and M. fagei) and a swollen median antenna and spoon-shaped palps (also seen in M. armoricana) (Levi 1953; Swedmark 1959; Westheide 2008; Worsaae et al. 2019a). The main difference between M. gamaglandulata and Mesonerilla dannyi is the presence or absence of chaetae in segment I, respectively. Mesonerilla gamaglandulata, Mesonerilla dannyi and N. irabuensis were monophyletic in the Bayesian and maximum likelihood analyses and they all have compound chaetae, nine segments and three antennae. Nipponerilla irabuensis differs from the two others by having a cigar-shaped body, spermioducts in segments VII and VIII and being gonochoristic. In contrast to M. gamaglandulata, N. irabuensis also has long palps and a relatively long median antenna (Worsaae et al. 2021b), traits that could not be determined from Mesonerilla dannyi. Apart from M. gamaglandulata sp. nov., oesophageal glands have also been recorded in M. laerkae, Mesonerilla katharinae Worsaae, Mikkelsen & Martínez, 2019, M. roscovita, M. fagei and M. xurxoi Worsaae, Mikkelsen & Martínez, 2019, with two lateral glands also being observed in segment I of the latter species (Worsaae et al. 2019a). Furthermore, M. minuta Jouin, 1970 has about 10 yellowish dorsal epidermal glands on each side of segment I (Swedmark 1959). Three independent groups of glands in the head region, as seen in M. gamaglandulata, have, to our knowledge, not been recorded previously in Nerillidae and the anteriormost pair of small glands seems unique to the species. Mesonerilla harubangi sp. nov. urn:lsid:zoobank.org:act:32DE4DE5-C0FB-4AE8-BAE5-D108C2E8114C Fig. 12; Table 6 Diagnosis Mesonerilla with three antennae. Segment I uniramous, with oval cirri; trunk segments biramous with cylindrical parapodial cirri. Pygidial cirri cylindrical. Row of seven dorsolateral ciliary tufts on palps. Trunk segments with short continuous ventrolateral band of cilia at each parapodia. Paired dorsolateral rows of cilia at basis of parapodia, not medially connecting. Dorsolateral ciliary tufts next to chaetae in segments II–VII. Gonochoristic. Females with rounded brooding hood extruding from the dorsal epidermis of segment VIII. Etymology The species name refers to the characteristic stone statues and deities (Dol-Hareubang, which means ‘Stone Grandfather’) of Jeju Island in South Korea, a large island geographically close to the islets where the species was collected. European Journal of Taxonomy 1021: 1–54 (2025) 38 Type material Holotype SOUTH KOREA • ♀; Jeju Island, Munseom Islet; 33.22772° N, 126.56330° E; sand and shell gravel at around 28 meters depth; 21 Oct. 2015; K. Worsaae and T. Park leg.; NIBRIV0000924478 mounted on SEM stub. Paratypes SOUTH KOREA • 4 ♀♀ adults; same data as for holotype; NIBRIV0000924479 to NIBRIV0000924482 mounted on SEM stub • 3 adults; same data as for holotype; NIBRIV0000924483 to NIBRIV0000924485 mounted on SEM stub. Representative DNA sequences GenBank accession numbers PQ149844 (nuclear 18S rRNA) and PQ570594 (nuclear H3); from specimen collected near type locality: SOUTH KOREA • Jeju Island, Seopseom Islet; 33.2294° N, 126.6027° E; shell gravel at around 33 meters depth, 19 October 2015, same collectors as holotype (Table 1). Description Measurements are based on holotype and values for paratypes are given in parentheses, all measurements obtained from SEM. Body with nine chaetigerous segments (Fig. 12A), total length about 590 µm excluding appendages (455–725 µm, n = 7). Trunk segments similar in size and up to about 130 µm wide including parapodia (120–125 µm, n = 2), about 80 µm excluding parapodia (75–80 µm, n = 2). Prostomium with club-shaped palps, 56 µm long (50–52 µm, n = 2) and 23 µm wide (26–28 µm, n = 2) (pa, Fig. 12A, C–D), and three antennae (las, mas, Fig. 12B–D). Lateral antennae lost in holotype and in all but one paratype (148 µm long) (la, Fig. 12B). Median antenna, 30 µm and possibly broken (ma, Fig. 12B). Eyes absent. Paired nuchal organs dorsolaterally between prostomium and segment I (no, Fig. 12B). Parapodia uniramous in segment I (Fig. 12B, D), with short oval cirrus in paratype (36 µm long) (bc, Fig. 12D). Parapodia biramous in segments II–IX, with cylindrical and tapering interramal cirrus (pc, Fig. 12A, F); increasing in length posteriorly up to 123 µm (56–152 µm, n = 7). Pygidium with 70 µm long cirri similar in shape to parapodial cirri, (pyc, Fig. 12H). Compound chaetae