Engineering phages towards Pseudomonas aeruginosa detection and control

Uni e sidade do Minho Escola de Engenha ia Ma ia João Cae ano da Cos a Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Oc obe 2022 Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Ma ia João Cae ano da Cos a UMinho | 2022 Uni e sidade do Minho Escola de Engenha ia Oc obe 2022 Ma ia João Cae ano da Cos a Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Mas e ’s Thesis Mas e ’s deg ee in Bio echnology Wo k supe ised by Doc o Diana P iscila Penso Pi es Doc o Síl io Robe o B anco dos San os ii Nome: Ma ia João Cae ano da Cos a Ende eço ele ónico: [email protected] Tí ulo da disse ação: Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol O ien ado es: Dou o a Diana P iscila Penso Pi es Dou o Síl io Robe o B anco dos San os Ano de conclusão: 2022 Mes ado em Bio ecnologia DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS Es e é um abalho académico que pode se u ilizado po e cei os desde que espei adas as eg as e boas p á icas in e nacionalmen e acei es, no que conce ne aos di ei os de au o e di ei os conexos. Assim, o p esen e abalho pode se u ilizado nos e mos p e is os na licença abaixo indicada. Caso o u ilizado necessi e de pe missão pa a pode aze um uso do abalho em condições não p e is as no licenciamen o indicado, de e á con ac a o au o , a a és do Reposi ó iUM da Uni e sidade do Minho. Licença concedida aos u ilizado es des e abalho A ibuição-NãoCome cial-SemDe i ações CC BY-NC-ND h ps://c ea i ecommons.o g/licenses/by-nc-nd/4.0/ iii AGRADECIMENTOS No inal des e pe cu so ão in enso e desa ian e, não podia deixa de exp essa o meu ag adecimen o a odos os que me acompanha am e apoia am du an e oda es a e apa p o issional e pessoal que chega ago a ao im. P imei amen e gos a ia de ag adece à Dou o a Diana P iscila Pi es e Dou o Síl io San os, o ien ado es da minha disse ação de mes ado, po me ecebe em ão bem nes e p oje o. Sou uma p i ilegiada po oda a expe iência e o mação que me p opo ciona am. Ag adeço a p esença cons an e, dedicação, paciência, con iança e po se em incansá eis nes e abalho. Todo o osso apoio, p o issionalismo, excelência e igo cien í ico ala ga am os meus ho izon es ao longo des a jo nada e o na am-me p epa ada pa a no os desa ios. Ao g upo do LPhage, ag adeço po me e em ecebido ão bem nes e labo a ó io. Ob igada pela ossa companhia, disponibilidade e ansmissão de conhecimen o semp e de o ma ão a enciosa. Foi um p aze abalha con osco e sem ocês não se ia o mesmo. Toda a ossa boa disposição, ca inho e ajuda con ibuí am pa a que udo is o se o nasse possí el. Ob igada aos amigos inc í eis que enho. Ag adeço e em c uzado o meu caminho, desde Ma co de Cana eses, Vila Real ou B aga, pela ossa amizade incondicional, companhei ismo, mo i ação e boa disposição capazes de ans o ma uma lág ima num so iso. To na am es e pe cu so mais ácil!! Ao B uno, ob igada pelo apoio incansá el nos momen os mais di íceis, po e es semp e uma pala a de con o o, pelo ca inho e po oda a cumplicidade. Ob igada po es a es semp e p esen e, ac edi a es e me aze es ac edi a que udo is o se ia possí el. Po úl imo, que o ag adece aos meus pais po o na em odo es e pe cu so possí el, apoia em em odos os momen os e es a em semp e p esen es. O maio ag adecimen o se á semp e pa a ós que me pe mi em, odos os dias, lu a pelos meus obje i os. Como não podia deixa de se , que o ambém ag adece aos meus i mãos, Flá ia e Ma co! Apesa de me ouba em os panados e eima em em con a ia comigo, sei que o cem po mim. Aos meus a ós, que semp e i e am é nas minhas conquis as, um ab acinho especial. Es e abalho oi inanciado po undos nacionais a a és da FCT – Fundação pa a a Ciência e a Tecnologia, I.P., no âmbi o do p oje o “PhageShape – uma pla a o ma e icien e pa a edi a agos de P. ae uginosa pa a o con olo de doenças in ecciosas” com a e e ência EXPL/EMD-EMD/1142/2021. Ob igado! i STATEMENT OF INTEGRITY I he eby decla e ha ing conduc ed his academic wo k wi h in eg i y. I con i m ha I ha e no used plagia ism o any o m o undue use o in o ma ion o alsi ica ion o esul s along he p ocess leading o i s elabo a ion. I u he decla e ha I ha e ully acknowledged he Code o E hical Conduc o he Uni e si y o Minho. SUMÁRIO A Pseudomonas ae uginosa é uma bac é ia G am-nega i a que p ospe a numa a iedade de ambien es. Es a bac é ia pa ogénica é um dos mic o ganismos mais equen emen e isolados do a o espi a ó io de pacien es em es ado c í ico e imunocomp ome ido. Pa a além disso, o seu equen e en ol imen o numa ampla gama de doenças e a sua baixa susce ibilidade a uma ampla gama de an ibió icos, o na P. ae uginosa um sé io desa io e apêu ico, que mui as ezes esul a em in e namen os p olongados, aumen o dos cus os médicos e al as axas de mo alidade. Face a is o, o desen ol imen o de abo dagens al e na i as ao uso des es an imic obianos é de ex ema impo ância e os bac e ió agos êm um ele ado po encial no con olo de doenças bac e ianas, mas ge almen e exibem um espe o de ação limi ado. A a és da u ilização de e amen as de engenha ia de agos, é possí el p oduzi agos quimé icos com ca ac e ís icas desejá eis de o ma a melho a a de eção e/ou con olo de es i pes bac e ianas num con ex o clínico. Além disso, os agos modi icados podem codi ica á ios genes epó e , subs i uindo assim os mé odos de cul u a con encionais. O obje i o des e p oje o assen a na engenha ia do genoma de agos de P. ae uginosa pa a melho a as suas uncionalidades, assim como aumen a o seu espe o de ação pa a uma ampla gama de bac é ias hospedei as e ob e uma e amen a p omisso a pa a o diagnós ico e a amen o de pacien es com in eções esis en es a an ibió icos. O p imei o passo des e abalho consis iu em a alia o po encial de um ago epó e p e iamen e cons uído, con endo o gene da NanoLuc luci e ase (PE3Δgp1–gp12:Nluc) pa a de e a células de P. ae uginosa . O limi e de de eção des e ago epó e a iou en e 620 e 9000 UFC/mL em apenas 7 h, sendo o limi e de de eção mais baixo alcançado pa a a es i pe hospedei a do ago. Pos o is o, es e sis ema de de eção baseado em ago cons i ui uma al e na i a p omisso a aos mé odos de cul u a, já que pe mi e um diagnós ico mais ápido. A im de aumen a o espe o lí ico des e ago, oi ealizada uma análise genómica pa a os agos de Pseudomonas phiIBB-PAA2 e B_PaeP_PE3. Des a o ma, o am iden i icadas e selecionadas po enciais Tail Fibe P o eins (TFPs). Se e p o eínas codi icadas nos genomas dos agos o am selecionadas e de seguida clonadas, exp essas e pu i icadas, mas apenas uma (pGFP_A2gp55) oi capaz de se liga a células de P. ae uginosa PAO1. Com base nes es ensaios, oi usada uma e amen a de engenha ia de agos baseada em le edu a pa a inse i com sucesso a TFP uncional ( gp 55) do ago A2 no genoma do ago PE3Δgp1–gp12:Nluc. Ainda assim, es e mé odo não pe mi iu aumen a o espe o de hospedei os do ago. Pala as-cha e: Pseudomonas ae uginosa , esis ência an ibió ica, bac e ió agos, engenha ia de agos, agos quimé icos, de eção de pa ógenos, con olo de pa ógenos, limi e de de eção. i ABSTRACT Pseudomonas ae uginosa is a G am-nega i e bac e ium ha h i es in a a ie y o en i onmen s. This bac e ial pa hogen is one o he mos common mic o ganims equen ly isola ed om he espi a o y ac o c i ically ill and immunocomp omised pacien s. In addi ion, i s equen in ol emen in a wide ange o illnesses and i s low suscep ibili y o a wide ange o an ibio ics, makes P. ae uginosa a se ious he apeu ic challenge, which o en esul s in p olonged hospi al s ays, inc eased medical cos s, and high mo ali y a es. Gi en his, he de elopmen o al e na i e app oaches o he use o hese an imic obials is ex emely impo an and bac e iophages ha e a emendous po en ial agains bac e ial diseases bu hey usually exhibi a limi ed hos ange. Taking ad an age o phage-enginee ing ools, i is possible o assemble chime ic phages wi h desi able ea u es in o de o imp o e he de ec ion and/o con ol bac e ial s ains in clinical se ings. In addi ion, enginee ed phages can encode nume ous epo e genes, he e o e eplacing he con en ional cul u e me hods. The aim o his p ojec elies on enginee ing he genome o P. ae uginosa phages o imp o e i s pe o mance by expanding hei hos ange, in o de o ge a p omising ool o he diagnosis and ea men o pa ien s wi h an ibio ic- esis an in ec ions. This esea ch's ini ial s ep was o e alua e how well a p e iously buil epo e phage (PE3gp1-gp12:Nluc) could iden i y P. ae uginosa cells. The lowes de ec ion limi o he phage hos s ain P. ae uginosa PAO1 was eached by his epo e phage, whose de ec ion limi anged om 620 o 9000 CFU/mL in only 7 hou s. Ne e heless, because i enables quicke diagnosis, his phage-based de ec ion echnology is a possible eplacemen o cul u e app oaches. To inc ease he hos ange o his phage, a genomic analysis was pe o med o he Pseudomonas phages phiIBB-PAA2 and B_PaeP_PE3. This me hod allowed o he iden i ica ion and selec ion o p ospec i e Tail Fibe P o eins (TFPs). Se en selec ed p o eins encoded in phage genomes we e hen cloned, exp essed and pu i ied, bu only one (pGFP_A2gp55) was capable o binding o P. ae uginosa PAO1 cells. Based on hese assays, he yeas -based phage-enginee ing ool was used o success ully inse he unc ional TFP ( gp 55) om A2 phage on PE3Δgp1–gp12:Nluc phage genome. Howe e , his app oach was unable o b oaden he ange o phage hos s. Keywo ds: Pseudomonas ae uginosa , an ibio ic esis ance, bac e iophages, phage-enginee ing, chime ic phages, pa hogen de ec ion, pa hogen con ol, limi o de ec ion. ii TABLE OF CONTENTS Ag adecimen os ................................................................................................................................. iii Sumá io .............................................................................................................................................. Abs ac ............................................................................................................................................. i Lis o abb e ia ions............................................................................................................................ ix Lis o igu es ..................................................................................................................................... xi Lis o ables ...................................................................................................................................... xi 1. In oduc ion ................................................................................................................................ 2 1.1. O e iew o Pseudomonas ae uginosa clinical impac .......................................................... 2 1.2. Diagnos ic me hods o de ec ion o Pseudomonas ae uginosa in clinical se ings ................. 4 1.3. Bac e iophages ................................................................................................................... 7 1.3.1. De ini ion and in ec ion cycles .............................................................................................. 7 1.3.2. Ad an ages and limi a ions o phages .................................................................................. 8 1.3.3. Diagnosis o pa hogens based on phages ........................................................................... 10 1.3.4. Phage-enginee ing echniques ........................................................................................... 11 1.4. P ojec aims ...................................................................................................................... 13 2. Ma e ials and me hods ............................................................................................................. 16 2.1. S ains, plasmids and cul u e condi ions ............................................................................ 16 2.2. Sensi i i y es s o de ec ion o P. ae uginosa .................................................................... 17 2.3. E alua ion o ly ic spec a and e iciency o pla ing ............................................................. 18 2.4. Cloning and unc ional analysis o po en ial TFPs ............................................................... 18 2.4.1. Gene ampli ica ion ............................................................................................................ 19 2.4.2. Cloning ............................................................................................................................. 