Uni e sidade do Minho
Escola de Engenha ia
Ma ia João Cae ano da Cos a
Enginee ing phages owa ds
Pseudomonas
ae uginosa
de ec ion and con ol
Oc obe 2022
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Ma ia João Cae ano da Cos a
UMinho | 2022
Uni e sidade do Minho
Escola de Engenha ia
Oc obe 2022
Ma ia João Cae ano da Cos a
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Mas e ’s Thesis
Mas e ’s deg ee in Bio echnology
Wo k supe ised by
Doc o Diana P iscila Penso Pi es
Doc o Síl io Robe o B anco dos San os
ii
Nome: Ma ia João Cae ano da Cos a
Ende eço ele ónico:
[email protected]
Tí ulo da disse ação: Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
O ien ado es:
Dou o a Diana P iscila Penso Pi es
Dou o Síl io Robe o B anco dos San os
Ano de conclusão: 2022
Mes ado em Bio ecnologia
DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS
Es e é um abalho académico que pode se u ilizado po e cei os desde que espei adas as
eg as e boas p á icas in e nacionalmen e acei es, no que conce ne aos di ei os de au o e di ei os
conexos.
Assim, o p esen e abalho pode se u ilizado nos e mos p e is os na licença abaixo indicada.
Caso o u ilizado necessi e de pe missão pa a pode aze um uso do abalho em condições
não p e is as no licenciamen o indicado, de e á con ac a o au o , a a és do Reposi ó iUM da
Uni e sidade do Minho.
Licença concedida aos u ilizado es des e abalho
A ibuição-NãoCome cial-SemDe i ações
CC BY-NC-ND
h ps://c ea i ecommons.o g/licenses/by-nc-nd/4.0/
iii
AGRADECIMENTOS
No inal des e pe cu so ão in enso e desa ian e, não podia deixa de exp essa o meu
ag adecimen o a odos os que me acompanha am e apoia am du an e oda es a e apa p o issional e
pessoal que chega ago a ao im.
P imei amen e gos a ia de ag adece à Dou o a Diana P iscila Pi es e Dou o Síl io San os,
o ien ado es da minha disse ação de mes ado, po me ecebe em ão bem nes e p oje o. Sou uma
p i ilegiada po oda a expe iência e o mação que me p opo ciona am. Ag adeço a p esença cons an e,
dedicação, paciência, con iança e po se em incansá eis nes e abalho. Todo o osso apoio,
p o issionalismo, excelência e igo cien í ico ala ga am os meus ho izon es ao longo des a jo nada e
o na am-me p epa ada pa a no os desa ios.
Ao g upo do LPhage, ag adeço po me e em ecebido ão bem nes e labo a ó io. Ob igada pela
ossa companhia, disponibilidade e ansmissão de conhecimen o semp e de o ma ão a enciosa. Foi
um p aze abalha con osco e sem ocês não se ia o mesmo. Toda a ossa boa disposição, ca inho e
ajuda con ibuí am pa a que udo is o se o nasse possí el.
Ob igada aos amigos inc í eis que enho. Ag adeço e em c uzado o meu caminho, desde Ma co
de Cana eses, Vila Real ou B aga, pela ossa amizade incondicional, companhei ismo, mo i ação e boa
disposição capazes de ans o ma uma lág ima num so iso. To na am es e pe cu so mais ácil!! Ao
B uno, ob igada pelo apoio incansá el nos momen os mais di íceis, po e es semp e uma pala a de
con o o, pelo ca inho e po oda a cumplicidade. Ob igada po es a es semp e p esen e, ac edi a es e
me aze es ac edi a que udo is o se ia possí el.
Po úl imo, que o ag adece aos meus pais po o na em odo es e pe cu so possí el, apoia em
em odos os momen os e es a em semp e p esen es. O maio ag adecimen o se á semp e pa a ós que
me pe mi em, odos os dias, lu a pelos meus obje i os. Como não podia deixa de se , que o ambém
ag adece aos meus i mãos, Flá ia e Ma co! Apesa de me ouba em os panados e eima em em
con a ia comigo, sei que o cem po mim. Aos meus a ós, que semp e i e am é nas minhas
conquis as, um ab acinho especial.
Es e abalho oi inanciado po undos nacionais a a és da FCT – Fundação pa a a Ciência e a
Tecnologia, I.P., no âmbi o do p oje o “PhageShape – uma pla a o ma e icien e pa a edi a agos de
P. ae uginosa
pa a o con olo de doenças in ecciosas” com a e e ência EXPL/EMD-EMD/1142/2021.
Ob igado!
i
STATEMENT OF INTEGRITY
I he eby decla e ha ing conduc ed his academic wo k wi h in eg i y. I con i m ha I ha e no
used plagia ism o any o m o undue use o in o ma ion o alsi ica ion o esul s along he p ocess
leading o i s elabo a ion.
I u he decla e ha I ha e ully acknowledged he Code o E hical Conduc o he Uni e si y o
Minho.
SUMÁRIO
A
Pseudomonas ae uginosa
é uma bac é ia G am-nega i a que p ospe a numa a iedade de
ambien es. Es a bac é ia pa ogénica é um dos mic o ganismos mais equen emen e isolados do a o
espi a ó io de pacien es em es ado c í ico e imunocomp ome ido. Pa a além disso, o seu equen e
en ol imen o numa ampla gama de doenças e a sua baixa susce ibilidade a uma ampla gama de
an ibió icos, o na
P. ae uginosa
um sé io desa io e apêu ico, que mui as ezes esul a em
in e namen os p olongados, aumen o dos cus os médicos e al as axas de mo alidade.
Face a is o, o desen ol imen o de abo dagens al e na i as ao uso des es an imic obianos é de
ex ema impo ância e os bac e ió agos êm um ele ado po encial no con olo de doenças bac e ianas,
mas ge almen e exibem um espe o de ação limi ado. A a és da u ilização de e amen as de engenha ia
de agos, é possí el p oduzi agos quimé icos com ca ac e ís icas desejá eis de o ma a melho a a
de eção e/ou con olo de es i pes bac e ianas num con ex o clínico. Além disso, os agos modi icados
podem codi ica á ios genes epó e , subs i uindo assim os mé odos de cul u a con encionais.
O obje i o des e p oje o assen a na engenha ia do genoma de agos de
P. ae uginosa
pa a
melho a as suas uncionalidades, assim como aumen a o seu espe o de ação pa a uma ampla gama
de bac é ias hospedei as e ob e uma e amen a p omisso a pa a o diagnós ico e a amen o de
pacien es com in eções esis en es a an ibió icos. O p imei o passo des e abalho consis iu em a alia
o po encial de um ago epó e p e iamen e cons uído, con endo o gene da NanoLuc luci e ase
(PE3Δgp1–gp12:Nluc) pa a de e a células de
P. ae uginosa
. O limi e de de eção des e ago epó e
a iou en e 620 e 9000 UFC/mL em apenas 7 h, sendo o limi e de de eção mais baixo alcançado pa a
a es i pe hospedei a do ago. Pos o is o, es e sis ema de de eção baseado em ago cons i ui uma
al e na i a p omisso a aos mé odos de cul u a, já que pe mi e um diagnós ico mais ápido.
A im de aumen a o espe o lí ico des e ago, oi ealizada uma análise genómica pa a os agos
de
Pseudomonas
phiIBB-PAA2 e B_PaeP_PE3. Des a o ma, o am iden i icadas e selecionadas
po enciais Tail Fibe P o eins (TFPs). Se e p o eínas codi icadas nos genomas dos agos o am
selecionadas e de seguida clonadas, exp essas e pu i icadas, mas apenas uma (pGFP_A2gp55) oi capaz
de se liga a células de
P. ae uginosa
PAO1. Com base nes es ensaios, oi usada uma e amen a de
engenha ia de agos baseada em le edu a pa a inse i com sucesso a TFP uncional (
gp
55) do ago A2
no genoma do ago PE3Δgp1–gp12:Nluc. Ainda assim, es e mé odo não pe mi iu aumen a o espe o
de hospedei os do ago.
Pala as-cha e:
Pseudomonas ae uginosa
, esis ência an ibió ica, bac e ió agos, engenha ia de
agos, agos quimé icos, de eção de pa ógenos, con olo de pa ógenos, limi e de de eção.
i
ABSTRACT
Pseudomonas ae uginosa
is a G am-nega i e bac e ium ha h i es in a a ie y o en i onmen s.
This bac e ial pa hogen is one o he mos common mic o ganims equen ly isola ed om he espi a o y
ac o c i ically ill and immunocomp omised pacien s. In addi ion, i s equen in ol emen in a wide
ange o illnesses and i s low suscep ibili y o a wide ange o an ibio ics, makes
P. ae uginosa
a se ious
he apeu ic challenge, which o en esul s in p olonged hospi al s ays, inc eased medical cos s, and high
mo ali y a es.
Gi en his, he de elopmen o al e na i e app oaches o he use o hese an imic obials is
ex emely impo an and bac e iophages ha e a emendous po en ial agains bac e ial diseases bu hey
usually exhibi a limi ed hos ange. Taking ad an age o phage-enginee ing ools, i is possible o
assemble chime ic phages wi h desi able ea u es in o de o imp o e he de ec ion and/o con ol
bac e ial s ains in clinical se ings. In addi ion, enginee ed phages can encode nume ous epo e genes,
he e o e eplacing he con en ional cul u e me hods.
The aim o his p ojec elies on enginee ing he genome o
P. ae uginosa
phages o imp o e i s
pe o mance by expanding hei hos ange, in o de o ge a p omising ool o he diagnosis and
ea men o pa ien s wi h an ibio ic- esis an in ec ions. This esea ch's ini ial s ep was o e alua e how
well a p e iously buil epo e phage (PE3gp1-gp12:Nluc) could iden i y
P. ae uginosa
cells. The lowes
de ec ion limi o he phage hos s ain
P. ae uginosa
PAO1 was eached by his epo e phage, whose
de ec ion limi anged om 620 o 9000 CFU/mL in only 7 hou s. Ne e heless, because i enables
quicke diagnosis, his phage-based de ec ion echnology is a possible eplacemen o cul u e
app oaches. To inc ease he hos ange o his phage, a genomic analysis was pe o med o he
Pseudomonas
phages phiIBB-PAA2 and B_PaeP_PE3. This me hod allowed o he iden i ica ion and
selec ion o p ospec i e Tail Fibe P o eins (TFPs). Se en selec ed p o eins encoded in phage genomes
we e hen cloned, exp essed and pu i ied, bu only one (pGFP_A2gp55) was capable o binding o
P. ae uginosa
PAO1 cells. Based on hese assays, he yeas -based phage-enginee ing ool was used o
success ully inse he unc ional TFP (
gp
55) om A2 phage on PE3Δgp1–gp12:Nluc phage genome.
Howe e , his app oach was unable o b oaden he ange o phage hos s.
Keywo ds:
Pseudomonas ae uginosa
, an ibio ic esis ance, bac e iophages, phage-enginee ing,
chime ic phages, pa hogen de ec ion, pa hogen con ol, limi o de ec ion.
ii
TABLE OF CONTENTS
Ag adecimen os ................................................................................................................................. iii
Sumá io ..............................................................................................................................................
Abs ac ............................................................................................................................................. i
Lis o abb e ia ions............................................................................................................................ ix
Lis o igu es ..................................................................................................................................... xi
Lis o ables ...................................................................................................................................... xi
1. In oduc ion ................................................................................................................................ 2
1.1. O e iew o
Pseudomonas ae uginosa
clinical impac .......................................................... 2
1.2. Diagnos ic me hods o de ec ion o
Pseudomonas ae uginosa
in clinical se ings ................. 4
1.3. Bac e iophages ................................................................................................................... 7
1.3.1. De ini ion and in ec ion cycles .............................................................................................. 7
1.3.2. Ad an ages and limi a ions o phages .................................................................................. 8
1.3.3. Diagnosis o pa hogens based on phages ........................................................................... 10
1.3.4. Phage-enginee ing echniques ........................................................................................... 11
1.4. P ojec aims ...................................................................................................................... 13
2. Ma e ials and me hods ............................................................................................................. 16
2.1. S ains, plasmids and cul u e condi ions ............................................................................ 16
2.2. Sensi i i y es s o de ec ion o
P. ae uginosa
.................................................................... 17
2.3. E alua ion o ly ic spec a and e iciency o pla ing ............................................................. 18
2.4. Cloning and unc ional analysis o po en ial TFPs ............................................................... 18
2.4.1. Gene ampli ica ion ............................................................................................................ 19
2.4.2. Cloning ............................................................................................................................. 22
2.4.3. P o ein exp ession ............................................................................................................. 25
2.4.4. P o ein pu i ica ion ............................................................................................................ 25
2.4.5. Fluo escence mic oscopy .................................................................................................. 27
2.5. Genome enginee ing o
P. ae uginosa
phage B_PaeP_PE3 .............................................. 27
2.5.1. P epa a ion o he PCR p oduc s o genome enginee ing ................................................... 28
2.5.2. Genome enginee ing ......................................................................................................... 30
2.5.3. T ans o ma ion o cap u ed phage genome in o
P. ae uginosa
cells .................................... 32
2.5.4. Phage p oduc ion and sequencing ..................................................................................... 33
2.5.5. Hos - ange o he chime ic phages ..................................................................................... 33
xi
LIST OF TABLES
Chap e 2
Table 1 - P ime s used o ampli y he TFPs encoding genes om philBB-PAA2A2 and B_PaeP_PE3
phages, he espec i e es ic ion enzyme si e used and hei pa ame e s. Tm ep esen s he mel ing
empe a u e. Enzyme es ic ion si es a e unde lined.…………….…..…………………………………………..…20
Table 2 - Componen s and quan i ies used o PCR wi h Phusion™ Plus DNA Polyme ase.……………....21
Table 3 - The mocycling condi ions o a ou ine PCR wi h Phusion™ Plus DNA Polyme ase ……………..21
Table 4 - Reac ion componen s and olumes o concen a ions used o diges he a ge genes………….22
Table 5 - Reac ion componen s, olumes o inal concen a ions o he liga ion o he a ge genes……..23
Table 6 - PCR mix componen s and hei inal concen a ions o colony PCR…………………………………24
Table 7 - P ime s used o colony PCR and hei pa ame e s. Tm ep esen s he mel ing empe a u e…24
Table 8 - The mocycling condi ions o a colony PCR…………………………………………………………………24
Table 9 – SDS-PAGE componen s and quan i ies ………………..……………………………………………………26
Table 10 - Backbone, ans o ma ions (T1 and T2) and he espec i e DNA agmen s, empla e, size and
p ime s used……………………….……………………………………………………………………………………………28
Table 11 - P ime s used o ampli y all he PCR p oduc s o he yeas ans o ma ion. O e hangs a e
unde lined….……………………………………………….……………………………………………………………………29
Table 12 - Componen s and quan i ies used o PCR wi h Xpe High Fideli y DNA Polyme ase.………....30
Table 13 - The mocycling condi ions used o PCR wi h Xpe High Fideli y DNA Polyme ase …….……..30
Table 14 - PCR mix componen s and concen a ions o yeas colony PCR…………………………….………31
Table 15 – P ime s used in yeas colony PCR and hei pa ame e s. Tm ep esen s he mel ing
empe a u e…………………………………………………………………………………………….……………….………31
Table 16 - The mocycling condi ions o a yeas colony PCR…………………………………………………….…31
Chap e 3
Table 17 - EOP agains di e en s ains o
P. ae uginosa
……..………………………..…………………………..41
Table 18 - EOP o he new phage p oduced (T2) agains di e en s ains o
P. ae uginosa
….………….…52
Supplemen a y ma e ial
Table S1 – Bac e ial s ains, bac e iophages and plasmids u ilized in his s udy…………………………….69
Table S2 - Sequence o nucleo ides and amino acids o he genes used a his wo k……………………….73
x
Table S3 - Anno a ion o phage A2. Fo each locus_ ag, he ansc ip ion s a and s op posi ion. The
co esponding gene p oduc size and pu a i e p edic ed unc ion based on he bes hi and E- alue
ob ained.………………………………………………………………………………………………………………………….76
Table S4 - Anno a ion o phage A2. Fo each locus_ ag, he ansc ip ion s a and s op posi ion. The
co esponding gene p oduc size and pu a i e p edic ed unc ion based on he bes hi and E- alue
ob ained ………………………………………………………………………………………………………………………….79
Chap e 1
INTRODUCTION
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 1 – In oduc ion
2
1. INTRODUCTION
1.1. O e iew o
Pseudomonas ae uginosa
clinical impac
Pseudomonas ae uginosa
is an ubiqui ous G am-nega i e bac e ium belonging o he
Pseudomonadaceae
amily ha is capable o su i ing in a wide ange o en i onmen s (Pacho i e al.,
2019; Silby e al., 2011). This oppo unis ic bac e ium can be ound in wa e , soil and plan s, in ec ing
many di e en o ganisms, such as yeas s, plan s, nema odes, insec s and mammals (Pacho i e al.,
2019; Pe ei a e al., 2014). In humans,
P. ae uginosa
is one o he mos equen pa hogens isola ed
om he espi a o y ac o c i ically ill and immunocomp omised pa ien s and is conside ed he main
cause o mo bidi y and mo ali y in pa ien s wi h en ila o -associa ed pneumonia and cys ic ib osis (CF).
