scieee AI-readable full text Open interactive document viewer

Are tomato plants co-exposed to heat and salinity able to ensure a proper carbon metabolism? – An insight into the photosynthetic hub

Rodrigues, Francisca; Sousa, Bruno; Soares, Cristiano; Moreira, Diana; Pereira, Cláudia; Moutinho-Pereira, José; Cunha, Ana; Fidalgo, Fernanda

Abstract

Abiotic stress combinations, such as high temperatures and soil/water salinization, severely threaten crop productivity worldwide. In this work, an integrative insight into the photosynthetic metabolism of tomato plants subjected to salt (100 mM NaCl) and/or heat (42 °C; 4 h/day) was performed. After three weeks, the stress combination led to more severe consequences on growth and photosynthetic pigments than the individual stresses. Regarding the photochemical efficiency, transcript accumulation and protein content of major actors (CP47 and D1) were depleted in all stressed plants, although the overall photochemical yield was not negatively affected under the co-exposure. Gas-exchange studies revealed to be mostly affected by salt (single or combined), which harshly compromised carbon assimilation. Additionally, transcript levels of stress-responsive genes (e.g., HsfA1 and NHX2) were differentially modulated by the single and combined treatments, suggesting the activation of stress-signature responses. Overall, by gathering an insightful overview of the main regulatory hub of photosynthesis, we show that the impacts on the carbon metabolism coming from the combination of heat and salinity, two major conditioners of crop yields, were not harsher than those of single stresses, indicating that the growth impairment might be attributed to a proficient distribution of resources towards defense mechanisms.

Full text

Plant Physiology and Biochemistry 206 (2024) 108270 Available online 10 December 2023 0981-9428/© 2023 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). Are tomato plants co-exposed to heat and salinity able to ensure a proper carbon metabolism? – An insight into the photosynthetic hub Francisca Rodrigues a , b , # , 1 , Bruno Sousa a , * , 1 , Cristiano Soares a , Diana Moreira c , Cl´ audia Pereira a , Jos´ e Moutinho-Pereira d , Ana Cunha b , Fernanda Fidalgo a a GreenUPorto – Sustainable Agrifood Production Research Centre and INOV4AGRO, Department of Biology, Faculty of Sciences of University of Porto, Rua do Campo Alegre s/n, 4169-007 Porto, Portugal b Biology Department and CBMA – Centre of Molecular and Environmental Biology, School of Sciences of University of Minho, Campus de Gualtar, 4710-057 Braga, Portugal c LAQV/REQUIMTE, Department of Biology, Faculty of Sciences of University of Porto, Rua do Campo Alegre s/n, 4169-007 Porto, Portugal d CITAB - Centre for the Research and Technology of Agro-Environmental and Biological Sciences, Universidade de Tr´ as-os-Montes e Alto Douro, 5000-801 Vila Real, Portugal ARTICLE INFO Keywords: Solanum lycopersicum Abiotic stress Photochemistry Chlorophyll fluorescence Photosystem II Gas exchange Heat shock response ABSTRACT Abiotic stress combinations, such as high temperatures and soil/water salinization, severely threaten crop productivity worldwide. In this work, an integrative insight into the photosynthetic metabolism of tomato plants subjected to salt (100 mM NaCl) and/or heat (42 ◦C; 4 h/day) was performed. After three weeks, the stress combination led to more severe consequences on growth and photosynthetic pigments than the individual stresses. Regarding the photochemical efficiency, transcript accumulation and protein content of major actors (CP47 and D1) were depleted in all stressed plants, although the overall photochemical yield was not negatively affected under the co-exposure. Gas-exchange studies revealed to be mostly affected by salt (single or combined), which harshly compromised carbon assimilation. Additionally, transcript levels of stress-responsive genes (e.g., HsfA1 and NHX2) were differentially modulated by the single and combined treatments, suggesting the activation of stress-signature responses. Overall, by gathering an insightful overview of the main regulatory hub of photosynthesis, we show that the impacts on the carbon metabolism coming from the combination of heat and salinity, two major conditioners of crop yields, were not harsher than those of single stresses, indicating that the growth impairment might be attributed to a proficient distribution of resources towards defense mechanisms. 