in all segments. Chaetae with distal extension (es, Fig. 12G) and increasing in length towards pygidium. Parapodia with up to 10 chaetae in segment I, maximum 109 µm long (42–98 µm, n = 7). Up to 13 neuroand 13 notochaetae in segments II–IX, maximum 184 µm long (127–191 µm, n = 7). Prostomium with anterior and posterior fields of cilia and paired lateral ciliary bands extending between lateral antenna and palps insertion (an, Fig. 12D). Palps ciliated continuously on frontal side from insertion point to tip of palps (ct, Fig. 12C), lined by dorsolateral row of ciliary tufts present posteriorly (each tuft with up to seven cilia). Ventral ciliation consisting of i) densely ciliated mouth (mo, Fig. 12D), ii) midventral longitudinal ciliary band extending from mouth to pygidium (vb, Fig. 12F) and iii) short transverse ventrolateral band of at least 20 cilia on each parapodia (vt, Fig. 12F–G). Continuous transverse dorsolateral row with numerous cilia on all trunk segments, extending from basis of parapodia to about halfway to mid-dorsal line (dt1, Fig. 12E). Dense dorsolateral tuft of more than 20 cilia on each parapodium next to notochaetae insertion and cirrus in segments II–VII (dt2, Fig. 12E). Dorsal ciliation patterns of last two segments not observable. Few individual cilia scattered on ventral and dorsal surfaces. Sixteen ciliary tufts observed on ridge of the brooding hood (ct, Fig. 12H). Gonochoristic. Females with round brooding hood, 103 µm long and 126 µm wide, in segment VII at parapodia level (bh, Fig. 12A, H), partially covering up to two embryos attached dorsally. One embryo WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 39 Fig. 12. Mesonerilla harubangi sp. nov., scanning electron micrographs (SEM). A, E, H. Holotype, ♀ (NIBRIV0000924478). B. Paratype, ♀ (NIBRIV0000924479). C–D. Paratype, ♀ (NIBRIV0000924482). F. Paratype (NIBRIV0000924484). G. Paratype, ♀ (NIBRIV0000924480). A. Overview of entire adult with brooding hood, dorsal view. B. Prostomium and intact lateral antenna of adult, lateral view. C. Palp broken off from adult, ventral view. D. Peristomium and prostomium of adult, ventral view. E. Closeup of segment IV–VI showing ciliation of adult, dorsal view. F. Close-up of segment V–VII showing ciliation and biramous parapodia of adult, ventrolateral view. G. Chaetae in adult, ventrolateral view. H. Brooding hood covering juvenile and embryo, posterolateral view. Abbreviations: an = anterior field of cilia; bc = buccal cirrus; bh = brooding hood; bl = chaetal blade; cs = chaetal shaft; ct = ciliary tuft; dt1–2 = dorsal ciliary tuft; em = embryo; es = extension of the shaft; ju = juvenile; la = lateral antenna; las = lateral antenna scar; ma = median antenna; mas = median antenna scar; mo = mouth opening; no = nuchal organ; pa = palp; pc = parapodial cirrus; pr = prostomium; pyc = pygidial cirrus; vb = midventrally ciliary band; vt = ventrolateral ciliary tuft; I–IX = segments I–IX. European Journal of Taxonomy 1021: 1–54 (2025) 40 typically more developed. Juveniles attached to female with six chaetigers maximum and conspicuous parapodia. Male gonopores not found. Nephridia and gonoducts not studied. Distribution and habitat Eastern coast of Seopseom Islet and the western coast of Munseom Islet, south of Jeju Island, South Korea. Collected from 22–33 meters depth from sediment consisting of sand and shell gravel. Associated nerillids from the Seopseom and Munseom Islets include Leptonerilla westheidei sp. nov., Mesonerilla dannyi sp. nov. and Nerillidium sp. 1. Molecular information Only the maximum likelihood analysis resolved M. harubangi sp. nov. as a sister group to Mesonerilla sp. 2 and M. laerkae (albeit poorly supported, BS: 78) within the large clade of gonochoristic Mesonerilla spp. Pairwise comparison of M. harubangi sp. nov. sequence similarity to other gonochoristic Mesonerilla spp.: 18S rRNA – 96.28–97.42% similar to its sister group (clade comprising M. laerkae and M. sp. 2) – 96.22–97.38% similar to the remaining gonochoristic Mesonerilla spp.; COI – 65.28–65.86% similar to its sister group – 56.57–71.65% similar to the remaining gonochoristic Mesonerilla spp. Remarks (see also Table 6 for comparisons of morphologically similar nerillids) Mesonerilla harubangi sp. nov. has nine segments, compound chaetae and club-shaped palps, and thereby conforms to the main characteristics of Mesonerilla. Furthermore, it