P. ae uginosa
is also equen ly in ol ed in many o he in ec ions, including ca he e -associa ed
in ec ions, bu n wound in ec ions, bloods eam in ec ions, u ina y ac in ec ions, and su gical si e
in ec ions, hus cons i u ing a eal and high conce n in hospi al se ings. Indeed, his pa hogen is a majo
cause o nosocomial bac e aemia, wi h a e y high (>30 %) associa ed mo ali y a e (Basse i e al.,
2018; Juan e al., 2017; Nguyen e al., 2018; Pacho i e al., 2019; Pe ei a e al., 2014). Acco ding o
he Cen e s o Disease Con ol and P e en ion, (2019), in 2017 he e we e an es ima ed 32.600 cases
o in ec ions caused by
P. ae uginosa
in hospi alized pa ien s and app oxima ely 2.700 dea hs in US,
co esponding o $ 767M o heal h ca e cos s.
P. ae uginosa
possesses an a senal o se e al i ulence ac o s o e ade hos cell de ences.
These i ulence mechanisms include adhesins, p o eases, phenazines, pyocyanin, exo oxins o he ype
III sec e ion sys em (T3SS), lagella o lipopolysaccha ides (LPS). These i ulence ac o s ha e speci ic
oles o coun e ac hos de ences. Adhesins, o ins ance, pa icipa e in he ini ial s age o in ec ion,
allowing bac e ia o adhe e o hos cells. P o eases, mainly alkaline p o ease and elas ase, deg ade
elas in, which ep esen s 28 % o he lung issue. Phenazins inc ease in acellula oxida i e s ess,
inhibi ing mi ochond ial ac i i y and cell p oli e a ion in neu ophils and mac ophages. T3SS p omo es
apop osis o euka yo ic cells and he sp ead o he disease h ough he lung (Passado e al., 1993;
Pe ei a e al., 2014; S a e a & Mi o , 2011). Many o he
P. ae uginosa
i ulence ac o s a e egula ed
by quo um-sensing (QS), a cell-cell communica ing mechanism ha con ols gene exp ession based in
luc ua ions on cell densi y. Two dis inc QS sys ems a e known in
P. ae uginosa
: las and hl (Reu e e
al., 2016; S a e a & Mi o , 2011). Besides he i ulence ac o s desc ibed abo e,
P. ae uginosa
also
has an inna e abili y o o m bio ilms, which can be de ined as agg ega es o bac e ia encased in a sel -
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 1 – In oduc ion
3
p oduced ma ix o ex acellula polyme ic subs ances (EPS) ha con e s p o ec ion o he bac e ial cells.
The e o e, hese complex s uc u es a e e y di icul o e en impossible o e adica e wi h an ibio ic
ea men (Cio u & Tolke -nielsen, 2019; Mo adali e al., 2017), being a huge challenge in clinical
se ings.
P. ae uginosa
esis ance may be exp essed by h ee di e en o ms (Figu e 1) o a wide ange
o an ibio ics, such as β-lac ams, aminoglycosides, quinolones and polymyxins (Basse i e al., 2018;
Heinz e al., 2019; Klockge he e al., 2011; Pacho i e al., 2019).
Figu e 1 -
Pseudomonas ae uginosa
esis ance mechanisms.
The in insic esis ance o
P. ae uginosa
includes low pe meabili y o he ou e memb ane,
exp ession o e lux pumps ha expel an ibio ics ou o he cell, and he p oduc ion o an ibio ic
inac i a ing enzymes (B eidens ein e al., 2011; Ghysels e al., 2008; Pacho i e al., 2019). The acqui ed
esis ance o
P. ae uginosa
can be achie ed by ho izon al ans e o esis ance genes o mu a ional
changes (B eidens ein e al., 2011; Pacho i e al., 2019). Adap i e esis ance is inducible and dependen
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 1 – In oduc ion
4
on he con inued p esence o an an ibio ic o ano he en i onmen al s imulus. Se e al igge ing ac o s
a e now quali ied o induce his ype o esis ance, including an ibio ics, biocides, polyamines,
anae obiosis, ca ions, pH and ca bon sou ces, as well as bio ilm o ma ion. These ac o s modula e he
exp ession o many genes, leading o e ec s on he e lux pumps, cell en elope, and enzymes. An
impo an ea u e o adap i e esis ance is ha , once he inducing ac o o condi ion is emo ed, he
o ganism e e s o wild- ype suscep ibili y. Adap i e esis ance can also ha e long- e m consequences.
I cells a e no comple ely e adica ed, as soon as he ea men s ops, g ow h can be obse ed
(B eidens ein e al., 2011). This is o pa icula conce n in clinical en i onmen s whe e
P. ae uginosa
g ows as a bio ilm (B eidens ein e al., 2011).
The o e use and misuse o an ibio ics is a g owing public heal h conce n, which can esul in
nega i e side e ec s and he de elopmen o d ug- esis an bac e ial s ains (Takahashi & Ta suma,
2014). Acco ding o Basse i e al. (2018), in ec ions ela ed o
Pseudomonas spp
. we e epo ed in
60 % o his s udies and o e all, mo ali y anged om 33 o 71 % in pa ien s wi h ca bapenem- esis an
Pseudomonas
in ec ions. In addi ion o mo ali y, esis ance is also associa ed wi h inc eased heal hca e
cos s (Basse i e al., 2018). Mo eo e he de elopmen o new an ibio ics is cu en ly e y limi ed and
ime-consuming (Pang e al., 2019).
In 2017, he Wo ld Heal h O ganiza ion (WHO) published a global p io i y lis o an ibio ic-
esis an bac e ia ha u gen ly equi e he de elopmen o new an ibio ics (Wo ld Heal h O ganiza ion,
2017). The mos c i ical g oup includes mul i- esis an bac e ia ha pose a speci ic h ea in hospi als,
nu sing homes and among pa ien s whose ca e equi es de ices such as en ila o s and blood ca he e s.
This g oup includes
Acine obac e baumannii
,
P. ae uginosa
and se e al
En e obac e iaceae
. Thus, he
disco e y and de elopmen o al e na i e he apeu ic s a egies o con ol
P. ae uginosa
in ec ions is
u gen (B eidens ein e al., 2011; Cha e jee e al., 2016; Pacho i e al., 2019). These new he apeu ic
s a egies can ac alone o in combina ion wi h con en ional he apies, and may include QS inhibi o s,
i on chela ion molecules, accine s a egy, nanopa icles, an imic obial pep ides, elec ochemical
sca olding and phage he apy (Pang e al., 2019).
1.2. Diagnos ic me hods o de ec ion o
Pseudomonas ae uginosa
in clinical se ings
A inc edibly low quan i ies,
Pseudomonas ae uginosa
can cause illnesses; jus 10–100 bacilli
can colonize he in es ine o ex emely ill o immunocomp omised pa ien s, which can esul in pe sis en
and long- e m in ec ions. Long u na ound imes o diagnoses can wo sen pa ien ou comes and aise
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 1 – In oduc ion
5
hospi al cos s (Tang e al., 2017). In addi ion o he de elopmen o new he apies o ea
P. ae uginosa
in ec ions, i is also u gen he de elopmen o as and accu a e ools o de ec
P. ae uginosa
in clinical
se ings, eplacing he con en ional me hods ha a e usually labo ious and ime-consuming.
The biological cha ac e is ics o he bac e ium unde speci ic cul u e condi ions o he ac i i ies
o bac e ial molecules like oxidase, ace amidase, a ginine dihyd olase, and pyocyanin a e he basis o
con en ional
Pseudomonas ae uginosa
de ec ion me hods (Tang e al., 2017). Bac e ia a e mos
equen ly de ec ed by cul u e me hods using selec i e and non-selec i e media.
P. ae uginosa
is easily
g own in di e en media and hese media play an impo an ole in hei de ec ion. In blood aga , a non-
selec i e medium,
P. ae uginosa
is some imes o e g own by he commensal lo a (Xu e al., 2004).
G am-nega i e selec i e media, such as McConkey aga , make he disc imina ion o
P. ae uginosa
om
o he espi a o y pa hogens and na i e lo a mo e con enien . Selec i e media such as
P. ae uginosa
isola ion aga o ce imide aga we e especially de eloped o he cul u e o
P. ae uginosa
(T ampe -
s ande s e al., 2005; Xu e al., 2004). Howe e , hese old p ocedu es ha e some signi ican limi a ions
and equen ly equi e mo e han 48 h o ea ly esul s (T ampe -s ande s e al., 2005).
On he o he hand, in ec ion wi h
P. ae uginosa
can be p o en bo h by he cul u e o he o ganism
i sel and by he de ec ion o he immune esponse o he mic oo ganism. The an ibody es wi h ELISA
(Enzyme-linked immunoso ben assay) demons a ed li le o no in e e ence om c oss- eac i e
an ibodies di ec ed agains o he bac e ia (T ampe -s ande s e al., 2005). Ch onic in ec ion gene ally
causes a high an ibody esponse (Bu ns e al., 2001; T ampe -s ande s e al., 2005).
The polyme ase chain eac ion (PCR) o samples has been used o he de ec ion o
P. ae uginosa
in pa ien s wi h CF a an ea ly s age and has a high sensi i i y o
P. ae uginosa
. Se ological
and molecula echniques a e pa icula ly use ul o ini ial o in e mi en coloniza ion, because ch onic
coloniza ion is usually easily con i med by cul u e (T ampe -s ande s e al., 2005). In o de o
disc imina e be ween iable and non- iable cells, e e se ansc ip ion PCR (RT-PCR) has been c ea ed.
Because hese es s ampli y RNA, a p oduc o ongoing cellula and me abolic ac i i ies, only ecen ly
ali e o ganisms may be iden i ied (Anbu e al., 2017; Young e al., 2005). Due o highe alse-posi i e
esul s as compa ed o cul u e and o he app oaches, as well as echnical di icul ies and cos s, RT-PCR-
based de ec ion me hods a e no equen ly employed, aising ques ions abou hei e icacy. (Jones e
al., 2020; Schmelche & Loessne , 2014).
By adding luo escen molecules o he eac ion mix u e, he eal- ime, luo escence-based
quan i a i e PCR ( eal- ime qPCR) app oach o e s a quan i a i e de ec ion h ough eal- ime moni o ing
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 1 – In oduc ion
6
o PCR eac ions and is one o he mos popula nucleic acid-based molecula de ec ion me hods o
pa hogens a he momen . This echnique allowed he de ec ion o
P. ae uginosa
in CF pa ien s mo e
quickly. Real-Time luo escence-based PCR was also a leading me hod o he de ec ion o pa hogens in
espi a o y ac in ec ions and pneumonia, and i was a e y sensi i e, powe ully speedy, ex ensi ely
applicable, and p ospec i ely de ec able ins umen (Tang e al., 2017).
FISH (Fluo escen In Si u Hyb idiza ion) is ano he echnique used o bac e ial de ec ion;
howe e , he sensi i i y, pe cen age o a ge s ains ha a e de ec ed wi h FISH compa ed o he cul u e
is no e y high, as he mic oscopic de ec ion limi depends on samples o high bac e ial densi y. In
addi ion, he p ocedu e is no simple and does no disc imina e be ween dead and li e cells (Hoga d e
al., 2000; T ampe -s ande s e al., 2005).
A no el kind o so ioniza ion mass spec ome y called ma ix-assis ed lase
deso p ion/ioniza ion ime o ligh mass spec ome y (MALDI-TOF MS) is used o map he p o ein
spec um o mic obes. To ob ain an iden i ica ion, he mass spec ome y da a o clinical mic oo ganisms
a e compa ed wi h he common p o ein da abase o ecognized bac e ia. MALDI-TOF MS has becoming
a as and e ec i e mic obial iden i ica ion me hod used in clinical diagnos ics, en i onmen al moni o ing,
and mic obiological classi ica ion esea ch due o i s speed, accu acy, sensi i i y, au oma ion, and high
h oughpu . This me hod has also been used by some esea che s o iden i y
P. ae uginosa
(Tang e al.,
2017).
These quick p ocedu es, ne e heless, a e hinde ed by he need o expensi e equipmen , ime-
consuming p e-en ichmen s eps, and challenging esul s handling and in e p e a ion (MALDI-TOF MS)
(Schmelche & Loessne , 2014).
Va ious bio ecogni ion componen s, including an ibodies, enzymes, ap ame s, and nucleic acids,
ha e been used ex ensi ely in ecen yea s and a e essen ial o he de ec ion o in ec ions in a a ie y o
complica ed ma ices. An ibodies agains
P. ae uginosa
can appea mon hs be o e a cul u e becomes
posi i e, and a e a use ul pa ame e o moni o ing in ec ion in pa ien s colonized wi h
P. ae uginosa
, as
i es may a y wi h an imic obial ea men bu hese compounds a e labo ious and expensi e o
p oduce, ha e high de ec ion limi s, and equen ly exhibi c oss- eac i i y (Cos a e al., 2022; T ampe -
s ande s e al., 2005). Bac e iophages a e good candida es o eplace adi ional ecogni ion molecules
due o hei in e es ing p ope ies, including high speci ici y, sensi i i y, s abili y, and ease o enginee ing
(Cos a e al., 2022). In addi ion, since hey only mul iply in iable cells, hey can also disc imina e
be ween li e and dead cells, a e simple and a o dable o p oduce, and exhibi high esis ance o changes
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 1 – In oduc ion
7
in empe a u e and pH, chemical sol en s, and p o eases (Schmelche & Loessne , 2014). These
p ope ies can imp o e he ea ly de ec ion o
P. ae uginosa
in clinical se ings since agg essi e
an imic obial he apy can p e en g ow h and de ec ion o
P. ae uginosa
h ough cul u e me hods.
