Unraveling the impact of hyperglycemia on early embryonic development

Daniela Machado Costa Unraveling the impact of hyperglycemia on early embryonic development outubro de 2022 UMinho | 2022 Daniela Machado Costa Unraveling the impact of hyperglycemia on early embryonic development Universidade do Minho Escola de Ciências University of Minho School of Sciences Daniela Machado Costa Unraveling the impact of hyperglycemia on early embryonic development Masters Dissertation Master’s in Molecular Genetics Dissertation supervised by Doutora Rute Carina Silva Moura Doutora Maria Manuela Ribeiro Costa october 2022 ii DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS Este é um trabalho académico que pode ser utilizado por terceiros desde que respeitadas as regras e boas práticas internacionalmente aceites, no que concerne aos direitos de autor e direitos conexos. Assim, o presente trabalho pode ser utilizado nos termos previstos na licença abaixo indicada. Caso o utilizador necessite de permissão para poder fazer um uso do trabalho em condições não previstas no licenciamento indicado, deverá contactar o autor, através do RepositóriUM da Universidade do Minho. Licença concedida aos utilizadores deste trabalho Atribuição-NãoComercial-SemDerivações CC BY-NC-ND https://creativecommons.org/licenses/by-nc-nd/4.0/ iii Acknowledgments Once, a good friend of mine told me that, a small positive thought in the morning every day, could change my whole day, week, or month. Now, in this work I would like to acknowledge all the people that stood by my side and helped me to achieve this major goal in my life. First of all, I would also like to express my gratitude to the School of Sciences and the School of Medicine for all the resources made available during my path. To all the teachers who were part of my academic journey from kindergarten to the end of this master’s degree, I offer my truthful thanks because everything they taught me is what made me get to where I am now. To Professor Manuela Costa for supervising this work and for all the availability. To Doctor Rute Moura, who has been accompanying me for the last 4 years, for always believing in me, and for the advices and patience that helped me to get to where I am. Furthermore, I would like to acknowledge my colleagues from I1.03 specially Hugo and Inês for the partnership and all the support during this work. I would also like to thank to those that always supported me, my friends. To all of my friends from CAB, which were there to support me when I needed to laugh, to talk and to work. A special thanks to Mel for all the pep talks during the car rides. To my boyfriend, my rock, the person that never lets me give up. Thank you for being present in all the moments of my life (specially the not so good ones). Thank you for listening to my frustations, for helping me with the charts, for trying to teach me to program, and for hugging me when I most needed it. And last but not least, to my parents and brother, to whom I dedicate this thesis, for the unconditional support, patience and love. For being present in all the important moments of my life and for making me the person that I am today. The work presented in this dissertation was performed at the Surgical Sciences Research Domain of the Life and Health Sciences Research Institute (ICVS), School of Medicine, University of Minho, Braga, Portugal (ICVS/3B’s – PT Government Associate Laboratory, Braga/Guimarães, Portugal). This work has been funded by National funds, through the Foundation for Science and Technology (FCT) – project UIDB/50026/2020 and UIDP/50026/2020. iv Statement of Integrity I hereby declare having conducted this academic work with integrity. I confirm that I have not used plagiarism or any form of undue use of information or falsification of results along the process leading to its elaboration. I further declare that I have fully acknowledged the Code of Ethical Conduct of the University of Minho. v Resumo Estudo do impacto da hiperglicemia no desenvolvimento embrionário precoce A diabetes é uma doença crónica caracterizada por níveis anormalmente elevados de glucose no sangue, causando hiperglicemia. A prevalência estimada de diabetes na população adulta está aumentar e aproximadamente um em cada dois adultos com diabetes não é diagnosticado, incluindo mulheres em idade reprodutiva. A hiperglicemia descontrolada contribui para um ambiente prejudicial in utero durante a gestação, comprometendo o desenvolvimento embriofetal. A hiperglicemia nas fases iniciais do desenvolvimento embrionário compromete a organogénese e causa anomalias congénita, porém, os mecanismos que as originam ainda não foram totalmente elucidados. Os modelos de mamífero são cruciais para entender os processos responsáveis pelo desenvolvimento de defeitos induzidos pela diabetes, mas enfrentam limitações éticas, práticas ou técnicas. Por outro lado, o modelo do embrião de galinha é adequado para estudar malformações embrionárias porque é acessível para simular distúrbios gestacionais específicos e é semelhante ao embrião de mamífero. Neste sentido, este projeto teve como objetivo caracterizar o impacto da hiperglicemia nos estadios iniciais do desenvolvimento embrionário usando um modelo in ovo . Para a indução de hiperglicemia, ovos de galinha fertilizados foram injetados com diferentes doses de D-Glucose usando, diferentes abordagens, e incubados durante 5 dias. O modelo in ovo foi validado através da determinação dos níveis de glucose sanguínea e no ovo. Os embriões foram analisados macroscopicamente para detetar malformações severas. Posteriormente, os tecidos foram analisados a nível molecular. Os resultados mostraram que é possível induzir diferentes cenários de hiperglicemia in ovo , reprodutíveis e independentes do efeito sistémico materno. A administração de glucose causou aumento na taxa de mortalidade e de malformações no embrião, de forma dose-dependente. A análise molecular revelou um aumento nos níveis de expressão de igf2 e, por outro lado, uma diminuição nos níveis de expressão de glut1 em fígados hiperglicémicos. Por fim, a atividade da superóxido dismutase, nos embriões malformados, diminui significativamente quando comparados com os controlos. Este modelo permite de uma forma sistemática, barata e facilmente reprodutível criar diferentes cenários hiperglicémicos durante o desenvolvimento embrionário. Altos níveis de glucose têm um forte efeito teratogénico durante o desenvolvimento do embrião, levando à desregulação do metabolismo da glucose e, alterando o stress oxidativo nas células. Palavras-chave: Desenvolvimento embrionário; Hiperglicemia; Glicose; Malformações congénitas. vi Abstract Unraveling the impact of hyperglycemia on early embryonic development Diabetes is a chronic condition associated with abnormally high blood glucose levels causing hyperglycemia. The estimated prevalence of diabetes in the adult population is increasing, and almost one in two adults with diabetes is undiagnosed, including women of reproductive age. Uncontrolled hyperglycemia contributes to a harmful in utero environment during gestation, impacting embryofetal development. Hyperglycemia in the early stages of embryonic development increases the risk of impairing organogenesis, which may cause severe developmental abnormalities; however, the mechanisms underlying these events are not yet fully understood. Mammalian animal models are crucial to understanding the pathophysiology of diabetes-induced defects throughout gestation but face ethical, practical, or technical limitations. Conversely, the chicken embryo model is suitable for studying embryo malformations because it is accessible to simulate specific gestational disorders and is similar to the mammalian embryo. Therefore, this project aimed to characterize the impact of uncontrolled hyperglycemia at the early stages of embryonic development using the in ovo approach. For this purpose, fertilized chicken eggs were injected with different doses of D-Glucose through different experimental approaches, and incubated for five days. The in ovo model was validated by determining blood glucose levels and glucose levels in the egg environment. Embryos were characterized at the macroscopic level and evaluated for the presence of gross malformations. Subsequently, tissues were analyzed at the molecular level to further support the model. Results showed that it is possible to induce different scenarios of hyperglycemia in ovo , in an extremely reproducible way and totally independent of the maternal systemic effect. The administration of glucose caused an