resembles M. intermedia and M. laerkae by possessing a brooding hood and being gonochoristic (Worsaae 2005a, 2021; Worsaae et al. 2019a). Mesonerilla laerkae has a pointed tip on the brooding hood and equally long parapodial cirri in the trunk segments, which is not seen in either M. harubangi or M. intermedia. Mesonerilla harubangi differs from both species by being smaller in size and by not possessing continuous dorsolateral transverse ciliary rows (found in M. intermedia). The dorsal and ventral ciliation patterns of M. harubangi are most comparable to those of M. xurxoi, but this species does not possess a brooding hood (Worsaae et al. 2019a). Specimens of M. harubangi sp. nov. used for morphological examination were collected from Munseom Islet, while the specimen used for DNA analysis was obtained from Seopseom Islet and identified in the field prior to DNA extraction. The unresolved phylogenetic position of M. harubangi sp. nov. among the other gonochoristic Mesonerilla could be explained by the absence of two of the four genes, as only 18S rRNA and COI fragments were successfully obtained. Individual maximum likelihood analysis of COI sequences found M. harubangi as sister group to Mesonerilla, Meganerilla, Speleonerilla, N. irabuensis, C. sulcipalpata gen. et sp. nov., Micronerilla, Leptonerilla, Trochonerilla and Aristonerilla. This is also reflected in the low pairwise sequence similarity of COI between M. harubangi and all other gonochoristic Mesonerilla (around 60%). Inclusion of additional sequence data is expected to clarify the phylogenetic position of this species within the clade of gonochoristic Mesonerilla spp. Mesonerilla dannyi sp. nov. urn:lsid:zoobank.org:act:AF47235F-7D0A-464E-904C-61D83C1E2AA3 Figs 13–14; Table 6 Diagnosis Hermaphroditic Mesonerilla with three antennae and equally short parapodial cirri on segments II–VIII. Segment I with short, ovoid cirri and lacking chaetae. Hermaphroditic with two pairs of spermioducts with separate openings in segments VI, VII, and one pair of oviducts opening in segment VIII. WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 41 Etymology Named in honour of Danny Eibye-Jacobsen, in recognition of his valuable contributions to annelid taxonomy and systematics, as well as his highly appreciated mentorship of the first author. Type material Holotype SOUTH KOREA • adult; Jeju Island, Munseom Islet; 33.22779° N, 126.5675° E; shell gravel with mud at 25 meters depth; 24 May 2018; K. Worsaae and T. Park leg.; NIBRIV0000924486 as permanent whole mount. Paratypes SOUTH KOREA • 2 adults; Jeju Island, Seopseom Islet; 33.2304° N, 126.6015° E; shell gravel at 15 meters depth; 25 May 2018; K. Worsaae and T. Park leg.; NHMD 1842024, NHMD 1842025 mounted on SEM stubs. Representative DNA sequences GenBank accession numbers PQ149847 (nuclear 18S rRNA), PQ149827 (nuclear 28S rRNA) and PQ570598 (nuclear H3); from specimen with same collection data as holotype (Table 1). Description Measurements are based on LM of holotype, counts and ciliation from SEM; values for paratypes are given in parentheses. Body with nine segments (Figs 13A, 14A), total length about 875 µm long (810– 985 µm, n = 3). Trunk segments up to about 185 µm wide including parapodia (155–185 µm, n = 3), about 120 µm (115–135 µm, n = 3) excluding parapodia. Segment lengths of paratype 72, 69, 86, 102, 92, 112, 88, 77, 49 µm. Round prostomium with palps and antennae lost in all mounted specimens, but median antennal and lateral antennal scars observed in SEM (las, ma, Fig. 13A–B). Eyes absent. Nuchal organs visible with CLSM and SEM (no, Fig. 14B). Parapodial cirri in segments I–IX. Segment I with short cylindrical cirri, 35 µm long (33 µm long, n = 1) (bc, Fig. 13B). Segments II–VIII with cylindrical, slightly tapering cirri, up to 65 µm long (54–74 µm long, n = 3), similar in length, slightly shorter cirri on segment VIII (pc, Fig. 13C). Only regenerating pygidial cirri were observed (rpc, Fig. 13D). Compound chaetae in segments II–IX, with up to 12 chaetae per parapodium and maximum 180 µm long (128–155 µm long, n = 2) (cc, Fig. 14A). Prostomium with anterior and posterior fields of presumed sensory cilia (acf, Fig. 14B). Paired, densely ciliated nuchal organs on dorsolateral border between prostomium and segment I (no, Fig. 14B). Ventral ciliation consisting of i) densely ciliated mouth (mo, Fig. 14C), ii) midventral longitudinal