22 2.4.3. P o ein exp ession ............................................................................................................. 25 2.4.4. P o ein pu i ica ion ............................................................................................................ 25 2.4.5. Fluo escence mic oscopy .................................................................................................. 27 2.5. Genome enginee ing o P. ae uginosa phage B_PaeP_PE3 .............................................. 27 2.5.1. P epa a ion o he PCR p oduc s o genome enginee ing ................................................... 28 2.5.2. Genome enginee ing ......................................................................................................... 30 2.5.3. T ans o ma ion o cap u ed phage genome in o P. ae uginosa cells .................................... 32 2.5.4. Phage p oduc ion and sequencing ..................................................................................... 33 2.5.5. Hos - ange o he chime ic phages ..................................................................................... 33 xi LIST OF TABLES Chap e 2 Table 1 - P ime s used o ampli y he TFPs encoding genes om philBB-PAA2A2 and B_PaeP_PE3 phages, he espec i e es ic ion enzyme si e used and hei pa ame e s. Tm ep esen s he mel ing empe a u e. Enzyme es ic ion si es a e unde lined.…………….…..…………………………………………..…20 Table 2 - Componen s and quan i ies used o PCR wi h Phusion™ Plus DNA Polyme ase.……………....21 Table 3 - The mocycling condi ions o a ou ine PCR wi h Phusion™ Plus DNA Polyme ase ……………..21 Table 4 - Reac ion componen s and olumes o concen a ions used o diges he a ge genes………….22 Table 5 - Reac ion componen s, olumes o inal concen a ions o he liga ion o he a ge genes……..23 Table 6 - PCR mix componen s and hei inal concen a ions o colony PCR…………………………………24 Table 7 - P ime s used o colony PCR and hei pa ame e s. Tm ep esen s he mel ing empe a u e…24 Table 8 - The mocycling condi ions o a colony PCR…………………………………………………………………24 Table 9 – SDS-PAGE componen s and quan i ies ………………..……………………………………………………26 Table 10 - Backbone, ans o ma ions (T1 and T2) and he espec i e DNA agmen s, empla e, size and p ime s used……………………….……………………………………………………………………………………………28 Table 11 - P ime s used o ampli y all he PCR p oduc s o he yeas ans o ma ion. O e hangs a e unde lined….……………………………………………….……………………………………………………………………29 Table 12 - Componen s and quan i ies used o PCR wi h Xpe High Fideli y DNA Polyme ase.………....30 Table 13 - The mocycling condi ions used o PCR wi h Xpe High Fideli y DNA Polyme ase …….……..30 Table 14 - PCR mix componen s and concen a ions o yeas colony PCR…………………………….………31 Table 15 – P ime s used in yeas colony PCR and hei pa ame e s. Tm ep esen s he mel ing empe a u e…………………………………………………………………………………………….……………….………31 Table 16 - The mocycling condi ions o a yeas colony PCR…………………………………………………….…31 Chap e 3 Table 17 - EOP agains di e en s ains o P. ae uginosa ……..………………………..…………………………..41 Table 18 - EOP o he new phage p oduced (T2) agains di e en s ains o P. ae uginosa ….………….…52 Supplemen a y ma e ial Table S1 – Bac e ial s ains, bac e iophages and plasmids u ilized in his s udy…………………………….69 Table S2 - Sequence o nucleo ides and amino acids o he genes used a his wo k……………………….73 x Table S3 - Anno a ion o phage A2. Fo each locus_ ag, he ansc ip ion s a and s op posi ion. The co esponding gene p oduc size and pu a i e p edic ed unc ion based on he bes hi and E- alue ob ained.………………………………………………………………………………………………………………………….76 Table S4 - Anno a ion o phage A2. Fo each locus_ ag, he ansc ip ion s a and s op posi ion. The co esponding gene p oduc size and pu a i e p edic ed unc ion based on he bes hi and E- alue ob ained ………………………………………………………………………………………………………………………….79 Chap e 1 INTRODUCTION Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 1 – In oduc ion 2 1. INTRODUCTION 1.1. O e iew o Pseudomonas ae uginosa clinical impac Pseudomonas ae uginosa is an ubiqui ous G am-nega i e bac e ium belonging o he Pseudomonadaceae amily ha is capable o su i ing in a wide ange o en i onmen s (Pacho i e al., 2019; Silby e al., 2011). This oppo unis ic bac e ium can be ound in wa e , soil and plan s, in ec ing many di e en o ganisms, such as yeas s, plan s, nema odes, insec s and mammals (Pacho i e al., 2019; Pe ei a e al., 2014). In humans, P. ae uginosa is one o he mos equen pa hogens isola ed om he espi a o y ac o c i ically ill and immunocomp omised pa ien s and is conside ed he main cause o mo bidi y and mo ali y in pa ien s wi h en ila o -associa ed pneumonia and cys ic ib osis (CF). P. ae uginosa is also equen ly in ol ed in many o he in ec ions, including ca he e -associa ed in ec ions, bu n wound in ec ions, bloods eam in ec ions, u ina y ac in ec ions, and su gical si e in ec ions, hus cons i u ing a eal and high conce n in hospi al se ings. Indeed, his pa hogen is a majo cause o nosocomial bac e aemia, wi h a e y high (>30 %) associa ed mo ali y a e (Basse i e al., 2018; Juan e al., 2017; Nguyen e al., 2018; Pacho i e al., 2019; Pe ei a e al., 2014). Acco ding o he Cen e s o Disease Con ol and P e en ion, (2019), in 2017 he e we e an es ima ed 32.600 cases o in ec ions caused by P. ae uginosa in hospi alized pa ien s and app oxima ely 2.700 dea hs in US, co esponding o $ 767M o heal h ca e cos s. P. ae uginosa possesses an a senal o se e al i ulence ac o s o e ade hos cell de ences. These i ulence mechanisms include adhesins, p o eases, phenazines, pyocyanin, exo oxins o he ype III sec e ion sys em (T3SS), lagella o lipopolysaccha ides (LPS). These i ulence ac o s ha e speci ic oles o coun e ac hos de ences. Adhesins, o ins ance, pa icipa e in he ini ial s age o in ec ion, allowing bac e ia o adhe e o hos cells. P o eases, mainly alkaline p o ease and elas ase, deg ade elas in, which ep esen s 28 % o he lung issue. Phenazins inc ease in acellula oxida i e s ess, inhibi ing mi ochond ial ac i i y and cell p oli e a ion in neu ophils and mac ophages. T3SS p omo es apop osis o euka yo ic cells and he sp ead o he disease h ough he lung (Passado e al., 1993; Pe ei a e al., 2014; S a e a & Mi o , 2011). Many o he P. ae uginosa i ulence ac o s a e egula ed by quo um-sensing (QS), a cell-cell communica ing mechanism ha con ols gene exp ession based in luc ua ions on cell densi y. Two dis inc QS sys ems a e known in P. ae uginosa : las and hl (Reu e e al., 2016; S a e a & Mi o , 2011). Besides he i ulence ac o s desc ibed abo e, P. ae uginosa also has an inna e abili y o o m bio ilms, which can be de ined as agg ega es o bac e ia encased in a sel - Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 1 – In oduc ion 3 p oduced ma ix o ex acellula polyme ic subs ances (EPS) ha con e s p o ec ion o he bac e ial cells. The e o e, hese complex s uc u es a e e y di icul o e en impossible o e adica e wi h an ibio ic ea men (Cio u & Tolke -nielsen, 2019; Mo adali e al., 2017), being a huge challenge in clinical se ings. P. ae uginosa esis ance may be exp essed by h ee di e en o ms (Figu e 1) o a wide ange o an ibio ics, such as β-lac ams, aminoglycosides, quinolones and polymyxins (Basse i e al., 2018; Heinz e al., 2019; Klockge he e al., 2011; Pacho i e al., 2019). Figu e 1 - Pseudomonas ae uginosa esis ance mechanisms. The in insic esis ance o P. ae uginosa includes low pe meabili y o he ou e memb ane, exp ession o e lux pumps ha expel an ibio ics ou o he cell, and he p oduc ion o an ibio ic inac i a ing enzymes (B eidens ein e al., 2011; Ghysels e al., 2008; Pacho i e al., 2019). The acqui ed esis ance o P. ae uginosa can be achie ed by ho izon al ans e o esis ance genes o mu a ional changes (B eidens ein e al., 2011; Pacho i e al., 2019). Adap i e esis ance is inducible and dependen Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 1 – In oduc ion 4 on he con inued p esence o an an ibio ic o ano he en i onmen al s imulus. Se e al igge ing ac o s a e now quali ied o induce his ype o esis ance, including an ibio ics, biocides, polyamines, anae obiosis, ca ions, pH and ca bon sou ces, as well as bio ilm o ma ion. These ac o s modula e he exp ession o many genes, leading o e ec s on he e lux pumps, cell en elope, and enzymes. An impo an ea u e o adap i e esis ance is ha , once he inducing ac o o condi ion is emo ed, he o ganism e e s o wild- ype suscep ibili y. Adap i e esis ance can also ha e long- e m consequences. I cells a e no comple ely e adica ed, as soon as he ea men s ops, g ow h can be obse ed (B eidens ein e al., 2011). This is o pa icula conce n in clinical en i onmen s whe e P. ae uginosa g ows as a bio ilm (B eidens ein e al., 2011). The o e use and misuse o an ibio ics is a g owing public heal h conce n, which can esul in nega i e side e ec s and he de elopmen o d ug- esis an bac e ial s ains (Takahashi & Ta suma, 2014). Acco ding o Basse i e al. (2018), in ec ions ela ed o Pseudomonas spp . we e epo ed in 60 % o his s udies and o e all, mo ali y anged om 33 o 71 % in pa ien s wi h ca bapenem- esis an Pseudomonas in ec ions. In addi ion o mo ali y, esis ance is also associa ed wi h inc eased heal hca e cos s (Basse i e al., 2018). Mo eo e he de elopmen o new an ibio ics is cu en ly e y limi ed and ime-consuming (Pang e al., 2019). In 2017, he Wo ld Heal h O ganiza ion (WHO) published a global p io i y lis o an ibio ic- esis an bac e ia ha u gen ly equi e he de elopmen o new an ibio ics (Wo ld Heal h O ganiza ion, 2017). The mos c i ical g oup includes mul i- esis an bac e ia ha pose a speci ic h ea in hospi als, nu sing homes and among pa ien s whose ca e equi es de ices such as en ila o s and blood ca he e s. This g oup includes Acine obac e baumannii , P. ae uginosa and se e al En e obac e iaceae . Thus, he disco e y and de elopmen o al e na i e he apeu ic s a egies o con ol P. ae uginosa in ec ions is u gen (B eidens ein e al., 2011; Cha e jee e al., 2016; Pacho i e al., 2019). These new he apeu ic s a egies can ac alone o in combina ion wi h con en ional he apies, and may include QS inhibi o s, i on chela ion molecules, accine s a egy, nanopa icles, an imic obial pep ides, elec ochemical sca olding and phage he apy (Pang e al., 2019). 1.2. Diagnos ic me hods o de ec ion o Pseudomonas ae uginosa in clinical se ings A inc edibly low quan i ies, Pseudomonas ae uginosa can cause illnesses; jus 10–100 bacilli can colonize he in es ine o ex emely ill o immunocomp omised pa ien s, which can esul in pe sis en and long- e m in ec ions. Long u na ound imes o diagnoses can wo sen pa ien ou comes and aise Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 1 – In oduc ion 5 hospi al cos s (Tang e al., 2017). In addi ion o he de elopmen o new he apies o ea P. ae uginosa in ec ions, i is also u gen he de elopmen o as and accu a e ools o de ec P. ae uginosa in clinical se ings, eplacing he con en ional me hods ha a e usually labo ious and ime-consuming. The biological cha ac e is ics o he bac e ium unde speci ic cul u e condi ions o he ac i i ies o bac e ial molecules like oxidase, ace amidase, a ginine dihyd olase, and pyocyanin a e he basis o con en ional Pseudomonas ae uginosa de ec ion me hods (Tang e al., 2017). Bac e ia a e mos equen ly de ec ed by cul u e me hods using selec i e and non-selec i e media. P. ae uginosa is easily g own in di e en media and hese media play an impo an ole in hei de ec ion. In blood aga , a non- selec i e medium, P. ae uginosa is some imes o e g own by he commensal lo a (Xu e al., 2004). G am-nega i e selec i e media, such as McConkey aga , make he disc imina ion o P. ae uginosa om o he espi a o y pa hogens and na i e lo a mo e con enien . Selec i e media such as P. ae uginosa isola ion aga o ce imide aga we e especially de eloped o he cul u e o P. ae uginosa (T ampe - s ande s e al., 2005; Xu e al., 2004). Howe e , hese old p ocedu es ha e some signi ican limi a ions and equen ly equi e mo e han 48 h o ea ly esul s (T ampe -s ande s e al., 2005). On he o he hand, in ec ion wi h P. ae uginosa can be p o en bo h by he cul u e o he o ganism i sel and by he de ec ion o he immune esponse o he mic oo ganism. The an ibody es wi h ELISA (Enzyme-linked immunoso ben assay) demons a ed li le o no in e e ence om c oss- eac i e an ibodies di ec ed agains o he bac e ia (T ampe -s ande s e al., 2005). Ch onic in ec ion gene ally causes a high an ibody esponse (Bu ns e al., 2001; T