1. Introduction Sessile organisms, such as plants, highly rely on their incredible plasticity to develop under adverse conditions (Zhang et al., 2021). However, the current climatic instability, coupled with anthropic-related environmental degradation, has been gradually – yet now at an unsettlingly accelerated pace – propelling agriculture past its limitations, since plants are not able to adapt in due time to these drastic abiotic fluctuations. Tomato (Solanum lycopersicum L.) fruit is one of the most produced and consumed goods within the Iberian Peninsula. Indeed, both Spain and Portugal regularly secure positions within the five biggest annual producers in Europe. However, recent years have witnessed a decline in tomato cultivation in these regions (Eurostat, 2021), this being most likely correlated with the impacts of an ever-shifting climate, a concern further amplified by the projections of the latest report of the Intergovernmental Panel on Climate Change (IPCC, 2021). According to it, before the year 2100, a rise in average temperature up to 5 ◦C in the Mediterranean area can be expected, with ~30 days each year reaching a maximum temperature over 40 ◦C, largely surpassing the 25–35 ◦C threshold for heat stress in most crops (Wahid et al., 2007). As a consequence of global warming, agricultural practises increasingly demand higher irrigation requirements, thus pushing the utilization of suboptimal water resources. All of this can result in long-term soil * Corresponding author. Sustainable Agrifood Production Research Centre and INOV4AGRO, Department of Biology, Faculty of Sciences of University of Porto, Rua do Campo Alegre s/n, 4169-007 Porto, Portugal. E-mail address: [email protected] (B. Sousa). # Present address: InnovPlantProtect, Estrada de Gil Vaz, Apartado 72 7351-901 Elvas, Portugal. 1 These authors contributed equally for this research and should both be considered as first authors. Contents lists available at ScienceDirect Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy https://doi.org/10.1016/j.plaphy.2023.108270 Received 28 August 2023; Received in revised form 7 November 2023; Accepted 6 December 2023 Plant Physiology and Biochemistry 206 (2024) 108270 2 salinization, compromising agricultural yield and further escalating the concerning scenario of desertification in the Mediterranean basin (Haddeland et al., 2014; Koutroulis et al., 2013; Daliakopoulos et al., 2016). To face these issues, plant stress research must shift towards understanding the crosstalk between heat and salinity effects on crop performance, as well as focusing on identifying putative tolerance mechanisms in order to promote a sustainable, yet profitable, agricultural chain. Being considered as the “power factory” of photoautotrophic organisms, the importance of the photosynthetic machinery should not be understated. Thus, upon disruption of this metabolic process, which is highly sensitive to environmental shifts, including changes in temperature and soil salt levels (Singh et al., 2018; Parihar et al., 2015; Mathur et al., 2014; Hassan et al., 2021), plant survival can be threatened and crop productivity put at risk. A common consequence of both salt and heat stress is the disruption of the chloroplast organization, as well as the increased degradation or inhibited production of chlorophylls and carotenoids, while also leading to defects in water relations, photochemical reactions, carbon metabolism and net photosynthetic rate, stomatal conductance, and protein biosynthesis, including Ribulose-1,5-bisphosphate carboxylase-oxygenase (RuBisCO; EC 4.1.1.39), the main enzyme responsible for carbon assimilation (Singh et al., 2018; Parihar et al., 2015; Mathur et al., 2014; Hassan et al., 2021; Zahra et al., 2022; Zahra et al., 2023). In an attempt to survive under these unfavorable conditions, plants must quickly respond and adapt, activating a series of coordinated molecular, biochemical, morphophysiological responses. Under abiotic stress exposure, heat shock proteins (HSPs) are important molecular chaperones responsible for protein stabilization and refolding after stress events (Al-Whaibi, 2011; Park and Seo, 2015). Moreover, specifically in the case of salinity, plants need also to employ strategies to avoid ionic toxicity, either by inhibiting salt uptake and translocation, or by favouring its compartmentalization, regulated by ion transporters, such as the NHX (Na + /H + antiporters) class (Parihar et al., 2015). These transporters are major regulators of active potassium (K) uptake and turgor potential, thus preventing the accumulation of toxic ions in plant cells, and maintaining K + /Na + homeostasis (Parihar et al., 2015). Nonetheless, and although the overall defense network can be enough to at least partially deal with slight to moderate stress episodes, strong and/or chronic exposures can be more harmful and still affect plant development. This is especially worrying because, in the context of climate change, the severity, frequency and combination of stressors are increasing, leading to consequences that can differ, and be harsher, than the effects of the sum of each one (Suzuki et al., 2014). Recently, the studies conducted by Rivero et al. (2014) and Lopez-Delacalle et al. (2021) observed that the behaviour of tomato plants treated with salt (hydroponics, 120 mM for 72 h or 75 mM NaCl for 14 days, respectively) and heat (35 ◦C) was similar to those exposed only to high temperatures and showed to be less affected than by the salt treatment, at least regarding growth and photosynthesis. Contrastingly, using a different experimental design (based on the current projections for the Mediterranean), results published by our research team (Sousa et al., 2022), indicate that the performance of potted tomato plants exposed to the combined stress (irrigated with 100 mM NaCl, and exposed