ciliary band extending from mouth to pygidium (vc, Fig. 14C–D) and iii) transverse rows of up to about 10 small ciliary tufts at level of parapodia (tvc, Fig. 14D). Multiple single cilia scattered on dorsal, lateral, and ventral sides of body. Many cilia lost during preparation. Three lateral enteronephridia extending from posterior end of stomach along the hindgut until pygidium (Fig. 13F). Spermioducts present in segments VI and VII with posterior ventral opening. Two relatively long and slender oviducts opening ventrally in segment VIII (so, ovo, Figs 13E, 14D). European Journal of Taxonomy 1021: 1–54 (2025) 48 Gallagher S.J., Iryu Y., Itaki T., Kitamura A., Koizumi I. & Hoiles P.W. 2015. The Pliocene to recent history of the Kuroshio and Tsushima Currents: a multi-proxy approach. Progress in Earth and Planetary Science 2 (1): 17. https://doi.org/10.1186/s40645-015-0045-6 Giere O. 2009. Meiobenthology: The Microscopic Motile Fauna of Aquatic Sediments. Springer-Verlag, Berlin Heidelberg. https://doi.org/10.1007/b106489 Giribet G., Carranza S., Baguña J., Riutort M. & Ribera C. 1996. First molecular evidence for the existence of a Tardigrada + Arthropoda clade. Molecular Biology and Evolution 13 (1): 76–84. https://doi.org/10.1093/oxfordjournals.molbev.a025573 Gonzalez B.C., Martínez A., Worsaae K. & Osborn K.J. 2021. Morphological convergence and adaptation in cave and pelagic scale worms (Polynoidae, Annelida). Scientific Reports 11: 10718. https://doi.org/10.1038/s41598-021-89459-y Hayami I. & Kase T. 1993. Submarine cave Bivalvia from the Ryukyu Islands: Systematics and evolutionary significance. The University Museum, The University of Tokyo, Bulletin 35: 1–133. He L., Mukai T., Chu K.H., Ma Q. & Zhang J. 2015. Biogeographical role of the Kuroshio current in the amphibious mudskipper Periophthalmus modestus indicated by mitochondrial DNA data. Scientific Reports 5: 15645. https://doi.org/10.1038/srep15645 Higgins R. & Thiel H. 1988. Introduction to the Study of Meiofauna. Smithsonian Institution Press, Washington DC. Hillis D.M. & Dixon M.T. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology 66 (4): 411–453. https://doi.org/10.1086/417338 Hoang D.T., Chernomor O., von Haeseler A., Minh B.Q. & Vinh L.S. 2018. UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35 (2): 518–522. https://doi.org/10.1093/molbev/msx281 Ibrahim A.K., Gamil I.S., Abd-El baky A.A., Hussein M.M. & Tohamy A.A. 2011. Comparative molecular and conventional detection methods of Babesia equi (B. Equi) in Egyptian equine. Global Veterinaria 7 (2): 201–210. Ise Y., Vacelet J., Mizuyama M. & Fujita Y. 2023. New lithistid sponge of the genus Sollasipelta (Porifera, Demospongiae, Tetractinellida, Neopeltidae) from submarine caves of the Ryukyu Islands, southwestern Japan, with redescription of S. sollasi. Zootaxa 5285 (2): 293–310. https://doi.org/10.11646/zootaxa.5285.2.4 Jimi N. 2024. The polychaetous annelids of Japan: Updated checklist of known species. Species Diversity 29 (2): 337–377. https://doi.org/10.12782/specdiv.29.337 Jouin C. 1968. Sexualité et biologie de la reproduction chez Mesonerilla Remane et Meganerilla Boaden (Archiannélides Nerillidae). Cahiers de Biologie Marine 9: 31–52. Jouin C. 1971. Status of the knowledge of the systematics and ecology of Archiannelida. Smithsonian Contributions to Zoology 76: 47–56. Jouin C. & Swedmark B. 1965. Paranerilla limicola n. g., n. sp., Archiannélide Nerillidae du benthos vaseux marin. Cahiers de Biologie Marine 6: 201–218 Kakui K. & Fujita Y. 2018. Haimormus shimojiensis, a new genus and species of Pseudozeuxidae (Crustacea: Tanaidacea) from a submarine limestone cave in Northwestern Pacific. PeerJ 6: e4720. https://doi.org/10.7717/peerj.4720 Kakui K. & Fujita Y. 2023. New sea spider species (Pycnogonida: Austrodecidae) from a submarine cave in Japan. Journal of the Marine Biological Association of the United Kingdom 103: e44. https://doi.org/10.1017/S002531542 10.1017/S002531542 WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 49 Kang T. & Kim D. 2020. Meiobenthic community structure on the Northeast coastal area of Jeju Island, Korea. Ocean and Polar Research 42 (1): 1–13. https://doi.org/10.4217/OPR.2020.42.1.001 Katoh K. & Standley D.M. 2013. MAFFT Multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30 (4): 772–780. https://doi.org/10.1093/molbev/mst010 Katoh K., Kuma K., Misawa K. & Miyata T. 2002. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30 (14): 3059–3066. https://doi.org/10.1093/nar/gkf436 Kim D., Je J. & Lee J. 2000. The community structure and spatial distribution of meiobenthos in the Kanghwa tidal flat, west coast of Korea. Ocean and Polar Research 22: 15–23. Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16 (2): 111–120. https://doi.org/10.1007/BF01731581 Koike K. 2010. Japan. In: Bird E.C.F. (ed.) Encyclopedia of the World’s Coastal Landforms: 1213–1224. Springer Netherlands, Dordrecht. https://doi.org/10.1007/978-1-4020-8639-7_223 Kojima S., Iijima A., Kamimura S., Kimura T., Kurozumi T. & Furota T. 2006. Molecular phylogeny and population structure of tideland snails in the genus Cerithidea around Japan. Marine Biology 149 (3): 525–535. https://doi.org/10.1007/s00227-005-0183-2 Komai T. & Fujita Y. 2018. A new genus and new species of alpheid shrimp from a marine cave in the Ryukyu Islands, Japan, with additional record of Salmoneus antricola Komai, Yamada & Yunokawa, 2015 (Crustacea: Decapoda: Caridea). Zootaxa 4369 (4): 575–586. https://doi.org/10.11646/zootaxa.4369.4.7 Kumar S., Knyaz C., Li M., Stecher G. & Tamura K. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35 (6): 1547–1549. https://doi.org/10.1093/molbev/msy096 Lee H., Kang T.W., Rho H.S. & Kim D. 2019. Seasonal distribution characteristics of meiobenthos at Gwangyang Bay, Korea. The Sea Journal of the Korean Society of Oceanography 24 (3): 400–421. https://doi.org/10.7850/JKSO.2019.24.3.400 Lévi C. 1953. Archiannélides Nerillidae de la région de Roscoff. Archives de Zoologie expérimentale et générale 90 (2): 64–70. Liu J.Y. 2013. Status of marine biodiversity of the China seas. PLoS ONE 8 (1): e50719. https://doi.org/10.1371/journal.pone.0050719 Magagnini G. 1966. Un nouvel Archiannélide Nerillidae des côtes de Roscoff: Meganerilla clavata n.sp. Cahiers de Biologie Marine 7: 331–335. Martínez A., Artois T., Curini-Galletti M., Di Domenico M., Fontaneto D., Gobert S., Jörger K.M., Leasi F., Norenburg J., Núñez J., Todaro M.A., Zotto M.D. & Worsaae K. 2019. Patterns of diversity and endemism of soft-bodied meiofauna in an oceanic island, Lanzarote, Canary Islands. Marine Biodiversity 49 (5): 2033–2055. https://doi.org/10.1007/s12526-019-01007-0 Mendes S.L. da S.D., Rodrigues J.C. & Rizzo A.E. 2024. A new species of Paranerilla Jouin & Swedmark, 1965 (Annelida: Polychaeta) from Brazil. European Journal of Taxonomy 943: 144–153. https://doi.org/10.5852/ejt.2024.943.2591 Meyer C.P. 2003. Molecular systematics of cowries (Gastropoda: Cypraeidae) and diversification patterns in the tropics. Biological Journal of the Linnean Society 79: 401–459. https://doi.org/10.1046/j.1095-8312.2003.00197.x European Journal of Taxonomy 1021: 1–54 (2025) 50 Miller M., Pfeiffer W.T. & Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. 2010 Gateway Computing Environments Workshop (GCE), New Orleans: 1–8. https://doi.org/10.1109/GCE.2010.5676129 Minh B.Q., Schmidt H.A., Chernomor O., Schrempf D., Woodhams M.D., von Haeseler A. & Lanfear R. 2020. IQ-TREE2: New models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution 37 (5): 1530–1534. https://doi.org/10.1093/molbev/msaa015 Motokawa M. & Kajihara H. 2017. Species Diversity of Animals in Japan. Springer Japan. https://doi.org/10.1007/978-4-431-56432-4 Müller M.C. 2002. Aristonerilla: A new nerillid genus (Annelida: Polychaeta) with description of Aristonerilla (Micronerilla) brevis comb. nov. from a seawater aquarium. Cahiers de Biologie Marine 43: 131–139. https://doi.org/10.21411/CBM.A.137553DE Müller M.C. & Worsaae K. 2006. CLSM analysis of the phalloidin-stained muscle system in Nerilla antennata, Nerillidium sp. and Trochonerilla mobilis (Polychaeta; Nerillidae). Journal of Morphology 267 (8): 885–896. https://doi.org/10.1002/jmor.10292 Müller M.C., Bernhard J.M. & Jouin-Toulmond C. 2001. A new member of Nerillidae (Annelida: Polychaeta), Xenonerilla bactericola gen. et sp. nov., collected off California, USA. Cahiers de Biologie Marine 42 (3): 203–217. https://doi.org/10.21411/CBM.A.64923395 Nakae M., Aizawa M., Fujiwara K., Fukui Y., Hagiwara K., Hata H., Jeong B., Koeda K., Senou H., Shinohara G., Motomura H., Tashiro S., Yamakawa T., Yoshida T. & Matsuura, K. 2018. An annotated checklist of fishes of Amami-oshima Island, the Ryukyu Islands, Japan. Memoirs of the National Museum of Nature and