ampe -s ande s e al., 2005). The polyme ase chain eac ion (PCR) o samples has been used o he de ec ion o P. ae uginosa in pa ien s wi h CF a an ea ly s age and has a high sensi i i y o P. ae uginosa . Se ological and molecula echniques a e pa icula ly use ul o ini ial o in e mi en coloniza ion, because ch onic coloniza ion is usually easily con i med by cul u e (T ampe -s ande s e al., 2005). In o de o disc imina e be ween iable and non- iable cells, e e se ansc ip ion PCR (RT-PCR) has been c ea ed. Because hese es s ampli y RNA, a p oduc o ongoing cellula and me abolic ac i i ies, only ecen ly ali e o ganisms may be iden i ied (Anbu e al., 2017; Young e al., 2005). Due o highe alse-posi i e esul s as compa ed o cul u e and o he app oaches, as well as echnical di icul ies and cos s, RT-PCR- based de ec ion me hods a e no equen ly employed, aising ques ions abou hei e icacy. (Jones e al., 2020; Schmelche & Loessne , 2014). By adding luo escen molecules o he eac ion mix u e, he eal- ime, luo escence-based quan i a i e PCR ( eal- ime qPCR) app oach o e s a quan i a i e de ec ion h ough eal- ime moni o ing Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 1 – In oduc ion 6 o PCR eac ions and is one o he mos popula nucleic acid-based molecula de ec ion me hods o pa hogens a he momen . This echnique allowed he de ec ion o P. ae uginosa in CF pa ien s mo e quickly. Real-Time luo escence-based PCR was also a leading me hod o he de ec ion o pa hogens in espi a o y ac in ec ions and pneumonia, and i was a e y sensi i e, powe ully speedy, ex ensi ely applicable, and p ospec i ely de ec able ins umen (Tang e al., 2017). FISH (Fluo escen In Si u Hyb idiza ion) is ano he echnique used o bac e ial de ec ion; howe e , he sensi i i y, pe cen age o a ge s ains ha a e de ec ed wi h FISH compa ed o he cul u e is no e y high, as he mic oscopic de ec ion limi depends on samples o high bac e ial densi y. In addi ion, he p ocedu e is no simple and does no disc imina e be ween dead and li e cells (Hoga d e al., 2000; T ampe -s ande s e al., 2005). A no el kind o so ioniza ion mass spec ome y called ma ix-assis ed lase deso p ion/ioniza ion ime o ligh mass spec ome y (MALDI-TOF MS) is used o map he p o ein spec um o mic obes. To ob ain an iden i ica ion, he mass spec ome y da a o clinical mic oo ganisms a e compa ed wi h he common p o ein da abase o ecognized bac e ia. MALDI-TOF MS has becoming a as and e ec i e mic obial iden i ica ion me hod used in clinical diagnos ics, en i onmen al moni o ing, and mic obiological classi ica ion esea ch due o i s speed, accu acy, sensi i i y, au oma ion, and high h oughpu . This me hod has also been used by some esea che s o iden i y P. ae uginosa (Tang e al., 2017). These quick p ocedu es, ne e heless, a e hinde ed by he need o expensi e equipmen , ime- consuming p e-en ichmen s eps, and challenging esul s handling and in e p e a ion (MALDI-TOF MS) (Schmelche & Loessne , 2014). Va ious bio ecogni ion componen s, including an ibodies, enzymes, ap ame s, and nucleic acids, ha e been used ex ensi ely in ecen yea s and a e essen ial o he de ec ion o in ec ions in a a ie y o complica ed ma ices. An ibodies agains P. ae uginosa can appea mon hs be o e a cul u e becomes posi i e, and a e a use ul pa ame e o moni o ing in ec ion in pa ien s colonized wi h P. ae uginosa , as i es may a y wi h an imic obial ea men bu hese compounds a e labo ious and expensi e o p oduce, ha e high de ec ion limi s, and equen ly exhibi c oss- eac i i y (Cos a e al., 2022; T ampe - s ande s e al., 2005). Bac e iophages a e good candida es o eplace adi ional ecogni ion molecules due o hei in e es ing p ope ies, including high speci ici y, sensi i i y, s abili y, and ease o enginee ing (Cos a e al., 2022). In addi ion, since hey only mul iply in iable cells, hey can also disc imina e be ween li e and dead cells, a e simple and a o dable o p oduce, and exhibi high esis ance o changes Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 1 – In oduc ion 7 in empe a u e and pH, chemical sol en s, and p o eases (Schmelche & Loessne , 2014). These p ope ies can imp o e he ea ly de ec ion o P. ae uginosa in clinical se ings since agg essi e an imic obial he apy can p e en g ow h and de ec ion o P. ae uginosa h ough cul u e me hods. (T ampe -s ande s e al., 2005). 1.3. Bac e iophages 1.3.1. De ini ion and in ec ion cycles Abou 100 yea s ago, Félix d'Hé elle disco e ed he i uses o bac e ia - bac e iophages (phages). Thei abili y o p eda e bac e ia quickly p omp ed i s use o ea and p e en in ec ious diseases in humans and animals (Lin e al., 2017; Mon ei o e al., 2019). Phages a e simple, ye ex emely di e se, biological en i ies ha consis o DNA o RNA encased in a p o ein capsid. As na u ally occu ing bac e ial pa asi es, phages a e unable o ep oduce independen ly and a e ul ima ely dependen on a bac e ial hos o su i al (Lin e al., 2017). The in ec ion begins wi h he adso p ion o he phage o speci ic bac e ial ecep o s loca ed on he cell su ace and his causes he genome o he phage o be ejec ed in o he cell. The subsequen eplica ion s a egy de ines he phage as s ic ly ly ic o empe a e (Figu e 2) (Lin e al., 2017; Mon ei o e al., 2019). Figu e 2 - Bac e iophage in ec ion cycle. Adap ed om Gaydos, (2018). Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 1 – In oduc ion 8 S ic ly ly ic o i ulen phages always ollow a ly ic li e cycle in which, immedia ely a e he genome is ejec ed, he exp ession o he phage's ea ly genes edi ec s he hos 's me abolism o phage DNA eplica ion and p o ein syn hesis. Vi al p o eins a e hen assembled, and he i al genome is packaged in capsids. A he end o he ly ic cycle, he p oduc ion o la e phage p o eins, such as holins and endolysins, leads o cell lysis and elease o p ogeny phages ha will be a ailable o s a a new cycle o in ec ion (D ulis-kawa e al., 2012; Ko igh e al., 2019; Mon ei o e al., 2019). Tempe a e phages can ollow a lysogenic cycle in which hey usually in eg a e hei genome wi h he hos ch omosome, whe e hey emain quiescen , as p ophages. The p ophage eplica es wi h he bac e ial ch omosome and is subsequen ly ansmi ed by cell di ision o he daugh e cells. This quiescen s a e can be main ained o long pe iods, unless he cell is exposed o an en i onmen al s imulus ha can cause he phage o be induced in o a ly ic cycle (Da ies e al., 2016; Ko igh e al., 2019; Lin e al., 2017; Mon ei o e al., 2019). In addi ion, phages can assume a pseudolysogenic cycle, in which he phage genome is anspo ed in hos cells wi hou p opaga ion (ly ic cycle) o eplica ion wi h he cell genome (lysogenic cycle). The non-in eg a ed phage genome is inhe i ed by only one o he eme ging descenden cells. This phenomenon is appa en ly caused by un a ou able g ow h condi ions o hos cells, such as se e e hunge , and ends when hose condi ions cease; he phage hen es a s i s de elopmen h ough he ly ic o lysogenic li e cycle (Lin e al., 2017; Mon ei o e al., 2019). 1.3.2. Ad an ages and limi a ions o phages In consequence o he global sp ead o an ibio ic esis ance, phages a e becoming inc easingly a ac i e as an al e na i e he apeu ic app oach agains an ibio ic- esis an bac e ial in ec ions (Pi nay e al., 2018). Theo e ically, he e a e no bac e ia ha canno be lysed by a leas one phage. One o he mos impo an cha ac e is ics o phages is hei high speci ici y, meaning ha hey ha e he abili y o kill only he pa hogen ha hey can ecognize (P incipi e al., 2019).This high speci ici y a oids he mos impo an p oblem ela ed o he adminis a ion o an ibio ics, which is hei in luence on he en i e mic obiome wi h he elimina ion o po en ially bene icial bac e ia (Domingo-Calap & Delgado-Ma ínez, 2018; Loc- ca illo & Abedon, 2011). In addi ion o he high speci ici y, phages o e some o he impo an ad an ages o e an ibio ics. One o hem is ha hei isola ion, ypically om was ewa e and sewage, is usually ela i ely easy (al hough i depends on he hos bac e ia) (P incipi e al., 2019). Also, phages a e Chap e 2 MATERIALS AND METHODS Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 16 2. MATERIALS AND METHODS 2.1. S ains, plasmids and cul u e condi ions All he s ains, bac e iophages and plasmids used in his wo k a e lis ed in Supplemen a y ma e ial - Table S1. The clinical isola es we e p o ided by he Hospi al o B aga (Po ugal). All bac e ial s ains we e g own in Lysogeny B o h (LB) (Nzy ech) a 37 °C unde agi a ion (120 pm) o in LB aga (LBA) pla es, ob ained by adding 12 g٠L-1 o aga (Lio lchem). All media we e p epa ed acco ding o he manu ac u e 's ins uc ions and au ocla ed be o e use. Due o he acili y o be manipula ed and he high pool o ools a ailable o his o ganism, Esche ichia coli was used o cloning and he e ologous exp ession. The E. coli s ain g ow h media we e supplemen ed wi h an ibio ics o selec ion when necessa y: kanamycin (Nzy ech) a 50 µg/mL and gen amicin (Nzy ech) a 20 µg/mL, and he bac e ial g ow h was de e mined by measu ing he op ical densi y a 600nm (OD600nm) in 96-well pla es (O ange Scien i c) using a Mul iskan™ FC Mic opla e Pho ome e (The moFishe Scien i c). Chemically compe en (QC) cells we e p epa ed o he ollowing s ains: E. coli A c ic Exp ess (AE)(DE3), C43 (DE3) and BL21 (DE3). Fo his, he E. coli s ain was g own o e nigh a 37 °C, 120 pm in 10 mL o LB. This cul u e was dilu ed 1:100 in esh LB and incuba ed a 37 °C, 120 pm o 1 h 30 min. Following cen i uga ion (3300 ×g, 4 °C, 10 min), he cells we e collec ed, esuspended in hal o he ini ial olume o ice-cold 0.1 M CaCl2, and s o ed on ice o 30 min. A e a second cen i uga ion (3300 ×g, 4 °C, 10 min), he pelle was esuspended in 1/10 o he ini ial olume o ice-cold 0.1 M CaCl2. Finally, ano he cen i uga ion (3300 ×g, 4 °C, 10 min) was ca ied and he pelle esuspended in 1 mL o ice-cold 0.1 M CaCl2 and aliquo s o 50 µL we e made and s o ed a -80 °C un il use. T ans o man AE cells we e inocula ed in LB b o h supplemen ed wi h Kanamycin and gen amicin, a 16 °C, 160 pm while C43 and BL21 cells we e inocula ed in LB b o h supplemen ed only wi h kanamycin. C43 cells we e cul u ed a 21 °C and 160 pm and BL21 cells we e cul u ed on he same condi ions as AE. The cons uc ions o he ecombinan plasmids we e p edic ed using he SnapGene™ 1.1.3 e sion So wa e. All bac e ia (wi h o wi hou he co ec cons uc s) we e s o ed a -20 °C in LB b o h supplemen ed wi h 20 % glyce ol ( / ). The Saccha omyces ce e isiae BY4741 (MATa his3Δ1 leu2Δ0 me 15Δ0 u a3Δ0) and he yeas cen ome e ec o pRS415 (ATCC 87520) wi h LEU2 ma ke we e ob ained om labo a o y s ocks. S. ce e isiae BY4741 was cul u ed in YPD (1 % (w/ ) Bac o Yeas Ex ac , 2 % (w/ ) Bac o Pep one and Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 17 2 % dex ose (w/ )) o YPD aga a 30 °C. All clones (yeas ans o man s) wi h he p ope gene size we e s o ed a -20 °C in SD-Leu [0.67 % Yeas Ni ogen Base (YNB), 0.069 % CSM-Leu, 2 % dex ose] supplemen ed wi h 20 % glyce ol ( / ). 2.2. Sensi i i y es s o de ec ion o P. ae uginosa The sensi i i y o a p e iously assembled epo e phage (designa ed as PE3Δgp1–gp12:Nluc) was assessed he e o de e mine he de ec ion limi o he phage. This phage consis s in he PE3Δgp1– gp12 phage wi h he Nanoluc epo e gene, which was inse ed a e he endolysin gene. Cul u es o P. ae uginosa PAO1 g own o e nigh in LB medium we e nine- old se ially dilu ed and in ec ed wi h 105 PFU/mL o he epo e phage PE3Δgp1–gp12:Nluc. Bac e ial coun s om each dilu ion we e de e mined by pla ing on LB aga p io o in ec ion. In ec ed cul u es (50 µL) we e incuba ed a 37 °C wi h agi a ion (120 pm) and bioluminescence was quan i ied a ime 0 and e e y hou , du ing a pe iod o 7 hou s, in eppendo ubes using a Ul asensi i e Single Tube Luminome e (P omega) a e he addi ion o Nano-Glo® Luci e ase (P omega) eagen acco ding o he manu ac u e ’s ins uc ions. Figu e 3 shows he p ocedu e o he sensi i i y es s in a schema ic way. Figu e 3 - P ocedu e ollowed o he sensi i i y es s, o he de ec ion o P. ae uginosa . In non-en ichmen expe imen s, he bac e ial cul u es we e in ec ed wi h phage immedia ely a e dilu ions, and he luminescence signal (RLUs) was acked o e ime (maximum o 7 h). In en ichmen Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 18 assays, he dilu ions o he bac e ial cul u e we e incuba ed a 37°C o h ee hou s be o e being in ec ed wi h phage o 4 hou s. The me hodology was epea ed o some clinical s ains o P. ae uginosa (5, 6, 16, 21, 23, 27, A65, 065, 092 and PA14 – lis ed in Supplemen a y ma e ial - Table S1) and o clinical s ains o E. coli (A51), Klebsiella pneumoniae (A36, A57), S aphylococcus au eus (A1, A9, A39), En e ococcus aecalis (A74), and En e ococcus aecium (A78), also lis ed in Supplemen a y ma e ial - Table S1. 