daily to 42 ◦C for 4 h during 3 weeks) is more severely affected than what could be expected from the individual effects. In light of this information, it is clear that there is still much more to learn concerning this subject, especially the intracellular and biochemical pathways involved in the crosstalk between salinity and heat. Thus, considering our previous studies, we hypothesize that the high growth inhibition found in tomato plants co-exposed to heat and salinity can result from an impaired photosynthetic performance and a downregulation of defensive pathways related to nutrient homeostasis, rather than oxidative damage, as recently shown (Sousa et al., 2022). To test these hypotheses, this work mainly aims to assess the consequences of the co-exposure to heat and salt on the photosynthetic apparatus of S. lycopersicum plants, by analysing several endpoints such as a) the evaluation of photosynthetic pigments and RuBisCO and D1 – both at the protein and gene level; b) chlorophyll fluorescence analysis; and c) gas-exchange measurements. To complement this approach, the histochemical detection of cell death and the expression of genes related to the heat shock response, as well as ion transporters (NHX), were also conducted to better understand the response of S. lycopersicum to this stress combination, which is set to become increasingly common in the Mediterranean region. 2. Material and methods 2.1. Plant growth and experimental design Seeds of cherry tomato (Solanum lycopersicum L. var cerasiforme) underwent a surface disinfection process with 70% (v/v) ethanol (7 min) and 20% (v/v) commercial bleach [5% active chloride and 0.02% (w/v) tween-20] (5 min). Then, seeds were washed several times with deionized water (dH 2 O) to remove the excess of disinfectants. Subsequently, seeds were evenly spread in Petri dishes filled with solid (0.675% w/v agar) half-strength MS (Murashige and Skoog, 1962) growth medium with Gamborg B5 (Gamborg et al., 1968) vitamins (Sigma-Aldrich®, Steinheim, Germany). Seeds were then germinated, for 7 days, in a growth chamber [16 h light/8 h dark photoperiod, photosynthetic photon flux density (PPFD) of 150 μ mol m −2 s −1 , 25 ◦C]. Afterwards, seedlings were planted and grown under the controlled conditions above-mentioned, on pots containing Siro Royal universal substrate (SIRO©, Portugal; characterized in Table S1 of Sousa et al. (2022)). For the first 7 days, seedlings were irrigated only with dH 2 O to allow them to acclimate to pot conditions. For each condition, four pots (defined as the biological replicate), each one with three plants, were considered. After the acclimation week, pots were randomly divided into different trays (4 pots per tray) and plants were grown for the next 3 weeks with these experimental groups: •CTL – control plants, only irrigated with dH 2 O (60 mL for each pot every two days) and grown under 25 ◦C; •SALT – salt-treated plants, irrigated, every two days, with a 100 mM NaCl solution (60 mL for each pot) and grown under 25 ◦C; •HEAT – heat-exposed plants, only irrigated with dH 2 O (60 mL for each pot every two days) and daily exposed, for 4 h, to 42 ◦C in a twin growth chamber; •COMBINED – co-exposed plants, irrigated, every two days, with a 100 mM NaCl solution (60 mL for each pot) and daily exposed, for 4 h, to 42 ◦C in a twin growth chamber. This experimental design was selected based on our previously published work (Sousa et al., 2022), being also aligned with former literature (Ayers and Westcot, 1985) and with the predicted future climatic trends for the Mediterranean basin (Carvalho et al., 2021). Heat stress was applied between the 5th and 9th hours of light, mimicking similar conditions to those observed under a real scenario. After 3 weeks of exposure, gas exchange determinations, chlorophyll fluorometry, and cell death analysis were carried out in vivo in the 2nd and 3rd fully expanded leaves of every plant. Afterwards, plants were collected, thoroughly washed, and the aerial portion of some plants was frozen and macerated in liquid nitrogen and stored at −80 ◦C for molecular and biochemical determinations. 2.2. Cell viability - histochemical determination Fully expanded leaves (2nd and 3rd) from plants of each condition were processed as detailed in Soares et al. (2016). In summary, leaves were incubated for 4 h in 0.25% (w/v) Evans Blue, in the dark, and then decolorized with 96% (v/v) boiling ethanol. Lastly, after being carefully washed, leaves were photographed. Since Evans Blue cannot enter viable cells, the occurrence of blueish areas indicates loss of cell F. Rodrigues et al. Plant Physiology and Biochemistry 206 (2024) 108270 3 viability. 2.3. Determination of chlorophylls and carotenoids levels The determination of the levels of photosynthetic pigments was carried out in accordance with the method of Lichtenthaler (1987). Here, frozen samples were macerated in 80% (v/v) acetone and absorbances were read at 664, 647, and 470 nm, after a 10 min-centrifugation. Chlorophyll (a and b) and carotenoids were calculated trough the formulas of Lichtenthaler (1987). Results were expressed in mg g −1 dry weight (dw), estimated from the calculated water content (Sousa et al., 2022). 