Science 52: 205–361. Naruse T. & Fujita Y. 2015. Lipkemera iejima, a new cavernicolous crab (Brachyura: Xanthidae) from a submarine cave at Ie Island, central Ryukyu Islands, Japan. Crustacean Research 44: 21–27. https://doi.org/10.18353/crustacea.44.0_21 Núñez J., Ocaña O. & Brito M.C. 1997. Two new species (Polychaeta: Fauveliopsidae and Nerillidae) and other polychaetes from the marine lagoon cave of Jameos del Agua, Lanzarote (Canary Islands). Bulletin of Marine Science 60 (2): 252–260. Odani S., Uchiyama Y., Kashima M., Kamidaira Y. & Mitarai S. 2017. Influence of the Kuroshio current on dispersal of coral spawn and larvae around Ryukyu Islands. Journal of Japan Society of Civil Engineers 73 (2): 1315–1320. https://doi.org/10.2208/kaigan.73.I_1315 Okanishi M. & Fujita Y. 2018. First finding of anchialine and submarine cave dwelling brittle stars from the Pacific Ocean, with descriptions of new species of Ophiolepis and Ophiozonella (Echinodermata: Ophiuroidea: Amphilepidida). Zootaxa 4377 (1): 1–20. https://doi.org/10.11646/zootaxa.4377.1.1 Osawa M. & Fujita Y. 2019. Submarine cave hermit crabs (Crustacea: Decapoda: Anomura: Paguroidea) from three islands of the Ryukyu Islands, southwestern Japan. Zootaxa 4560 (3): 463–482. https://doi.org/10.11646/zootaxa.4560.3.3 Osawa M. & Fujita Y. 2022. A new species of the genus Eutrichopagurus Komai, 2015 (Crustacea: Decapoda: Anomura: Paguridae) from a submarine cave in the Ryukyu Islands, southwestern Japan. Zootaxa 5214 (3): 440–450. https://doi.org/10.11646/zootaxa.5214.3.6 Park J. 2023. Systematic Studies on the Korean Interstitial Polychaetes (Annelida) Based on Morphological and Molecular Data. PhD Thesis, Ewha Womans University, Seoul, Korea. Pavlyuk O.N. & Trebukhova Y.A. 2011. Intertidal meiofauna of Jeju Island, Korea. Ocean Science Journal 46 (1): 1–11. https://doi.org/10.1007/s12601-011-0001-3 WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 51 Posada D. 2008. jModelTest: Phylogenetic model averaging. Molecular Biology and Evolution 25: 1253– 1256. https://doi.org/10.1093/molbev/msn083 Rambaut A., Baele G., Drummond A.J., Xie D. & Suchard M.A. 2018. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology 67 (5): 901–904. https://doi.org/10.1093/sysbio/syy032 Reimer J., Biondi P., Lau Y.W., Masucci G.D., Nguyen X., Santos M. & Wee H.B. 2019. Marine biodiversity research in the Ryukyu Islands, Japan: Current status and trends. PeerJ Preprints 7: e27029v2. https://doi.org/10.7717/peerj.6532 Riser N.W. 1988. Morphology of a new species of nerillid polychaete from the north shore of Massachusetts Bay, U.S.A. Transactions of the American Microscopical Society 107 (2): 171–179. https://doi.org/10.2307/3226459 Ronquist F. & Huelsenbeck J. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. https://doi.org/10.1093/bioinformatics/btg180 Saito T. & Fujita Y. 2022. A new shrimp of the genus Odontozona Holthuis, 1946 (Decapoda: Stenopodidea: Stenopodidae) from a submarine cave of the Ryukyu Islands, Indo-West Pacific. Zootaxa 5175 (4): 439–452. https://doi.org/10.11646/zootaxa.5175.4.2 Saito Y. & Alino P.M. 2008. Regional Conditions. In: Mimura N. (ed.) Asia-Pacific Coasts and their Management: States of Environment: 255–331. Springer, Dordrecht. https://doi.org/10.1007/978-1-4020-3625-5_5 Saphonov M.V. & Tzetlin A.B. 1988. Nerilla jouini sp. n. (Polychaeta, Nerillidae) – a new archiannelid from the Japan Sea. Zoologicheskii Zhurnal 67 (6): 839–845. Saphonov M.V. & Tzetlin A.B. 1997. Nerillidae (Annelida: Polychaeta) from the White Sea, with description of a new species of Micronerilla Jouin. Ophelia 47 (3): 215–226. https://doi.org/10.1080/00785236.1997.10428672 Sasaki S. 1981. A new species of the genus Saccocirrus (Archiannelida) from Hokkaido, Northern Japan. Annotationes Zoologicae Japonenses 54 (4): 259–266 Schindelin J., Arganda-Carreras I., Eliceiri K., Frise E., Hartenstein V., Kaynig V., Longair M., Pietzsch T., Preibisch S., Rueden C., Saalfeld S., Schmid B., Tinevez J., Tomancak P., White D.J. & Cardona A. 2012. Fiji: An open-source platform for biological-image analysis. Nature Methods 9 (7): 676–682. https://doi.org/10.1038/nmeth.2019 Schmidt H. & Westheide W. 1998. RAPD-PCR experiments confirm the distinction between three morphologically similar species of Nerilla (Polychaeta: Nerillidae). Zoologischer Anzeiger 236: 277– 285. Shimada D. & Kajihara H. 2014. Two new species of