increase in the mortality malformation rate in the developing embryo in a dose-dependent manner. The molecular analysis revealed an increase in igf2 expression levels and a decrease in the expression levels of glut1 in hyperglycemic livers. Finally, the activity of superoxide dismutase significantly decreased when compared to control groups. This model allows a systematic, inexpensive, and easily reproducible way to create different hyperglycemic scenarios during embryonic development. High glucose levels have a strong teratogenic effect during embryo development, disturbing glucose metabolism by the liver and altering the oxidative state of the cells. Keywords: Embryonic development; Hyperglycemia; Glucose; Congenital Malformations. vii Table of Contents Acknowledgments ............................................................................................................................... iii Statement of Integrity ......................................................................................................................... iv Resumo............................................................................................................................................... v Abstract.............................................................................................................................................. vi List of abbreviations ............................................................................................................................. x List of figures ..................................................................................................................................... xii List of tables ...................................................................................................................................... xiii Chapter 1. Introduction .............................................................................................. 1 1.1. Glucose Metabolism ................................................................................................................ 1 1.2. Introduction to Diabetes .......................................................................................................... 2 1.2.1. History of Diabetes .............................................................................................................. 3 1.2.2. Types of Diabetes ................................................................................................................ 3 1.2.3. World Incidence of Diabetes ................................................................................................ 4 1.3. Pregnancy: a period of adaptations .......................................................................................... 5 1.3.1. Hyperglycemia during pregnancy ......................................................................................... 5 1.3.2. Risks of hyperglycemia in pregnancy .................................................................................... 6 1.4. Animal models to study DIP..................................................................................................... 6 1.4.1. Mammalian animal models ................................................................................................. 7 1.4.1.1. Surgical Models ............................................................................................................... 7 1.4.1.2. Chemical models ............................................................................................................. 7 1.4.1.3. Genetic models ............................................................................................................... 8 1.4.1.4. Major difficulties in the use of mammalian models ........................................................... 9 1.4.2. Gallus gallus model ........................................................................................................... 10 Chapter 2. Objectives ............................................................................................... 12 Chapter 3. Materials and Methods ........................................................................... 13 xiv Table 18: Values of egg environment glucose concentration of embryos after air sac injection, with membrane, of varying concentrations of D-Glucose at day 1. ............................................................. 53 Table 19: Values of blood glucose concentration of embryos after air sac injection, with membrane, of varying concentrations of D-Glucose at day 1. .................................................................................... 54 Table 20: Values of egg environment glucose concentration of embryos after air sac injection, with membrane, of varying concentrations of D-Glucose at day 1. ............................................................. 54 Table 21: Values of blood glucose concentration of embryos after air sac injection, with membrane, of varying concentrations of D-Glucose at day 1. .................................................................................... 55 1 Chapter 1. Introduction 1.1. Glucose Metabolism Glucose is the most abundant monosaccharide, a subcategory of carbohydrates, and it is also one of the most important sugars for organisms since it serves as the major cell energy source, through the process of glycolysis (Niaz et al., 2020). Blood circulating glucose can be obtained from three sources: intestinal absorption during the fed state, glycogenolysis, and gluconeogenesis. Plants (rice, potato, wheat, etc…) are a major supply source of carbohydrates, like cellulose and starch, in the human diet. Animals lack the enzymes that can break down cellulose, but they have enzymes that can break down starch into smaller glucose molecules (Chandel, 2021). Starch digestion starts in the mouth by the salivary α-amylase and continues in the small intestine by pancreatic α-amylase. Starch digestion is completed in the small intestine, where the two brush border enzymes, isomaltase and glucoamylase, produce glucose which is then transported through the enterocyte into the bloodstream (Ayua et al., 2021). The absorption of monosaccharides leads to an increase in circulating blood glucose levels. Glycogenolysis is the process of degradation of glycogen, stored in the liver, into glucose. This process is important for maintaining blood glucose levels during meal intervals (Blanco & Blanco, 2017). Finally, after several hours of starvation, gluconeogenesis synthesizes glucose and glycogen from lactate, pyruvate, glycerol, and certain amino acids (Exton, 1972), also contributing to the increasing blood glucose levels. When blood glucose levels are high, β-cells, in the pancreas, are stimulated to produce insulin. Insulin, then, promotes the translocation of glucose transporter 4, GLUT4, from intracellular storage sites to the plasma membrane of fat and muscle cells (Stöckli et al., 2011). GLUT4 belongs to a family of facilitative transmembrane hexose transporters with 14 members, each of which has a distinct affinity and specificity for sugars, as well as different tissue distributions and physiological function (Khan & Pessin, 2002; Lema-Pérez, 2021; Leto & Saltiel, 2012). In the liver, the primary organ for glucose metabolism, there has been documented the expression of several glucose transporters, like GLUT1, GLUT2, GLUT9 and GLUT10 (Karim et al., 2012). 2 Once inside the hepatocytes, glucose is phosphorylated into glucose-6-phophate by glucokinase. Glucose-6-phophate is a key molecule in the metabolism of glucose. From this point, three known metabolic pathways can be followed, namely glycolysis, glycogenesis, or pentose monophosphate pathway (Figure 1). The most important pathway of glucose utilization in the liver is glycogen synthesis due to the necessity of generating a fuel reserve that can be used during fasting periods (Adeva-Andany et al., 2016; Burgess, 2015; Hashimoto, 2016). The dysregulation of hepatic glucose metabolism is the main factor for the development of Diabetes Mellitus. Additionally, the insulin-like growth factors (IGFs) and their binding proteins (IGFBPs) also play an important role in glucose metabolism. Insulin-like growth factor 1 (IGF1) is a liver-derived factor, that can be found in circulation and is mainly responsible for maintaining normal insulin sensitivity, increase glucose uptake, decrease plasma triglycerides, and regulate cholesterol levels (Jensen-Cody & Potthoff, 2021). Insulin-like growth factor 2 (IGF2), mainly synthesized by the liver in adults, inhibits hepatic glucose synthesis and prevents glycogen production (Pouriamehr et al., 2019). 