2.4. Chlorophyll fluorometry 2.4.1. Photochemical efficiency of photosystem II (PSII) - maximum quantum yield (F v /F m ), relative electron transport rate (rETR), PSII efficiency (ΦPSII), and non-photochemical quenching (NPQ) Chlorophyll fluorescence parameters were analysed [as described in Soares et al. (2020)], through pulse-amplitude modulated (PAM) fluorometry, in the 2nd and 3rd expanded leaves, with a PAM-210 fluorometer (Heinz Walz GmbH, 1997), controlled with the PAMWin software. This equipment possessed a far red LED [long-pass filter (>710 nm ad with a peak at ~730 nm)], an actinic red LED (unfiltered, with a peak at ~665 nm), a red measuring LED [short-pass filter (<690 nm)] and a PIN photodiode and dichroic filter, which reflect fluorescence to the detector at a 90◦angle. Plants were kept in obscurity for over half an hour so that all the PSII reaction centres were open. Afterwards, minimal fluorescence (F 0 ) was recorded before applying a saturating light pulse (PPFD: 3500 μ mol m −2 s −1 , 800 ms), which allowed the detection of maximum fluorescence (F m ) and the calculation of the maximum PSII quantum yield (F v / F m – – (F m –F 0 )/F m (Kitajima and Butler, 1975). Then, after a 10 min adaptation to an actinic light with similar light intensity to that of the growth chamber (128 μ mol m −2 s −1 ), a saturating light pulse was applied, allowing the determination of the steady-state fluorescence (F t ) and maximum fluorescence yield (F’ m ). Here, relative electron transport rate (rETR =Φ PSII x PPFD) and effective PSII quantum yield [Φ PSII = (F’ m -F t )/F’ m ] (Genty et al., 1989) were calculated. Non-photochemical quenching (NPQ) was determined as (F m –F’ m )/F’ m (Muller et al., 2001). 2.4.2. Rapid light curves (RLC) Immediately after the above-mentioned quantifications (2.4.1), the same leaves were subjected to eleven increasing actinic light levels for 20 s (PPFD: 18, 68, 98, 128, 158, 218, 318, 448, 608, 858 and 1258 μ mol m −2 s −1 ). After each step, leaves were exposed to a saturating pulse to calculate the respective Φ PSII , rETR and NPQ. 2.5. Gas-exchange measurements An infrared gas analysed (IRGA; LCpro + , ADC, Hodderson, UK), coupled to a broad light source was used to evaluate gas-exchange parameters, simulating greenhouse conditions (atmospheric CO 2 concentration, PPFD of 128 μ mol m −2 s −1 ). Measurements were carried out in fully expanded leaves of plants from every biological replicate. Net CO 2 assimilation rate (P N , μ mol m −2 s −1 ), stomatal conductance (g s , mmol m −2 s −1 ), transpiration rate (E, mmol m −2 s −1 ), and intracellular/atmospheric CO 2 (C i /C a ) were calculated through the equations of von Caemmerer and Farquhar (von Caemmerer and Farquhar, 1981). Moreover, specific leaf area [SLA =leaf area (cm 2 )/dw (g)] and intrinsic water use efficiency (WUE i =P N /g s .) were also evaluated. Since SLA was altered by the different treatments, all gas exchange parameters were expressed based on mass (mol g −1 s −1 ) instead of area (mol m −2 s −1 ). 2.6. RT-qPCR gene expression analysis 2.6.1. RNA extraction and purification and cDNA synthesis Total RNA was extracted from frozen shoot samples with the NZYol (NZytech®, Portugal) reagent, according to the suppliers’s instructions. Then, the GRS Total RNA kit – Plant from GRiSP® (GRiSP Research Solutions, Portugal), which includes a DNAse I step, was utilized to purify the extracted RNA. Upon these steps, RNA levels (1.0 Abs 260 nm = 40 ng μ L −1 ) and purity (Abs 260/280 nm and Abs 260/230 nm ) were determined with a DS-11 Microvolume Abs Spectrophotometer (DeNovix Inc., USA). RNA integrity was analysed by agarose gel electrophoresis. Afterwards, cDNA synthesis was achieved through the Xpert cDNA Synthesis Kit (GRiSP®), with 1 μ g of RNA (20 μ L total volume). Samples were stored at −20 ◦C before being used for real-time PCR (qPCR). 2.6.2. qPCR analysis of gene expression Through a qPCR analysis, the transcript accumulation for a range of genes associated with photosynthesis (Table 1) or responsive to salt or heat stress conditions (Table 2) was determined. D1 and CP47 are responsible for encoding proteins linked to the reaction centre of PSII, whereas RbcL and RbcS code for the large and small subunits of RuBisCO, respectively. The reactions were carried out, in triplicate, on a CFX96 Real-Time Detection System (Bio-Rad®, Portugal). In every reaction (20 μ L), the following components were added: 1x PowerUp™ SYBR® Green Master Mix, 0.4 μ M primers (Tables 1 and 2) and 1 μ L of diluted (1:10) cDNA. The qPCR cycle was: 50 ◦C for 2 min, 95 ◦C for 2 min, 35 cycles of 95 ◦C for 3, 60 ◦C (Table 1) or 57 ◦C (Table 2) for 30 s. Melting curve analysis was done with a 60–95 ◦C range, at 0.5 ◦C increments, to assess primer specificity, showing an individual peak for each gene. The obtained data was normalized through the 2 (−ΔΔCt) formula (Livak and Schmittgen, 2001), using UBIQUITIN and ACTIN as reference genes (Løvdal and Lillo, 2009). 