(T ampe -s ande s e al., 2005).
1.3. Bac e iophages
1.3.1. De ini ion and in ec ion cycles
Abou 100 yea s ago, Félix d'Hé elle disco e ed he i uses o bac e ia - bac e iophages (phages).
Thei abili y o p eda e bac e ia quickly p omp ed i s use o ea and p e en in ec ious diseases in
humans and animals (Lin e al., 2017; Mon ei o e al., 2019). Phages a e simple, ye ex emely di e se,
biological en i ies ha consis o DNA o RNA encased in a p o ein capsid.
As na u ally occu ing bac e ial pa asi es, phages a e unable o ep oduce independen ly and
a e ul ima ely dependen on a bac e ial hos o su i al (Lin e al., 2017). The in ec ion begins wi h he
adso p ion o he phage o speci ic bac e ial ecep o s loca ed on he cell su ace and his causes he
genome o he phage o be ejec ed in o he cell. The subsequen eplica ion s a egy de ines he phage
as s ic ly ly ic o empe a e (Figu e 2) (Lin e al., 2017; Mon ei o e al., 2019).
Figu e 2 - Bac e iophage in ec ion cycle. Adap ed om Gaydos, (2018).
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 1 – In oduc ion
8
S ic ly ly ic o i ulen phages always ollow a ly ic li e cycle in which, immedia ely a e he
genome is ejec ed, he exp ession o he phage's ea ly genes edi ec s he hos 's me abolism o phage
DNA eplica ion and p o ein syn hesis. Vi al p o eins a e hen assembled, and he i al genome is
packaged in capsids. A he end o he ly ic cycle, he p oduc ion o la e phage p o eins, such as holins
and endolysins, leads o cell lysis and elease o p ogeny phages ha will be a ailable o s a a new cycle
o in ec ion (D ulis-kawa e al., 2012; Ko igh e al., 2019; Mon ei o e al., 2019).
Tempe a e phages can ollow a lysogenic cycle in which hey usually in eg a e hei genome wi h
he hos ch omosome, whe e hey emain quiescen , as p ophages. The p ophage eplica es wi h he
bac e ial ch omosome and is subsequen ly ansmi ed by cell di ision o he daugh e cells. This
quiescen s a e can be main ained o long pe iods, unless he cell is exposed o an en i onmen al
s imulus ha can cause he phage o be induced in o a ly ic cycle (Da ies e al., 2016; Ko igh e al.,
2019; Lin e al., 2017; Mon ei o e al., 2019).
In addi ion, phages can assume a pseudolysogenic cycle, in which he phage genome is
anspo ed in hos cells wi hou p opaga ion (ly ic cycle) o eplica ion wi h he cell genome (lysogenic
cycle). The non-in eg a ed phage genome is inhe i ed by only one o he eme ging descenden cells. This
phenomenon is appa en ly caused by un a ou able g ow h condi ions o hos cells, such as se e e
hunge , and ends when hose condi ions cease; he phage hen es a s i s de elopmen h ough he ly ic
o lysogenic li e cycle (Lin e al., 2017; Mon ei o e al., 2019).
1.3.2. Ad an ages and limi a ions o phages
In consequence o he global sp ead o an ibio ic esis ance, phages a e becoming inc easingly
a ac i e as an al e na i e he apeu ic app oach agains an ibio ic- esis an bac e ial in ec ions (Pi nay
e al., 2018).
Theo e ically, he e a e no bac e ia ha canno be lysed by a leas one phage. One o he mos
impo an cha ac e is ics o phages is hei high speci ici y, meaning ha hey ha e he abili y o kill only
he pa hogen ha hey can ecognize (P incipi e al., 2019).This high speci ici y a oids he mos impo an
p oblem ela ed o he adminis a ion o an ibio ics, which is hei in luence on he en i e mic obiome
wi h he elimina ion o po en ially bene icial bac e ia (Domingo-Calap & Delgado-Ma ínez, 2018; Loc-
ca illo & Abedon, 2011). In addi ion o he high speci ici y, phages o e some o he impo an
ad an ages o e an ibio ics. One o hem is ha hei isola ion, ypically om was ewa e and sewage, is
usually ela i ely easy (al hough i depends on he hos bac e ia) (P incipi e al., 2019). Also, phages a e
Chap e 2
MATERIALS AND METHODS
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
16
2. MATERIALS AND METHODS
2.1. S ains, plasmids and cul u e condi ions
All he s ains, bac e iophages and plasmids used in his wo k a e lis ed in Supplemen a y
ma e ial - Table S1. The clinical isola es we e p o ided by he Hospi al o B aga (Po ugal).
All bac e ial s ains we e g own in Lysogeny B o h (LB) (Nzy ech) a 37 °C unde agi a ion (120
pm) o in LB aga (LBA) pla es, ob ained by adding 12 g٠L-1 o aga (Lio lchem). All media we e p epa ed
acco ding o he manu ac u e 's ins uc ions and au ocla ed be o e use. Due o he acili y o be
manipula ed and he high pool o ools a ailable o his o ganism,
Esche ichia coli
was used o cloning
and he e ologous exp ession. The
E. coli
s ain g ow h media we e supplemen ed wi h an ibio ics o
selec ion when necessa y: kanamycin (Nzy ech) a 50 µg/mL and gen amicin (Nzy ech) a 20 µg/mL,
and he bac e ial g ow h
was de e mined by measu ing he op ical densi y a 600nm (OD600nm) in 96-well
pla es (O ange Scien i c) using a Mul iskan™ FC Mic opla e Pho ome e (The moFishe Scien i c).
Chemically compe en (QC) cells we e p epa ed o he ollowing s ains:
E. coli
A c ic Exp ess
(AE)(DE3), C43 (DE3) and BL21 (DE3). Fo his, he
E. coli
s ain was g own o e nigh a 37 °C, 120
pm in 10 mL o LB. This cul u e was dilu ed 1:100 in esh LB and incuba ed a 37 °C, 120 pm o 1
h 30 min. Following cen i uga ion (3300 ×g, 4 °C, 10 min), he cells we e collec ed, esuspended in hal
o he ini ial olume o ice-cold 0.1 M CaCl2, and s o ed on ice o 30 min. A e a second cen i uga ion
(3300 ×g, 4 °C, 10 min), he pelle was esuspended in 1/10 o he ini ial olume o ice-cold 0.1 M
CaCl2. Finally, ano he cen i uga ion (3300 ×g, 4 °C, 10 min) was ca ied and he pelle esuspended in
1 mL o ice-cold 0.1 M CaCl2 and aliquo s o 50 µL we e made and s o ed a -80 °C un il use.
T ans o man AE cells we e inocula ed in LB b o h supplemen ed wi h Kanamycin and
gen amicin, a 16 °C, 160 pm while C43 and BL21 cells we e inocula ed in LB b o h supplemen ed only
wi h kanamycin. C43 cells we e cul u ed a 21 °C and 160 pm and BL21 cells we e cul u ed on he
same condi ions as AE.
The cons uc ions o he ecombinan plasmids we e p edic ed using he SnapGene™ 1.1.3
e sion So wa e. All bac e ia (wi h o wi hou he co ec cons uc s) we e s o ed a -20 °C in LB b o h
supplemen ed wi h 20 % glyce ol ( / ).
The
Saccha omyces ce e isiae
BY4741 (MATa his3Δ1 leu2Δ0 me 15Δ0 u a3Δ0) and he yeas
cen ome e ec o pRS415 (ATCC 87520) wi h LEU2 ma ke we e ob ained om labo a o y s ocks.
S.
ce e isiae
BY4741 was cul u ed in YPD (1 % (w/ ) Bac o Yeas Ex ac , 2 % (w/ ) Bac o Pep one and
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
17
2 % dex ose (w/ )) o YPD aga a 30 °C. All clones (yeas ans o man s) wi h he p ope gene size we e
s o ed a -20 °C in SD-Leu [0.67 % Yeas Ni ogen Base (YNB), 0.069 % CSM-Leu, 2 %
dex ose] supplemen ed wi h 20 % glyce ol ( / ).
2.2. Sensi i i y es s o de ec ion o
P. ae uginosa
The sensi i i y o a p e iously assembled epo e phage (designa ed as PE3Δgp1–gp12:Nluc)
was assessed he e o de e mine he de ec ion limi o he phage. This phage consis s in he PE3Δgp1–
gp12 phage wi h he Nanoluc epo e gene, which was inse ed a e he endolysin gene.
Cul u es o
P. ae uginosa
PAO1 g own o e nigh in LB medium we e nine- old se ially dilu ed and
in ec ed wi h 105 PFU/mL o he epo e phage PE3Δgp1–gp12:Nluc. Bac e ial coun s om each dilu ion
we e de e mined by pla ing on LB aga p io o in ec ion. In ec ed cul u es (50 µL) we e incuba ed a
37 °C wi h agi a ion (120 pm) and bioluminescence was quan i ied a ime 0 and e e y hou , du ing a
pe iod o 7 hou s, in eppendo ubes using a Ul asensi i e Single Tube Luminome e (P omega) a e
he addi ion o Nano-Glo® Luci e ase (P omega) eagen acco ding o he manu ac u e ’s ins uc ions.
Figu e 3 shows he p ocedu e o he sensi i i y es s in a schema ic way.
Figu e 3 - P ocedu e ollowed o he sensi i i y es s, o he de ec ion o
P. ae uginosa
.
In non-en ichmen expe imen s, he bac e ial cul u es we e in ec ed wi h phage immedia ely a e
dilu ions, and he luminescence signal (RLUs) was acked o e ime (maximum o 7 h). In en ichmen
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
18
assays, he dilu ions o he bac e ial cul u e we e incuba ed a 37°C o h ee hou s be o e being in ec ed
wi h phage o 4 hou s.
The me hodology was epea ed o some clinical s ains o
P. ae uginosa
(5, 6, 16, 21, 23, 27,
A65, 065, 092 and PA14 – lis ed in Supplemen a y ma e ial - Table S1) and o clinical s ains o
E. coli
(A51),
Klebsiella pneumoniae
(A36, A57),
S aphylococcus au eus
(A1, A9, A39),
En e ococcus
aecalis
(A74), and
En e ococcus aecium
(A78), also lis ed in Supplemen a y ma e ial - Table S1.
2.3. E alua ion o ly ic spec a and e iciency o pla ing
To e alua e he ly ic spec um o phages, one d op (5 µL) o each phage sample was added o
he bac e ial lawns and incuba ed o e nigh a 37 °C. The bac e ial lawns we e p epa ed by mixing 100
µL o bac e ial suspensions wi h 3-5 mL o LB so aga (LB wi h 0.6 % (w/ ) o aga ) in o a LBA pla e.
A e incuba ion, he hos ange was de e mined by isualizing he p esence o lysis zones, sugges ing
he phage's abili y o in ec he hos (Pi es e al., 2021; Ribei o e al., 2019). I a lysis zone was obse ed
in he spo es , hen he e iciency o pla ing (EOP) o he espec i e phage was assessed by pla ing se ial
dilu ions o he phage s ock on he bac e ial lawns ha p e iously showed a lysis zone. A e o e nigh
incuba ion a 37 °C, he esul ing Plaque o ming uni s (PFU’s) we e coun ed. The EOP (a e age PFU on
a ge bac e ia / a e age PFU on hos bac e ia) was hen de e mined (Table 17).
When he a io was 0.5 o highe , meaning ha he in ec ion on he a ge bac e ia p oduced a
leas 50 % o he PFU epo ed o he p ima y hos , he a e age EOP alue o a ce ain phage-bac e ium
combina ion was classed as "High p oduc ion". EOP alues be ween 0.001 and 0.1 we e ca ego ized as
"Low p oduc ion" e iciency, while alues g ea e han 0.1 bu less han 0.5 we e classi ied as "Medium
p oduc ion" e iciency. An EOP o 0.001 o less was conside ed ine icien (Mi zaei & Nilsson, 2015).
Based on he analysis o he ly ic spec a, 2 phages wi h complemen a y hos anges we e selec ed o
he nex asks.
2.4. Cloning and unc ional analysis o po en ial TFPs
Tail ibe p o eins iden i ied du ing he genome analysis we e selec ed based on he exis ence o
homologs deposi ed in he NCBI da abase o non- edundan p o eins iden i ied h ough BLASTp and also
on homologs o he p edic ed s uc u e using HHp ed. In addi ion, he p edic ed unc ional domains, he
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
19
molecula weigh , and he isoelec ic poin o he p o eins we e iden i ied and calcula ed using
bioin o ma ics analysis ools (Cos a e al., 2020; San os e al., 2020).
2.4.1. Gene ampli ica ion
Se en di e en genes we e selec ed (nucleo ide and amino acidic sequence o he selec ed genes
a e a ailable in Supplemen a y ma e ial – Table S2). P ime s con aining speci ic es ic ion cloning si es
we e designed o ampli y he genes encoding he ecombinan p o eins and o inse hem in o he pGFP
plasmid. This plasmid consis s in a cons uc ion o he comme cial plasmid pET28a(+) (No agen’s), ha
ca ies he T7 p omo e , a 6× His- ag N- e minal, a kanamycin esis an ma ke and a lac p omo e , wi h
he syn he ic cons uc aceGFP (
Aequo a coe ulescens
G een Fluo escen P o ein gene. GenBank:
AY233272.1) inse ed in he mul iple cloning si e (MCS) be ween he
Nde
I
and
BamH
I es ic ion enzymes
si es (Figu e 4) (Cos a e al., 2020). aceGFP is a commonly used ool in molecula biology, medicine and
cell biology, as i can be used as biological ma ke . Fu he mo e, usion o aceGFP o a p o ein does no
usually change he unc ion o loca ion o he p o ein and combines a numbe o ad an ageous ai s,
including high s abili y, minimal oxici y, and he abili y o induce luo escence when exci ed a a p ope
wa eleng h, elimina ing he need o a subs a e as is necessa y o luci e ases (Schmelche & Loessne ,
2014).
Figu e 4 – Gene al ea u es o pGFP ec o , used o cloning and exp ession o he TFP genes. pGFP ec o con ains he same ea u es as
pET28a+ (No agen) wi h he addi ion o he aceGFP gene.
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
20
The TFP genes we e inse ed be ween he
Sac
I and
Xho
I es ic ion si es since hese enzymes do
no cu he TFP coding sequences as p edic ed wi h SnapGene™ 1.1.3. The use o wo di e en es ic ion
enzymes was used o p e en he plasmid om eci cula ing clea age and o ensu e he inse ion o he
TFP gene in he co ec di ec ion.
The p ime s (Table 1) we e designed o include a he 5' end he enzyme es ic ion si es
(unde lined) and some nucleo ides ha we e added o op imize enzyme ac i i y (CG epea s). SnapGene™
1.1.3 was used o de e mine some pa ame e s as he mel ing empe a u e (Tm) and he GC con en .