free-living marine nematodes of Adoncholaimus Filipjev, 1918 (Oncholaimida: Oncholaimidae: Adoncholaiminae) from Hokkaido, northern Japan, with a key to species and discussion of the genus. Nematology 16: 437–451. https://doi.org/10.1163/15685411-00002776 Shimada D., Kajihara H. & Mawatari S. 2009. Three new species of free-living marine nematodes (Nematoda: Enoplida) from Northern Japan. Species Diversity 14: 137–150. https://doi.org/10.12782/specdiv.14.137 Shimada D., Kakui K. & Fujita Y. 2023. A new species of free-living marine nematode, Fotolaimus cavus sp. nov. (Nematoda, Oncholaimida, Oncholaimidae), isolated from a submarine anchialine cave in the Ryukyu Islands, southwestern Japan. Zoosystematics and Evolution 99: 519–533. https://doi.org/10.3897/zse.99.109097 European Journal of Taxonomy 1021: 1–54 (2025) 52 Shimomura M. & Fujita Y. 2017. First description of the female of Heteromysoides simplex Hanamura & Kase, 2001 (Mysidacea: Mysidae) collected from a submarine cave on Ie-jima Island, Ryukyu Islands, southwestern Japan. Proceedings of the Biological Society of Washington 130: 75–83. https://doi.org/10.2988/17-00001 Shimomura M. & Fujita Y. 2021. Seborgia cavernicola sp. nov. from a submarine cave on Okinawa Island, Ryukyu Islands, southwestern Japan (Crustacea, Amphipoda, Seborgiidae). Zootaxa 4927 (1): 133–142. https://doi.org/10.11646/zootaxa.4927.1.9 Shimomura M., Fujita Y. & Naruse T. 2012. First record of the genus Thetispelecaris Gutu & Illife, 1998 (Crustacea: Peracarida: Bochusacea) from a submarine cave in the Pacific Ocean. Zootaxa 3367 (1): 69–78. https://doi.org/10.11646/zootaxa.3367.1.7 Sterrer W. & Iliffe T. 1982. Mesonerilla prospera, a new Archiannelid from marine caves in Bermuda. Proceedings of the Biological Society of Washington 95: 509–514. Available from https://www.biodiversitylibrary.org/page/34964823 [accessed 17 Jul. 2025]. Swedmark B. 1959. Archiannélides Nerillidae des côtes du Finistère. Archives de Zoologie expérimentale et générale 98: 26–42. Takayasu K. 1978. Ryukyu Limestone of Okinawa-Jima, South Japan: A stratigraphical and sedimentological study. Memoirs of the Faculty of Science, Kyoto University. Series of Geology and Mineralogy 45 (1): 133–175. Tzetlin A.B. & Larionov V.V. 1988. Morphology of a new Archiannelid Akessoniella orientalis gen. et sp. n. (Nerillidae). Zoologicheskii Zhurnal 67: 846–857. Tzetlin A.B. & Saphonov M.A.V. 1992. Trochonerilla mobilis gen. et sp. n., a meiofaunal nerillid (Annelida, Polychaeta) from a marine aquarium in Moscow. Zoologica Scripta 21 (3): 251–254. https://doi.org/10.1111/j.1463-6409.1992.tb00329.x Uchida T. 1935. Eine neue Urannelidenart, Polygordius pacificus n. sp. Proceedings of the Imperial Academy 11: 119–120. https://doi.org/10.2183/pjab1912.11.119 Veron J.E.N. 1992. Hermatypic corals of Japan. Australian Institute of Marine Science, Monograph Series 9: 1–234. https://doi.org/10.5962/bhl.title.60634 Vonnemann V., Schrödl M., Klussmann-Kolb A. & Wägele H. 2005. Reconstruction of the phylogeny of the Opisthobranchia (Mollusca: Gastropoda) by means of 18S and 28S rRNA gene sequences. Journal of Molluscan Studies 71 (2): 113–125. https://doi.org/10.1093/mollus/eyi014 Wang P., Li Q. & Li C. 2014. Geology of the China Seas. Developments in Marine Geology 6. Elsevier. Weese D.A., Fujita Y. & Santos S.R. 2016. Looking for needles in a haystack: Molecular identification of anchialine crustacean larvae (Decapoda: Caridea) from the Shiokawa Spring, Okinawa Island, Ryukyu Islands, Japan. Journal of Crustacean Biology 36 (1): 61–67. Westheide W. 2008. Polychaetes: Interstitial Families, Keys and Notes for the Identification of the Species. Synopses of the British Fauna (New Series) 44, 2nd Edition. Linnean Society, London. Westheide W. & Purschke G. 1996. Leptonerilla diplocirrata, a new genus and species of interstitial polychaetes from the island of Hainan, South China (Nerillidae). Proceedings of the Biological Society of Washington 109 (3): 586–590. Available from https://www.biodiversitylibrary.org/page/34645193 [accessed 17 Jul. 2025]. Wilke U. 1953. Mesonerilla intermedia nov. sp., ein neuer Archiannelide aus dem Golf von Neapel. Zoologischer Anzeiger 150: 211–215. Worsaae K. 2005a. Systematics of Nerillidae (Polychaeta, Annelida). Meiofauna Marina: 49–74. WORSAAE K.et al., New species of Nerillidae (Annelida) from the East China Sea 53 Worsaae K. 2005b. Phylogeny of Nerillidae (Polychaeta, Annelida) as inferred from combined 18S rDNA and morphological data. Cladistics 21 (2): 143–162. https://doi.org/10.1111/j.1096-0031.2005.00058.x Worsaae K. 2020. Annelida (excluding Clitellata and Sipuncula). In: Schmidt-Rhaesa A. (ed.) Guide to the Identification of Marine Meiofauna: 239–270. Verlag Dr. Friedrich Pfeil. Worsaae K. 2021 (2014, Online version). 