2.7. Western blotting analysis of RbcL and D1 Soluble proteins from frozen shoot samples were extracted, under ice-cold conditions, as described in Sousa et al. (2022). Total soluble protein content was then determined spectrophotometrically (at 595 nm) according to the Bradford method (Bradford, 1976), using different concentrations of bovine serum albumin for the calibration curve. Four parts of the protein sample were then mixed with one part of 5x SDS-PAGE Sample Loading Buffer (NZytech®, Portugal) and incubated at 100 ◦C for 5 min. After a quick centrifugation, samples were allowed to cool down to room temperature before being used for western blotting. SDS-PAGE was performed using a 12.5% polyacrylamide gel (Laemmli, 1970), loading the volume containing 15 μ g of each protein extract. BLUE Wide Range CSL-BBL Prestained Protein Ladder (Cleaver Scientific Ltd) was used as a protein molecular weight marker. Following electrophoresis, proteins were transferred to a nitrocellulose membrane through the Trans-Blot Turbo Transfer System (Biorad®), with a buffer containing 25 mM Tris, 192 mM glycine, and 20% (v/v) methanol. Then, the membrane was blocked for 30 min, under constant agitation, in TBS-T buffer [20 mM Tris, 150 mM NaCl, 0.1% (w/v) Tween®20] supplemented with 5% (w/v) skim milk and subsequently incubated overnight at 4 ◦C, under constant rotation, with antibodies raised against PsbA/D1 (AS05 084, Agrisera, Sweden) or RbcL (AS03 037, Agrisera, Sweden), diluted to 1:10 000 and 1:7 500, respectively. The housekeeping protein tubulin (AS10 680, Agrisera, Sweden), diluted 1:1 000, was used as an internal loading control. Membranes were then washed three times with TBS-T buffer before incubating for 1 h, under constant rotation, with anti-Rabbit IgG (H&L), HRP conjugated (AS09 602, Agrisera, Sweden), diluted to 1:10 000. Then, membranes were washed three times with TBS-T and one time with dH 2 O. The reaction was then revealed using Clarity Western ECL Blotting Substrate and imaged through a Chemidoc™ XRS +System (Biorad®), with the F. Rodrigues et al. Plant Physiology and Biochemistry 206 (2024) 108270 4 software Image Lab™ 5.2 (Biorad®). Band intensity was estimated by measuring the mean signal intensity of each band, using ImageJ/Fiji (Schindelin et al., 2012). Values were normalized against the relative intensity of tubulin for each situation and relativized against the control. 2.8. Statistical analysis Each determination was performed on at least three biological replicates (n ≥3). Results were expressed as mean ±standard error of the mean (SEM). After assessing the homogeneity of variances (BrownForsythe test), the effects of the two factors [SALT and HEAT] were analysed running a two-way ANOVA (Table S1). Differences between groups were then discriminated by Tukey’s post-hoc test. To execute a principal component analysis (PCA), the results obtained for each tested parameter were plotted and the first two components used for biplots. All statistical procedures, along with a Pearson correlation test (Table S2), were performed on GraphPad Prism version 9.5.0 for Windows (GraphPad Software, San Diego, California USA, www.graphpad. com). Data visualization through clustered heatmaps was obtained through the use of the heatmaply package in R. 3. Results 3.1. Specific leaf area (SLA) and cell viability assay As observed in Fig. 1a, combined stress resulted in smaller leaves than those from the individual conditions, which were equally affected in comparison with the CTL. Concerning cell death, results indicate that no major symptoms were induced regardless of the imposed stress, as no bluish spots could be observed on the leaf surface (Fig. 1a). Although no other severe macroscopic toxicity symptoms were detected, aside from the stunted growth, equally diminished specific leaf area (SLA) was observed for all treatments. This significant reduction in SLA (30–42%) regardless of the stress condition (Fig. 1b) indicates that an increase in leaf mesophyll density and/or thickness occurred independently of the treatment. 3.2. Chlorophylls (a and b) and carotenoids As can be seen on Fig. 2 and on Table S1, the ANOVA shows a significant effect of both stress factors on photosynthetic pigments. This was constant among both groups of chlorophylls and carotenoids, with a ~24% decrease for HEAT and a 30–38%% for SALT. The COMBINED treatment led to a decrease of ~70% in both photosynthetic pigments. 3.3. Chlorophyll fluorometry 3.3.1. Photochemical efficiency at plant growing light conditions Results indicate that there was a small yet significant increase (3%) in F v /F m in plants grown under the combined treatment (Fig. 3a). Besides, despite the individual stressors negatively affecting Φ PSII, and rETR (reductions of 8% and 22% for SALT and HEAT, respectively), no differences were found between leaves of COMBINED and CTL (Fig. 3b and c). Lastly, NPQ was increased in all stressed plants (SALT: 193%; HEAT: 103%; COMBINED: 119%) when compared to the CTL (Fig. 3d). 