2.3. E alua ion o ly ic spec a and e iciency o pla ing To e alua e he ly ic spec um o phages, one d op (5 µL) o each phage sample was added o he bac e ial lawns and incuba ed o e nigh a 37 °C. The bac e ial lawns we e p epa ed by mixing 100 µL o bac e ial suspensions wi h 3-5 mL o LB so aga (LB wi h 0.6 % (w/ ) o aga ) in o a LBA pla e. A e incuba ion, he hos ange was de e mined by isualizing he p esence o lysis zones, sugges ing he phage's abili y o in ec he hos (Pi es e al., 2021; Ribei o e al., 2019). I a lysis zone was obse ed in he spo es , hen he e iciency o pla ing (EOP) o he espec i e phage was assessed by pla ing se ial dilu ions o he phage s ock on he bac e ial lawns ha p e iously showed a lysis zone. A e o e nigh incuba ion a 37 °C, he esul ing Plaque o ming uni s (PFU’s) we e coun ed. The EOP (a e age PFU on a ge bac e ia / a e age PFU on hos bac e ia) was hen de e mined (Table 17). When he a io was 0.5 o highe , meaning ha he in ec ion on he a ge bac e ia p oduced a leas 50 % o he PFU epo ed o he p ima y hos , he a e age EOP alue o a ce ain phage-bac e ium combina ion was classed as "High p oduc ion". EOP alues be ween 0.001 and 0.1 we e ca ego ized as "Low p oduc ion" e iciency, while alues g ea e han 0.1 bu less han 0.5 we e classi ied as "Medium p oduc ion" e iciency. An EOP o 0.001 o less was conside ed ine icien (Mi zaei & Nilsson, 2015). Based on he analysis o he ly ic spec a, 2 phages wi h complemen a y hos anges we e selec ed o he nex asks. 2.4. Cloning and unc ional analysis o po en ial TFPs Tail ibe p o eins iden i ied du ing he genome analysis we e selec ed based on he exis ence o homologs deposi ed in he NCBI da abase o non- edundan p o eins iden i ied h ough BLASTp and also on homologs o he p edic ed s uc u e using HHp ed. In addi ion, he p edic ed unc ional domains, he Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 19 molecula weigh , and he isoelec ic poin o he p o eins we e iden i ied and calcula ed using bioin o ma ics analysis ools (Cos a e al., 2020; San os e al., 2020). 2.4.1. Gene ampli ica ion Se en di e en genes we e selec ed (nucleo ide and amino acidic sequence o he selec ed genes a e a ailable in Supplemen a y ma e ial – Table S2). P ime s con aining speci ic es ic ion cloning si es we e designed o ampli y he genes encoding he ecombinan p o eins and o inse hem in o he pGFP plasmid. This plasmid consis s in a cons uc ion o he comme cial plasmid pET28a(+) (No agen’s), ha ca ies he T7 p omo e , a 6× His- ag N- e minal, a kanamycin esis an ma ke and a lac p omo e , wi h he syn he ic cons uc aceGFP ( Aequo a coe ulescens G een Fluo escen P o ein gene. GenBank: AY233272.1) inse ed in he mul iple cloning si e (MCS) be ween he Nde I and BamH I es ic ion enzymes si es (Figu e 4) (Cos a e al., 2020). aceGFP is a commonly used ool in molecula biology, medicine and cell biology, as i can be used as biological ma ke . Fu he mo e, usion o aceGFP o a p o ein does no usually change he unc ion o loca ion o he p o ein and combines a numbe o ad an ageous ai s, including high s abili y, minimal oxici y, and he abili y o induce luo escence when exci ed a a p ope wa eleng h, elimina ing he need o a subs a e as is necessa y o luci e ases (Schmelche & Loessne , 2014). Figu e 4 – Gene al ea u es o pGFP ec o , used o cloning and exp ession o he TFP genes. pGFP ec o con ains he same ea u es as pET28a+ (No agen) wi h he addi ion o he aceGFP gene. Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 20 The TFP genes we e inse ed be ween he Sac I and Xho I es ic ion si es since hese enzymes do no cu he TFP coding sequences as p edic ed wi h SnapGene™ 1.1.3. The use o wo di e en es ic ion enzymes was used o p e en he plasmid om eci cula ing clea age and o ensu e he inse ion o he TFP gene in he co ec di ec ion. The p ime s (Table 1) we e designed o include a he 5' end he enzyme es ic ion si es (unde lined) and some nucleo ides ha we e added o op imize enzyme ac i i y (CG epea s). SnapGene™ 1.1.3 was used o de e mine some pa ame e s as he mel ing empe a u e (Tm) and he GC con en . Table 1 - P ime s used o ampli y he TFPs encoding genes om phiIBB-PAA2 and B_PaeP_PE3 phages, he espec i e es ic ion enzyme si e used and hei pa ame e s. Tm ep esen s he mel ing empe a u e. Enzyme es ic ion si es a e unde lined Gene Sequence (5’→3’) Enzyme Tm (°C) GC con en .(%) A2gp53 Fw: GCCGCCGAGCTCATGAGTCAAAAGTACAGCCCTTCG Sac I 56 46 R : CCGCCGCTCGAGTCATGGAGTCACCACCAGGG Xho I 56 60 A2gp55 Fw: GCCGCCGAGCTCATGGGTCTTGAGGTCGCAAC Sac I 54 55 R : CCGCCGCTCGAGTCAGTTCTTAATGATGAAGAACACAG Xho I 53 35 PE3gp39 Fw: GCCGCCGAGCTCATGCTACTACTCGACGCAGTG Sac I 69 64 R : CCGCCGCTCGAGTCAGGTCCTCAAGCTGCGC Xho I 72 71 PE3gp44 Fw: GCCGCCGAGCTCGTGGCTCGGTTCAAGAATCC Sac I 54 55 R : CCGCCGCTCGAGTTATTCGTCCTCCATGGCCC Xho I 54 55 PE3gp45 Fw: GCCGCCGAGCTCATGCGCGGCATTATCGCGG Sac I 55 63 R : CCGCCGCTCGAGTTAAACATTTTTCAGCTCCGCCTG Xho I 54 42 PE3gp46 Fw: GCCGCCGAGCTCATGTTTAAGACCGAAGTAAAGGGACG Sac I 56 42 R : CCGCCGCTCGAGTTATGCCCTCGCCACCGTAAAC Xho I 57 55 PE3gp47 Fw: GCCGCCGAGCTCATGGCACTGATCTACGACTTCAAC Sac I 56 46 R : CCGCCGCTCGAGTTACATGTGCCCTCTGAATTGGAC Xho I 56 46 DNA agmen s we e ampli ied wi h Phusion™ Plus DNA Polyme ase (The moFishe Scien i ic) ha has p oo eading ac i i y in o de o educe he inse ion o inco ec nucleo ides, using phage phiIBB- PAA2 (sho name A2) as empla e DNA o genes 53 and 55, and phage B_PaeP_PE3 (sho name PE3) as empla e DNA o genes 39, 44, 45, 46 and 47. The PCR mix componen s we e adjus ed Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 21 acco ding o he manu ac u e 's ins uc ions (Table 2) and he PCR ampli ica ion was pe o med on a T100™ The mal Cycle (BioRad). Table 2 - Componen s and quan i ies used o PCR wi h Phusion™ Plus DNA Polyme ase Componen s Concen a ion Phusion Plus DNA Polyme ase 0.02 U/µL 5× Phusion Plus Bu e 1× dNTP mix (10mM) 200 µM P ime s 0.5 µM Templa e DNA 0.9 ng/µL Wa e , nuclease ee o 50 µL The he mocycling condi ions o he PCR a e shown in Table 3. Table 3 - The mocycling condi ions o a ou ine PCR wi h Phusion™ Plus DNA Polyme ase S ep Tempe a u e Time Ini ial Dena u a ion 98 °C 5 min 25-35 Cycles 98 °C 10 sec 55 °C o 60 °C 10 sec 72 °C 15-30 sec/Kb Final Ex ension 72 °C 5 min Hold 12 °C Con i ma ion o PCR p oduc s was pe o med h ough aga ose gel elec opho esis. The gels con ained 1 % (w/ ) aga ose (Nzy ech) dissol ed in 1× TAE bu e (1 mM e hylenediamine e aace ic acid (EDTA); 40 mM T is base; 20 mM ace ic acid) and we e s ained wi h G eenSa e P emium (Nzy ech). The 1 Kb GRS Ladde DNA (G isp) was used as a ma ke . Elec opho esis was pe o med in 1× TAE bu e a 100 V o 40 min in a Pe ec Blue gel sys em (VWR) and he gels we e isualized using a ChemiDoc™ XRS (BioRad) equipmen wi h Image Lab™ 5.1 so wa e (BioRad). Then, he PCR p oduc s we e pu i ied using he DNA Clean and Concen a o ki (Zymo Resea ch) and he DNA concen a ion o he ampli ied Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 22 agmen s was de e mined using he NanoD op™ One Mic o olume UV-Vis Spec opho ome e (The moFishe Scien i ic). 2.4.2. Cloning Plasmid and PCR p oduc s we e diges ed wi h wo Fas Diges Res ic ion Enzymes Sac I and Xho I (The moFishe Scien i ic), c ea ing s icky ends complemen a y be ween he ec o and he inse . The eac ion componen s we e adjus ed acco ding o he manu ac u e 's ins uc ions and a e shown in Table 4. Diges ions we e pe o med a 37 °C o 2 h and inac i a ed in a Hea Block (VWR) a 82 °C o 6 min. Table 4 - Reac ion componen s and olumes o concen a ions used o diges he a ge genes Componen s Volume 10× FD Bu e 2 µL DNA inse o DNA plasmid 200 ng o 1000 ng SacI FD 1 µL XhoI FD 1 µL Wa e , nuclease ee o 20 µL Diges ed p oduc s we e cleaned wi h he DNA Clean and Concen a o Ki (Zymo Resea ch) acco ding o he manu ac u e ’s ins uc ions and DNA concen a ion de e mined using he NanoD op™ One Mic o olume UV-Vis Spec opho ome e (The moFishe Scien i ic). A e diges ion, he genes we e inse ed in o pGFP ( o use hem wi h he ups eam aceGFP) using he T4 DNA Ligase (The moFishe Scien i ic), acco ding o he manu ac u e 's ins uc ions (Table 5), o liga e DNA agmen s wi h cohesi e ends, ob aining di e en cons uc s. The liga ion mix u e was incuba ed a oom empe a u e o 2 h and he eac ion s opped by a subsequen incuba ion a 72 °C o 6 min. To educe backg ound (non-diges ed pGFP), a subsequen diges ion s ep was pe o med wi h 0.5 µL o Sal I (The moFishe Scien i ic) and 1 µL o he espec i e bu e (The moFishe Scien i ic), ollowed by incuba ion a 37 °C o 45 min. The Sal I enzyme was u he inac i a ed a 80 °C o 5 min. Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 23 Table 5 - Reac ion componen s, olumes o inal concen a ions o he liga ion o he a ge genes Componen s Volume Linea ec o DNA (plasmid) 20-100 ng Inse DNA (gene) 1:1 o 5:1 mola a io o e ec o 10× T4 DNA Ligase Bu e 2 µL T4 DNA Ligase 1 Weiss U Wa e , nuclease ee o 20 µL The p ime design, gene ampli ica ions, diges ions and liga ions we e all simula ed in silico using he SnapGene™ 1.1.3 e sion So wa e. The ecombinan plasmids pGFP_A2gp53, pGFP_A2gp55, pGFP_PE3gp39, pGFP_PE3gp44, pGFP_PE3gp45, pGFP_PE3gp46 and pGFP_PE3gp47 consis in he inse ion o he pu a i e TFP encoding genes gp53 and gp55 , om phiIBB-PAA2 phage, and gp 39, gp 44, gp 45 , gp 46 and gp 47, om B_PaeP_PE3 phage, in he pGFP plasmid. These plasmids we e ans o med in o compe en E. coli AE (DE3) cells by hea shock. B ie ly, o he ans o ma ion o he plasmids, 5 µL o liga ion was mixed gen ly wi h an aliquo o chemically compe en cells. A e 20-30 min on ice, a hea shock was pe o med: 50 sec a 42 °C and 2 min on ice. Then, 300 µL o SOC (Supe Op imal b o h wi h Ca aboli e ep ession) was added o he ube and he cells we e allowed o eco e o 1 h 30 min a 37 °C. Then, he suspension was sp ead on LB aga pe i dishes con aining kanamycin (50 µg/mL) and gen amicin (20 µg/mL) o QC AE (DE3) cells. The pla es we e incuba ed o e nigh a 37 °C and checked o he p esence o ans o med colonies. The esul ing ans o med colonies we e subjec ed o colony PCR o assess co ec assembly (cells ha inco po a ed he ecombinan ec o ) be o e he con i ma ion by Sange sequencing. Colonies we e andomly selec ed and esuspended in 25 µL o LB b o h wi h he co esponding an ibio ic(s) o be used as a empla e in he PCR eac ion. The PCR eac ion was pe o med using he Xpe Fas Ho s a Mas e mix (2×) (G isp) whe e he T7 p ime s we e added and he eac ion was adjus ed acco ding o he manu ac u e 's ecommenda ions (Table 6). Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 24 Table 6 - PCR mix componen s and hei inal concen a ions o colony PCR Componen s Concen a ion Xpe Fas Ho s a Mas e mix (2×) wi h dye (G isp) 1× T7 Fo wa d p ime 0.4 µM T7 Re e se p ime 0.4 µM Templa e DNA 1-250 ng Wa e , nuclease ee o 6 µL T7 Mas e mix (2×) wi h dye (G isp) consis s on he Xpe Fas Ho s a , supplied as a con enien 2× mas e mix and which includes an elec opho esis ine acking dye, con aining all componen s necessa y o as PCR and he T7 o wa d and e e se p ime s (speci ic o he pGFP plasmid, showed on Table 7). Table 7 - P ime s used o colony PCR and hei pa ame e s. Tm ep esen s he mel ing empe a u e P ime Sequence (5’→3’) Size (bp) Tm (ºC) GC con en (%) T7 o wa d TAATACGACTCACTATAGGG 20 47.7 40 T7 e e se GCTAGTTATTGCTCAGCGG 19 51.1 53 PCR ampli ica ion was pe o med in a DNA he mocycle (T100™ The mal Cycle (BioRad)) and he PCR p o ocol is desc ibed in Table 8. Table 8 - The mocycling condi ions o a colony PCR S ep Tempe a u e Time Ini ial Dena u a ion 95 °C 5 min 35 Cycles 95 °C 15 sec 49 °C 15 sec 72 °C 30 sec Final Ex ension 72 °C 5 min Hold 12 °C Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 31 Li hium Ace a e, and 50 µL 2 mg/mL salmon spe m DNA). A e 45 min o incuba ion a 42 °C, he mix u e was cen i uged (13000 ×g, RT, 30 sec), esuspended in 1 mL o YPD and incuba ed a 30 °C o 2-3 hou s wi h 120 pm o agi a ion. The yeas ans o man s we e hen selec ed on syn he ic de ined medium wi h leucine d opou (SD-Leu) [0.67 % Yeas Ni ogen Base (YNB), 0.069 % CSM-Leu, 2 % dex ose] aga pla es incuba ed a 30 °C o 3 days. A e , yeas colony PCR was pe o med o con i m he co ec assembly o he agmen s. Fo his, andomly chosen colonies we e esuspended in 10 µL o 0.02 M NaOH and hea ed a 99 °C o 10 min. The supe na an was hen used as empla e o he PCR eac ion wi h D eamTaq™ DNA polyme ase (The moFishe Scien i ic) ollowing he manu ac u e 's ins uc ions (Table 14). The p ime s used in yeas colony PCR o bo h ans o ma ions a e lis ed in Table 15 and he PCR condi ions a e de ailed in Table 16. All he PCR eac ions we e ca ied ou in a DNA he mocycle (T100™ The mal Cycle (BioRad)). Table 14 - PCR mix componen s and concen a ions o yeas colony PCR Componen s Concen a ion D eamTaq™ G een PCR Mas e Mix (2×) 25 µL Fo wa d p ime 0.5 µM Re e se p ime 0.5 µM Templa e DNA 3 µL Wa e , nuclease ee o 50 µL Table 15 – P ime s used in yeas colony PCR and hei pa ame e s. Tm ep esen s he mel ing empe a u e P ime Sequence (5’→3’) Tm (°C) GC con en .