1.2. Introduction to Diabetes Maintenance of a normal plasma glucose concentration requires a precise balance between glucose utilization, endogenous glucose production and dietary glucose ingestion (Giugliano et al., 2008). Diabetes mellitus (DM) is a group of metabolic diseases characterized by hyperglycemia, technical term Figure 1: Summary of liver glucose metabolism (Adeva-Andany et al., 2016). 3 for abnormally high blood glucose levels, in either fasting or after meal states which can result from defects in insulin secretion, insulin action, or both (Alam et al., 2014; American Diabetes, 2009; Kerner & Brückel, 2014). 1.2.1. History of Diabetes Diabetes has been known since ancient times. Clinical features similar to diabetes mellitus, like excessive thirst and copious urination, were described 3500 years ago by the ancient Egyptians (Ahmed, 2002). Around the 5th century BC, the Indian surgeon Sushruta identified diabetes, by using the term madhumeha (honey-like urine) and pointed out not only the sweet taste of the urine but also its sticky feeling to the touch and its ability to attract the ants (Lakhtakia, 2013). However, the term “diabetes” was only introduced by Aretaeus of Cappadocia during the second century AC. Aretaeus gave a precise description of diabetes based only on observation of patients. He described symptoms like increased urine flow, thirst, and weight loss (Bilous et al., 2021; Karamanou et al., 2016). Historical documents show that Greek, Indian, Arab, Egyptian, and Chinese doctors knew about the condition, but none of them could determine its cause (Bilous et al., 2021). In 1815, Chevreul, a French chemist, proved that the sweetness of diabetic urine was due to glucose. By the end of the 19th century, diabetes was divided into two groups, diabète maigre (lean subjects) and diabète gras (obese). A few years later, in 1930, diabetes was classified into insulin-sensitive and insulin-insensitive types. These classifications were the forerunners of the etiological classification into type 1 (insulin-dependent) and type 2 (non-insulin-dependent) diabetes (Tattersall, 2017). 1.2.2. Types of Diabetes Nowadays, World Health Organization distinguishes two main types of DM named type 1 and type 2 diabetes mellitus (World Health, 2019). Type 1 diabetes mellitus (T1DM) is a chronic autoimmune disease, characterized by absolute insulin deficiency induced hyperglycemia, resulting from the destruction of the pancreatic islet β-cells by the interaction of genetic, environmental, and immunological factors. T1DM accounts for 5 to 10 % of the cases of DM and occurs with increasing incidence in childhood. This type of DM requires an immediate need for exogenous insulin replacement (Bailes, 2002; Katsarou et al., 2017; Paschou et al., 2018). 4 Type 2 Diabetes Mellitus (T2DM), the most common form of diabetes, usually diagnosed in people above 40 years, is characterized by deficient insulin secretion by pancreatic islet β-cells, tissue insulin resistance and an inadequate compensatory insulin secretory response. T2DM is a heterogeneous disorder, comprising 90 to 95 % of cases in the diabetic syndrome, and is caused by a combination of genetic factors related to impaired insulin secretion or insulin resistance and environmental factors such as obesity, overeating, lack of exercise, stress, and aging (Galicia-Garcia et al., 2020; Ozougwu, 2013). 1.2.3. World Incidence of Diabetes Over the past years, medical advances have led to a more sophisticated understanding of the causes of diabetes and to an abundance of new tools for managing it. But better treatments have done little to stem the rise of the disease. Diabetes is, nowadays, considered to be in an epidemic state, with 537 million adults with ages between 20–79 years worldwide being diabetic (Figure 2). This represents 10.5% of all adults in this age group (Federation, 2021). This high prevalence of DM seems to be associated with lifestyle changes and globalization, particularly, the sedentary lifestyle of people from First World countries, resulting in obesity, a major cause for the development of T2DM. Figure 2: Estimated total number of adults (20–79 years) with diabetes in 2021 (Federation, 2021). 5 1.3. Pregnancy: a period of adaptations During pregnancy, a woman undergoes many physiological changes in multiple systems, including cardiovascular, respiratory, and metabolic systems, to maintain a healthy balance between the mother and fetus while ensuring proper fetal development. Glucose and amino acids are the primary nutrients for the developing fetus; in the context of glucose metabolism, these adaptations occur to ensure efficient glucose transport, across the placenta, to the developing embryo while maintaining adequate maternal nutrition (Angueira et al., 2015; Moore, 2018). 1.3.1. Hyperglycemia during pregnancy According to WHO and the International Federation of Gynecology and Obstetrics (FIGO), hyperglycemia in pregnancy (HIP) can be classified as either pre-gestational diabetes (PGDM), gestational diabetes mellitus (GDM) or diabetes in pregnancy (DIP) (Hod et al., 2015; World Health, 2013). Pre-gestational diabetes, also called preexisting diabetes in pregnancy, includes women with known type 1, type 2 or rarer forms of diabetes before pregnancy (Alexopoulos et al., 2019). Gestational diabetes is defined as glucose intolerance with onset or first recognition during pregnancy. GDM is usually diagnosed in the second or third trimester of pregnancy and usually resolves following delivery (Buchanan et al., 2007; Landon & Gabbe, 2011; Plows et al., 2018). Diabetes in pregnancy is a more serious type of diabetes, which occurs in pregnant women with hyperglycemia that is first diagnosed during the first trimester of pregnancy (< 13 weeks). Unlike GDM, this condition usually persists beyond birth (Guariguata et al., 2014; World Health, 2013). To further distinguish between GDM and DIP, WHO created a glucose levelbased criterion (Table 1). Table 1: Criteria for the determination of diabetes first detected during pregnancy (World Health, 2013). Gestational diabetes mellitus Diabetes in pregnancy • fasting plasma glucose - 5.1-6.9 mmol/l (92 -125 mg/dl) • 1-hour plasma glucose - ≥ 10.0 mmol/l (180 mg/dl) following a 75g oral glucose load • 2-hour plasma glucose - 8.5-11.0 mmol/l (153 -199 mg/dl) following a 75g oral glucose load • fasting plasma glucose - ≥ 7.0 mmol/l (126 mg/ dl) • 2-hour plasma glucose - ≥ 11.1 mmol/l (200 mg/dl) following a 75g oral glucose load • random plasma glucose - ≥ 11.1 mmol/l (200 mg/ dl) in the presence of diabetes symptoms. 6 The International Diabetes Federation (IDF) estimated that, in 2021, 21.1 million or 16.7% of live births, experienced some form of hyperglycemia during pregnancy. Of these, 80.3% were due to GDM, while 10.6% were the result of diabetes detected prior to pregnancy, and 9.1% due to diabetes (including type 1 and type 2) first detected in pregnancy (Federation, 2021). 1.3.2. Risks of hyperglycemia in pregnancy Any type of diabetes, if not properly managed, can cause severe risk of obstetric and neonatal complications, morbidity, and mortality. The most common fetal adverse outcome found in pregnancies of women with diabetes are fetal and neonatal loss. Other outcomes that are usually observed are premature delivery (delivery occurring before 37 weeks gestation), fetal growth acceleration and macrosomia (newborn with an excessive birth weight - >4 kg and/or >90th percentile weight). Early pregnancy (the first 6–7 weeks) is particularly crucial, as this is when organogenesis occurs. During this period, the embryo does not possess a fully developed pancreas, and, as a consequence, there is no embryonic production of insulin. Production and secretion of insulin by the fetus can only be observed at 19 weeks of gestation so, during the first stages of development, the embryo cannot protect itself from hyperglycemic insults.(Holemans et al., 2003; Murphy et al., 2018; Negrato et al., 2012; Parrettini et al., 2020). In case of uncontrolled hyperglycemia during organogenesis, the most common consequences are spontaneous abortion and congenital malformation of the central nervous system, cardiac system, gastrointestinal system, and genitourinary tract (Sugrue & Zera, 2018). In the present work, the focus will be on diabetes in pregnancy, attempting to characterize the effect of uncontrolled hyperglycemia in the early stages of development of the embryo. 