3.3.2. Rapid light curves (RLC) The plot in Fig. 4 shows the variation of photochemical efficiency of PSII (a), electron transport rate (b), and non-photochemical efficiency Table 1 Forward (Fwd) and reverse (Rev) qPCR primers for genes related to photosynthesis, along with the respective amplicon size and melting temperature. Name Sequence Amplicon Size (bp) Melting Temperature (◦C) Reference D1 Fwd: TGGATGGTTTGGTGTTTTGATG 191 54.03 Mariz-Ponte et al. (2021) Rev: CCG TAAAGTAGAGACCCTGAAAC 54.83 CP47 Fwd: CCTATTCCATCTTAGCGTCCG 142 54.90 Rev: TTGCCGAACCATACCACATAG 54.87 RbcS Fwd: TGAGACTGAGCACGGATTTG 148 54.90 Rev: TTTAGCCTCTTGAACCTCAGC 54.79 RbcL Fwd: ATCTTGCTCGGGAAGGTAATG 81 54.68 Rev: TCTTTCCATACCTCACAAGCAG 54.64 Table 2 Forward (Fwd) and reverse (Rev) qPCR primers for stress-related genes, along with the respective amplicon size and melting temperature. Name Sequence Amplicon Size (bp) Melting Temperature (◦C) HsfA1 Fwd: GCAGTTGAGGGAAAAGTGGG 159 59.04 Rev: ATCAGGGGAACAAGGGCTTT 59.21 HsfA2 Fwd: CAATGTCAGGCCGGATTCTG 125 58.98 Rev: CTACTTCCTCTGCTGCTCGA 58.9 Hsp70 Fwd: TAAGGTGCCTGCTGACGTAA 193 59.03 Rev: TGTACCAGCACCAGGAGAAG 59.02 NHX2 Fwd: GTCAGCTGGTGTTGGAGTTG 190 59.05 Rev: GCGCTTCATAACGACTCCAG 59.08 Fig. 1. Cell death (a) and specific leaf area (b) in Solanum lycopersicum plants after 3-weeks of growth under daily exposure to 42 ◦C (4 h) and irrigation with or without 100 mM NaCl. Leaves in (a) are visually representative of each situation. Data are presented as mean ±SEM (n ≥3). Distinct letters above bars indicate significant (p ≤0.05) differences between groups. F. Rodrigues et al. Plant Physiology and Biochemistry 206 (2024) 108270 5 Fig. 2. Chlorophyll a (a) and b (b), total chlorophyll (c) and carotenoid (d) content of Solanum lycopersicum leaves after 3-weeks of growth under daily exposure to 42 ◦C (4 h) and irrigation with or without 100 mM NaCl. Data are presented as mean ±SEM (n ≥3). Distinct letters above bars indicate significant (p ≤0.05) differences between groups. Fig. 3. F v /F m (a), Φ PSII (b), rETR (c), and NPQ (d) of Solanum lycopersicum leaves after 3-weeks of growth under daily exposure to 42 ◦C (4 h) and irrigation with or without 100 mM NaCl. Data are presented as mean ±SEM (n ≥3). Distinct letters above bars indicate significant (p ≤0.05) differences between groups. F. Rodrigues et al. Plant Physiology and Biochemistry 206 (2024) 108270 6 (c) as a function of increasing light intensities in the rapid light curves trials. CTL and SALT appear to saturate at PPFD ~500–600 μ mol photons m −2 s −1 , with the maximum ETR values being around 70 μ mol m −2 s −1 . Contrarily, saturation for COMBINED and HEAT only occurred at the last light step, but while ETR for the former peaked at 80 μ mol m −2 s −1 , COMBINED plants showed maximum values of over 105 μ mol m −2 s −1 . At low PPFD, all stressed plants were dissipating more light energy by NPQ than the CTL, however, for successive increments in light intensity this difference diminishes, and only plants singly exposed to salinity stress consistently maintained higher NPQ values than CTL (Fig. 4c), which corroborates the results obtained under growth light conditions (Fig. 3 d). Fig. 4. Φ PSII (a), rETR (b), and NPQ (c) of Solanum lycopersicum leaves exposed to PPFD increments after 3-weeks of growth under daily exposure to 42 ◦C (4 h) and irrigation with or without 100 mM NaCl. Data are presented as mean ±SEM (n ≥3). Distinct letters above bars indicate significant (p ≤0.05) differences between groups. Fig. 5. Transpiration (a), stomatal conductance (b), carbon assimilation (c), C i /C a (d), and WUE i (e) of Solanum lycopersicum leaves after 3-weeks of growth under daily exposure to 42 ◦C (4 h) and irrigation with or without 100 mM NaCl. Data are presented as mean ±SEM (n ≥3). Distinct letters above bars indicate significant (p ≤0.05) differences between groups. F. Rodrigues et al. Plant Physiology and Biochemistry 206 (2024) 108270 7 3.4. Gas exchange measurements Regarding gas-exchange parameters (Fig. 5), there is a clear distinction between two groups (CTL and HEAT x SALT and COMBINED). The latter pair of stressed plants exhibited decreased E and g s (~70–80%; Fig. 5a and b), P N (~55%, Fig. 5c), and C i /C i (14%, Fig. 5d). As expected, an opposite pattern was observed for WUE i (Fig. 5e), since the reduction caused by these treatments in g s was higher than in P N (Fig. 5b and c), with SALT and COMBINED presenting values ~80% higher than those found in CTL plants. 3.5. D1, CP47, RbcS and RbcL gene expression pattern SALT heavily impacted the transcript accumulation of both PSIIrelated genes by 85–90% (Fig. 6a and b), while the combination with heat led to a lesser inhibitory response of 55% and 73% for CP47 and D1, respectively, with the ANOVA showing an interaction between HEAT and SALT (Table S1). HEAT plants showed an inhibition of 72% for both genes. Regarding RuBisCO (Fig. 6c and d), RbcS, a gene located in the nuclear genome, was identically repressed by both stressors and their combination (40–55% lower than in CTL) but for RbcL, located in the chloroplast genome, the lowest transcript accumulation (76% less than CTL) was observed for HEAT treatment. Contrarily, SALT led to the highest accumulation of RbcL transcripts, with a 74% increment in relation to the CTL. In combination with HEAT (COMBINED), the accumulation of RbcL transcripts decreased in relation to SALT, being statistically similar to the CTL (Fig. 6d). 