(%) P15 Fw: GCACCTTCCGGCTGATCC 59 67 P16 R : GCAGAAGTCCAGCACGTCG 59 63 Table 16 - The mocycling condi ions o a yeas colony PCR S ep Tempe a u e Time Ini ial Dena u a ion 95 °C 3 min 30 Cycles 95 °C 30 sec Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 32 55 °C 30 sec 72 °C 1 min/Kb Final Ex ension 72 °C 10 min Hold 4 °C The PCR p oduc s om yeas colony PCRs we e un on a 1 % (w/ ) aga ose gel. The posi i e ans o man s ha showed he co ec assembly we e inocula ed in SD-Leu liquid medium o 24 h a 30 °C. Then, he YAC-Phage DNA was ex ac ed om yeas cells using he QIAp ep Spin Minip ep Ki (Qiagen) combined wi h zymolyase® 20T (G isp) ollowing a p e iously desc ibed p o ocol (Ando e al., 2015) and he DNA concen a ion was de e mined using he NanoD op™ One Mic o olume UV-Vis Spec opho ome e (The moFishe Scien i ic). 2.5.3. T ans o ma ion o cap u ed phage genome in o P. ae uginosa cells The p epa a ion o elec ocompe en P. ae uginosa PAO1 cells was pe o med acco ding o a me hod p e iously desc ibed by Choi e al., (2006) wi h mino modi ica ions. B ie ly, 6 mL o an o e nigh - g own cul u e we e dis ibu ed by 4 mic ocen i uge ubes and cen i uged (16000 ×g, RT, 1 min). Each pelle was hen washed wice wi h 1 mL o 300 mM suc ose. Fo each ans o ma ion, he 4 bac e ial pelle s we e esuspended in a o al o 100 µL o 300 mM suc ose and mixed wi h he ex ac ed DNA (YAC-phage DNA) (Pi es e al., 2021). This mix u e was hen ans e ed in o a 2 mm gap elec opo a ion cu e e, a pulse (25 µF, 200 Ω, 2.5 kV) was applied using an E. coli Pulse ™ T ans o ma ion Appa a us (BioRad) and 900 µL o LB medium was added o eco e he cells. Be o e pe o ming plaque o ma ion expe imen s, he cellula suspension was ans e ed o a ube and incuba ed a 37 °C o 2-4 hou s wi h 120 pm o agi a ion (Pi es e al., 2021). Abou 300 µL o he cellula suspension p oduced by YAC-phage DNA elec opo a ion we e combined wi h 3 mL o LB so aga and pla ed in LBA pla e in o de o eco e he chime ic phages. The pla es we e examined o see i any phage plaques we e p esen a e o e nigh incuba ion a 37 °C (Pi es e al., 2021). Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 2 – Ma e ials and Me hods 33 2.5.4. Phage p oduc ion and sequencing When phage plaques we e eco e ed a e he elec opo a ion o he YAC-phage DNA, he ecombinan phages we e hen p opaga ed o high i e s. B ie ly, a single phage plaque was picked and elu ed in 50 µL o SM bu e . Then, his solu ion was used o in ec 15 mL o a P. ae uginosa PAO1 log- phase cul u e. A e incuba ion o 8 h a 37 °C, his suspension was cen i uged (9000 ×g, 4 °C, 10 min) and he supe na an was collec ed, il e ed (0.22 µm) and kep a 4 °C un il u he use (Pi es e al., 2017). Finally, he phage i e was e alua ed by PFU’s coun ing. The phage s ock solu ion was se ially dilu ed in SM bu e and 10 µL o each dilu ion we e pla ed in o he bac e ial lawns. The pla es we e incuba ed o e nigh a 37 °C and he PFU’s we e hen coun ed. The co ec inse ion o he gene encoding he TFP on he chime ic phages was con i med by PCR, wi h he p ime s used on yeas colony PCR and a e p oduc cleaning, by Sange sequencing. 2.5.5. Hos - ange o he chime ic phages The hos - ange o he chime ic phages was e alua ed agains he clinical s ains o P. ae uginosa o compa e o he wild- ype phage. This was pe o med as desc ibed in sec ion 2.3. In he cases whe e lysis was seen, phage suspensions we e se ially dilu ed and he dilu ions we e pla ed on he bac e ial lawns o look o po en ial cases o lysis om wi hou . Chap e 3 RESULTS AND DISCUSSION Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 35 3. RESULTS AND DISCUSSION 3.1. Fas and sensi i e de ec ion o P. ae uginosa using epo e phages Rapid and sensi i e me hods a e highly needed o he speci ic de ec ion o P. ae uginosa, namely in clinical se ings. An accu a e iden i ica ion o he pa hogen allows a apid implemen a ion o he app op ia e ea men , educing he se e i y o in ec ion and also he associa ed cos s. The PE3Δgp1– gp12:Nluc epo e phage ca ying he Nluc gene was p e iously assembled using he yeas -based phage- enginee ing pla o m a he esea ch g oup and he e, his phage was explo ed o assess i s sensi i i y and speci ici y o de ec P. ae uginosa cells and e alua e he de ec ion limi . The sensi i i y o his epo e phage sys em was quan i ied by in ec ing se ial dilu ions o hos cells wi h he phage a 105 PFU/mL and quan i ying he ligh -emi ing RLUs (Rela i e ligh uni s) o 7 h. Figu e 6 shows he dispe sion g aph e e ing o he RLUs o e ime, o assays wi hou en ichmen . Figu e 6 - Rela i e ligh uni s (RLUs) o e ime, wi hou sample en ichmen . E o ba s ep esen s anda d de ia ions om 3 independen expe imen s. The ba g aph e e ing o he RLUs o e ime, o assays wi hou en ichmen , is ep esen ed in Figu e 7. 200 2000 20000 200000 2000000 20000000 200000000 012345678 Rela i e Ligh Uni s (RLUs) Time (h) 5.4x10^9 CFU/mL PAO1 (PAO1 only) PE3Δgp1–gp12:Nluc (phage only) 5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 36 Figu e 7 - G aphic ep esen a ion o ba s co esponding o di e en concen a ions o bac e ia in ec ed wi h he epo e phage, wi hou sample en ichmen , o ela i e ligh uni s a ime 0 h and 7 h. E o ba s ep esen s anda d de ia ions om 3 independen expe imen s. Acco ding o he esul s om Figu e 7, he de ec ion limi o phage PE3Δgp1–gp12:Nluc was 5.4×102 CFU/mL bu o y o imp o e his limi o de ec ion, an addi ional es was ca ied ou . P. ae uginosa PAO1 was en iched be o e phage addi ion by incuba ing he bac e ial dilu ions a 37 ºC o 3 h. A e adding he phage, he in ec ion was acked o 4 h in o de o keep he o al ime o he expe imen 7 h, simila ly o he assays wi hou en ichmen . The esul s ob ained o he dispe sion g aph e e ing o he RLUs o e ime, o assays wi h en ichmen a e ep esen ed in Figu e 8. Figu e 8 - Rela i e ligh uni s (RLUs) o e ime, wi h sample en ichmen . E o ba s ep esen s anda d de ia ions om 3 independen expe imen s. 200 2000 20000 200000 2000000 20000000 200000000 0 7 Rela i e Ligh Uni s (RLUs) Time (h) 5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 200 2000 20000 200000 2000000 20000000 200000000 0 1 2 3 4 5 Rela i e Ligh Uni s (RLUs) Time (h) 5.4x10^9 CFU/mL PAO1 (PAO1 only) PE3Δgp1–gp12:Nluc (phage only) 5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 37 The ba g aph e e ing o he RLUs o e ime, o assays wi h en ichmen , is ep esen ed in Figu e 9. Figu e 9 - G aphic ep esen a ion o ba s, co esponding o di e en concen a ions o bac e ia in ec ed wi h he epo e phage, wi h en ichmen , o ela i e ligh uni s o e ime. E o ba s ep esen s anda d de ia ions om 3 independen expe imen s. The de ec ion limi is de ined as he minimum numbe o bac e ia needed o p oduce a signal ha is dis inguishable om he backg ound. The minimum CFU numbe de ec able by he PE3Δgp1– gp12:Nluc phage was 540 pe mL o bo h expe imen s (wi h and wi hou en ichmen ). Al hough he en ichmen s ep o 3 h led o a highe luminescence signal wi hou comp omising he o al ime o he me hod, he limi o de ec ion was he same and hus, his s ep can be skipped as he p o ocol wi hou en ichmen is simple and easie o pe o m. Based on his, all he subsequen expe imen s we e pe o med wi hou he en ichmen s ep. De ec ion assays wi h he epo e phage we e op imized and epea ed in iplica e o he hos s ain PAO1 and he esul s measu ed a e 7 h a e ep esen ed in Figu e 10. 200 2000 20000 200000 2000000 20000000 200000000 0 4 Rela i e Ligh Uni s (RLUs) Time (h) 5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 38 Figu e 10 - Bioluminescence ou pu (RLUs) o se ial dilu ions o hos s ain in ec ed wi h he epo e phage PE3gp1-gp12:Nluc wi h 105 PFU/mL and espec i e con ols. E o ba s ep esen s anda d de ia ions om 3 independen expe imen s. Acco ding o Figu e 10, i is possible o obse e ha he PE3Δgp1–gp12:Nluc epo e phage eliably de ec s 620 CFU/mL o he hos s ain. This was accomplished wi hin 7 hou s, which is 41 hou s less ime han he con en ional selec i e pla ing echniques (T ampe -s ande s e al., 2005). Cu en ly, epo e phages a e mos ly ocused on he ood indus y. To build a epo e phage o he de ec ion and di e en ia ion o li e Lis e ia cells, which cause a se ious oodbo ne illness, Meile e al., (2020) used CRISPR-Cas-assis ed phage edi ing. In less han 24 hou s, he NLuc-based phage, A511::nlucCPS, can iden i y one CFU o L. monocy ogenes in 25 g o a i icially con amina ed milk, cold cu s, and le uce. Mo e ecen ly, E ickson e al., (2021) used homologous ecombina ion o c ea e a ecombinan o m o LPJP1 ha encodes he NanoLuc luci e ase. Wi hin ou hou s, his luci e ase epo e phage de ec ed 100 s a iona y phase colony o ming uni s o bo h L. g ayi subspecies. Hinkley e al., (2018) gene ically al e ed a T7 coliphage o exp ess NanoLuc using homologous ecombina ion and he use o mic oc ys alline cellulose o concen a e he usion epo e was hen shown o enable he de ec ion o a maximum o 10 CFU/mL E. coli wi hin h ee hou s. Also, he limi o de ec ion o he epo e phages c ea ed by Nguyen e al., (2020) using homologous ecombina ion was 10-100 CFU pe mL in Salmonella cul u e wi hin wo hou s. In ood ma ix es s, a combina ion o enginee ed phages success ully iden i ied 1 CFU in ei he 100 g o powde ed in an o mula wi h a 16 h en ichmen o 25 g o g ound u key wi h a 7 h en ichmen . 100 1000 10000 100000 1000000 10000000 100000000 1000000000 0 7 Rela i e Ligh Uni s (RLUs) Time (h) Wi hou En ichmen 6,2x10^9 CFU/mL PAO1 (PAO1 only) PE3Δgp1–gp12:Nluc (phage only) 6,2x10^8 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^7 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^6 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^5 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 39 He e, as he phage is speci ic o P. ae uginosa species, clinical isola es known o be sensi i e o phage PE3Δgp1–gp12:Nluc we e also es ed (s ains 5, 6, 16, 21, 23, 27 A65, 065 and 092) o assess he de ec ion limi in o he bac e ial s ains a he han he hos . Beyond ha , he me hodology was also epea ed o clinical s ains o E. coli (A51), Klebsiella pneumoniae (A36 and A57), S aphylococcus au eus (A1, A9 and A39), En e ococcus aecalis , En e ococcus aecium (A74 and A78 espec i ely) and P. ae uginosa PA14. The Figu e 11 shows he RLUs emi ed a e se en hou s o phage in ec ion o each bac e ial s ain abo e men ioned. Figu e 11 - Bioluminescence ou pu (RLUs) o di e en clinical s ains in ec ed wi h PE3Δgp1-gp12:Nluc phage (105 PFU/mL) o 7 h . (A) P. ae uginosa s ains ha a e sensi i e o phage; (B) clinical s ains ha a e no in ec ed by he phage (chosen as nega i e con ols). As obse ed in Figu e 11 (A), phage PE3Δgp1-gp12:Nluc was unable o de ec i e (16, 23, 27, 065 and 092) ou o he nine clinical s ains o P. ae uginosa . All hese 9 s ains a e sensi i e o he phage, which was obse ed hough de e mina ion o he ly ic spec a and EOP (Table 17). This is unexpec ed, acco ding o EOP esul s mos phage—bac e ium combina ion was classi ied as a medium p oduc ion and he e o e, all s ains we e supposed o be de ec ed. Since his phage is speci ic o P. ae uginosa , as expec ed, all o he species es ed did no show any luminescence, and in his case he e we e no alse posi i es, as can be seen in Figu e 11 (B). Among he 4 clinical s ains ha he epo e phage was capable o de ec , he de ec ion limi is ep esen ed in Figu e 12. Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 40 Figu e 12 – Concen a ion (CFU/mL) o a i icially in ec ed samples. Samples we e incuba ed wi h 105 PFU/mL o PE3gp1-gp12:Nluc phage. The minimum CFU numbe de ec able by he PE3Δgp1–gp12:Nluc phage o hose s ains is in he ange o 103 CFU pe mL, which is app oxima ely en imes highe han he minimum concen a ion ob ained o he hos s ain PAO1. I would be in e es ing o es he phage in mo e clinical s ains a he han jus a ew, as his se e ely es ic s he abili y o make eliable conclusions abou his echnique. The subsequen s age will also in ol e unning hese de ec ion assays in eal samples om pa ien s like blood, u ine, o o he luids. In conclusion, he P. ae uginosa epo e phage was capable o eliably de ec 620 CFU in 1 mL o samples con amina ed wi h PAO1 in less han 8 h, hus o e coming he majo limi a ion o he cu en ly used de ec ion me hods, which is ime-consuming. On he o he hand, his echnique was no capable o de ec ing all he s ains known o be sensi i e o he phage, which is an issue. This implies, and hence suppo s, he equi emen o phage-enginee ing wo k o expand he hos ange o he phage and a possible app oach may be he cloning o addi ional TFPs om o he phages wi h complemen a y hos anges. 3.2. De e mina ion o he hos ange and e iciency o pla ing Se en phages (PE1, A2, DP1, PA14G, PA14-20, PE3 and PE3Δgp1–gp12:Nluc) we e es ed agains a panel o 52 P. ae uginosa clinical s ains by spo es in o de o e alua e he ly ic spec a o each phage. Table 17 shows he hos ange o each phage, whe e LFW means lysis om wi hou . This is 1,00E+02 1,00E+03 1,00E+04 1,00E+05 1,00E+06 1,00E+07 1,00E+08 1,00E+09 Concen a ion o he in ec ed s ain (CFU/mL) Limi o phage de ec ion in clinical s ains o P. ae uginosa, o an in ec ion pe iod o 7 h S ain 5 S ain 6 S ain 21 S ain A65 Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 47 The esul s ob ained om he SDS-PAGE gel a e shown in Figu e 17. Figu e 17 - SDS-PAGE wi h esul s o he pu i ied p o eins, exp essed in AE cells. (1) pGFP_PE3gp39 1s elu ion, (2) pGFP_PE3gp39 pelle , (3) pGFP_PE3gp44 1s elu ion, (4) pGFP_PE3gp44 pelle , (5) pGFP_PE3gp45 1s elu ion, (6) pGFP_PE3gp45 pelle , (7) pGFP_PE3gp46 1s elu ion, (8) pGFP_PE3gp46 pelle , (9) pGFP_PE3gp47 1s elu ion, (10) pGFP_PE3gp47 pelle , (11) pGFP_A2gp53 1s elu ion, (12) pGFP_A2gp53 pelle , (L1) NZYColou P o ein Ma ke II (Nzy ech), (13) pGFP_A2gp55 1s elu ion and (L2) PageRule ™ B oad Range Uns ained P o ein Ladde The molecula weigh is exp essed in KDa. In addi ion o TFP exp ession by SDS-PAGE, he exp ession was also de ec able by he colou o he cul u es a e exp ession, which showed s ong g een s aining due o he p esence o he aceGFP usion p o ein. All he p o eins ans o med in AE (DE3) cells we e shown o ha e he expec ed size bu he pGFP_PE3gp46 p o ein showed a la ge band close o 27 KDa, co esponding o aceGFP exp ession. This may indica e ha some p ocessing o he ecombinan p o ein may ha e occu ed, wi h clea age o he used p o ein. In cases whe e a s onge band appea s in he pelle o he pu i ied p o ein, a solubiliza ion o he pelle was pe o med o u he analysis. The p esence o insoluble p o ein is ypically caused by imp ope p o ein olding, which causes he p o ein o become inac i e and exp essed in inclusion bodies (Agilen Technologies, 2015). The pelle ed p o ein was washed using a bu e con aining he su ac an T i on X-100 and hen p o ein was solubilized using u ea. Al hough i was possible o solubilize he p o eins, on he day a e , he p o ein los s abili y and p ecipi a ed again. Then, a unc ional analysis o he TFPs was pe o med by epi luo escence. The amoun o p o ein elu ion o be used in each eac ion was es ima ed h ough he in ensi y o he colou (g een) o he elu ion and he esul s o SDS-PAGE analysis o he exp ession. A e obse a ion unde he mic oscope, p o ein pGFP_A2gp55 was he only one ha demons a ed binding abili y o P. ae uginosa PAO1 cells (Figu e 18). Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 48 pGFP_PE3gp45 pGFP_PE3gp55 Figu e 18 - Fluo escence mic oscopy assays o p o ein unc ion analysis. On he i s ow, i is possible o obse e he images wi hou a il e and in he second, wi h he FITC il e , sensi i e o g een luo escence. A nega i e example is shown in he i s column, such as he pGFP_PE3gp45 p o ein and in he second column he only exp essed p o ein ha was able o bind P. ae uginosa PAO1, pGFP_PE3gp55. E en hough he emaining p o eins we e well exp essed and showed a g een, luo escen colou , hey we e no able o bind o bac e ial cells. A e ha , he exp ession o he p o eins was epea ed in di e en cells. E. coli C43 (DE3) con ains gene ic mu a ions ha educes he ac i i y o T7 RNA Polyme ase, hus p e en ing cell dea h by o e exp ession o ecombinan oxic p o ein (Lucigen Co po a ion, 2018) and he E. coli BL21 (DE3) con ains se e al gene ic mu a ions and is widely used in o de o ob ain high yields o p o ein p oduc ion. Howe e , despi e being well exp essed, none o hem showed binding capaci y o P. ae uginosa PAO1, besides pGFP_A2gp55 p o ein. The e a e di e en easons o explain ha . An inco ec olding o he p o ein may esul in an inadequa e exposu e o he p o ein domain esponsible o hos ecogni ion o e en in a non- unc ional ecep o binding p o ein. Mo eo e , i is possible ha hese p o eins equi e he p esence o o he phage p o eins o acqui e he unc ional s uc u e (usually ime iza ion) (No h e al., 2019). Ano he hypo hesis is ha he p o eins unde s udy a e no uly hos ecogni ion o binding p o eins, e en knowing ha hey a e homolog o o he iden i ied ecep o binding p o eins in he NCBI da abase. The ac is ha he majo i y o anno a ed phage ecep o binding p o eins deposi ed in he NCBI da abase we e no alida ed Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 49 h ough unc ional assays and hus, hey migh no be able o ecognize and bind o he phage bac e ial hos s, leading o an e oneous selec ion o ecep o binding p o eins. Conside ing he expe imen ally alida ed abili y o pGFP_A2gp55 o bind PAO1 cells, homologous p o eins we e sea ched o cloning wi h he in en ion o pe o ming a gene exchange be ween phages A2 and PE3, bu none i was ound. This impai ed swapping homologous genes, bu s ill enabled he addi ion o his p o ein o phage PE3 in o de o exp ess an addi ional ecep o binding p o ein ha could expand i s hos ange. 3.4. Expanding he hos ange o P. ae uginosa phages by genome enginee ing Acco ding o he luo escence mic oscopy assays, only pGFP_A2gp55 p o ein was binding o he hos cells, which co esponds o gp 55 om A2 phage. The e o e, his gene was selec ed o be cloned be ween gp 46 and gp 47 genes om PE3 phage ha also encode TFPs. Since he addi ion o new genes may equi e ex a space in phage genomes, he phage PE3Δgp1–gp12 was used he e as empla e o he in oduc ion o he new gene as his phage is a a ian o phage PE3 wi h a educed genome and was p e iously shown o be unc ional and o ha e simila e icacy agains he hos cells (Pi es e al., 2021). The assembly o he new chime ic phage was accomplished using he yeas -based phage- enginee ing pla o m, which has been al eady used o e icien ly manipula e he genomes o E. coli , Klebsiella and P. ae uginosa phages (Ando e al., 2015; Pi es e al., 2021). In S. ce e isiae , homologous ecombina ion is pa icula ly e ec i e due o he na i e gap epai sys em ha acili a es he assembly o DNA agmen s ha sha e sho homology egions, and phage genomes may be kep s able and a e no haza dous o yeas . Since his me hod in ol es emo ing he phage genome om yeas and in oducing i in o he bac e ial hos o gene a e unc ional phage pa icles, i s e icacy is cons ained by he a e a which bac e ia may unde go ans o ma ion (Pi es e al., 2016). In his wo k, 2 di e en cons uc s we e ied: i) cloning o TFP in phage PE3Δgp1–gp12 wi hou Nluc gene ( ans o ma ion 1 - T1); and ii) cloning o TFP in phage PE3Δgp1–gp12:Nluc ( ans o ma ion 2 - T2). To assemble he chime ic phages, he en i e phage genome o PE3Δgp1–gp12 phage was ampli ied by PCR in o e lapping agmen s using speci ic se s o p ime s (Table 10). Fo each ans o ma ion, se en PCR p oduc s spanning he phage genome, he gene gp55 om phage A2 o be cloned and he linea ized YAC ca ying homologous “a ms” wi h he ex emi ies o phage genome we e Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 50 ans o med in o yeas cells whe e he ecombina ion occu s because o he gap epai sys em ha connec s each agmen o he subsequen , esul ing in a ull phage genome cap u ed in he YAC.The PCR ampli ica ion o all he DNA agmen s was con i med on a 1 % (w/ ) aga ose gel and he esul s a e shown in Figu e 19. Figu e 19 - Gel elec opho esis wi h esul s o he PCR ampli ica ion o each agmen . (YAC) annealing empe a u e: 65 °C; (F1) annealing empe a u e: 60 °C; (F2) annealing empe a u e: 60 °C; (F3) annealing empe a u e: 60 °C; (F4) annealing empe a u e: 60 °C; (F5) annealing empe a u e: 60 °C; (F6) annealing empe a u e: 65 °C; (F7) annealing empe a u e: 65 °C and (L) 1 Kb GRS Ladde DNA (G isp). The sequence leng h is exp essed in bp. As obse ed in Figu e 19, all he PCR p oduc s ha e he expec ed sizes o be used in he yeas ans o ma ion. A e ans o ma ion, i was possible o eco e se e al ans o man s o each ans o ma ion (T1 and T2) a e pla ing on selec i e media, while no colonies we e obse ed o he nega i e con ol ( ans o ma ion only wi h he linea ized YAC). To assess i he phage genomes we e co ec ly assembled in he YAC, he yeas ans o man s we e sc eened by yeas colony PCR using a se o p ime s placed ups eam and downs eam o he gene inse ion si es (Table 15). The p oduc s o each yeas colony PCR we e isualized on a 1 % (w/ ) elec opho esis aga ose gel, as shown in Figu e 20. Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 51 Figu e 20 - Gel elec opho esis showing he ampli ica ion o one co ec ans o man o each yeas ans o ma ion. (C) con ol – o iginal sequence, and (L) 1 Kb GRS Ladde DNA (G isp). The DNA sizes p esen ed include he size o he o iginal sequence plus an addi ional 648 bp co esponden o he ampli ica ion o he gp 55 om A2 phage. Figu e 20 shows bands wi h he expec ed sizes o ampli ica ion o each ans o ma ion (T1: 1108 bp; T2 1108 bp; Con ol: 460 bp), which con i ms ha gp55 om phage A2 was success ully cloned in o PE3Δgp1–gp12 phage o T1 and PE3Δgp1–gp12:Nluc phage o T2. These posi i e yeas clones we e hen used o yeas DNA ex ac ion in o de o eco e he YAC-phage DNA. A e DNA ex ac ion om yeas cells, 500 ng o he cons uc s (YAC-phage DNA) we e ans o med in o he P. ae uginosa PAO1 hos , which allows phage genes o be ansc ibed and p oduce unc ional phages in case he gene inse ion does no al e he iabili y o he phage. In his s ep, he ans o ma ion was ia elec opo a ion due o he supe io e icacy compa ed o he hea -shock app oach (Yoshida & Sa o, 2009). In ac , phage plaques we e obse ed a e pla ing, bu only o T2 e en a e h ee a emp s. In o de o eco e plaques om T1, i would p obably be essen ial o do some op imiza ions o he DNA concen a ion o be elec opo a ed o incuba ion ime a e elec opo a ion. Since phage plaques we e ob ained o T2, he wo k p oceeded wi h his newly enginee ed phage as his was he phage al eady ca ying he Nluc gene ha can be used o de ec ion. The esul ing phage plaques ob ained om elec opo a ion we e picked and he ecombinan phage was p oduced and checked by PCR using he se o p ime s desc ibed abo e. The elec opho esis gel and he Sange sequencing e ealed ha he Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 52 inse ion o he TFP om phage A2 in o he genome o phage PE3Δgp1–gp12 was success ully done (Figu e 21). Figu e 21 – Wild- ype phage e sus chime ic phage. (1) PE3 phage; (2) PCR-based con i ma ion o he inse ion o A2 gp 55 in he genome o phage PE3Δgp1–gp12:Nluc and (L) 1 Kb GRS Ladde DNA (G isp). The sequence leng h is exp essed in bp. A e p opaga ion o ecombinan phage and con i ma ion o he co ec assembly, a new analysis o he hos ange was pe o med o unde s and i he addi ion o a new TFP did ac ually esul in he abili y o he enginee ed phage o a ge a wide ange o s ains compa ed o wild- ype phage. This would be a g ea ad an age as cu en ly, he mos popula me hod o achie ing a wide hos ange is he combina ion o mul iple phages wi h a ious hos anges in o a single cock ail, which is always a ime- consuming p ocess. The hos ange o he ou phages A2, PE3 WT, PE3Δgp1–gp12:Nluc and T2 we e es ed agains a panel o 52 P. ae uginosa clinical s ains by spo es . Table 18 shows he esul s o he ly ic spec a. Table 18 - EOP o he A2, PE3 WT, PE3Δgp1–gp12:Nluc and ecombinan T2 phages agains di e en s ains o P. ae uginosa Phage S ain A2 PE3 PE3Δgp1 – gp12:Nluc T2 1 0.5 - - LFW 2 - - - - Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 53 3 <0.001 - - - 4 LFW - - LFW 5 0.4 0.3 0.4 0.1 6 0.4 0.6 0.4 0.004 7 <0.001 - - - 8 LFW LFW LFW LFW 9 LFW - - LFW 10 - - - - 11 - 0.3 LFW LFW 12 LFW 0.3 LFW LFW 14 - - - - 15 LFW - - - 16 0.1 0.3 0.4 LFW 17 - 0.1 LFW LFW 18 0.005 - - LFW 