1.4. Animal models to study Diabetes in Pregnancy The increase in women with DIP led to the necessity to advance the use of experimental diabetic models to gain insight into the molecular basis, the pathogenesis of complications and the utility of therapeutic agents in a multifactorial disease such as Diabetes Mellitus. Experimental models of diabetes and pregnancy need to be chosen according to what aspect of the disease that is being investigated. Animal diabetic models can be obtained by surgical procedures, chemical induction, or the use of spontaneous or genetically derived animal strains (Chatzigeorgiou et al., 2009; Jawerbaum & White, 2010). In the early stages of diabetes research, larger animals were used, like dogs and rabbits. 7 Later, the scientists preferred to conduct experiments on smaller animals since they are easier to manipulate and involve smaller expenses. 1.4.1. Mammalian animal models Mammalian animal models, particularly rodent (rats and mice), are widely used to study metabolic disorders. This is due to the fact that because they are mammals, the physiology of mice and rats is closer to that of humans than non-mammalian species (Kleinert et al., 2018). There are several animal models for the study of diabetes; however, in the next subsections, only the mammalian animal models used to study, specifically, diabetes in pregnancy are addressed. 1.4.1.1. Surgical Models The most invasive procedure is the surgical reduction or removal of the pancreas. This procedure results in the decrease of insulin-producing cells and various other pancreatic cells, which ultimately impair the body’s ability to control blood glucose homeostasis. Although moderate hyperglycemia during pregnancy can be successfully achieved with this procedure, there are strong disadvantages to consider. This major procedure can be challenging in rodent animals because of the particular anatomy of the pancreas and pancreatic ducts. Additionally, the surgery can cause inflammation and other changes in the pancreatic microenvironment not necessarily related to diabetes and, in more severe cases, can lead to pregnancy death, and spontaneous abortion. Finally, the removal of 95% of the pancreas takes up to 3 months until diabetes is settled, and normally, in 90% of the cases, a pancreatic regeneration is observed (He et al., 2020; Kottaisamy et al., 2021; Pasek & Gannon, 2013). Despite these disadvantages, partial pancreatectomy remains a viable option to study the outcomes of diabetes during pregnancy on maternal health and the subsequent health of the offspring. 1.4.1.2. Chemical models Various chemicals are currently available to induce diabetes by inducing the death of insulin-producing β-cells or otherwise impairing β-cell function in the experimental animals. Such chemicals are called as diabetogenic agents. Streptozotocin and alloxan are the most commonly used chemical agents to induce diabetes in pregnancy. 8 Streptozotocin (STZ) is an antibiotic extracted from streptomycin, which has a highly selective toxic effect on the islet β cells of experimental animals, which can make insulin secretion insufficient and increase blood glucose (He et al., 2020). Alloxan acts in two different paths: it selectively inhibits glucose-induced insulin secretion through specific inhibition of glucokinase and causes a state of insulin-dependent diabetes through its ability to induce ROS formation, resulting in the selective necrosis of beta cells (Lenzen, 2008). Depending on the animal strain, dose, route of drug administration, and the life-period in which STZ or Alloxan is administered in rats, severe diabetes or mild diabetes can be generated (Damasceno et al., 2014). Alloxan was the first diabetogenic drug to be established however STZ has almost completely replaced the use of alloxan due to a greater selectivity towards β-cells, a lower mortality rate and a longer or irreversible diabetes induction (Maqbool & Mir, 2019). Despite this, STZ is toxic to organs and tissues other than the pancreatic islet β-cells, so this model does not precisely mimic the human condition. Additionally, to induce T2DM, it is necessary to perform STZ injection alongside with the administration of nicotinamide or combine a high fat diet (HFD) feeding followed by a low-dose multiple STZ injections. Taking all of this in perspective, innumerable factors affect the activity of STZ/alloxan and the extent of diabetes induction. Although it is a basic and commonly used model for inducing diabetes, it is challenging due to problems such as variability, high cost, time, and mortality rates (Akinlade et al., 2021; Furman, 2021; Goyal et al., 2016). 1.4.1.3. Genetic models The Cohen diabetic rat is the type 2 diabetic model most used during early organogenesis. This model derives from two contrasting strains: the sensitive (CDs) and resistant (CDr). The CDs rats develop type 2 DM when fed a high-sucrose (72%), and low-copper diet (HSD) for 4 weeks, whereas the CDr rats maintain normoglycemia even when fed HSD. This model is a unique rodent model that allows the study of interactions between the genetic background and environmental nutritional factors with the advantage that this is a nonobese model of diabetes, which allows dissociation of the confounding obesity factor from other diabetogenic genes (Ergaz et al., 2012; Ornoy et al., 2009; Ryu et al., 2008). Nevertheless, this model has never been systematically characterized in terms of phenotype or genotype since it was established many years ago, being this a major drawback (Weksler-Zangen et al., 2001). 9 1.4.1.4. Major difficulties in the use of mammalian models A range of factors requires consideration when selecting an appropriate animal model to study diabetes. Since the human condition can never be equally simulated in an animal model, caution should be taken to extrapolate the results obtained to the human disease and it is also required to validate the results obtained. The use of mammalian animal models, like rats and mice, implies various ethical, economic, and experimental issues. In the first instance, to perform medical research in mammalian animal models, it is necessary to have approval from an ethics commission, which needs to evaluate the purposes of the experiment and if it will bring advancement to the knowledge of human physiology. The European Commission, in 2015, stated that investigators should adopt the 3Rs (Replacement, Reduction and Refinement) policy, first developed by (Russell et al., 1959), when working with animals. Replacement comprises the replacement of protected animals for insentient material like cell lines or cultured tissues; mathematical modeling of existing data sets; use of humans, their tissues, or their cells (with permission); or use of immature forms of animals. Reduction means minimizing the number of animals used to obtain valuable and precise information. Refinement involves either reducing the invasiveness of a technique or improving animal welfare and health during scientific studies (Hubrecht & Carter, 2019; Sneddon et al., 2017). After approval, proper care should be taken to provide living conditions for animals. Normally, these animals need special facilities and access to those facilities normally is very restricted (Pasupuleti et al., 2016). When the subject of the study are pregnant and diabetic animal models, water and food consumption is usually increased, and care should be taken to provide adequate housing considering their increased urination (Jawerbaum & White, 2010). Another setback to the use of this model is the time necessary to perform one single experiment. Between the induction of hyperglycemia in the mother, the process of mating and the successful pregnancy, several weeks pass by (Gallego et al., 2018). In addition, the economic burden to buy and sustain the facilities and the animal’s alimentation and care is too high. Finally, and having in mind the purpose of this work, mammalian animal models are not the most adequate model since there is no direct access to perform embryo analysis and there are maternal influences in the development. 16 For the second procedure, the air sac membrane was preserved intact. 200 µL of CRS and 0.1 mmol to 0.4 mmol of D-Glucose diluted in Chick Ringer Solution were pipetted over the air sac membrane. In both cases, the window was sealed with medical tape, a material that mimics the eggshell, preventing the accumulation of water due to condensation. Eggs were then incubated for 5 days. Table 3: Summary of the D0 air sac injection procedure. 