3.6. Transcriptional regulation of heat and salinity stress-related genes Data revealed that only HEAT led to an inhibition of HsfA1 transcription (53%) (Fig. 7a). Regarding HsfA2, no differences could be found between the stress conditions and the CTL (Fig. 7b). In Fig. 7c, it can be observed that transcript accumulation for Hsp70 was strongly increased (about 2.94-fold) under high-temperature treatments (HEAT and COMBINED). On another hand, only the SALT treatment had an effect on the expression of NHX2 causing a 71% increase in its transcripts (Fig. 7d). 3.7. Western-blotting analysis of D1 and RbcL content Protein immunoblots analysis, and pixel-based quantification of band intensity (normalized against the tubulin band intensity), indicated that the content of D1 protein (~35 kDa) decreased under salt exposure, individually (67% decrease) and especially in combination with heat (81% decrease), and was slightly less abundant in HEAT (decrease of 25%) as well (Fig. 8a). Contrarily, regarding RbcL (~50 kDa), all stress conditions led to a higher accumulation of this protein (1.675and 2.99-fold increase in SALT and HEAT, respectively), especially in the combined treatment (4.48-fold) (Fig. 8b). 3.8. Principal component analysis (PCA) and clustered heatmap A principal component analysis was performed to find correlations between distinct groups/conditions and all evaluated endpoints (Fig. 9). Also, a heatmap was constructed from these results to better analyse and summarize the main outputs (Fig. 10). Regarding the PCA, more than 72% of the total variance was explained by the two main components, with the first one explaining 51.92% and the second one 20.24%. As can be observed in Fig. 9, CTL and HEAT appeared to be distant from each other (respectively in the 2nd and 3rd quadrants) and from the other two treatments, SALT and COMBINED, that showed high proximity, appearing both in the 1st quadrant. This separation between groups can also be perceived on the clustered heatmap (Fig. 10), where both salt treatments are mostly associated with decreased photosynthetic pigments, gas-exchange parameters, and the expression of genes coding for PSII crucial proteins (CP47 and D1) as well as protein levels of D1. Furthermore, both employed approaches highlighted that CTL plants were characterized by a high expression of photosynthesis-related genes and an enhanced content of photosynthetic pigments, as well as improved P N , g s, and E. Contrastingly, combined stress differed from all other treatments by a very high decrease of chlorophyll and carotenoids and an increment in F v /F m and rETR and Φ PSII , the latter especially in the RLC trial. Fig. 6. Transcript accumulation of D1 (a), CP47 (b), RbcS (c), and RbcL (d) of Solanum lycopersicum leaves after 3-weeks of growth under daily exposure to 42 ◦C (4 h) and irrigation with or without 100 mM NaCl. Data are presented as mean ±SEM (n ≥3). Distinct letters above bars indicate significant (p ≤0.05) differences between groups. F. Rodrigues et al. Plant Physiology and Biochemistry 206 (2024) 108270 8 Fig. 7. Transcript accumulation of HsfA1 (a), HsfA 2 (b), Hsp70 (c), and NHX2 (d) of Solanum lycopersicum leaves after 3-weeks of growth under daily exposure to 42 ◦C (4 h) and irrigation with or without 100 mM NaCl. Data are presented as mean ±SEM (n ≥3). Distinct letters above bars indicate significant (p ≤0.05) differences between groups. Fig. 8. Immunoblot analyses of D1 (AS05 084, Agrisera, Sweden) (a) and RbcL (AS03 037, Agrisera, Sweden) (b) protein abundance in Solanum lycopersicum leaves after 3-weeks of growth under daily exposure to 42 ◦C (4 h) and irrigation with/without 100 mM NaCl. Tubulin (AS10 680, Agrisera, Sweden) (c) was used as a reference protein. Pixel intensity was calculated by normalization against the reference protein and values were normalized against the control for D1 (d) and RbcL (e). Data are presented as mean ±SEM (n ≥3). Distinct letters above bars indicate significant (p ≤0.05) differences between groups. Fig. 9. Biplot-based PCA elucidating the differential response of Solanum lycopersicum plants after 3-weeks of growth under daily exposure to 42 ◦C (4 h) and irrigation with or without 100 mM NaCl. F. Rodrigues et al. Plant Physiology and Biochemistry 206 (2024) 108270 9 4. Discussion Together with drought, the rising heat waves and increased salinization are two of the most impactant abiotic stresses nowadays. Thus, as a follow-up to our previous work on the regulation of the plants’ redox status (Sousa et al., 2022), this study aimed to unravel the response of cherry tomato plants to the combination of heat and salt stresses in terms of photosynthetic performance and cell viability. 