19 - - - - 20 0.006 LFW - LFW 21 0.4 0.3 0.004 0.005 22 0.1 - - LFW 23 LFW 0.3 0.8 <0.001 24 - - - - 25 0.5 - - LFW 26 - LFW LFW LFW 27 0.1 0.4 LFW LFW 28 0.2 <0.001 LFW LFW 29 0.1 LFW LFW LFW A22 0.2 LFW LFW LFW A63 - - - - A64 LFW LFW LFW LFW Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 54 A65 LFW 0.2 0.4 LFW A66 LFW LFW LFW LFW A67 LFW LFW LFW LFW A69 LFW 0.3 LFW LFW A70 0.8 - - LFW A71 LFW - - - 052EX - LFW LFW LFW O64 LFW - - LFW O65 - 0.004 0.4 <0.001 O77 LFW - - LFW O78 0.2 0.2 LFW LFW O79 0.2 LFW LFW LFW O92 - 0.1 0.020 <0.001 144 0.5 0.5 LFW LFW 149 - - - - wzy LFW 0.4 0.1 0.006 wbpL - 0.1 0.007 LFW mlC - - - - md 0.1 0.5 0.6 0.1 PAO1 1.0 1.0 1.0 1.0 PA14 - - - LFW % in ec ion 54 51 31 23 % high p oduc i e in ec ion 13 10 8 2 Con a y o wha was expec ed, he ecombinan phage, named T2, did no e eal a b oade hos ange. Al hough i was expec ed ha his phage would also be able o in ec he P. ae uginosa s ains ha a e in ec ed by phage A2 leading o a 58 % in ec ion a e, his was no obse ed and he enginee ed phage Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 3 – Resul s and Discussion 55 e ealed a na owe hos ange. In ac , T2 was only able o in ec 12 s ains, which is e en less han he numbe in ec ed by he PE3gp1-gp12:Nluc phage ha was used as a sca old. So a , some s udies ha e aken ad an age o he ac ha hos ange is connec ed o ail ibe composi ion o speci ic phages o show ha he hos anges o phages can be changed o expanded. Fo ins ance, in o de o pa icula ly a ge E. coli O157:H7, Yoichi e al., (2005) gene ically al e ed a T2 phage by eplacing he long ail ibe genes wi h hose om phage PP01. The exchange was ca ied ou h ough homologous ecombina ion. Al hough i had he same hos ange as phage PP01 and had he PP01 genes gp37 and gp38, he ecombinan phage T2ppD1 was unable o in ec i s o iginal hos , E. coli K-12 (Yoichi e al., 2005). Lin e al., (2012) de eloped a hyb id T3 and T7 phage (T3/7) by eplacing a po ion o he T3 ail ibe gene (gp17) wi h ha o he T7 phage. Compa ed o ei he o he T3 o T7 wild- ype phages, he T3/7 ecombinan phage had a wide hos ange and g ea e adso p ion e iciency (Lin e al., 2012). By modula ly eplacing he componen s o he phage ail and using he yeas -based pla o m, Ando e al., (2015) we e able o edi ec E. coli phage sca olds o a ge pa hogenic Ye sinia and Klebsiella bac e ia, and Klebsiella phage sca olds o a ge E. coli . Al hough he p omising esul s epo ed in he li e a u e, he e i was no possible o inc ease he phage hos ange h ough he inse ion o he TFP om A2 phage in he PE3Δgp1–gp12:Nluc phage genome. A possible explana ion is ha he phage may need he o he TFPs o acqui e he same spec um as A2 phage. Addi ionally, Pi es e al., (2021) disco e ed ha he dele ion o genes gp1 o gp12 om PE3 phage esul ed in a sligh educ ion o he hos ange o he phage; hence, some o hese genes may be in ol ed in hos ecogni ion, akeo e o beginning o eplica ion, which may explain he inc ease o LFW. In his ega d, i would be in e es ing o clone new TFPs wi hou dele ing genes om he phage genome as a u u e s ep. Howe e , as his leads o an inc ease in he size o he phage genome, i can be a challenge due o he phage's capaci y o encapsula e DNA. Al hough he phage genomic modi ica ion did no esul in he expec ed ou come, i was possible o demons a e ha he yeas -based phage- enginee ing s a egy is an e icien and obus me hod o enginee he genomes o P. ae uginosa phages and can be easily applied in he u u e o pe o m o he modi ica ions as men ioned abo e ha may esul in hos ange inc ease (Pi es e al., 2021). Chap e 4 CONCLUSIONS AND FUTURE PERSPECTIVES Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 5 – Re e ences 63 An al e na i e o an ibio ics in he age o mul i-d ug esis ance. Wo ld Jou nal o Gas oin es inal Pha macology and The apeu ics , 8 (3), 162–173. h ps://doi.o g/10.4292/wjgp . 8.i3.162 Lin, T. Y., Lo, Y. H., Tseng, P. W., Chang, S. F., Lin, Y. T., & Chen, T. S. (2012). A T3 and T7 ecombinan phage acqui es e icien adso p ion and a b oade hos ange. PLoS ONE , 7 (2), 1–10. h ps://doi.o g/10.1371/jou nal.pone.0030954 Loc-ca illo, C., & Abedon, S. T. (2011). P os and cons o phage he apy. Bac e iophage , 1 (2), 111–114. h ps://doi.o g/10.4161/bac .1.2.14590 Lu, T. K., & Collins, J. J. (2007). Dispe sing bio ilms wi h enginee ed enzyma ic bac e iophage. PNAS , 104 (27), 11197–11202. h ps://doi.o g/10.1073/pnas.0704624104 Lu, T. K., & Collins, J. J. (2009). Enginee ed bac e iophage a ge ing gene ne wo ks as adju an s o an ibio ic he apy. PNAS , 106 (12), 4629–4634. h ps://doi.o g/10.1073/pnas.0800442106 Lucigen Co po a ion. (2018). O e Exp ess TM Chemically Compe en cells . Ma suda, T., F eeman, T. A., Hilbe , D. W., Du , M., Fuo es, M., S aple on, P. P., & Daly, J. M. (2005). Lysis-de icien bac e iophage he apy dec eases endo oxin and in lamma o y media o elease and imp o es su i al in a mu ine pe i oni is model. Su ge y , 137 (6), 639–646. h ps://doi.o g/10.1016/j.su g.2005.02.012 Meile, S., Kilche , S., Loessne , M. J., & Dunne, M. (2020). Repo e Phage-Based De ec ion o Bac e ial Pa hogens : Design Guidelines and Recen De elopmen s. Vi uses , 12 (944), 25. h ps://doi.o g/doi:10.3390/ 12090944 Meile, S., Sa bach, A., Du, J., Schupple , M., Saez, C., Loessne , M. J., & Kilche , S. (2020). Enginee ed epo e phages o apid bioluminescence-based de ec ion and di e en ia ion o iable Lis e ia cells. Applied and En i onmen al Mic obiology , 86 (11), 1–14. h ps://doi.o g/10.1128/AEM.00442-20 Mi zaei, M. K., & Nilsson, A. S. (2015). Isola ion o phages o phage he apy: A compa ison o spo es s and e iciency o pla ing analyses o de e mina ion o hos ange and e icacy. PLoS ONE , 10 (3), 1–13. h ps://doi.o g/10.1371/jou nal.pone.0118557 Mon ei o, R., Pi es, D. P., Cos a, A. R., & Aze edo, J. (2019). Phage The apy : Going Tempe a e ? T ends in Mic obiology , 27 (4), 368–378. h ps://doi.o g/10.1016/j. im.2018.10.008 Mo adali, M. F., Ghods, S., & Rehm, B. H. A. (2017). Pseudomonas ae uginosa Li es yle : A Pa adigm o Adap a ion , Su i al , and Pe sis ence. F on ie s in Cellula and In ec ion Mic obiology , 7 (39), 29. h ps://doi.o g/10.3389/ cimb.2017.00039 Mo lagh, A. M., Bha acha jee, A. S., & Goel, R. (2016). Bio ilm con ol wi h na u al and gene ically- Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 5 – Re e ences 64 modi ied phages. Wo ld Jou nal o Mic obiology and Bio echnology , 32 (67), 10. h ps://doi.o g/10.1007/s11274-016-2009-4 Nai , A., & Khai na , K. (2019). Gene ically enginee ed phages o he apeu ics : p oceed wi h cau ion. Na u e Medicine , 25 (1028), 1. h ps://doi.o g/10.1038/s41591-019-0506-3 Nguyen, L., Ga cia, J., G uenbe g, K., & MacDougall, C. (2018). Mul id ug-Resis an Pseudomonas In ec ions: Ha d o T ea , Bu Hope on he Ho izon? Cu en In ec ious Disease Repo s , 20 (8), 10. h ps://doi.o g/10.1007/s11908-018-0629-6 Nguyen, M. M., Gil, J., B own, M., Cesa Tondo, E., So aya Ma ins de Aquino, N., Eisenbe g, M., & E ickson, S. (2020). Accu a e and sensi i e de ec ion o Salmonella in oods by enginee ed bac e iophages. Scien i ic Repo s , 10 (1), 1–13. h ps://doi.o g/10.1038/s41598-020-74587-8 No h, O. I., Sakai, K., Yamashi a, E., Nakagawa, A., Iwazaki, T., Bü ne , C. R., Takeda, S., & Da idson, A. R. (2019). Phage ail ib e assembly p o eins employ a modula s uc u e o d i e he co ec olding o di e se ib es. Na u e Mic obiology , 4 (10), 1645–1653. h ps://doi.o g/10.1038/s41564-019-0477-7 Pacho i, P., Go halwal, R., & Gandhi, P. (2019). Eme gence o an ibio ic esis ance Pseudomonas ae uginosa in in ensi e ca e uni  ; a c i ical e iew. Genes & Diseases , 6 (2), 109–119. h ps://doi.o g/10.1016/j.gendis.2019.04.001 Pang, Z., Raudonis, R., Glick, B. R., Lin, T. J., & Cheng, Z. (2019). An ibio ic esis ance in Pseudomonas ae uginosa: mechanisms and al e na i e he apeu ic s a egies. Bio echnology Ad ances , 37 (1), 177–192. h ps://doi.o g/10.1016/j.bio echad .2018.11.013 Passado , L., Cook, J. M., Gambello, M. J., Rus , L., & Iglewski, B. H. (1993). Exp ession o Pseudomonas ae uginosa i ulence genes equi es cell- o-cell communica ion. Science , 260 (5111), 1127–1130. h ps://doi.o g/10.1126/science.8493556 Pe ei a, S. G., Rosa, A. C., Fe ei a, A. S., Mo ei a, L. M., P oença, D. N., Mo ais, P. V., & Ca doso, O. (2014). Vi ulence ac o s and in ec ion abili y o Pseudomonas ae uginosa isola es om a hyd opa hic acili y and espi a o y in ec ions. Jou nal o Applied Mic obiology , 116 (5), 1359–1368. h ps://doi.o g/10.1111/jam.12463 Pi es, D., Melo, L., Vilas Boas, D., Sillanko a, S., & Aze edo, J. (2017). Phage he apy as an al e na i e o complemen a y s a egy o p e en and con ol bio ilm- ela ed in ec ions. Cu en Opinion in Mic obiology , 39 , 48–56. h ps://doi.o g/10.1016/j.mib.2017.09.004 Pi es, D. P., Cle o, S., Sillanko a, S., Aze edo, J., & Lu, T. K. (2016). Gene ically Enginee ed Phages: a Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 5 – Re e ences 65 Re iew o Ad ances o e he Las Decade. Mic obiology and Molecula Biology Re iews , 80 (3), 523– 543. h ps://doi.o g/10.1128/mmb .00069-15 Pi es, D. P., Cos a, A. R., Meneses, L., & Aze edo, J. (2020). Cu en challenges and u u e oppo uni ies o phage he apy. FEMS Mic obiology Le e s , 44 (6), 684–700. h ps://doi.o g/10.1093/ ems e/ uaa017 Pi es, D. P., Dö sch, A., Ande son, E. M., Hao, Y., Khu siga a, C. M., Lam, J. S., Sillanko a, S., & Aze edo, J. (2017). A geno ypic analysis o i e P. ae uginosa s ains a e bio ilm in ec ion by phages a ge ing di e en cell su ace ecep o s. F on ie s in Mic obiology , 8 (1229), 1–14. h ps://doi.o g/10.3389/ micb.2017.01229 Pi es, D. P., K opinski, A. M., Aze edo, J., & Sillanko a, S. (2014). Comple e genome sequence o he Pseudomonas ae uginosa bac e iophage phiIBB-PAA2. Genome Announcemen s , 2 (1), 7–8. h ps://doi.o g/10.1128/genomeA.e01102-13 Pi es, D. P., Mon ei o, R., Mil-Homens, D., Fialho, A., Lu, T. K., & Aze edo, J. (2021). Designing P. ae uginosa syn he ic phages wi h educed genomes. Scien i ic Repo s , 11 (1), 1–10. h ps://doi.o g/10.1038/s41598-021-81580-2 Pi nay, J.-P., Vos, D. De, Ve beken, G., Me abish ili, M., Chanish ili, N., Vaneechou e, M., Zizi, M., Lai e, G., La igne, R., Huys, I., Moo e , G. Van den, Buckling, A., Deba bieux, L., Pouillo , F., Aze edo, J., Ku e , E., Dublanche , A., Gó ski, A., & Adamia, R. (2011). The Phage The apy Pa adigm: P ê -à- Po e o Su -mesu e ? Pha m Res , 28 , 934–937. h ps://doi.o g/10.1007/s11095-010-0313-5 Pi nay, J., Ve beken, G., Ceyssens, P., Huys, I., Vos, D. De, Ameloo , C., & Fauconnie , A. (2018). The Magis al Phage. Vi uses , 10 (2), 1–7. h ps://doi.o g/10.3390/ 10020064 P incipi, N., Sil es i, E., & Esposi o, S. (2019). Ad an ages and Limi a ions o Bac e iophages o he T ea men o Bac e ial In ec ions. F on ie s in Pha macology , 10 (513), 1–9. h ps://doi.o g/10.3389/ pha .2019.00513 Rahim, R., Bu ows, L. L., Mon ei o, M. A., Pe y, M. B., & Lam, J. S. (2000). In ol emen o he ml locus in co e oligosaccha ide and O polysaccha ide assembly in Pseudomonas ae uginosa. Mic obiology , 146 (11), 2803–2814. h ps://doi.o g/10.1099/00221287-146-11-2803 Reu e , K., S einbach, A., & Helms, V. (2016). In e e ing wi h Bac e ial Quo um Sensing. Pe spec i es in Medical Chemis y , 8 , 1–15. h ps://doi.o g/10.4137/PMC.S13209 Ribei o, H. G., Melo, L. D. R., Oli ei a, H., Boon, M., La igne, R., Noben, J.-P., Aze edo, J., & Oli ei a, A. (2019). Cha ac e iza ion o a new podo i us in ec ing Paenibacillus la ae. Scien i ic Repo s , Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 5 – Re e ences 66 9 (20355), 1–12. h ps://doi.o g/10.1038/s41598-019-56699-y Rocche a, H. L., Bu ows, L. L., Pacan, J. C., & Lam, J. S. (1998). Th ee hamnosyl ans e ases esponsible o assembly o he A-band D- hamnan polysaccha ide in Pseudomonas ae uginosa: A ou h ans e ase, WbpL, is equi ed o he ini ia ion o bo h A-band and B-band lipopolysaccha ide syn hesis (Molecula Mi. Molecula Mic obiology , 28 (6), 1103–1119. h ps://doi.o g/10.1046/j.1365-2958.1998.01109.x Rocche a, H. L., Pacan, J. C., & Lam, J. S. (1998). Syn hesis o he A-band polysaccha ide suga D- hamnose equi es Rmd and WbpW: Iden i ica ion o mul iple AlgA homologues, WbpW and ORF488, in Pseudomonas ae uginosa. Molecula Mic obiology , 29 (6), 1419–1434. h ps://doi.o g/10.1046/j.1365-2958.1999.0e a .x Rohde, C., Wi mann, J., & Ku e , E. (2018). Bac e iophages: A he apy concep agains mul i-d ug- esis an bac e ia. Su gical In ec ions , 19 (8), 737–744. h ps://doi.o g/10.1089/su .2018.184 San os, S. B., Cunha, A. P., Macedo, M., Noguei a, C. L., B andão, A., Cos a, S. P., Melo, L. D. R., Aze edo, J., & Ca alho, C. M. (2020). Bac e iophage ‐ ecep o binding p o eins o mul iplex de ec ion o S aphylococcus and En e ococcus in blood. Bio echnology Ad ances , 117 , 3286–3298. h ps://doi.o g/10.1002/bi .27489 Schmelche , M., & Loessne , M. J. (2008). P inciples o Bac e ial De ec ion : Biosenso s, Recogni ion Recep o es and Mic osys ems . Schmelche , M., & Loessne , M. J. (2014). Applica ion o bac e iophages o de ec ion o oodbo ne pa hogens. Bac e iophage , 4 (e28137), 1–14. h ps://doi.o g/10.4161/bac .28137 Silby, M. W., Wins anley, C., God ey, S. A. C., Le y, S. B., & Jackson, R. W. (2011). Pseudomonas genomes: Di e se and adap able. FEMS Mic obiology Re iews , 35 (4), 652–680. h ps://doi.o g/10.1111/j.1574-6976.2011.00269.x S a e a, T., & Mi o , I. (2011). Con ibu ion o an a senal o i ulence ac o s o pa hogenesis o Pseudomonas ae uginosa in ec ions. Annals o Mic obiology , 61 (4), 717–732. h ps://doi.o g/10.1007/s13213-011-0273-y Taglia e i, T. L., Jansen, M., & Ho z, H.