Table 1 - P ime s used o ampli y he TFPs encoding genes om phiIBB-PAA2 and B_PaeP_PE3 phages, he espec i e es ic ion enzyme
si e used and hei pa ame e s. Tm ep esen s he mel ing empe a u e. Enzyme es ic ion si es a e unde lined
Gene
Sequence (5’→3’)
Enzyme
Tm (°C)
GC
con en .(%)
A2gp53
Fw: GCCGCCGAGCTCATGAGTCAAAAGTACAGCCCTTCG
Sac
I
56
46
R : CCGCCGCTCGAGTCATGGAGTCACCACCAGGG
Xho
I
56
60
A2gp55
Fw: GCCGCCGAGCTCATGGGTCTTGAGGTCGCAAC
Sac
I
54
55
R : CCGCCGCTCGAGTCAGTTCTTAATGATGAAGAACACAG
Xho
I
53
35
PE3gp39
Fw: GCCGCCGAGCTCATGCTACTACTCGACGCAGTG
Sac
I
69
64
R : CCGCCGCTCGAGTCAGGTCCTCAAGCTGCGC
Xho
I
72
71
PE3gp44
Fw: GCCGCCGAGCTCGTGGCTCGGTTCAAGAATCC
Sac
I
54
55
R : CCGCCGCTCGAGTTATTCGTCCTCCATGGCCC
Xho
I
54
55
PE3gp45
Fw: GCCGCCGAGCTCATGCGCGGCATTATCGCGG
Sac
I
55
63
R : CCGCCGCTCGAGTTAAACATTTTTCAGCTCCGCCTG
Xho
I
54
42
PE3gp46
Fw: GCCGCCGAGCTCATGTTTAAGACCGAAGTAAAGGGACG
Sac
I
56
42
R : CCGCCGCTCGAGTTATGCCCTCGCCACCGTAAAC
Xho
I
57
55
PE3gp47
Fw: GCCGCCGAGCTCATGGCACTGATCTACGACTTCAAC
Sac
I
56
46
R : CCGCCGCTCGAGTTACATGTGCCCTCTGAATTGGAC
Xho
I
56
46
DNA agmen s we e ampli ied wi h Phusion™ Plus DNA Polyme ase (The moFishe Scien i ic)
ha has p oo eading ac i i y in o de o educe he inse ion o inco ec nucleo ides, using phage phiIBB-
PAA2 (sho name A2) as empla e DNA o genes 53 and 55, and phage B_PaeP_PE3 (sho name
PE3) as empla e DNA o genes 39, 44, 45, 46 and 47. The PCR mix componen s we e adjus ed
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
21
acco ding o he manu ac u e 's ins uc ions (Table 2) and he PCR ampli ica ion was pe o med on a
T100™ The mal Cycle (BioRad).
Table 2 - Componen s and quan i ies used o PCR wi h Phusion™ Plus DNA Polyme ase
Componen s
Concen a ion
Phusion Plus DNA Polyme ase
0.02 U/µL
5× Phusion Plus Bu e
1×
dNTP mix (10mM)
200 µM
P ime s
0.5 µM
Templa e DNA
0.9 ng/µL
Wa e , nuclease ee
o 50 µL
The he mocycling condi ions o he PCR a e shown in Table 3.
Table 3 - The mocycling condi ions o a ou ine PCR wi h Phusion™ Plus DNA Polyme ase
S ep
Tempe a u e
Time
Ini ial Dena u a ion
98 °C
5 min
25-35 Cycles
98 °C
10 sec
55 °C o 60 °C
10 sec
72 °C
15-30 sec/Kb
Final Ex ension
72 °C
5 min
Hold
12 °C
Con i ma ion o PCR p oduc s was pe o med h ough aga ose gel elec opho esis. The gels
con ained 1 % (w/ ) aga ose (Nzy ech) dissol ed in 1× TAE bu e (1 mM e hylenediamine e aace ic acid
(EDTA); 40 mM T is base; 20 mM ace ic acid) and we e s ained wi h G eenSa e P emium (Nzy ech). The
1 Kb GRS Ladde DNA (G isp) was used as a ma ke . Elec opho esis was pe o med in 1× TAE bu e a
100 V o 40 min in a Pe ec Blue gel sys em (VWR) and he gels we e isualized using a ChemiDoc™
XRS (BioRad) equipmen wi h Image Lab™ 5.1 so wa e (BioRad). Then, he PCR p oduc s we e pu i ied
using he DNA Clean and Concen a o ki (Zymo Resea ch) and he DNA concen a ion o he ampli ied
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
22
agmen s was de e mined using he NanoD op™ One Mic o olume UV-Vis Spec opho ome e
(The moFishe Scien i ic).
2.4.2. Cloning
Plasmid and PCR p oduc s we e diges ed wi h wo Fas Diges Res ic ion Enzymes
Sac
I and
Xho
I
(The moFishe Scien i ic), c ea ing s icky ends complemen a y be ween he ec o and he inse . The
eac ion componen s we e adjus ed acco ding o he manu ac u e 's ins uc ions and a e shown in
Table 4. Diges ions we e pe o med a 37 °C o 2 h and inac i a ed in a Hea Block (VWR) a 82 °C o
6 min.
Table 4 - Reac ion componen s and olumes o concen a ions used o diges he a ge genes
Componen s
Volume
10× FD Bu e
2 µL
DNA inse o DNA plasmid
200 ng o 1000 ng
SacI FD
1 µL
XhoI FD
1 µL
Wa e , nuclease ee
o 20 µL
Diges ed p oduc s we e cleaned wi h he DNA Clean and Concen a o Ki (Zymo Resea ch)
acco ding o he manu ac u e ’s ins uc ions and DNA concen a ion de e mined using he NanoD op™
One Mic o olume UV-Vis Spec opho ome e (The moFishe Scien i ic).
A e diges ion, he genes we e inse ed in o pGFP ( o use hem wi h he ups eam aceGFP) using
he T4 DNA Ligase (The moFishe Scien i ic), acco ding o he manu ac u e 's ins uc ions (Table 5), o
liga e DNA agmen s wi h cohesi e ends, ob aining di e en cons uc s. The liga ion mix u e was
incuba ed a oom empe a u e o 2 h and he eac ion s opped by a subsequen incuba ion a 72 °C
o 6 min. To educe backg ound (non-diges ed pGFP), a subsequen diges ion s ep was pe o med wi h
0.5 µL o
Sal
I (The moFishe Scien i ic) and 1 µL o he espec i e bu e (The moFishe Scien i ic),
ollowed by incuba ion a 37 °C o 45 min. The
Sal
I enzyme was u he inac i a ed a 80 °C o 5 min.
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
23
Table 5 - Reac ion componen s, olumes o inal concen a ions o he liga ion o he a ge genes
Componen s
Volume
Linea ec o DNA (plasmid)
20-100 ng
Inse DNA (gene)
1:1 o 5:1 mola a io o e ec o
10× T4 DNA Ligase Bu e
2 µL
T4 DNA Ligase
1 Weiss U
Wa e , nuclease ee
o 20 µL
The p ime design, gene ampli ica ions, diges ions and liga ions we e all simula ed
in silico
using
he SnapGene™ 1.1.3 e sion So wa e.
The ecombinan plasmids pGFP_A2gp53, pGFP_A2gp55, pGFP_PE3gp39, pGFP_PE3gp44,
pGFP_PE3gp45, pGFP_PE3gp46 and pGFP_PE3gp47 consis in he inse ion o he pu a i e TFP
encoding genes
gp53
and
gp55
, om phiIBB-PAA2 phage, and
gp
39,
gp
44, gp
45
, gp
46
and
gp
47, om
B_PaeP_PE3 phage, in he pGFP plasmid. These plasmids we e ans o med in o compe en
E. coli
AE
(DE3) cells by hea shock.
B ie ly, o he ans o ma ion o he plasmids, 5 µL o liga ion was mixed gen ly wi h an aliquo
o chemically compe en cells. A e 20-30 min on ice, a hea shock was pe o med: 50 sec a 42 °C and
2 min on ice. Then, 300 µL o SOC (Supe Op imal b o h wi h Ca aboli e ep ession) was added o he
ube and he cells we e allowed o eco e o 1 h 30 min a 37 °C. Then, he suspension was sp ead on
LB aga pe i dishes con aining kanamycin (50 µg/mL) and gen amicin (20 µg/mL) o QC AE (DE3)
cells. The pla es we e incuba ed o e nigh a 37 °C and checked o he p esence o ans o med colonies.
The esul ing ans o med colonies we e subjec ed o colony PCR o assess co ec assembly
(cells ha inco po a ed he ecombinan ec o ) be o e he con i ma ion by Sange sequencing. Colonies
we e andomly selec ed and esuspended in 25 µL o LB b o h wi h he co esponding an ibio ic(s) o be
used as a empla e in he PCR eac ion. The PCR eac ion was pe o med using he Xpe Fas Ho s a
Mas e mix (2×) (G isp) whe e he T7 p ime s we e added and he eac ion was adjus ed acco ding o he
manu ac u e 's ecommenda ions (Table 6).
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
24
Table 6 - PCR mix componen s and hei inal concen a ions o colony PCR
Componen s
Concen a ion
Xpe Fas Ho s a Mas e mix (2×)
wi h dye (G isp)
1×
T7 Fo wa d p ime
0.4 µM
T7 Re e se p ime
0.4 µM
Templa e DNA
1-250 ng
Wa e , nuclease ee
o 6 µL
T7 Mas e mix (2×) wi h dye (G isp) consis s on he Xpe Fas Ho s a , supplied as a con enien
2× mas e mix and which includes an elec opho esis ine acking dye, con aining all componen s
necessa y o as PCR and he T7 o wa d and e e se p ime s (speci ic o he pGFP plasmid, showed
on Table 7).
Table 7 - P ime s used o colony PCR and hei pa ame e s. Tm ep esen s he mel ing empe a u e
P ime
Sequence (5’→3’)
Size (bp)
Tm (ºC)
GC con en (%)
T7 o wa d
TAATACGACTCACTATAGGG
20
47.7
40
T7 e e se
GCTAGTTATTGCTCAGCGG
19
51.1
53
PCR ampli ica ion was pe o med in a DNA he mocycle (T100™ The mal Cycle (BioRad)) and
he PCR p o ocol is desc ibed in Table 8.
Table 8 - The mocycling condi ions o a colony PCR
S ep
Tempe a u e
Time
Ini ial Dena u a ion
95 °C
5 min
35 Cycles
95 °C
15 sec
49 °C
15 sec
72 °C
30 sec
Final Ex ension
72 °C
5 min
Hold
12 °C
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
31
Li hium Ace a e, and 50 µL 2 mg/mL salmon spe m DNA). A e 45 min o incuba ion a 42 °C, he
mix u e was cen i uged (13000 ×g, RT, 30 sec), esuspended in 1 mL o YPD and incuba ed a 30 °C
o 2-3 hou s wi h 120 pm o agi a ion. The yeas ans o man s we e hen selec ed on syn he ic de ined
medium wi h leucine d opou (SD-Leu) [0.67 % Yeas Ni ogen Base (YNB), 0.069 % CSM-Leu, 2 %
dex ose] aga pla es incuba ed a 30 °C o 3 days.
A e , yeas colony PCR was pe o med o con i m he co ec assembly o he agmen s. Fo
his, andomly chosen colonies we e esuspended in 10 µL o 0.02 M NaOH and hea ed a 99 °C o 10
min. The supe na an was hen used as empla e o he PCR eac ion wi h D eamTaq™ DNA polyme ase
(The moFishe Scien i ic) ollowing he manu ac u e 's ins uc ions (Table 14). The p ime s used in yeas
colony PCR o bo h ans o ma ions a e lis ed in Table 15 and he PCR condi ions a e de ailed in Table
16. All he PCR eac ions we e ca ied ou in a DNA he mocycle (T100™ The mal Cycle (BioRad)).
Table 14 - PCR mix componen s and concen a ions o yeas colony PCR
Componen s
Concen a ion
D eamTaq™ G een PCR Mas e Mix (2×)
25 µL
Fo wa d p ime
0.5 µM
Re e se p ime
0.5 µM
Templa e DNA
3 µL
Wa e , nuclease ee
o 50 µL
Table 15 – P ime s used in yeas colony PCR and hei pa ame e s. Tm ep esen s he mel ing empe a u e
P ime
Sequence (5’→3’)
Tm (°C)
GC
con en .(%)
P15
Fw: GCACCTTCCGGCTGATCC
59
67
P16
R : GCAGAAGTCCAGCACGTCG
59
63
Table 16 - The mocycling condi ions o a yeas colony PCR
S ep
Tempe a u e
Time
Ini ial Dena u a ion
95 °C
3 min
30 Cycles
95 °C
30 sec
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
32
55 °C
30 sec
72 °C
1 min/Kb
Final Ex ension
72 °C
10 min
Hold
4 °C
The PCR p oduc s om yeas colony PCRs we e un on a 1 % (w/ ) aga ose gel. The posi i e
ans o man s ha showed he co ec assembly we e inocula ed in SD-Leu liquid medium o 24 h a
30 °C. Then, he YAC-Phage DNA was ex ac ed om yeas cells using he QIAp ep Spin Minip ep Ki
(Qiagen) combined wi h zymolyase® 20T (G isp) ollowing a p e iously desc ibed p o ocol (Ando e al.,
2015) and he DNA concen a ion was de e mined using he NanoD op™ One Mic o olume UV-Vis
Spec opho ome e (The moFishe Scien i ic).
2.5.3. T ans o ma ion o cap u ed phage genome in o
P. ae uginosa
cells
The p epa a ion o elec ocompe en
P. ae uginosa
PAO1 cells was pe o med acco ding o a
me hod p e iously desc ibed by Choi e al., (2006) wi h mino modi ica ions. B ie ly, 6 mL o an o e nigh -
g own cul u e we e dis ibu ed by 4 mic ocen i uge ubes and cen i uged (16000 ×g, RT, 1 min). Each
pelle was hen washed wice wi h 1 mL o 300 mM suc ose. Fo each ans o ma ion, he 4 bac e ial
pelle s we e esuspended in a o al o 100 µL o 300 mM suc ose and mixed wi h he ex ac ed DNA
(YAC-phage DNA) (Pi es e al., 2021). This mix u e was hen ans e ed in o a 2 mm gap elec opo a ion
cu e e, a pulse (25 µF, 200 Ω, 2.5 kV) was applied using an
E. coli
Pulse ™ T ans o ma ion Appa a us
(BioRad) and 900 µL o LB medium was added o eco e he cells. Be o e pe o ming plaque o ma ion
expe imen s, he cellula suspension was ans e ed o a ube and incuba ed a 37 °C o 2-4 hou s wi h
120 pm o agi a ion (Pi es e al., 2021).
Abou 300 µL o he cellula suspension p oduced by YAC-phage DNA elec opo a ion we e
combined wi h 3 mL o LB so aga and pla ed in LBA pla e in o de o eco e he chime ic phages. The
pla es we e examined o see i any phage plaques we e p esen a e o e nigh incuba ion a 37 °C (Pi es
e al., 2021).