7.9 Errantia incertae sedis: Nerillidae Levinsen, 1883. In: Purschke G., Böggemann M. & Westheide W. (eds) Handbook of Zoology. Annelida Volume 3: Pleistoannelida, Sedentaria III and Errantia I: 215–227. DeGruyter, Berlin. https://doi.org/10.1515/9783110291704-011 Worsaae K. & Kristensen R.M. 2005. Evolution of interstitial Polychaeta (Annelida). In: Bartolomaeus T. & Purschke G. (eds) Morphology, Molecules, Evolution and Phylogeny in Polychaeta and Related Taxa. Developments in Hydrobiology 179: 319–340. Springer Netherlands, Dordrecht. https://doi.org/10.1007/1-4020-3240-4_18 Worsaae K. & Müller M.C.M. 2004. Nephridial and gonoduct distribution patterns in Nerillidae (Annelida: Polychaeta) examined by tubulin staining and cLSM. Journal of Morphology 261 (3): 259– 269. https://doi.org/10.1002/jmor.10153 Worsaae K. & Rouse G. 2009. Mesonerilla neridae n. sp. (Nerillidae): First meiofaunal annelid from deep-sea hydrothermal vents. Zoosymposia 2: 297–303. https://doi.org/10.11646/ZOOSYMPOSIA.2.1.20 Worsaae K., Sterrer W. & Iliffe T. 2004. Longipalpa saltatrix, a new genus and species of the meiofaunal family Nerillidae (Annelida: Polychaeta) from an anchialine cave in Bermuda. Proceedings of the Biological Society of Washington 117 (3): 346–362. Available from https://www.biodiversitylibrary.org/page/35515799 [accessed 17 Jul. 2025]. Worsaae K., Martínez A. & Núñez J. 2009. Nerillidae (Annelida) from the Corona lava tube, Lanzarote, with description of Meganerilla cesari n. sp. Marine Biodiversity 39 (3): 195–207. https://doi.org/10.1007/s12526-009-0027-2 Worsaae K., Mikkelsen M.D. & Martínez A. 2019a. Description of six new species of Mesonerilla (Nerillidae, Annelida) and an emended description of M. intermedia Wilke, 1953, from marine and cave environments. Marine Biodiversity 49 (5): 2141–2165. https://doi.org/10.1007/s12526-019-00984-6 Worsaae K., Armenteros M., Gonzalez B.C., Iliffe T.M., Jørgensen J.T., Kerbl A., Nielsen S.H. & Martínez A. 2019b. Diversity and evolution of the stygobitic Speleonerilla nom. nov. (Nerillidae, Annelida) with description of three new species from anchialine caves in the Caribbean and Lanzarote. Marine Biodiversity 49 (5): 2167–2192. https://doi.org/10.1007/s12526-018-0906-5 Worsaae K., Kerbl A., Di Domenico M., Gonzalez B.C., Bekkouche N. & Martínez A. 2021a. Interstitial Annelida. Diversity 13 (2): 77. https://doi.org/10.3390/d13020077 Worsaae K., Hansen M.J., Axelsen O., Kakui K., Møller P.R., Osborn K.J., Martínez A., Gonzalez B.C., Miyamoto N. & Fujita Y. 2021b. A new cave-dwelling genus and species of Nerillidae (Annelida) from the Ryukyu Islands, Japan. Marine Biodiversity 51: 67. https://doi.org/10.1007/s12526-021-01199-4 Xia X. 2018. DAMBE7: New and improved tools for data analysis in molecular biology and evolution. Molecular Biology and Evolution 35 (6): 1550–1552. https://doi.org/10.1093/molbev/msy073 Yamanishi R. 1983. Preliminary report on the fauna of interstitial polychaetes (Annelida) of Japan. Benthos Research 24: 41–48. https://doi.org/10.5179/benthos1970.1983.41 European Journal of Taxonomy 1021: 1–54 (2025) 54 Printed versions of all papers are deposited in the libraries of four of the institutes that are members of the EJT consortium: Muséum national dʼHistoire naturelle, Paris, France; Meise Botanic Garden, Belgium; Royal Museum for Central Africa, Tervuren, Belgium; Royal Belgian Institute of Natural Sciences, Brussels, Belgium. The other members of the consortium are: Natural History Museum of Denmark, Copenhagen, Denmark; Naturalis Biodiversity Center, Leiden, the Netherlands; Museo Nacional de Ciencias Naturales-CSIC, Madrid, Spain; Leibniz Institute for the Analysis of Biodiversity Change, Bonn – Hamburg, Germany; National Museum of the Czech Republic, Prague, Czech Republic; The Steinhardt Museum of Natural History, Tel Aviv, Israël. Supplementary file Supp. file 1. Pairwise genetic distances for 18S, 28S, H3, and COI gene fragments (values in %). https://doi.org/10.5852/ejt.2025.1021.3075.13715