3.3.2.2.2. Day 1 Conversely, a 2-cm window was made above the egg air sac one day after incubation (day 1). Similar to the previous method, different approaches were tested (Table 4). On the first approach, with the help of fine forceps, the air sac membrane was carefully peeled off. 200 µL of CRS was pipetted onto the air sac, and in the case of D-Glucose, the quantity administered was 0.4 mmol. On the second approach, the air sac membrane was preserved intact. 200 µL of CRS and 0.05 mmol to 0.4 mmol of D-Glucose diluted in Chick Ringer Solution were pipetted over the air sac membrane. In the third approach, the air sac membrane was preserved intact. 200 µL of NaCl 0.72%, 0.2 mmol, and 0.4 mmol of D-Glucose diluted in NaCl 0.72% were pipetted over the air sac membrane. In the three scenarios, the window was sealed with medical tape. Eggs were then incubated for four days. Local of Injection Day Membrane Solution Quantity (µL) Quantity (mmol) Air Sac 0 Without Chick Ringer 250 With 200 Without D-Glucose (CRS) 0.375 0.5 With 0.1 0.15 0.2 0.3 0.4 17 Table 4: Summary of the D1 air sac injection procedure. 3.4. Determination of glucose levels On developmental day 5 (E5), the medical tape was gently removed to expose the embryo and the fluid surrounding the embryo was collected using a 24-gauge needle attached to a syringe. Next, with the help of a p10 pipette , 10 µL were used to determine glucose concentration. Live embryos were carefully removed from the egg to a Petri dish. Under the stereomicroscope, and using fine forceps, the amniotic sac was removed, and the embryo was cleaned from residues with a disposable transfer pipette. Then, using a 30-gauge needle attached to a syringe, the aorta was punctured, and blood was pulled out. Subsequently, with the help of a p10 pipette, 10 µL of blood was collected from the syringe to proceed with the measure. In both cases, glucose concentration was immediately measured with a Contour NEXT glucose monitoring kit (Ascensia Diabetes Care US Inc., Parsippany, USA). The Contour Next blood glucose monitoring kit is a device utilized by individuals with diabetes in home settings to quantify glucose in whole blood. Also, it has already been used for investigation purposes, as reported by (Ding et al., Local of Injection Day Membrane Solution Quantity (µL) Quantity (mmol) Air Sac 1 Without Chick Ringer 200 With Chick Ringer NaCl 0.72% Without D-Glucose (CRS) 0.4 With D-Glucose (CRS) 0.05 0.06 0.08 0.1 0.2 0.4 D-Glucose (NaCl 0.72%) 0.2 0.4 18 2020). This kit has a detection range of 20 to 600 mg/dL and can detect glucose in a minimum sample volume of 0.6 μL. 3.5. Developmental Outcome Assessment After 5-day incubation, embryos were classified according to their viability into different categories. Embryos that did not exhibit a heartbeat or were non-developed were considered dead. Conversely, the other embryos were macroscopically analyzed, photographed and divided into alive or malformed embryos. A specific score was attributed to the malformed embryos depending on the severity of the malformations. This score is divided into four categories. The first one reflects embryos with non-severe malformations, for example, in the optical organ (OP). The second category includes embryos with two visible malformations or one severe malformation, in this case the criteria was OP and/or encephalocele (EC)/microcephaly (MC)/anencephaly (ANC). The third category comprises three visible or two severe malformations, OP and/or EC/MC/ANC and ectopia cordis and/ or cardiac edema. Finally, the fourth category contains embryos with most of the above malformations plus unclosed neural folds (UNF) (Table 5). Table 5: Detailed score used to categorize malformed embryos 3.6. RNA extraction, cDNA synthesis and quantitative real-time PCR Total RNA was isolated from the collected liver tissue using the TripleXtrator directRNA Kit (GRiSP Research Solutions, Porto, Portugal). Briefly, tissue was mechanically homogenized and total RNA was prepared according to the manufacturer’s instructions. RNA (1 µg) was reverse transcribed into cDNA using Xpert cDNA Synthesis Kit (GRiSP Research Solutions, Porto, Portugal). Primers for GLUT1 and housekeeping gene β-actin were already available in the lab (Fernandes-Silva et al., 2021). Two sets of primers for IGF1 were obtained from (Penha et al., 2011) and (Ji et al., 2021). Likewise, primers for IGF2 were taken from (Liu, Zhi, et al., 2016)(Table 6). SCORE MALFORMATION 1 one "not severe" malformation (ex: OP) 2 OP &/or MC, EC, ANC 3 OP &/or MC, EC,ANC & + Ectopia Cordis &/ or Cardiac Edema 4 most of the above + UNF (total malformation of the embryo) 19 Initially, primers were tested in a conventional PCR (Biorad, USA) with a temperature gradient to determine the best annealing temperature using NZY Taq 2x Green Master Mix (NZYTech, Portugal) and cDNA from livers of control embryos. Even though, two different pairs of primers for the igf1 gene were tested, neither presented an acceptable expression in liver (Annex 2 - figure 16). However, consistent with (Liu, Zhi, et al., 2016) results, IGF1 expression in embryonic tissues can be found more prominently in muscle so, as a positive control, both pairs of primers for igf1 gene were tested in heart (Annex 2 - figure 17). Accordingly, due to the poor expression of igf1 gene in liver, only the expression levels of igf2 and glut1 genes were evaluated. Then, primer efficiency was also assessed by performing a cDNA concentration gradient by qRT-PCR (Applied Biosystems 7500 Fast Real-Time PCR System; Applied Biosystems, California, USA). qRT-PCR was performed using NZY Supreme qPCR Green Master Mix (2x) (ROX; NZYTech, Lisboa, Portugal) according to the manufacturer’s instructions and with 1 µl of 1:6 diluted cDNA (n ≥ 6 per condition). Each sample was run in duplicate. Data were first normalized for β-actin expression levels and expression variations were calculated following the mathematical model 2^(-ΔCt) (Livak & Schmittgen, 2001). Table 6: Primers and qRT-PCR conditions. Primer sequences forward (Fw) and reverse (Rv), corresponding PCR product size, annealing temperature, and the number of cycles. Gene Sequence 5’-3’ Size (bp) Annealing T (°C) Cycles  – actin Fw – CTTCTAAACCGGACTGTTACCA Rv – AAACAAATAAAGCCATGCCAATCT 100 58 40 glut1 Fw – GCAGTTCGGCTACAACACCG Rv – ATCAGCATGGAGTTACGCCG 222 58 40 igf1 _P Fw –CTTCAGTTCGTATGTGGAGACA Rv – GATTTAGGTGGCTTTATTGGAG 167 58 40 igf1 _J Fw –CCACAAGGGAATAGTGGATGA Rv – CAGAGCGTGCAGATTTAGG 101 60 40 igf2 Fw – AGACCAGTGGGACGAAATAACA Rv – CACGCTCTGACTTGACGGAC 131 58 40 igf1_P - (Penha et al., 2011) and Igf1_J - (Ji et al., 2021) 20 3.7. Superoxide Dismutase activity assay Samples were removed from -80ºC and, before processing, tissues were washed thoroughly with icecold PBS 1x. Next, tissues were homogenized, on ice, with a pellet pestle cordless motor (Kontes Glass, Vineland, New Jersey, USA), in 0.5 mL of PBS with 0.1% of protease inhibitor (Sigma-Aldrich, Missouri, USA) per 100 mg of tissue. Subsequently, tissues underwent sonication (Vibra Cell, SONICS) at an amplitude of 30 for 30 seconds and a pulse of 2. The suspension was centrifuged at 4000 rpm for 10 minutes at 4°C. The supernatant was collected and stored at - 80°C. SOD activity was measured using the Superoxide Dismutase Colorimetric Activity Kit (Invitrogen, Massachusetts, USA). The supernatants, adequately diluted (1:4), were added to the reaction mixture consisting of Xanthine Oxidase Reagent and the enzyme’s substrate. The mixture was incubated at room temperature for 20 minutes, and the absorbance was then measured at 450 nm using a Multimode Microplate Reader Varioskan Flash (Thermo Fisher Scientific Inc, Massachusetts, USA). SOD activity was expressed in units per ml using a Four Parameter Logistic (4PL) Curve (AAT Bioquest, Inc., Sunnyvale, California, USA). 3.8. Statistical analysis Statistical analysis and the graphical representation were performed using GraphPad Prism version 8 (GraphPad Software, La Jolla, San Diego, USA). One-Way ANOVA was performed and followed by Fisher’s Least Significant Difference (LSD) post hoc test for multiple comparisons. All experimental data are presented as mean ± standard deviation (SD). Statistical significance was set for p ≤0.05 (95% confidence level). 21 Chapter 4. Results and Discussion D-Glucose is one of the most important biological compounds found in nature, responsible for generating a large portion of the energy potential required for healthy growth and reproduction (Galant et al., 2015). However, in excess, glucose may have a teratogenic effect in the early stages of development. The first part of this work aimed to establish a hyperglycemic model in ovo , to study the impact of hyperglycemia in early embryo development using several methodologies. 