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 2 – Ma e ials and Me hods
33
2.5.4. Phage p oduc ion and sequencing
When phage plaques we e eco e ed a e he elec opo a ion o he YAC-phage DNA, he
ecombinan phages we e hen p opaga ed o high i e s. B ie ly, a single phage plaque was picked and
elu ed in 50 µL o SM bu e . Then, his solu ion was used o in ec 15 mL o a
P. ae uginosa
PAO1 log-
phase cul u e. A e incuba ion o 8 h a 37 °C, his suspension was cen i uged (9000 ×g, 4 °C, 10
min) and he supe na an was collec ed, il e ed (0.22 µm) and kep a 4 °C un il u he use (Pi es e
al., 2017).
Finally, he phage i e was e alua ed by PFU’s coun ing. The phage s ock solu ion was se ially
dilu ed in SM bu e and 10 µL o each dilu ion we e pla ed in o he bac e ial lawns. The pla es we e
incuba ed o e nigh a 37 °C and he PFU’s we e hen coun ed.
The co ec inse ion o he gene encoding he TFP on he chime ic phages was con i med by
PCR, wi h he p ime s used on yeas colony PCR and a e p oduc cleaning, by Sange sequencing.
2.5.5. Hos - ange o he chime ic phages
The hos - ange o he chime ic phages was e alua ed agains he clinical s ains o
P. ae uginosa
o compa e o he wild- ype phage. This was pe o med as desc ibed in sec ion 2.3. In he cases whe e
lysis was seen, phage suspensions we e se ially dilu ed and he dilu ions we e pla ed on he bac e ial
lawns o look o po en ial cases o lysis om wi hou .
Chap e 3
RESULTS AND DISCUSSION
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
35
3. RESULTS AND DISCUSSION
3.1. Fas and sensi i e de ec ion o
P. ae uginosa
using epo e phages
Rapid and sensi i e me hods a e highly needed o he speci ic de ec ion o
P. ae uginosa,
namely
in clinical se ings. An accu a e iden i ica ion o he pa hogen allows a apid implemen a ion o he
app op ia e ea men , educing he se e i y o in ec ion and also he associa ed cos s. The PE3Δgp1–
gp12:Nluc epo e phage ca ying he Nluc gene was p e iously assembled using he yeas -based phage-
enginee ing pla o m a he esea ch g oup and he e, his phage was explo ed o assess i s sensi i i y and
speci ici y o de ec
P. ae uginosa
cells and e alua e he de ec ion limi .
The sensi i i y o his epo e phage sys em was quan i ied by in ec ing se ial dilu ions o hos
cells wi h he phage a 105 PFU/mL and quan i ying he ligh -emi ing RLUs (Rela i e ligh uni s) o 7 h.
Figu e 6 shows he dispe sion g aph e e ing o he RLUs o e ime, o assays wi hou en ichmen .
Figu e 6 - Rela i e ligh uni s (RLUs) o e ime, wi hou sample en ichmen . E o ba s ep esen s anda d de ia ions om 3 independen
expe imen s.
The ba g aph e e ing o he RLUs o e ime, o assays wi hou en ichmen , is ep esen ed in
Figu e 7.
200
2000
20000
200000
2000000
20000000
200000000
012345678
Rela i e Ligh Uni s (RLUs)
Time (h)
5.4x10^9 CFU/mL PAO1 (PAO1 only)
PE3Δgp1–gp12:Nluc (phage only)
5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
36
Figu e 7 - G aphic ep esen a ion o ba s co esponding o di e en concen a ions o bac e ia in ec ed wi h he epo e phage, wi hou
sample en ichmen , o ela i e ligh uni s a ime 0 h and 7 h. E o ba s ep esen s anda d de ia ions om 3 independen expe imen s.
Acco ding o he esul s om Figu e 7, he de ec ion limi o phage PE3Δgp1–gp12:Nluc was
5.4×102 CFU/mL bu o y o imp o e his limi o de ec ion, an addi ional es was ca ied ou .
P. ae uginosa
PAO1 was en iched be o e phage addi ion by incuba ing he bac e ial dilu ions a 37 ºC o
3 h. A e adding he phage, he in ec ion was acked o 4 h in o de o keep he o al ime o he
expe imen 7 h, simila ly o he assays wi hou en ichmen . The esul s ob ained o he dispe sion g aph
e e ing o he RLUs o e ime, o assays wi h en ichmen a e ep esen ed in Figu e 8.
Figu e 8 - Rela i e ligh uni s (RLUs) o e ime, wi h sample en ichmen . E o ba s ep esen s anda d de ia ions om 3 independen
expe imen s.
200
2000
20000
200000
2000000
20000000
200000000
0 7
Rela i e Ligh Uni s (RLUs)
Time (h)
5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
5.4x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
200
2000
20000
200000
2000000
20000000
200000000
0 1 2 3 4 5
Rela i e Ligh Uni s (RLUs)
Time (h)
5.4x10^9 CFU/mL PAO1 (PAO1 only) PE3Δgp1–gp12:Nluc (phage only)
5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
5.4x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
37
The ba g aph e e ing o he RLUs o e ime, o assays wi h en ichmen , is ep esen ed in
Figu e 9.
Figu e 9 - G aphic ep esen a ion o ba s, co esponding o di e en concen a ions o bac e ia in ec ed wi h he epo e phage, wi h
en ichmen , o ela i e ligh uni s o e ime. E o ba s ep esen s anda d de ia ions om 3 independen expe imen s.
The de ec ion limi is de ined as he minimum numbe o bac e ia needed o p oduce a signal
ha is dis inguishable om he backg ound. The minimum CFU numbe de ec able by he PE3Δgp1–
gp12:Nluc phage was 540 pe mL o bo h expe imen s (wi h and wi hou en ichmen ). Al hough he
en ichmen s ep o 3 h led o a highe luminescence signal wi hou comp omising he o al ime o he
me hod, he limi o de ec ion was he same and hus, his s ep can be skipped as he p o ocol wi hou
en ichmen is simple and easie o pe o m. Based on his, all he subsequen expe imen s we e
pe o med wi hou he en ichmen s ep. De ec ion assays wi h he epo e phage we e op imized and
epea ed in iplica e o he hos s ain PAO1 and he esul s measu ed a e 7 h a e ep esen ed in
Figu e 10.
200
2000
20000
200000
2000000
20000000
200000000
0 4
Rela i e Ligh Uni s (RLUs)
Time (h)
5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
5.4x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
38
Figu e 10 - Bioluminescence ou pu (RLUs) o se ial dilu ions o hos s ain in ec ed wi h he epo e phage PE3gp1-gp12:Nluc wi h
105 PFU/mL and espec i e con ols. E o ba s ep esen s anda d de ia ions om 3 independen expe imen s.
Acco ding o Figu e 10, i is possible o obse e ha he PE3Δgp1–gp12:Nluc epo e phage
eliably de ec s 620 CFU/mL o he hos s ain. This was accomplished wi hin 7 hou s, which is 41 hou s
less ime han he con en ional selec i e pla ing echniques (T ampe -s ande s e al., 2005).
Cu en ly, epo e phages a e mos ly ocused on he ood indus y. To build a epo e phage o
he de ec ion and di e en ia ion o li e
Lis e ia
cells, which cause a se ious oodbo ne illness, Meile e
al., (2020) used CRISPR-Cas-assis ed phage edi ing. In less han 24 hou s, he NLuc-based phage,
A511::nlucCPS, can iden i y one CFU o
L. monocy ogenes
in 25 g o a i icially con amina ed milk, cold
cu s, and le uce. Mo e ecen ly, E ickson e al., (2021) used homologous ecombina ion o c ea e a
ecombinan o m o LPJP1 ha encodes he NanoLuc luci e ase. Wi hin ou hou s, his luci e ase
epo e phage de ec ed 100 s a iona y phase colony o ming uni s o bo h
L. g ayi
subspecies.
Hinkley e al., (2018) gene ically al e ed a T7 coliphage o exp ess NanoLuc using homologous
ecombina ion and he use o mic oc ys alline cellulose o concen a e he usion epo e was hen shown
o enable he de ec ion o a maximum o 10 CFU/mL
E. coli
wi hin h ee hou s. Also, he limi o de ec ion
o he epo e phages c ea ed by Nguyen e al., (2020) using homologous ecombina ion was 10-100
CFU pe mL in
Salmonella
cul u e wi hin wo hou s. In ood ma ix es s, a combina ion o enginee ed
phages success ully iden i ied 1 CFU in ei he 100 g o powde ed in an o mula wi h a 16 h en ichmen
o 25 g o g ound u key wi h a 7 h en ichmen .
100
1000
10000
100000
1000000
10000000
100000000
1000000000
0 7
Rela i e Ligh Uni s (RLUs)
Time (h)
Wi hou En ichmen
6,2x10^9 CFU/mL PAO1 (PAO1 only) PE3Δgp1–gp12:Nluc (phage only)
6,2x10^8 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^7 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
6,2x10^6 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^5 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
6,2x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
6,2x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
6,2x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
39
He e, as he phage is speci ic o
P. ae uginosa
species, clinical isola es known o be sensi i e o
phage PE3Δgp1–gp12:Nluc we e also es ed (s ains 5, 6, 16, 21, 23, 27 A65, 065 and 092) o assess
he de ec ion limi in o he bac e ial s ains a he han he hos . Beyond ha , he me hodology was also
epea ed o clinical s ains o
E. coli
(A51),
Klebsiella pneumoniae
(A36 and A57),
S aphylococcus au eus
(A1, A9 and A39),
En e ococcus aecalis
,
En e ococcus aecium
(A74 and A78 espec i ely) and
P.
ae uginosa
PA14.
The Figu e 11 shows he RLUs emi ed a e se en hou s o phage in ec ion o each bac e ial
s ain abo e men ioned.
Figu e 11 - Bioluminescence ou pu (RLUs) o di e en clinical s ains in ec ed wi h PE3Δgp1-gp12:Nluc phage (105 PFU/mL) o 7 h .
(A)
P. ae uginosa
s ains ha a e sensi i e o phage; (B) clinical s ains ha a e no in ec ed by he phage (chosen as nega i e con ols).
As obse ed in Figu e 11 (A), phage PE3Δgp1-gp12:Nluc was unable o de ec i e (16, 23, 27,
065 and 092) ou o he nine clinical s ains o
P. ae uginosa
. All hese 9 s ains a e sensi i e o he
phage, which was obse ed hough de e mina ion o he ly ic spec a and EOP (Table 17). This is
unexpec ed, acco ding o EOP esul s mos phage—bac e ium combina ion was classi ied as a medium
p oduc ion and he e o e, all s ains we e supposed o be de ec ed. Since his phage is speci ic o
P. ae uginosa
, as expec ed, all o he species es ed did no show any luminescence, and in his case
he e we e no alse posi i es, as can be seen in Figu e 11 (B). Among he 4 clinical s ains ha he
epo e phage was capable o de ec , he de ec ion limi is ep esen ed in Figu e 12.
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
40
Figu e 12 – Concen a ion (CFU/mL) o a i icially in ec ed samples. Samples we e incuba ed wi h 105 PFU/mL o PE3gp1-gp12:Nluc phage.
The minimum CFU numbe de ec able by he PE3Δgp1–gp12:Nluc phage o hose s ains is in
he ange o 103 CFU pe mL, which is app oxima ely en imes highe han he minimum concen a ion
ob ained o he hos s ain PAO1. I would be in e es ing o es he phage in mo e clinical s ains a he
han jus a ew, as his se e ely es ic s he abili y o make eliable conclusions abou his echnique. The
subsequen s age will also in ol e unning hese de ec ion assays in eal samples om pa ien s like blood,
u ine, o o he luids.
In conclusion, he
P. ae uginosa
epo e phage was capable o eliably de ec 620 CFU in 1 mL
o samples con amina ed wi h PAO1 in less han 8 h, hus o e coming he majo limi a ion o he cu en ly
used de ec ion me hods, which is ime-consuming. On he o he hand, his echnique was no capable o
de ec ing all he s ains known o be sensi i e o he phage, which is an issue. This implies, and hence
suppo s, he equi emen o phage-enginee ing wo k o expand he hos ange o he phage and a
possible app oach may be he cloning o addi ional TFPs om o he phages wi h complemen a y hos
anges.
3.2. De e mina ion o he hos ange and e iciency o pla ing
Se en phages (PE1, A2, DP1, PA14G, PA14-20, PE3 and PE3Δgp1–gp12:Nluc) we e es ed
agains a panel o 52
P. ae uginosa
clinical s ains by spo es in o de o e alua e he ly ic spec a o
each phage. Table 17 shows he hos ange o each phage, whe e LFW means lysis om wi hou . This is
1,00E+02
1,00E+03
1,00E+04
1,00E+05
1,00E+06
1,00E+07
1,00E+08
1,00E+09
Concen a ion o he in ec ed s ain
(CFU/mL)
Limi o phage de ec ion in clinical s ains o
P. ae uginosa, o an in ec ion pe iod o 7 h
S ain 5 S ain 6 S ain 21 S ain A65
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
47
The esul s ob ained om he SDS-PAGE gel a e shown in Figu e 17.
Figu e 17 - SDS-PAGE wi h esul s o he pu i ied p o eins, exp essed in AE cells. (1) pGFP_PE3gp39 1s elu ion, (2) pGFP_PE3gp39 pelle ,
(3) pGFP_PE3gp44 1s elu ion, (4) pGFP_PE3gp44 pelle , (5) pGFP_PE3gp45 1s elu ion, (6) pGFP_PE3gp45 pelle , (7) pGFP_PE3gp46 1s
elu ion, (8) pGFP_PE3gp46 pelle , (9) pGFP_PE3gp47 1s elu ion, (10) pGFP_PE3gp47 pelle , (11) pGFP_A2gp53 1s elu ion,
(12) pGFP_A2gp53 pelle , (L1) NZYColou P o ein Ma ke II (Nzy ech), (13) pGFP_A2gp55 1s elu ion and (L2) PageRule ™ B oad Range
Uns ained P o ein Ladde The molecula weigh is exp essed in KDa.
In addi ion o TFP exp ession by SDS-PAGE, he exp ession was also de ec able by he colou o
he cul u es a e exp ession, which showed s ong g een s aining due o he p esence o he aceGFP
usion p o ein.
All he p o eins ans o med in AE (DE3) cells we e shown o ha e he expec ed size bu he
pGFP_PE3gp46 p o ein showed a la ge band close o 27 KDa, co esponding o aceGFP exp ession.
This may indica e ha some p ocessing o he ecombinan p o ein may ha e occu ed, wi h clea age o
he used p o ein. In cases whe e a s onge band appea s in he pelle o he pu i ied p o ein, a
solubiliza ion o he pelle was pe o med o u he analysis. The p esence o insoluble p o ein is ypically
caused by imp ope p o ein olding, which causes he p o ein o become inac i e and exp essed in
inclusion bodies (Agilen Technologies, 2015). The pelle ed p o ein was washed using a bu e con aining
he su ac an T i on X-100 and hen p o ein was solubilized using u ea. Al hough i was possible o
solubilize he p o eins, on he day a e , he p o ein los s abili y and p ecipi a ed again.
Then, a unc ional analysis o he TFPs was pe o med by epi luo escence. The amoun o p o ein
elu ion o be used in each eac ion was es ima ed h ough he in ensi y o he colou (g een) o he elu ion
and he esul s o SDS-PAGE analysis o he exp ession. A e obse a ion unde he mic oscope, p o ein
pGFP_A2gp55 was he only one ha demons a ed binding abili y o
P. ae uginosa
PAO1 cells (Figu e
18).