4.1. The combination of stresses was the most impactful treatment in plant performance, despite all treatments equally diminishing SLA Tomato plants exposed to either salt or heat present reduced organ elongation and biomass, with the co-exposure to both stresses leading to a more severe effect (Sousa et al., 2022). This damage was associated with a disturbed ionic balance, with an increased sodium accumulation leading to high phytotoxicity (Sousa et al., 2022). The present results show that these negative effects also expand in terms of leaf area and mesophyll structure, which was confirmed by the impact of the different treatments on SLA. Despite other works showing the opposite, some reports suggest that salt stress can lead to thicker leaf lamina, which can result from bigger mesophyll cells or increased cell layers (Bayuelo-- Jim´ enez et al., 2012). Also, the results of Bayuelo-Jim´ enez et al. (2012) showed that Phaseolus species exposed to increasing NaCl levels presented lower SLA, which in turn, in salt-tolerant genotypes, was suggested to be a tolerance mechanism. Since salt-induced stomata closure can lead to decreased carbon availability, plants presenting thicker mesophylls might have increased internal surface area for CO 2 absorption, counteracting limited carbon assimilation. Thus, the reduction in SLA could be a way to mitigate the stomatal limitations of photosynthesis and, hence, plant growth. Moreover, previous works (Poorter and Garnier, 2007) comparing species with contrasting SLA values, showed that, under stress conditions, a lower SLA is correlated with higher nutrient retention and protection from dehydration. In this sense, the reduction of SLA herein observed can indicate a possible defensive trait, mostly when considering SALT and COMBINED. Regarding HEAT, a different strategy can be hypothesized, since irrigation was not limiting and previous reports show that the reduced biomass was not related to nutrient imbalances in plants exposed to these conditions (Sousa et al., 2022). Knight and Ackerly (2003) reported that plants with lower SLA presented increased thermotolerance, with this higher mesophyll density being coupled with a higher HSP content in the chloroplast and an enhanced ETR recovery after heat stress. Curiously, our results only agree with this assessment when plants were submitted to the joint effect of both heat and salinity. Nonetheless, both heat-related treatments presented higher rETR at increasing light intensities, which might indicate the enhancement of protective strategies. In what concerns the combined stress, it is possible to see that leaf size was severely reduced in comparison with the individual stresses, being directly related to the decreased height and biomass previously observed by our research group (Sousa et al., 2022). We had previously hypothesized that this synergistic effect between stressors in plant growth could be related to salinity negatively influencing the transpiration rate, thus increasing the susceptibility to heat stress (Sousa et al., 2022). However, in terms of photosynthetic performance assessed by PAM fluorometry and gas-exchange parameters, plants subjected to combined stressors were not more affected than those subjected to individual stressors. Therefore, the severely reduced plant growth observed can be ascribed mainly to the mobilization of resources for defense pathways (Sousa et al., 2022) or the negative impacts of these stress factors in other important processes, such as cell expansion and division. Furthermore, even though salinity (Parihar et al., 2015) and moderate heat stress (Hassan et al., 2021; Wahid et al., 2007) commonly lead to cell death, Evans Blue dye was not able to cross the membranes indicating that these stressors did not significantly affect cell viability. Indeed, previous results (Sousa et al., 2022) have shown that, at least in these conditions, tomato plants exposed to salt and/or heat, did not present increased lipid peroxidation, with these results being related to an efficient antioxidant machinery, where proline had a prominent role since this metabolite is heavily associated with membrane stability (Spormann et al., 2023). Moreover, another work (Banu et al., 2009) demonstrated the importance of proline in reducing cell damage in salt-stressed (50–200 mM NaCl) tobacco. 4.2. Heat and salt combination impacts the transcriptional and biochemical control of photosynthetic players, but without major effects on overall yield The initial step in the photosynthetic machinery is the absorption of light energy by the photosynthetic pigments chlorophylls and carotenoids. Although very important, they are also very susceptible to stress (Singh et al., 2018), with heat and salt being able to interfere with the production of chlorophyll precursors and the activity of several important players in the biosynthetic pathways of chlorophylls and carotenoids (Ashraf and Harris, 2013; Santos, 2004; Ann et al., 2011; Maurya et al., 2015). Accordingly, the results herein obtained show that these stressors impacted either the production or degradation of both sets of pigments, leading to a reduction in their levels. Moreover, these effects Fig. 10. Clustered heatmap, elucidating the differential response on the performance of Solanum lycopersicum plants after 3-weeks of growth under daily exposure to 42 ◦C (4 h) and irrigation with or without 100 mM NaCl. The mean values of the numerous parameters obtained in this study were normalized and clustered. The color scale displays the intensity of normalized mean values of distinct parameters. F. Rodrigues et al.