4.1. Establishment of the in ovo model 4.1.1. The effect of exogenous glucose injection procedure on embryo viability and glucose levels To determine if the administration of exogenous glucose was effectively causing an increase in blood glucose levels, therefore leading to a hyperglycemic state, features such as embryo viability, blood and egg glucose levels were assessed. This evaluation was necessary to establish the procedure and proceed to further studies. 4.1.1.1. In ovo injection With the in ovo injection approach, the mortality rate was very inconsistent. The Sham group presented a survival rate of 79%; we consider that this value accounts for the normal survival rate of E5 embryos. From our experience, some embryos naturally die during development. Control groups (treated with vehicle only, CRS) display higher mortality rates, CveCRS(300) and CveCRS(600), than glucose-treated groups. Furthermore, there were random differences in the mortality rate between the glucose-treated groups (Table 7). According to (Scott-Drechsel et al., 2013), yolk-injected embryos, with vehicle solution or glucose, have a higher mortality percentage because the insertion of a syringe by itself into the egg yolk causes a 50% mortality rate for embryos; according to these authors, this procedure is too invasive. Moreover, they describe an increase of 30% in the mortality of D-Glucose embryos compared to the control. In our case, since the values are so inconsistent, we cannot rely on these values. 22 Table 7: Effect of glucose yolk injection on the survival rate of 5-day chicken embryo. Experimental Condition n %Alive %Malformed %Dead Sham 39 79 8 13 CveCRS (300) 41 49 7 44 CveCRS (450) 16 75 6 19 CveCRS (600) 17 18 12 71 D-Glucose 0.03 mmol 12 83 8 8 D-Glucose 0.3 mmol 23 65 9 26 D-Glucose 0.45 mmol 17 59 24 18 D-Glucose 0.6 mmol 17 41 18 41 D-Glucose 0.9 mmol 10 0 0 100 D-Glucose 1.2 mmol 9 56 0 44 CveCRS(xxx) where xxx is the volume injected in µL Moreover, blood glucose was measured to confirm if glucose administration induced a hyperglycemic state. In this procedure, Sham embryos presented a value of 87 mg/dL blood circulating glucose. This value can be considered the basal glucose value since no treatment was applied. In the control group, the values ranged from 83 to 96.64 mg/dL. There were no statistically significant differences between the vehicle and Sham controls. These results are in accordance with what was expected because the addition of a saline solution should not alter the glucose values, as demonstrated by (Scott-Drechsel et al., 2013). For the control groups, we had to use different volumes of CRS to increase the amount of glucose injected; glucose maximum solubility prevented us from obtaining highly concentrated D-Glucose solutions. Consequently, more volume of a less concentrated solution needed to be administrated to inject a larger amount of D-Glucose. When we compared the different vehicle solutions, we obtained differences between CveCRS(300) and CveCRS(600); this result was unexpected because a saline solution should not alter blood glucose levels. On the other hand, glucose values in the treated groups ranged from 84.40 to 103.70 mg/dL (Figure 3A). The reference study showed that the administration of 0.45 mmol of D-Glucose raised plasma 23 glucose to 177 mg/dL, a significantly different value compared to the 72 mg/dL of the control embryos (Scott-Drechsel et al., 2013). Our data is not in agreement with the results obtained by these authors since, in our study, the administration of the same amount of glucose only raised the blood glucose to 103.70 mg/dL. When we increased the quantity of glucose administered, the values dropped (87.75 - 101 mg/dL), instead of rising. Finally, some doses administered revealed a significant difference compared to the controls however these differences were different depending on the volume of CRS administered. Again, this result did not seem reliable since the same dose of glucose should present similar differences with all of the control values, due to the previous mention reason. Also, between doses it was also possible to see significant differences however, due to the high mortality rate, it was not possible to obtain enough measurements to ensure a reliable result (Figure 3B). Taking into consideration these results, and the lack of consistency between groups, a different approach was conducted. Figure 3: ABlood glucose concentration after yolk injection of varying concentrations of D-Glucose at day 0. Results are presented as mean ± SD; BStatistical analysis of blood glucose assay. * p < 0.05; ** p < 0.01, *** p < 0.001, **** p < 0.0001. n≥3 For more details, please refer to Annex 1 – table 13 24 4.1.1.2. Air sac injection Since the egg yolk injection approach displayed inconsistent results in terms of mortality and blood glucose levels, we decided to employ a different methodology to induce hyperglycemia. We assessed different variations of the same administration method (air sac injection) by changing the day of injection (D0 vs D1) and the absence or presence of the eggshell membrane. Different amounts of glucose were evaluated. 4.1.1.2.1. Without membrane 4.1.1.2.1.1. Day 0 With this approach, we obtained around 55% mortality rate for the Sham group and 33% for CRS-treated group. We consider that the Sham mortality rate includes not only the embryos that naturally die during development but also those that have suffered from the experimental procedure. We registered a 7075% mortality rate for the glucose-treated groups, which is most likely due to glucose itself (Table 8). Scott-Drechsel and co-workers also performed a similar assay, however the drops of glucose were performed along four consecutive days (from E0 to E3). With this methodology, they reported a 1% of mortality rate for the vehicle control and 10% for the 0.0075 mmol D-Glucose dose (Scott-Drechsel et al., 2013). These results are quite different from ours, which can be due to the differences in the injection protocol, like time points and the glucose dose administered, which was considerably lower than the ones used in our study. Nonetheless, due to the poor control results we did not trust the procedure by itself. Table 8: Effect glucose air sac injection without eggshell membrane, on day 0 (prior incubation) on the survival and malformation rate of 5-day chicken embryo. Experimental Condition n %Alive %Malformed %Dead Sham 11 27 18 55 CveCRS (250) 9 33 33 33 D-Glucose 0.375 mmol 8 13 13 75 D-Glucose 0.5 mmol 10 10 20 70 CveCRS(250) where 250 is the volume injected in µL 25 To confirm if hyperglycemia was being induced, blood glucose was assessed. The data collected show that there is a significant difference between the controls and the treated embryos (Figure 4) with blood glucose levels rising from 109.50mg/dL in the CRS group to 154 mg/dL in D-Glucose 0.375 mmol treated group and decreasing to 105 mg/dL in D-Glucose 0.5 mmoL treated group. The previous study that sought to induce hyperglycemia for several days, and used different concentrations of D-Glucose, reported 80 mg/dL of blood glucose in treated embryos which means that they could not induce sustained hyperglycemia in the chicken embryos (Scott-Drechsel et al., 2013). However, with the increase in the amount of glucose administered, we expected to detect a significant increase in blood glucose levels. In fact, with this approach, we were able to increase blood glucose circulating levels in one of the treated groups, however, due to the elevated mortality rate we would need an enormous amount of fertilized eggs conduct the study. Our goal was not to induce embryo mortality but hyperglycemic and viable embryos. 