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
48
pGFP_PE3gp45
pGFP_PE3gp55
Figu e 18 - Fluo escence mic oscopy assays o p o ein unc ion analysis. On he i s ow, i is possible o obse e he images wi hou a
il e and in he second, wi h he FITC il e , sensi i e o g een luo escence. A nega i e example is shown in he i s column, such as he
pGFP_PE3gp45 p o ein and in he second column he only exp essed p o ein ha was able o bind
P. ae uginosa
PAO1, pGFP_PE3gp55.
E en hough he emaining p o eins we e well exp essed and showed a g een, luo escen colou ,
hey we e no able o bind o bac e ial cells. A e ha , he exp ession o he p o eins was epea ed in
di e en cells.
E. coli
C43 (DE3) con ains gene ic mu a ions ha educes he ac i i y o T7 RNA
Polyme ase, hus p e en ing cell dea h by o e exp ession o ecombinan oxic p o ein (Lucigen
Co po a ion, 2018) and he
E. coli
BL21 (DE3) con ains se e al gene ic mu a ions and is widely used in
o de o ob ain high yields o p o ein p oduc ion. Howe e , despi e being well exp essed, none o hem
showed binding capaci y o
P. ae uginosa
PAO1, besides pGFP_A2gp55 p o ein.
The e a e di e en easons o explain ha . An inco ec olding o he p o ein may esul in an
inadequa e exposu e o he p o ein domain esponsible o hos ecogni ion o e en in a non- unc ional
ecep o binding p o ein. Mo eo e , i is possible ha hese p o eins equi e he p esence o o he phage
p o eins o acqui e he unc ional s uc u e (usually ime iza ion) (No h e al., 2019). Ano he hypo hesis
is ha he p o eins unde s udy a e no uly hos ecogni ion o binding p o eins, e en knowing ha hey
a e homolog o o he iden i ied ecep o binding p o eins in he NCBI da abase. The ac is ha he
majo i y o anno a ed phage ecep o binding p o eins deposi ed in he NCBI da abase we e no alida ed
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
49
h ough unc ional assays and hus, hey migh no be able o ecognize and bind o he phage bac e ial
hos s, leading o an e oneous selec ion o ecep o binding p o eins.
Conside ing he expe imen ally alida ed abili y o pGFP_A2gp55 o bind PAO1 cells, homologous
p o eins we e sea ched o cloning wi h he in en ion o pe o ming a gene exchange be ween phages A2
and PE3, bu none i was ound. This impai ed swapping homologous genes, bu s ill enabled he addi ion
o his p o ein o phage PE3 in o de o exp ess an addi ional ecep o binding p o ein ha could expand
i s hos ange.
3.4. Expanding he hos ange o
P. ae uginosa
phages by genome enginee ing
Acco ding o he luo escence mic oscopy assays, only pGFP_A2gp55 p o ein was binding o he
hos cells, which co esponds o
gp
55 om A2 phage. The e o e, his gene was selec ed o be cloned
be ween
gp
46 and
gp
47 genes om PE3 phage ha also encode TFPs. Since he addi ion o new genes
may equi e ex a space in phage genomes, he phage PE3Δgp1–gp12 was used he e as empla e o
he in oduc ion o he new gene as his phage is a a ian o phage PE3 wi h a educed genome and
was p e iously shown o be unc ional and o ha e simila e icacy agains he hos cells (Pi es e al.,
2021).
The assembly o he new chime ic phage was accomplished using he yeas -based phage-
enginee ing pla o m, which has been al eady used o e icien ly manipula e he genomes o
E. coli
,
Klebsiella and
P. ae uginosa
phages (Ando e al., 2015; Pi es e al., 2021). In
S. ce e isiae
, homologous
ecombina ion is pa icula ly e ec i e due o he na i e gap epai sys em ha acili a es he assembly o
DNA agmen s ha sha e sho homology egions, and phage genomes may be kep s able and a e no
haza dous o yeas . Since his me hod in ol es emo ing he phage genome om yeas and in oducing
i in o he bac e ial hos o gene a e unc ional phage pa icles, i s e icacy is cons ained by he a e a
which bac e ia may unde go ans o ma ion (Pi es e al., 2016).
In his wo k, 2 di e en cons uc s we e ied: i) cloning o TFP in phage PE3Δgp1–gp12 wi hou
Nluc gene ( ans o ma ion 1 - T1); and ii) cloning o TFP in phage PE3Δgp1–gp12:Nluc ( ans o ma ion
2 - T2).
To assemble he chime ic phages, he en i e phage genome o PE3Δgp1–gp12 phage was
ampli ied by PCR in o e lapping agmen s using speci ic se s o p ime s (Table 10). Fo each
ans o ma ion, se en PCR p oduc s spanning he phage genome, he gene gp55 om phage A2 o be
cloned and he linea ized YAC ca ying homologous “a ms” wi h he ex emi ies o phage genome we e
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
50
ans o med in o yeas cells whe e he ecombina ion occu s because o he gap epai sys em ha
connec s each agmen o he subsequen , esul ing in a ull phage genome cap u ed in he YAC.The
PCR ampli ica ion o all he DNA agmen s was con i med on a 1 % (w/ ) aga ose gel and he esul s a e
shown in Figu e 19.
Figu e 19 - Gel elec opho esis wi h esul s o he PCR ampli ica ion o each agmen . (YAC) annealing empe a u e: 65 °C; (F1) annealing
empe a u e: 60 °C; (F2) annealing empe a u e: 60 °C; (F3) annealing empe a u e: 60 °C; (F4) annealing empe a u e: 60 °C;
(F5) annealing empe a u e: 60 °C; (F6) annealing empe a u e: 65 °C; (F7) annealing empe a u e: 65 °C and (L) 1 Kb GRS Ladde DNA
(G isp). The sequence leng h is exp essed in bp.
As obse ed in Figu e 19, all he PCR p oduc s ha e he expec ed sizes o be used in he yeas
ans o ma ion. A e ans o ma ion, i was possible o eco e se e al ans o man s o each
ans o ma ion (T1 and T2) a e pla ing on selec i e media, while no colonies we e obse ed o he
nega i e con ol ( ans o ma ion only wi h he linea ized YAC).
To assess i he phage genomes we e co ec ly assembled in he YAC, he yeas ans o man s
we e sc eened by yeas colony PCR using a se o p ime s placed ups eam and downs eam o he gene
inse ion si es (Table 15). The p oduc s o each yeas colony PCR we e isualized on a 1 % (w/ )
elec opho esis aga ose gel, as shown in Figu e 20.
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
51
Figu e 20 - Gel elec opho esis showing he ampli ica ion o one co ec ans o man o each yeas ans o ma ion.
(C) con ol – o iginal sequence, and (L) 1 Kb GRS Ladde DNA (G isp). The DNA sizes p esen ed include he size o he o iginal sequence
plus an addi ional 648 bp co esponden o he ampli ica ion o he
gp
55 om A2 phage.
Figu e 20 shows bands wi h he expec ed sizes o ampli ica ion o each ans o ma ion
(T1: 1108 bp; T2 1108 bp; Con ol: 460 bp), which con i ms ha gp55 om phage A2 was success ully
cloned in o PE3Δgp1–gp12 phage o T1 and PE3Δgp1–gp12:Nluc phage o T2. These posi i e yeas
clones we e hen used o yeas DNA ex ac ion in o de o eco e he YAC-phage DNA. A e DNA
ex ac ion om yeas cells, 500 ng o he cons uc s (YAC-phage DNA) we e ans o med in o he
P. ae uginosa
PAO1 hos , which allows phage genes o be ansc ibed and p oduce unc ional phages in
case he gene inse ion does no al e he iabili y o he phage. In his s ep, he ans o ma ion was ia
elec opo a ion due o he supe io e icacy compa ed o he hea -shock app oach (Yoshida & Sa o, 2009).
In ac , phage plaques we e obse ed a e pla ing, bu only o T2 e en a e h ee a emp s. In
o de o eco e plaques om T1, i would p obably be essen ial o do some op imiza ions o he DNA
concen a ion o be elec opo a ed o incuba ion ime a e elec opo a ion. Since phage plaques we e
ob ained o T2, he wo k p oceeded wi h his newly enginee ed phage as his was he phage al eady
ca ying he Nluc gene ha can be used o de ec ion. The esul ing phage plaques ob ained om
elec opo a ion we e picked and he ecombinan phage was p oduced and checked by PCR using he
se o p ime s desc ibed abo e. The elec opho esis gel and he Sange sequencing e ealed ha he
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
52
inse ion o he TFP om phage A2 in o he genome o phage PE3Δgp1–gp12 was success ully done
(Figu e 21).
Figu e 21 – Wild- ype phage e sus chime ic phage. (1) PE3 phage; (2) PCR-based con i ma ion o he inse ion o A2
gp
55 in he genome
o phage PE3Δgp1–gp12:Nluc and (L) 1 Kb GRS Ladde DNA (G isp). The sequence leng h is exp essed in bp.
A e p opaga ion o ecombinan phage and con i ma ion o he co ec assembly, a new analysis
o he hos ange was pe o med o unde s and i he addi ion o a new TFP did ac ually esul in he
abili y o he enginee ed phage o a ge a wide ange o s ains compa ed o wild- ype phage. This would
be a g ea ad an age as cu en ly, he mos popula me hod o achie ing a wide hos ange is he
combina ion o mul iple phages wi h a ious hos anges in o a single cock ail, which is always a ime-
consuming p ocess. The hos ange o he ou phages A2, PE3 WT, PE3Δgp1–gp12:Nluc and T2 we e
es ed agains a panel o 52
P. ae uginosa
clinical s ains by spo es . Table 18 shows he esul s o he
ly ic spec a.
Table 18 - EOP o he A2, PE3 WT, PE3Δgp1–gp12:Nluc and ecombinan T2 phages agains di e en s ains o
P. ae uginosa
Phage
S ain
A2
PE3
PE3Δgp1
–
gp12:Nluc
T2
1
0.5
-
-
LFW
2
-
-
-
-
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
53
3
<0.001
-
-
-
4
LFW
-
-
LFW
5
0.4
0.3
0.4
0.1
6
0.4
0.6
0.4
0.004
7
<0.001
-
-
-
8
LFW
LFW
LFW
LFW
9
LFW
-
-
LFW
10
-
-
-
-
11
-
0.3
LFW
LFW
12
LFW
0.3
LFW
LFW
14
-
-
-
-
15
LFW
-
-
-
16
0.1
0.3
0.4
LFW
17
-
0.1
LFW
LFW
18
0.005
-
-
LFW
19
-
-
-
-
20
0.006
LFW
-
LFW
21
0.4
0.3
0.004
0.005
22
0.1
-
-
LFW
23
LFW
0.3
0.8
<0.001
24
-
-
-
-
25
0.5
-
-
LFW
26
-
LFW
LFW
LFW
27
0.1
0.4
LFW
LFW
28
0.2
<0.001
LFW
LFW
29
0.1
LFW
LFW
LFW
A22
0.2
LFW
LFW
LFW
A63
-
-
-
-
A64
LFW
LFW
LFW
LFW
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
54
A65
LFW
0.2
0.4
LFW
A66
LFW
LFW
LFW
LFW
A67
LFW
LFW
LFW
LFW
A69
LFW
0.3
LFW
LFW
A70
0.8
-
-
LFW
A71
LFW
-
-
-
052EX
-
LFW
LFW
LFW
O64
LFW
-
-
LFW
O65
-
0.004
0.4
<0.001
O77
LFW
-
-
LFW
O78
0.2
0.2
LFW
LFW
O79
0.2
LFW
LFW
LFW
O92
-
0.1
0.020
<0.001
144
0.5
0.5
LFW
LFW
149
-
-
-
-
wzy
LFW
0.4
0.1
0.006
wbpL
-
0.1
0.007
LFW
mlC
-
-
-
-
md
0.1
0.5
0.6
0.1
PAO1
1.0
1.0
1.0
1.0
PA14
-
-
-
LFW
% in ec ion
54
51
31
23
% high
p oduc i e
in ec ion
13
10
8
2
Con a y o wha was expec ed, he ecombinan phage, named T2, did no e eal a b oade hos
ange. Al hough i was expec ed ha his phage would also be able o in ec he
P. ae uginosa
s ains ha
a e in ec ed by phage A2 leading o a 58 % in ec ion a e, his was no obse ed and he enginee ed phage
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 3 – Resul s and Discussion
55
e ealed a na owe hos ange. In ac , T2 was only able o in ec 12 s ains, which is e en less han he
numbe in ec ed by he PE3gp1-gp12:Nluc phage ha was used as a sca old.
So a , some s udies ha e aken ad an age o he ac ha hos ange is connec ed o ail ibe
composi ion o speci ic phages o show ha he hos anges o phages can be changed o expanded. Fo
ins ance, in o de o pa icula ly a ge
E. coli
O157:H7, Yoichi e al., (2005) gene ically al e ed a T2
phage by eplacing he long ail ibe genes wi h hose om phage PP01. The exchange was ca ied ou
h ough homologous ecombina ion. Al hough i had he same hos ange as phage PP01 and had he
PP01 genes gp37 and gp38, he ecombinan phage T2ppD1 was unable o in ec i s o iginal hos ,
E. coli
K-12 (Yoichi e al., 2005). Lin e al., (2012) de eloped a hyb id T3 and T7 phage (T3/7) by
eplacing a po ion o he T3 ail ibe gene (gp17) wi h ha o he T7 phage. Compa ed o ei he o he
T3 o T7 wild- ype phages, he T3/7 ecombinan phage had a wide hos ange and g ea e adso p ion
e iciency (Lin e al., 2012).
By modula ly eplacing he componen s o he phage ail and using he yeas -based pla o m,
Ando e al., (2015) we e able o edi ec
E. coli
phage sca olds o a ge pa hogenic
Ye sinia
and
Klebsiella
bac e ia, and
Klebsiella
phage sca olds o a ge
E. coli
.
Al hough he p omising esul s epo ed in he li e a u e, he e i was no possible o inc ease he
phage hos ange h ough he inse ion o he TFP om A2 phage in he PE3Δgp1–gp12:Nluc phage
genome. A possible explana ion is ha he phage may need he o he TFPs o acqui e he same spec um
as A2 phage. Addi ionally, Pi es e al., (2021) disco e ed ha he dele ion o genes gp1 o gp12 om
PE3 phage esul ed in a sligh educ ion o he hos ange o he phage; hence, some o hese genes may
be in ol ed in hos ecogni ion, akeo e o beginning o eplica ion, which may explain he inc ease o
LFW. In his ega d, i would be in e es ing o clone new TFPs wi hou dele ing genes om he phage
genome as a u u e s ep. Howe e , as his leads o an inc ease in he size o he phage genome, i can
be a challenge due o he phage's capaci y o encapsula e DNA. Al hough he phage genomic modi ica ion
did no esul in he expec ed ou come, i was possible o demons a e ha he yeas -based phage-
enginee ing s a egy is an e icien and obus me hod o enginee he genomes o
P. ae uginosa
phages
and can be easily applied in he u u e o pe o m o he modi ica ions as men ioned abo e ha may esul
in hos ange inc ease (Pi es e al., 2021).