-P. (2019). Figh ing Pa hogenic Bac e ia on Two F on s: Phages and An ibio ics as Combined S a egy. F on ie s in Cellula and In ec ion Mic obiology , 9 (22), 13. h ps://doi.o g/10.3389/ cimb.2019.00022 Takahashi, Y., & Ta suma, T. (2014). Me al oxides and hyd oxides as echa geable ma e ials o pho oca alys s wi h oxida i e ene gy s o age abili ies. Elec ochemis y , 82 (9), 749–751. Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Chap e 5 – Re e ences 67 h ps://doi.o g/10.5796/elec ochemis y.82.749 Tang, Y., Ali, Z., Zou, J., Jin, G., Zhu, J., Yang, J., & Dai, J. (2017). De ec ion me hods o : Pseudomonas ae uginosa: His o y and u u e pe spec i e. RSC Ad ances , 7 (82), 51789–51800. h ps://doi.o g/10.1039/c7 a09064a To es-Ba celó, C. (2018). Phage The apy Faces E olu iona y Challenges. Vi uses , 10 (323), 8. h ps://doi.o g/10.3390/ 10060323 T ampe -s ande s, G. A., En , C. K. Van De , & Wol s, T. F. W. (2005). De ec ion o Pseudomonas ae uginosa in pa ien s wi h cys ic ib osis. Jou nal o Cys ic Fib osis , 4 (2), 37–43. h ps://doi.o g/10.1016/j.jc .2005.05.009 Viazis, S., Akh a , M., Fei ag, J., B abban, A. D., & Diez-Gonzalez, F. (2011). Isola ion and cha ac e iza ion o ly ic bac e iophages agains en e ohaemo hagic Esche ichia coli. Jou nal o Applied Mic obiology , 110 (5), 1323–1331. h ps://doi.o g/10.1111/j.1365-2672.2011.04989.x Wa e s, E. M., Neill, D. R., Kaman, B., Saho a, J. S., Clokie, M. R. J., Wins anley, C., & Kadioglu, A. (2017). Phage he apy is highly e ec i e agains ch onic lung in ec ions wi h Pseudomonas ae uginosa. Tho ax , 0 (0), 2. h ps://doi.o g/10.1136/ ho axjnl-2016-209265 Wo ld Heal h O ganiza ion. (2017). WHO publishes lis o bac e ia o which new an ibio ics a e u gen ly needed . h ps://www.who.in /news/i em/27-02-2017-who-publishes-lis -o -bac e ia- o -which-new- an ibio ics-a e-u gen ly-needed Xu, J., Moo e, J. E., Mu phy, P. G., Milla , B. C., & Elbo n, S. (2004). Ea ly de ec ion o Pseudomonas ae uginosa – compa ison o con en ional e sus molecula ( PCR ) de ec ion di ec ly om adul pa ien s wi h cys ic ib osis ( CF ). Annals o Clinical Mic obiology and An imic obials , 3 (21), 1–5. h ps://doi.o g/10.1186/1476-0711-3-21 Yoichi, M., Abe, M., Miyanaga, K., Unno, H., & Tanji, Y. (2005). Al e a ion o ail ibe p o ein gp38 enables T2 phage o in ec Esche ichia coli O157:H7. Jou nal o Bio echnology , 115 (1), 101–107. h ps://doi.o g/10.1016/j.jbio ec.2004.08.003 Yoshida, N., & Sa o, M. (2009). Plasmid up ake by bac e ia : a compa ison o me hods and e iciencies. Applied Mic obiology and Bio echnology , 83 (5), 791–798. h ps://doi.o g/10.1007/s00253-009- 2042-4 Young, J. S., Go mley, E., & Welling on, E. M. H. (2005). Molecula de ec ion o Mycobac e ium bo is and Mycobac e ium bo is BCG (Pas eu ) in soil. Applied and En i onmen al Mic obiology , 71 (4), 1946–1952. h ps://doi.o g/10.1128/AEM.71.4.1946-1952.2005 Supplemen a y ma e ial Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Supplemen a y ma e ial 69 S ains, bac e iophages and plasmids used in his wo k can be seen in he Table S1. Table S1 - Bac e ial s ains, bac e iophages and plasmids used in his s udy S ain, bac e iophage, o plasmid Re e ence o sou ce P. ae uginosa s ains PAO1 Ge man Collec ion o Mic oo ganisms and Cell Cul u es (DSM22644) PA14 Labo a o y s ock 1 U ine 2 Skin 3 Ea 4 B onchial 5 Hemocul u e 6 U ine 7 Ea 8 U ine 9 U ine 10 U ine 11 Skin ulce 12 Expec o a ion 14 U ine 15 Skin ulce 16 Skin ulce 17 Ca he e 18 Ea 19 Skin ulce 20 U ine 21 U ine 22 Hemocul u e 23 U ine Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Supplemen a y ma e ial 70 24 Expec o a ion 25 Expec o a ion 26 Ea 27 Unknown 28 Unknown 29 Unknown A22 Unknown A63 Expec o a ion A64 B onchial A65 B onchial A66 B onchial A67 B onchial A69 B onchial A70 B onchial A71 Expec o a ion 052EX Expec o a ion O64 Hemocul u e O65 B onchial O77 Unknown O78 Unknown O79 Unknown O92 Unknown 144 Unknown 149 Unknown wzy (A+B−), de icien in O-an igen polyme ase o B-band biosyn hesis, p oduces co e-plus-one O- epea uni (de Kie i e al., 1995) wbpL (A−B−), de icien in he ini ial glycosyl ans e ase a ec ing bo h B-band Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Supplemen a y ma e ial 71 and A-band (Rocche a, Bu ows, e al., 1998) mlC (A−B−), de ec i e in TDP-L- hamnose biosyn hesis, wi h unca ed ou e co e (Rahim e al., 2000) md (A−B+), de icien in GDP-D- hamnose biosyn hesis becomes A-band minus, no a ec ing B-band (Rocche a, Pacan, e al., 1998) E. coli s ains A c ic exp ess Labo a o y s ock C43 Labo a o y s ock BL21 Labo a o y s ock A51 B onchial Saccha omyces ce e isiae s ains BY4741 Labo a o y s ock Klebsiella pneumoniae s ains A36 B onchial A57 B onchial S aphylococcus au eus s ains A1 B onchial - MRSA (Mul i-Resis en S. au eus ) A9 Hemocul u e - MRSA (Mul i-Resis en S. au eus ) A39 B onchial - MSSA (Mul i-Sensi i e S. au eus ) En e ococcus aecalis s ains A74 U ine En e ococcus aecium s ains A78 Skin ulce Bac e iophages PE1 - Enginee ing phages owa ds Pseudomonas ae uginosa de ec ion and con ol Supplemen a y ma e ial 72 phiIBB-PAA2 Accession numbe : NC_022971.1 B_PaeM_CEB_DP1 Accession numbe : KR869157 PA14G - PA14-20 - B_PaeP_PE3 Accession numbe : MN901924.1 PE3Δgp1–gp12 D. P. Pi es e al., (2021) PE3Δgp1–gp12:Nluc This wo k Plasmids pRS415 ATCC 87520 pGFP Labo a o y s ock 79 phiIBBPAA2_0053 33356 34045 690 RBP Lis e ia 3. 0E-02 phiIBBPAA2_0054 34042 35583 1542 i al p o ein En e obac e ia phage T7 6.7E-06 phiIBBPAA2_0055 35592 36239 648 RB domain o sho TFP gp12 Bizionia a gen inensis JUB59 79 phiIBBPAA2_0056 36229 36477 249 hypo he ical p o ein Pseudomonas i us Pa223 1.0E-49 phiIBBPAA2_0057 36461 36652 192 hypo he ical p o ein Pseudomonas i us LUZ24 1.0E-34 phiIBBPAA2_0058 36663 37289 627 i ion p o ein Pseudomonas i us LUZ24 1.0E-151 phiIBBPAA2_0059 37293 37613 321 hypo he ical p o ein Pseudomonas i us LUZ24 5.0E-72 phiIBBPAA2_0060 37662 38615 954 majo head p o ein Mic ocys is phage Mic1 2.0E-101 phiIBBPAA2_0061 38634 39626 993 sca olding p o ein Pseudomonas ae uginosa 0.0 phiIBBPAA2_0062 39626 39868 243 hypo he ical p o ein Pseudomonas ae uginosa 4.0E-51 phiIBBPAA2_0063 39871 41991 2121 po al p o ein Pseudomonas phage phiIBB-PAA2 2.2E-40 phiIBBPAA2_0064 41991 43439 1449 e minase la ge subuni Pseudomonas i us LUZ24 5.0E-47 phiIBBPAA2_0065 43439 43837 399 lysozyme Pseudomonas phage TL 2.0E-89 phiIBBPAA2_0066 43869 44327 459 hypo he ical p o ein Pseudomonas phage phiIBB-PAA2 5.0E-107 Table S4 - Anno a ion o phage PE3. Fo each locus_ ag, he ansc ip ion s a and s op posi ion. The co esponding gene p oduc size and pu a i e p edic ed unc ion based on he bes hi and E- alue ob ained locus_ ag Minimum (bp) Maximum (bp) Leng h (bp) Pu a i e unc ion Bes Species Hi E- alue BPaePPE3_001 1776 2060 285 hypo he ical p o ein Pseudomonas phage phiKMV 4.0E-62 BPaePPE3_002 2060 2287 228 hypo he ical p o ein Pseudomonas phage phiKMV 5.0E-46 80 BPaePPE3_003 2298 2837 540 hypo he ical p o ein Pseudomonas phage LUZ19 5.0E-128 BPaePPE3_004 2834 3004 171 hypo he ical p o ein Pseudomonas phage B_PaeP_130_113 1.0E-32 BPaePPE3_005 3007 3126 120 hypo he ical p o ein Pseudomonas phage B_PaeP_PE3 7.0E-18 BPaePPE3_006 3205 3573 369 hypo he ical p o ein Pseudomonas phage phiKMV 4.0E-85 BPaePPE3_007 3560 3787 228 hypo he ical p o ein Pseudomonas phage phiKMV 7.0E-49 BPaePPE3_008 3784 3969 186 hypo he ical p o ein Pseudomonas phage B_PaeP_PE3 3.0E-34 BPaePPE3_009 3966 4139 174 hypo he ical p o ein Pseudomonas ae uginosa 3.0E-34 BPaePPE3_010 4139 4420 282 hypo he ical p o ein Pseudomonas ae uginosa 2.0E-59 BPaePPE3_011 4420 4680 261 hypo he ical p o ein Pseudomonas ae uginosa 4.0E-55 BPaePPE3_012 4682 4969 288 hypo he ical p o ein Pseudomonas phage B_PaeP_PE3 2.0E-63 BPaePPE3_013 5048 5464 417 hypo he ical p o ein Pseudomonas phage B_PaeP_PE3 1.0E-92 BPaePPE3_014 5533 5892 360 hypo he ical p o ein Pseudomonas phage phiKMV 2.0E-78 BPaePPE3_015 5895 6704 810 DNA-binding p o ein Pseudomonas phage B_PaeP_PE3 0.0 BPaePPE3_016 6784 7203 420 hypo he ical p o ein Pseudomonas phage B_PaeP_PE3 7.0E-98 BPaePPE3_017 6974 7516 543 hypo he ical p o ein Pseudomonas phage B_PaeP_PE3 3.0E-129 BPaePPE3_018 7526 7729 204 hypo he ical p o ein Pseudomonas phage PT5 3.0E-41 BPaePPE3_019 7702 8526 825 pu a i e DNA p imase Aqui ex aeolicus 1.3E-22 BPaePPE3_020 8495 9763 1269 DNA helicase Bacillus phage SPP1 1.5E-39 BPaePPE3_021 9753 10370 618 pu a i e nucleo idyl ans e ase Pseudomonas phage B_PaeP_PE3 2.0E-148 BPaePPE3_022 10370 11317 948 DNA ligase Pseudomonas phage B_PaeP_PE3 1.5E-37 81 BPaePPE3_023 11320 11649 330 hypo he ical p o ein Pseudomonas phage B_PaeP_PE3 2.0E-74 BPaePPE3_024 11646 14069 2424 DNA polyme ase I Plasmodium alcipa um 6.0E-64 BPaePPE3_025 14066 14377 312 hypo he ical p o ein Pseudomonas phage LKD16 2.0E-69 BPaePPE3_026 14432 15481 1050 hypo he ical p o ein Pseudomonas phage MPK7 0.0 BPaePPE3_027 15481 16422 942 5'-3' exonuclease Mycobac e ium smegma is 4.3E-30 BPaePPE3_028 16412 16852 441 pu a i e DNA endonuclease VII Pseudomonas phage MPK6 5.0E-105 BPaePPE3_029 16849 17895 1047 DNA polyme ase Py obaculum calidi on is 2.7E-10 BPaePPE3_030 17905 18267 363 hypo he ical p o ein Pseudomonas phage B_PaeP_PE3 1.0E-80 BPaePPE3_031 18260 18610 351 hypo he ical p o ein Pseudomonas phage B_PaeP_PE3 4.0E-78 BPaePPE3_032 18619 21066 2448 pu a i e DNA-dependen RNA polyme ase En e obac e ia phage T7 6.0E-152 BPaePPE3_033 21240 21491 252 hypo he ical p o ein Pseudomonas phage LUZ19 1.0E-52 BPaePPE3_034 21491 21964 474 pu a i e ace yl ans e ase Pseudomonas phage B_PaeP_PE3 5.0E-114 BPaePPE3_035 21909 22205 297 pu a i e s uc u al p o ein Pseudomonas phage B_PaeP_PE3] 4.0E-61 BPaePPE3_036 22217 23749 1533 pu a i e head- ail connec o p o ein En e obac e ia phage T7 5.6E-91 BPaePPE3_037 23753 24721 969 sca olding p o ein Pseudomonas phage B_PaeP_PE3 0.0 BPaePPE3_038 24774 25781 1008 capsid p o ein Pseudomonas phage phiKMV 0.0 BPaePPE3_039 25878 26432 555 ail ubula p o ein A Pseudomonas phage LUZ19 8.0E-132 BPaePPE3_040 26435 28915 2481 ail ubula p o ein B En e obac e ia phage T7 8.3E-110 BPaePPE3_041 28915 29460 546 pu a i e in e nal i ion p o ein A Pseudomonas phage phiKMV 2.0E-124 82 BPaePPE3_042 29460 32156 2697 in e nal i ion p o ein Pseudomonas phage B_PaeP_PE3 0.0 BPaePPE3_043 32160 36173 4014 in e nal i ion p o ein Pseudomonas phage B_PaeP_PE3 0.0 BPaePPE3_044 36175 36930 756 pu a i e ail ibe p o ein En e obac e ia phage T7 4.6E-11 BPaePPE3_045 36930 37388 459 ail ibe p o ein Pseudomonas phage LUZ19 7.0E-106 BPaePPE3_046 37381 38286 906 ail ibe p o ein Pseudomonas phage B_PaeP_PE3 0.0 BPaePPE3_047 38290 38895 606 ail ibe p o ein Pseudomonas phage LUZ19 9.0E-148 BPaePPE3_048 38895 39200 306 hypo he ical p o ein Pseudomonas phage B_PaeP_PAO1_1- 15pyo 1.0E-68 BPaePPE3_049 39210 41015 1806 e minase la ge subuni Pseudomonas phage B_PaeP_PE3 1.4E-32 BPaePPE3_050 41012 41212 201 hypo he ical p o ein Pseudomonas phage phiKMV 2.0E-38 BPaePPE3_051 41209 41691 483 endolysin Pseudomonas phage B_PaeP_PE3 1.0E-114 BPaePPE3_052 41649 41978 330 hypo he ical p o ein Pseudomonas phage DL62 4.0E-72 BPaePPE3_053 42130 42480 351 mino s uc u al p o ein Pseudomonas phage B_PaeP_PE3 3.0E-72 BPaePPE3_054 42499 42744 246 pa icle p o ein Pseudomonas phage B_PaeP_PE3 3.0E-49 BPaePPE3_055 42753 42968 216 hypo he ical p o ein Pseudomonas phage LUZ19 3.0E-42