4.1.1.2.1.2. Day 1 In the very beginning of mammalian development, the embryo is not immediately exposed to the maternal blood. In fact, contact with maternal blood flow only happens after embryo implantation in the Figure 4: Blood glucose concentration of embryos after air sac injection, without membrane, of varying concentrations of D-Glucose at day 0. Results are presented as mean ± SD. * p < 0.05; ** p < 0.01. n≥1 For more details, please refer to Annex 1 – table14 32 Regarding blood glucose levels, no significant differences were found between the groups. Sham group and vehicle control group presented similar values, 92.40 mg/dL and 97.38 mg/dL, respectively. The values of blood glucose for the glucose treated groups ranged from 88.67 mg/dL to 107 mg/dL (Figure 9). In some groups, it was not possible to obtain a substantial number of measurements due to the higher mortality and malformation rate in the glucose-treated conditions. Moreover, these results are very similar to the ones obtained in the previous methodology however no significant differences were obtained from the controls to the groups of D-Glucose doses. To conclude, we were not able to replicate the results obtained by (Ding et al., 2020; Scott-Drechsel et al., 2013) and (Miller et al., 2005). We reproduced the methods described in these studies to the best of our ability but without success. Figure 8: Egg environment glucose concentration of embryos after air sac injection of varying concentrations of D-Glucose at day 1. Results are presented as mean ± SD. **** p < 0.0001. n≥3 For more details, please refer to Annex 1 – table 18 33 In this sense, we searched the literature to try to find other approaches, and we came across two reports that used NaCl 0.72% as the vehicle solution, instead of CRS, and performed the injections on day 1 (Zhang et al., 2016) and (Tan et al., 2017). Nonetheless, the data we obtained in the previous assays allowed us to select with some confidence the air sac injection maintaining the eggshell membrane (that displayed less mortality rate). Moreover, we opted to assess only two glucose conditions 0.2 and 0.4 mmol. Viability assessment showed that in both controls, the embryos were mostly alive (Cve = 80% and Sham =71%). In the case of the two doses of glucose administered, the mortality rate increased significantly. In the case of D-Glucose 0.2 mmol embryos, 20% were registered as malformed and 64% of the embryos were dead. And, as expected, when the dose of glucose was doubled to 0.4 mmol, the death rate increased to 83% (Table 12). (Zhang et al., 2016) showed that Sham group presented a 6.70% of mortality rate and 0% of gross abnormalities. For the vehicle group, the mortality increased to 10% and abnormalities were seen in 7.40% of the embryos. These results, although with values lower than ours, allow us to conclude that the procedure was successfuly performed. For the glucose treated groups, (Zhang et al., 2016) reported 36.70% of dead embryos for the 0.2 mmol of glucose. (Tan et al., 2017) showed that in the 0.2 mmol group mortality rate was almost 40% Figure 9: Blood glucose concentration of embryos after air sac injection of varying concentrations of D-Glucose at day 1. Results are presented as mean ± SD. n≥3 For more details, please refer to Annex 1 – table 19 34 and in the 0.4 mmol group was 58.3 %. However, they described high percentages of malformations, around 50% for the 0.2 mmol group and 80% for the 0.4 mmol group. These results are not a perfect match to our data, but still, we decided to perform the glucose assessment. Table 12: Effects of glucose air sac injection and NaCl 0.72% on day 1 on the percentage of embryo death and gross abnormality. Experimental Condition n %Alive %Malformed %Dead Sham 113 71 12 18 Cve NaCl(200) 84 80 10 11 D-Glucose 0.2 mmol 133 16 20 64 D-Glucose 0.4 mmol 151 10 7 83 CveNaCl(200) where 200 is the volume injected in µL Like in the previous tests, environment glucose was also assessed. It was possible to see a significant increase in glucose-treated eggs. The values of glucose increased from 136.70 mg/dL in the control group to 255.50 mg/dL in the first dose of glucose, 0.2 mmol, and 330.90 mg/dL in the dose of 0.4 mmol (Figure 10). These results allowed us to conclude that a hyperglycemic environment was being created however it was still necessary to confirm an increase in the blood glucose levels. Figure 10: Egg environment glucose concentration of embryos after air sac injection of varying concentrations of D-Glucose at day 1. Results are presented as mean ± SD. **** p < 0.0001. n≥29 For more details, please refer to Annex 1 – table 20 35 Blood glucose measurement revealed a significant difference between the control group and the doses administered (Figure 11). Blood glucose values rise from 85.80 mg/dL in the control to 94.06 mg/dL in 0.2 mmol dose and 95.40 mg/dL in 0.4 mmol dose. Both, (Tan et al., 2017) and (Zhang et al., 2016), reported that the values of blood glucose rose from 80-90 mg/dL in control to approximately 120 mg/dL in the 0.2 mmol group and 140 mg/dL in the 0.4 mmol group. Despite this difference in the values, we obtained, for the first time, a significant increase in treated groups, meaning that we were able to induce hyperglycemia in the chicken embryo. The subsequent analyses were based on this approach. 4.1.2. The effect of exogenous glucose injection procedure on embryo malformations Exposure of the developing embryo to hyperglycemia can lead to devastating consequences, including spontaneous abortions, stillbirths, neonatal death, and congenital malformations. Malformations occur within the first 10 weeks of pregnancy during early organogenesis and almost any organ system can be affected (Loeken, 2020). Figure 11: Blood glucose concentration of embryos after air sac injection of varying concentrations of D-Glucose at day 1. Results are presented as mean ± SD. * p < 0.05. n≥29 For more details, please refer to Annex 1 – table 21 36 To determine if the exposure of the chicken embryo to exogenous and elevated glucose levels led to the development of severe malformations, a macroscopic analysis was performed. The administration of glucose caused severe malformations in the developing embryo, in a dose-dependent manner (Figure 12). Cve and Sham embryos developed normally. On the contrary, embryos exposed to hyperglycemia presented defects in the optic organ, in the development of the brain (encephalocele, microcephaly, anencephalous), in the development of the neural tube (unclosed neural folds), and the heart ( Ectopia Cordis , Cardiac Edema). It was also possible to observe an abnormal turning of the embryo in some embryos. To analyze these results more systematically, we developed a specific score based on the severity of the malformations. 53.8% of 0.2 mmol glucose embryo malformations and 66.7% of 0.4 mmol embryo malformations were scored as level 4, the highest level of this score. Additionally, 23.1% and 33.3% of 0.2 mmol and 0.4 mmol malformations, respectively, were classified as level 3. Finally, for the 0.2 mmol of glucose, 19.2% of the malformed embryos were categorized as a score level of 2 and 3.8% as a score level of 1. In the case of 0.4 mmol of glucose, there were no malformed embryos classified as level 1 or 2 (Figure 13). Figure 12: Developmental outcome of chicken embryos after D-Glucose exposure. a-Cve; b-Sham; c-0.2 mmol; d-0.4 mmol. Arrow: brain; Asterisk: eye; Arrowhead: aorta; Cardinal: heart; scale bar: 2000 μm. 37 Figure 13: Statistical analysis of the levels of malformation. AScore of malformations of 0.2 mmol embryos; BScore of malformations of 0.4 mmol embryos. A few studies in the literature also reported malformations in the developing embryo when exposed to high doses of glucose (Lawson et al., 2018; Tan et al., 2017; Zhang et al., 2016). Lawson and coworkers demonstrated that hyperglycemia disturbed the normal development of the embryonic chicken heart, causing structural malformations in the endocardial cushions, two thicker areas that develop into the septum and in the outflow tract, a structure that connects the embryonic ventricles to the arterial system in the aortic sac. These malformations affect blood flow patterns, which may further enhance the teratogenic effects of hyperglycemia and contribute to secondary malformations in the vasculature (Lawson et al., 2018). Additionally, it has been reported that a hyperglycemic state during chicken embryo development, leads to a high risk of stillbirth, growth retardation and development of congenital central nervous system (CNS) abnormalities similar to clinical manifestations, such as encephalocele, anencephaly, and exencephaly. The authors also showed that the incidence and severity of malformations increased in a dose-dependent manner (Tan et al., 2017). Lastly, it has been shown that hyperglycemic conditions can induce osmotic stress, causing retina and lens cell lesions, in the chicken embryo. This study demonstrate that high glucose levels led to excess production of ROS, which, in turn, suppressed pax6 expression, an important gene that regulates the formation of the optic vesicle, optic cup, lens placode and retina (Zhang et al., 2016). Our results are in agreement with these studies and indicate that the hyperglycemic conditions induced in our model likely altered both the cardiac and nervous