Chap e 4
CONCLUSIONS AND FUTURE PERSPECTIVES
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 5 – Re e ences
63
An al e na i e o an ibio ics in he age o mul i-d ug esis ance.
Wo ld Jou nal o Gas oin es inal
Pha macology and The apeu ics
,
8
(3), 162–173. h ps://doi.o g/10.4292/wjgp . 8.i3.162
Lin, T. Y., Lo, Y. H., Tseng, P. W., Chang, S. F., Lin, Y. T., & Chen, T. S. (2012). A T3 and T7 ecombinan
phage acqui es e icien adso p ion and a b oade hos ange.
PLoS ONE
,
7
(2), 1–10.
h ps://doi.o g/10.1371/jou nal.pone.0030954
Loc-ca illo, C., & Abedon, S. T. (2011). P os and cons o phage he apy.
Bac e iophage
,
1
(2), 111–114.
h ps://doi.o g/10.4161/bac .1.2.14590
Lu, T. K., & Collins, J. J. (2007). Dispe sing bio ilms wi h enginee ed enzyma ic bac e iophage.
PNAS
,
104
(27), 11197–11202. h ps://doi.o g/10.1073/pnas.0704624104
Lu, T. K., & Collins, J. J. (2009). Enginee ed bac e iophage a ge ing gene ne wo ks as adju an s o
an ibio ic he apy.
PNAS
,
106
(12), 4629–4634. h ps://doi.o g/10.1073/pnas.0800442106
Lucigen Co po a ion. (2018).
O e Exp ess TM Chemically Compe en cells
.
Ma suda, T., F eeman, T. A., Hilbe , D. W., Du , M., Fuo es, M., S aple on, P. P., & Daly, J. M. (2005).
Lysis-de icien bac e iophage he apy dec eases endo oxin and in lamma o y media o elease and
imp o es su i al in a mu ine pe i oni is model.
Su ge y
,
137
(6), 639–646.
h ps://doi.o g/10.1016/j.su g.2005.02.012
Meile, S., Kilche , S., Loessne , M. J., & Dunne, M. (2020). Repo e Phage-Based De ec ion o Bac e ial
Pa hogens : Design Guidelines and Recen De elopmen s.
Vi uses
,
12
(944), 25.
h ps://doi.o g/doi:10.3390/ 12090944
Meile, S., Sa bach, A., Du, J., Schupple , M., Saez, C., Loessne , M. J., & Kilche , S. (2020). Enginee ed
epo e phages o apid bioluminescence-based de ec ion and di e en ia ion o iable Lis e ia cells.
Applied and En i onmen al Mic obiology
,
86
(11), 1–14. h ps://doi.o g/10.1128/AEM.00442-20
Mi zaei, M. K., & Nilsson, A. S. (2015). Isola ion o phages o phage he apy: A compa ison o spo es s
and e iciency o pla ing analyses o de e mina ion o hos ange and e icacy.
PLoS ONE
,
10
(3),
1–13. h ps://doi.o g/10.1371/jou nal.pone.0118557
Mon ei o, R., Pi es, D. P., Cos a, A. R., & Aze edo, J. (2019). Phage The apy : Going Tempe a e ?
T ends
in Mic obiology
,
27
(4), 368–378. h ps://doi.o g/10.1016/j. im.2018.10.008
Mo adali, M. F., Ghods, S., & Rehm, B. H. A. (2017). Pseudomonas ae uginosa Li es yle : A Pa adigm o
Adap a ion , Su i al , and Pe sis ence.
F on ie s in Cellula and In ec ion Mic obiology
,
7
(39), 29.
h ps://doi.o g/10.3389/ cimb.2017.00039
Mo lagh, A. M., Bha acha jee, A. S., & Goel, R. (2016). Bio ilm con ol wi h na u al and gene ically-
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 5 – Re e ences
64
modi ied phages.
Wo ld Jou nal o Mic obiology and Bio echnology
,
32
(67), 10.
h ps://doi.o g/10.1007/s11274-016-2009-4
Nai , A., & Khai na , K. (2019). Gene ically enginee ed phages o he apeu ics : p oceed wi h cau ion.
Na u e Medicine
,
25
(1028), 1. h ps://doi.o g/10.1038/s41591-019-0506-3
Nguyen, L., Ga cia, J., G uenbe g, K., & MacDougall, C. (2018). Mul id ug-Resis an Pseudomonas
In ec ions: Ha d o T ea , Bu Hope on he Ho izon?
Cu en In ec ious Disease Repo s
,
20
(8), 10.
h ps://doi.o g/10.1007/s11908-018-0629-6
Nguyen, M. M., Gil, J., B own, M., Cesa Tondo, E., So aya Ma ins de Aquino, N., Eisenbe g, M., &
E ickson, S. (2020). Accu a e and sensi i e de ec ion o Salmonella in oods by enginee ed
bac e iophages.
Scien i ic Repo s
,
10
(1), 1–13. h ps://doi.o g/10.1038/s41598-020-74587-8
No h, O. I., Sakai, K., Yamashi a, E., Nakagawa, A., Iwazaki, T., Bü ne , C. R., Takeda, S., & Da idson,
A. R. (2019). Phage ail ib e assembly p o eins employ a modula s uc u e o d i e he co ec
olding o di e se ib es.
Na u e Mic obiology
,
4
(10), 1645–1653.
h ps://doi.o g/10.1038/s41564-019-0477-7
Pacho i, P., Go halwal, R., & Gandhi, P. (2019). Eme gence o an ibio ic esis ance Pseudomonas
ae uginosa in in ensi e ca e uni ; a c i ical e iew.
Genes & Diseases
,
6
(2), 109–119.
h ps://doi.o g/10.1016/j.gendis.2019.04.001
Pang, Z., Raudonis, R., Glick, B. R., Lin, T. J., & Cheng, Z. (2019). An ibio ic esis ance in Pseudomonas
ae uginosa: mechanisms and al e na i e he apeu ic s a egies.
Bio echnology Ad ances
,
37
(1),
177–192. h ps://doi.o g/10.1016/j.bio echad .2018.11.013
Passado , L., Cook, J. M., Gambello, M. J., Rus , L., & Iglewski, B. H. (1993). Exp ession o Pseudomonas
ae uginosa i ulence genes equi es cell- o-cell communica ion.
Science
,
260
(5111), 1127–1130.
h ps://doi.o g/10.1126/science.8493556
Pe ei a, S. G., Rosa, A. C., Fe ei a, A. S., Mo ei a, L. M., P oença, D. N., Mo ais, P. V., & Ca doso, O.
(2014). Vi ulence ac o s and in ec ion abili y o Pseudomonas ae uginosa isola es om a
hyd opa hic acili y and espi a o y in ec ions.
Jou nal o Applied Mic obiology
,
116
(5), 1359–1368.
h ps://doi.o g/10.1111/jam.12463
Pi es, D., Melo, L., Vilas Boas, D., Sillanko a, S., & Aze edo, J. (2017). Phage he apy as an al e na i e
o complemen a y s a egy o p e en and con ol bio ilm- ela ed in ec ions.
Cu en Opinion in
Mic obiology
,
39
, 48–56. h ps://doi.o g/10.1016/j.mib.2017.09.004
Pi es, D. P., Cle o, S., Sillanko a, S., Aze edo, J., & Lu, T. K. (2016). Gene ically Enginee ed Phages: a
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 5 – Re e ences
65
Re iew o Ad ances o e he Las Decade.
Mic obiology and Molecula Biology Re iews
,
80
(3), 523–
543. h ps://doi.o g/10.1128/mmb .00069-15
Pi es, D. P., Cos a, A. R., Meneses, L., & Aze edo, J. (2020). Cu en challenges and u u e oppo uni ies
o phage he apy.
FEMS Mic obiology Le e s
,
44
(6), 684–700.
h ps://doi.o g/10.1093/ ems e/ uaa017
Pi es, D. P., Dö sch, A., Ande son, E. M., Hao, Y., Khu siga a, C. M., Lam, J. S., Sillanko a, S., & Aze edo,
J. (2017). A geno ypic analysis o i e P. ae uginosa s ains a e bio ilm in ec ion by phages a ge ing
di e en cell su ace ecep o s.
F on ie s in Mic obiology
,
8
(1229), 1–14.
h ps://doi.o g/10.3389/ micb.2017.01229
Pi es, D. P., K opinski, A. M., Aze edo, J., & Sillanko a, S. (2014). Comple e genome sequence o he
Pseudomonas ae uginosa bac e iophage phiIBB-PAA2.
Genome Announcemen s
,
2
(1), 7–8.
h ps://doi.o g/10.1128/genomeA.e01102-13
Pi es, D. P., Mon ei o, R., Mil-Homens, D., Fialho, A., Lu, T. K., & Aze edo, J. (2021). Designing P.
ae uginosa syn he ic phages wi h educed genomes.
Scien i ic Repo s
,
11
(1), 1–10.
h ps://doi.o g/10.1038/s41598-021-81580-2
Pi nay, J.-P., Vos, D. De, Ve beken, G., Me abish ili, M., Chanish ili, N., Vaneechou e, M., Zizi, M., Lai e,
G., La igne, R., Huys, I., Moo e , G. Van den, Buckling, A., Deba bieux, L., Pouillo , F., Aze edo, J.,
Ku e , E., Dublanche , A., Gó ski, A., & Adamia, R. (2011). The Phage The apy Pa adigm: P ê -à-
Po e o Su -mesu e ?
Pha m Res
,
28
, 934–937. h ps://doi.o g/10.1007/s11095-010-0313-5
Pi nay, J., Ve beken, G., Ceyssens, P., Huys, I., Vos, D. De, Ameloo , C., & Fauconnie , A. (2018). The
Magis al Phage.
Vi uses
,
10
(2), 1–7. h ps://doi.o g/10.3390/ 10020064
P incipi, N., Sil es i, E., & Esposi o, S. (2019). Ad an ages and Limi a ions o Bac e iophages o he
T ea men o Bac e ial In ec ions.
F on ie s in Pha macology
,
10
(513), 1–9.
h ps://doi.o g/10.3389/ pha .2019.00513
Rahim, R., Bu ows, L. L., Mon ei o, M. A., Pe y, M. B., & Lam, J. S. (2000). In ol emen o he ml
locus in co e oligosaccha ide and O polysaccha ide assembly in Pseudomonas ae uginosa.
Mic obiology
,
146
(11), 2803–2814. h ps://doi.o g/10.1099/00221287-146-11-2803
Reu e , K., S einbach, A., & Helms, V. (2016). In e e ing wi h Bac e ial Quo um Sensing.
Pe spec i es
in Medical Chemis y
,
8
, 1–15. h ps://doi.o g/10.4137/PMC.S13209
Ribei o, H. G., Melo, L. D. R., Oli ei a, H., Boon, M., La igne, R., Noben, J.-P., Aze edo, J., & Oli ei a, A.
(2019). Cha ac e iza ion o a new podo i us in ec ing Paenibacillus la ae.
Scien i ic Repo s
,
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 5 – Re e ences
66
9
(20355), 1–12. h ps://doi.o g/10.1038/s41598-019-56699-y
Rocche a, H. L., Bu ows, L. L., Pacan, J. C., & Lam, J. S. (1998). Th ee hamnosyl ans e ases
esponsible o assembly o he A-band D- hamnan polysaccha ide in Pseudomonas ae uginosa: A
ou h ans e ase, WbpL, is equi ed o he ini ia ion o bo h A-band and B-band lipopolysaccha ide
syn hesis (Molecula Mi.
Molecula Mic obiology
,
28
(6), 1103–1119.
h ps://doi.o g/10.1046/j.1365-2958.1998.01109.x
Rocche a, H. L., Pacan, J. C., & Lam, J. S. (1998). Syn hesis o he A-band polysaccha ide suga D-
hamnose equi es Rmd and WbpW: Iden i ica ion o mul iple AlgA homologues, WbpW and
ORF488, in Pseudomonas ae uginosa.
Molecula Mic obiology
,
29
(6), 1419–1434.
h ps://doi.o g/10.1046/j.1365-2958.1999.0e a .x
Rohde, C., Wi mann, J., & Ku e , E. (2018). Bac e iophages: A he apy concep agains mul i-d ug-
esis an bac e ia.
Su gical In ec ions
,
19
(8), 737–744. h ps://doi.o g/10.1089/su .2018.184
San os, S. B., Cunha, A. P., Macedo, M., Noguei a, C. L., B andão, A., Cos a, S. P., Melo, L. D. R.,
Aze edo, J., & Ca alho, C. M. (2020). Bac e iophage ‐ ecep o binding p o eins o mul iplex
de ec ion o S aphylococcus and En e ococcus in blood.
Bio echnology Ad ances
,
117
, 3286–3298.
h ps://doi.o g/10.1002/bi .27489
Schmelche , M., & Loessne , M. J. (2008).
P inciples o Bac e ial De ec ion
: Biosenso s, Recogni ion
Recep o es and Mic osys ems
.
Schmelche , M., & Loessne , M. J. (2014). Applica ion o bac e iophages o de ec ion o oodbo ne
pa hogens.
Bac e iophage
,
4
(e28137), 1–14. h ps://doi.o g/10.4161/bac .28137
Silby, M. W., Wins anley, C., God ey, S. A. C., Le y, S. B., & Jackson, R. W. (2011). Pseudomonas
genomes: Di e se and adap able.
FEMS Mic obiology Re iews
,
35
(4), 652–680.
h ps://doi.o g/10.1111/j.1574-6976.2011.00269.x
S a e a, T., & Mi o , I. (2011). Con ibu ion o an a senal o i ulence ac o s o pa hogenesis o
Pseudomonas ae uginosa in ec ions.
Annals o Mic obiology
,
61
(4), 717–732.
h ps://doi.o g/10.1007/s13213-011-0273-y
Taglia e i, T. L., Jansen, M., & Ho z, H.-P. (2019). Figh ing Pa hogenic Bac e ia on Two F on s: Phages
and An ibio ics as Combined S a egy.
F on ie s in Cellula and In ec ion Mic obiology
,
9
(22), 13.
h ps://doi.o g/10.3389/ cimb.2019.00022
Takahashi, Y., & Ta suma, T. (2014). Me al oxides and hyd oxides as echa geable ma e ials o
pho oca alys s wi h oxida i e ene gy s o age abili ies.
Elec ochemis y
,
82
(9), 749–751.
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Chap e 5 – Re e ences
67
h ps://doi.o g/10.5796/elec ochemis y.82.749
Tang, Y., Ali, Z., Zou, J., Jin, G., Zhu, J., Yang, J., & Dai, J. (2017). De ec ion me hods o : Pseudomonas
ae uginosa: His o y and u u e pe spec i e.
RSC Ad ances
,
7
(82), 51789–51800.
h ps://doi.o g/10.1039/c7 a09064a
To es-Ba celó, C. (2018). Phage The apy Faces E olu iona y Challenges.
Vi uses
,
10
(323), 8.
h ps://doi.o g/10.3390/ 10060323
T ampe -s ande s, G. A., En , C. K. Van De , & Wol s, T. F. W. (2005). De ec ion o Pseudomonas
ae uginosa in pa ien s wi h cys ic ib osis.
Jou nal o Cys ic Fib osis
,
4
(2), 37–43.
h ps://doi.o g/10.1016/j.jc .2005.05.009
Viazis, S., Akh a , M., Fei ag, J., B abban, A. D., & Diez-Gonzalez, F. (2011). Isola ion and
cha ac e iza ion o ly ic bac e iophages agains en e ohaemo hagic Esche ichia coli.
Jou nal o
Applied Mic obiology
,
110
(5), 1323–1331. h ps://doi.o g/10.1111/j.1365-2672.2011.04989.x
Wa e s, E. M., Neill, D. R., Kaman, B., Saho a, J. S., Clokie, M. R. J., Wins anley, C., & Kadioglu, A.
(2017). Phage he apy is highly e ec i e agains ch onic lung in ec ions wi h Pseudomonas
ae uginosa.
Tho ax
,
0
(0), 2. h ps://doi.o g/10.1136/ ho axjnl-2016-209265
Wo ld Heal h O ganiza ion. (2017).
WHO publishes lis o bac e ia o which new an ibio ics a e u gen ly
needed
. h ps://www.who.in /news/i em/27-02-2017-who-publishes-lis -o -bac e ia- o -which-new-
an ibio ics-a e-u gen ly-needed
Xu, J., Moo e, J. E., Mu phy, P. G., Milla , B. C., & Elbo n, S. (2004). Ea ly de ec ion o Pseudomonas
ae uginosa – compa ison o con en ional e sus molecula ( PCR ) de ec ion di ec ly om adul
pa ien s wi h cys ic ib osis ( CF ).
Annals o Clinical Mic obiology and An imic obials
,
3
(21), 1–5.
h ps://doi.o g/10.1186/1476-0711-3-21
Yoichi, M., Abe, M., Miyanaga, K., Unno, H., & Tanji, Y. (2005). Al e a ion o ail ibe p o ein gp38 enables
T2 phage o in ec Esche ichia coli O157:H7.
Jou nal o Bio echnology
,
115
(1), 101–107.
h ps://doi.o g/10.1016/j.jbio ec.2004.08.003
Yoshida, N., & Sa o, M. (2009). Plasmid up ake by bac e ia : a compa ison o me hods and e iciencies.
Applied Mic obiology and Bio echnology
,
83
(5), 791–798. h ps://doi.o g/10.1007/s00253-009-
2042-4
Young, J. S., Go mley, E., & Welling on, E. M. H. (2005). Molecula de ec ion o Mycobac e ium bo is
and Mycobac e ium bo is BCG (Pas eu ) in soil.
Applied and En i onmen al Mic obiology
,
71
(4),
1946–1952. h ps://doi.o g/10.1128/AEM.71.4.1946-1952.2005
Supplemen a y ma e ial
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Supplemen a y ma e ial
69
S ains, bac e iophages and plasmids used in his wo k can be seen in he Table S1.
Table S1 - Bac e ial s ains, bac e iophages and plasmids used in his s udy
S ain, bac e iophage, o plasmid
Re e ence o sou ce
P. ae uginosa
s ains
PAO1
Ge man Collec ion o Mic oo ganisms
and Cell Cul u es (DSM22644)
PA14
Labo a o y s ock
1
U ine
2
Skin
3
Ea
4
B onchial
5
Hemocul u e
6
U ine
7
Ea
8
U ine
9
U ine
10
U ine
11
Skin ulce
12
Expec o a ion
14
U ine
15
Skin ulce
16
Skin ulce
17
Ca he e
18
Ea
19
Skin ulce
20
U ine
21
U ine
22
Hemocul u e
23
U ine
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Supplemen a y ma e ial
70
24
Expec o a ion
25
Expec o a ion
26
Ea
27
Unknown
28
Unknown
29
Unknown
A22
Unknown
A63
Expec o a ion
A64
B onchial
A65
B onchial
A66
B onchial
A67
B onchial
A69
B onchial
A70
B onchial
A71
Expec o a ion
052EX
Expec o a ion
O64
Hemocul u e
O65
B onchial
O77
Unknown
O78
Unknown
O79
Unknown
O92
Unknown
144
Unknown
149
Unknown
wzy
(A+B−), de icien in O-an igen
polyme ase o B-band biosyn hesis,
p oduces co e-plus-one O- epea uni (de
Kie i e al., 1995)
wbpL
(A−B−), de icien in he ini ial
glycosyl ans e ase a ec ing bo h B-band
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Supplemen a y ma e ial
71
and A-band (Rocche a, Bu ows, e al.,
1998)
mlC
(A−B−), de ec i e in TDP-L- hamnose
biosyn hesis, wi h unca ed ou e co e
(Rahim e al., 2000)
md
(A−B+), de icien in GDP-D- hamnose
biosyn hesis becomes A-band minus, no
a ec ing B-band (Rocche a, Pacan, e
al., 1998)
E. coli
s ains
A c ic exp ess
Labo a o y s ock
C43
Labo a o y s ock
BL21
Labo a o y s ock
A51
B onchial
Saccha omyces ce e isiae
s ains
BY4741
Labo a o y s ock
Klebsiella pneumoniae
s ains
A36
B onchial
A57
B onchial
S aphylococcus au eus
s ains
A1
B onchial - MRSA (Mul i-Resis en
S.
au eus
)
A9
Hemocul u e - MRSA (Mul i-Resis en
S.
au eus
)
A39
B onchial - MSSA (Mul i-Sensi i e
S.
au eus
)
En e ococcus aecalis s ains
A74
U ine
En e ococcus aecium
s ains
A78
Skin ulce
Bac e iophages
PE1
-
Enginee ing phages owa ds
Pseudomonas ae uginosa
de ec ion and con ol
Supplemen a y ma e ial
72
phiIBB-PAA2
Accession numbe : NC_022971.1
B_PaeM_CEB_DP1
Accession numbe : KR869157
PA14G
-
PA14-20
-
B_PaeP_PE3
Accession numbe : MN901924.1
PE3Δgp1–gp12
D. P. Pi es e al., (2021)
PE3Δgp1–gp12:Nluc
This wo k
Plasmids
pRS415
ATCC 87520
pGFP
Labo a o y s ock
79
phiIBBPAA2_0053
33356
34045
690
RBP
Lis e ia
3. 0E-02
phiIBBPAA2_0054
34042
35583
1542
i al p o ein
En e obac e ia phage T7
6.7E-06
phiIBBPAA2_0055
35592
36239
648
RB domain o sho TFP gp12
Bizionia a gen inensis JUB59
79
phiIBBPAA2_0056
36229
36477
249
hypo he ical p o ein
Pseudomonas i us Pa223
1.0E-49
phiIBBPAA2_0057
36461
36652
192
hypo he ical p o ein
Pseudomonas i us LUZ24
1.0E-34
phiIBBPAA2_0058
36663
37289
627
i ion p o ein
Pseudomonas i us LUZ24
1.0E-151
phiIBBPAA2_0059
37293
37613
321
hypo he ical p o ein
Pseudomonas i us LUZ24
5.0E-72
phiIBBPAA2_0060
37662
38615
954
majo head p o ein
Mic ocys is phage Mic1
2.0E-101
phiIBBPAA2_0061
38634
39626
993
sca olding p o ein
Pseudomonas ae uginosa
0.0
phiIBBPAA2_0062
39626
39868
243
hypo he ical p o ein
Pseudomonas ae uginosa
4.0E-51
phiIBBPAA2_0063
39871
41991
2121
po al p o ein
Pseudomonas phage phiIBB-PAA2
2.2E-40
phiIBBPAA2_0064
41991
43439
1449
e minase la ge subuni
Pseudomonas i us LUZ24
5.0E-47
phiIBBPAA2_0065
43439
43837
399
lysozyme
Pseudomonas phage TL
2.0E-89
phiIBBPAA2_0066
43869
44327
459
hypo he ical p o ein
Pseudomonas phage phiIBB-PAA2
5.0E-107
Table S4 - Anno a ion o phage PE3. Fo each locus_ ag, he ansc ip ion s a and s op posi ion. The co esponding gene p oduc size and pu a i e p edic ed unc ion based on he bes hi and E- alue ob ained
locus_ ag
Minimum
(bp)
Maximum
(bp)
Leng h
(bp)
Pu a i e unc ion
Bes Species Hi
E- alue
BPaePPE3_001
1776
2060
285
hypo he ical p o ein
Pseudomonas phage phiKMV
4.0E-62
BPaePPE3_002
2060
2287
228
hypo he ical p o ein
Pseudomonas phage phiKMV
5.0E-46
80
BPaePPE3_003
2298
2837
540
hypo he ical p o ein
Pseudomonas phage LUZ19
5.0E-128
BPaePPE3_004
2834
3004
171
hypo he ical p o ein
Pseudomonas phage B_PaeP_130_113
1.0E-32
BPaePPE3_005
3007
3126
120
hypo he ical p o ein
Pseudomonas phage B_PaeP_PE3
7.0E-18
BPaePPE3_006
3205
3573
369
hypo he ical p o ein
Pseudomonas phage phiKMV
4.0E-85
BPaePPE3_007
3560
3787
228
hypo he ical p o ein
Pseudomonas phage phiKMV
7.0E-49
BPaePPE3_008
3784
3969
186
hypo he ical p o ein
Pseudomonas phage B_PaeP_PE3
3.0E-34
BPaePPE3_009
3966
4139
174
hypo he ical p o ein
Pseudomonas ae uginosa
3.0E-34
BPaePPE3_010
4139
4420
282
hypo he ical p o ein
Pseudomonas ae uginosa
2.0E-59
BPaePPE3_011
4420
4680
261
hypo he ical p o ein
Pseudomonas ae uginosa
4.0E-55
BPaePPE3_012
4682
4969
288
hypo he ical p o ein
Pseudomonas phage B_PaeP_PE3
2.0E-63
BPaePPE3_013
5048
5464
417
hypo he ical p o ein
Pseudomonas phage B_PaeP_PE3
1.0E-92
BPaePPE3_014
5533
5892
360
hypo he ical p o ein
Pseudomonas phage phiKMV
2.0E-78
BPaePPE3_015
5895
6704
810
DNA-binding p o ein
Pseudomonas phage B_PaeP_PE3
0.0
BPaePPE3_016
6784
7203
420
hypo he ical p o ein
Pseudomonas phage B_PaeP_PE3
7.0E-98
BPaePPE3_017
6974
7516
543
hypo he ical p o ein
Pseudomonas phage B_PaeP_PE3
3.0E-129
BPaePPE3_018
7526
7729
204
hypo he ical p o ein
Pseudomonas phage PT5
3.0E-41
BPaePPE3_019
7702
8526
825
pu a i e DNA p imase
Aqui ex aeolicus
1.3E-22
BPaePPE3_020
8495
9763
1269
DNA helicase
Bacillus phage SPP1
1.5E-39
BPaePPE3_021
9753
10370
618
pu a i e nucleo idyl
ans e ase
Pseudomonas phage B_PaeP_PE3
2.0E-148
BPaePPE3_022
10370
11317
948
DNA ligase
Pseudomonas phage B_PaeP_PE3
1.5E-37
81
BPaePPE3_023
11320
11649
330
hypo he ical p o ein
Pseudomonas phage B_PaeP_PE3
2.0E-74
BPaePPE3_024
11646
14069
2424
DNA polyme ase I
Plasmodium alcipa um
6.0E-64
BPaePPE3_025
14066
14377
312
hypo he ical p o ein
Pseudomonas phage LKD16
2.0E-69
BPaePPE3_026
14432
15481
1050
hypo he ical p o ein
Pseudomonas phage MPK7
0.0
BPaePPE3_027
15481
16422
942
5'-3' exonuclease
Mycobac e ium smegma is
4.3E-30
BPaePPE3_028
16412
16852
441
pu a i e DNA endonuclease
VII
Pseudomonas phage MPK6
5.0E-105
BPaePPE3_029
16849
17895
1047
DNA polyme ase
Py obaculum calidi on is
2.7E-10
BPaePPE3_030
17905
18267
363
hypo he ical p o ein
Pseudomonas phage B_PaeP_PE3
1.0E-80
BPaePPE3_031
18260
18610
351
hypo he ical p o ein
Pseudomonas phage B_PaeP_PE3
4.0E-78
BPaePPE3_032
18619
21066
2448
pu a i e DNA-dependen RNA
polyme ase
En e obac e ia phage T7
6.0E-152
BPaePPE3_033
21240
21491
252
hypo he ical p o ein
Pseudomonas phage LUZ19
1.0E-52
BPaePPE3_034
21491
21964
474
pu a i e ace yl ans e ase
Pseudomonas phage B_PaeP_PE3
5.0E-114
BPaePPE3_035
21909
22205
297
pu a i e s uc u al p o ein
Pseudomonas phage B_PaeP_PE3]
4.0E-61
BPaePPE3_036
22217
23749
1533
pu a i e head- ail connec o
p o ein
En e obac e ia phage T7
5.6E-91
BPaePPE3_037
23753
24721
969
sca olding p o ein
Pseudomonas phage B_PaeP_PE3
0.0
BPaePPE3_038
24774
25781
1008
capsid p o ein
Pseudomonas phage phiKMV
0.0
BPaePPE3_039
25878
26432
555
ail ubula p o ein A
Pseudomonas phage LUZ19
8.0E-132
BPaePPE3_040
26435
28915
2481
ail ubula p o ein B
En e obac e ia phage T7
8.3E-110
BPaePPE3_041
28915
29460
546
pu a i e in e nal i ion p o ein
A
Pseudomonas phage phiKMV
2.0E-124
82
BPaePPE3_042
29460
32156
2697
in e nal i ion p o ein
Pseudomonas phage B_PaeP_PE3
0.0
BPaePPE3_043
32160
36173
4014
in e nal i ion p o ein
Pseudomonas phage B_PaeP_PE3
0.0
BPaePPE3_044
36175
36930
756
pu a i e ail ibe p o ein
En e obac e ia phage T7
4.6E-11
BPaePPE3_045
36930
37388
459
ail ibe p o ein
Pseudomonas phage LUZ19
7.0E-106
BPaePPE3_046
37381
38286
906
ail ibe p o ein
Pseudomonas phage B_PaeP_PE3
0.0
BPaePPE3_047
38290
38895
606
ail ibe p o ein
Pseudomonas phage LUZ19
9.0E-148
BPaePPE3_048
38895
39200
306
hypo he ical p o ein
Pseudomonas phage B_PaeP_PAO1_1-
15pyo
1.0E-68
BPaePPE3_049
39210
41015
1806
e minase la ge subuni
Pseudomonas phage B_PaeP_PE3
1.4E-32
BPaePPE3_050
41012
41212
201
hypo he ical p o ein
Pseudomonas phage phiKMV
2.0E-38
BPaePPE3_051
41209
41691
483
endolysin
Pseudomonas phage B_PaeP_PE3
1.0E-114
BPaePPE3_052
41649
41978
330
hypo he ical p o ein
Pseudomonas phage DL62
4.0E-72
BPaePPE3_053
42130
42480
351
mino s uc u al p o ein
Pseudomonas phage B_PaeP_PE3
3.0E-72
BPaePPE3_054
42499
42744
246
pa icle p o ein
Pseudomonas phage B_PaeP_PE3
3.0E-49
BPaePPE3_055
42753
42968
216
hypo he ical p o ein
Pseudomonas phage LUZ19
3.0E-42