system development, causing the observed 38 malformations. Subsequently, in the second part of this work, we wanted to characterize the impact of hyperglycemia at the molecular level, since few studies have been performed in this area. 4.2. Molecular characterization of the impact of uncontrolled hyperglycemia on the expression levels of key glucose transporters and hormones in the liver Glucose homeostasis must be tightly regulated, and the liver has a major role in controlling various pathways of glucose metabolism, including glycolysis. Glucose entrance into the hepatic cells occurs through transporters like GLUT1. GLUT2 acts as the primary glucose transporter and sensor in rodent pancreatic islets and is widely assumed to play a similar role in humans however recent findings showed that GLUT1 is more expressed in human pancreatic islets and beta-cells (McCulloch et al., 2011). The insulin-like growth factor (IGF) system is an important regulator of growth and development in vertebrates. Throughout embryonic and postnatal development, and in adult life, the IGFs and their binding proteins are expressed in a wide variety of tissues. According to previous studies, IGF1 expression in the liver is undetectable until E19 (Liu, Guo, et al., 2016). In fact, during our conventional PCR studies, igf1 was absent from the liver at E5 (Annex 1Figure 16). Nonetheless, it was detected in the heart of chicken embryo (Annex 1Figure 17), which might indicate that IGF1 may have a significant role in muscle tissue growth during chick embryo development. IGF2 has been shown to act in the muscles, helping to decrease blood glucose levels by facilitating glucose uptake, and to act on the embryonic liver to reduce hepatic glucose output and increase glucose storage as glycogen (Holly et al., 2019). In fact, the expression of IGF2 was detected in the chicken embryo liver on E10 with a peak at E14 (Liu, Guo, et al., 2016). Considering the major role played by GLUT1 and IGF2 in liver/glucose homeostasis, we asked whether they were affected by the induction of hyperglycemia. In this sense, mRNA expression levels of igf2 and glut1 in the liver from live embryos were quantified by qPCR. Results showed a clear increasing tendency in a dose-dependent manner in igf2 expression levels; however, only the 0.4 mmol dose displayed a statistically significant difference with the Sham group. On the other hand, glut1 expression levels decreased in a dose-dependent manner, presenting a statistically significant difference with the control group (Figure 14). 39 Although IGF2 plays a fundamental role in embryonic development in mammals, understanding its physiological and pathological role is limited compared with IGF1 (Dupont & Holzenberger, 2003). Furthermore, a few studies have been conducted in avian species to study the expression of insulin-like growth factor system genes; moreover, the early embryonic period (E0 to E5) has not been extensively studied until today (Liu, Guo, et al., 2016; Liu, Zhi, et al., 2016; Lu et al., 2007; McMurtry et al., 1998; Mohammed et al., 2017; Richards et al., 2005). Some studies, predominantly in mammals, have evaluated IGF2 during a diabetic state (Imai et al., 2010; Sireesha et al., 2009; Xuan et al., 2019). It has been shown that IGF2 levels increase in the liver of diabetic mice (Ge et al., 2018). Indeed, we observed an increase in igf2 expression levels in hyperglycemic livers from chicken embryos. Since there is more glucose in the system, it needs to be properly metabolized by the liver by boosting the storage of glycogen. It seems an expected response considering the over-availability of glucose. On the other hand, GLUT1 has been widely studied in healthy livers and in metabolic disorders (Chadt & Al-Hasani, 2020; Meireles et al., 2017). In 1995, the presence of GLUT1 was characterized for the first time in chicken embryo fibroblasts (Wagstaff et al., 1995). Since then, some studies have described the alterations in GLUT1 in a hyperglycemic state. It has been reported that after D-Glucose administration, glut1 expression decreased in the whole chicken embryo (Tan et al., 2017) and the chicken embryonic eye (Zhang et al., 2016). We detected a significant decrease in glut1 expression in chicken embryo hyperglycemic livers. This downregulation is probably a result of cellular protective mechanisms under the unfavorable high-glucose environment. Figure 14: The effect of exogenous glucose on hepatic igf2 and glut1 expression. Results are presented as mean ± SD, normalized for β-actin. * p < 0.05. n≥6 40 Additionally, a study in a GLUT1 knockout mice revealed that the suppression of GLUT1 lead to the development of embryonic malformations like caudal regression and anencephaly with absence of the head. These malformations are similar to those observed in embryos exposed to the hyperglycemia of maternal diabetes where embryonic GLUT1 is known to be reduced (Heilig et al., 2003). In conclusion, even though only the highest dose of glucose administrated revealed significant alterations in expression of these genes, our results are in accordance with the literature and further validate our approach as a successful method to induce a hyperglycemic state during early embryo development. 4.3. Impact of hyperglycemia in the modulation of oxidative stress Hyperglycemia activates a particular metabolic route that involves diacylglycerol (DAG)—protein kinase C (PKC)—and NADPH-oxidase, culminating in the production of Reactive Oxygen Species (ROS). This pathway has been considered a “dangerous metabolic route in diabetes” because, an increase in oxidizing species in the absence of an antioxidant response, a consequence of hyperglycemia, leads to a state of oxidative stress. This condition can disrupt various signaling pathways that may result in the onset and progression of complications, such as vascular dysfunction and pathologies (NogueiraMachado & Chaves, 2008). Conversely, superoxide dismutases (SODs) are a group of metalloenzymes that constitute a very important antioxidant defense against oxidative stress in the body (Landis & Tower, 2005). These enzymes catalyze the conversion of superoxide(O2-) into oxygen and hydrogen peroxide(H2O2) (Younus, 2018), therefore controlling the levels of ROS and limiting the potential toxicity of these molecules. For this reason, we decided to measure SOD activity in the whole embryo. Specifically, we used normal control versus malformed treated embryos. Results showed that, in a hyperglycemic state, the levels of SOD significantly decrease in glucose-treated embryos when compared to both control groups (Figure 15). 41 During early pregnancy, the embryo uses high levels of oxygen, and because its antioxidant defenses are not well developed, the embryo becomes vulnerable to oxidative damage (Jin et al., 2013). The elevation of ROS during oxidative stress has long been linked to diabetes or diabetic pregnancies (Eriksson & Borg, 1993; Wender-Ozegowska et al., 2004). Alternatively, elevated levels of SOD are shown to lower oxidative stress; however, in diabetic tissues, several studies reported a decline in these levels (Fujita et al., 2009; He et al., 2011; Skrha et al., 1996). Zhang and co-workers showed that embryos treated with D-Glucose presented a higher production of ROS in the eye tissue and decreased in SOD activity levels (Zhang et al., 2016). In our case, we did not analyze a specific tissue; instead, we evaluate whole embryos from severely malformed chicken embryos. Despite that, our results also showed a decrease in the levels of SOD activity, which means that the developing embryos are exposed to a high level of oxidative stress, thus contributing to unfavorable outcomes for the embryo. Figure 15: SOD activity quantification in embryos. Results are presented as mean ± SD. * p < 0.05; ** p < 0.01. n≥6 48 radioimmunoassay. Journal of Endocrinology , 157 (3), 463-473. https://doi.org/10.1677/joe.0.1570463 Meireles, P., Sales-Dias, J., Andrade, C. M., Mello-Vieira, J., Mancio-Silva, L., Simas, J. P., Staines, H. M., & Prudêncio, M. (2017). GLUT1-mediated glucose uptake plays a crucial role during Plasmodium hepatic infection. Cellular Microbiology , 19 (2), e12646. https://doi.org/https://doi.org/10.1111/cmi.12646 Miller, R. R., Jr., Burum, A. L., Leithart, M. E., & Hart, J. D. (2005). Hyperglycemia-induced changes in hepatic membrane fatty acid composition correlate with increased caspase-3 activities and reduced chick embryo viability. Comp Biochem Physiol B Biochem Mol Biol , 141 (3), 323-330. https://doi.org/10.1016/j.cbpc.2005.04.008 Mohammed, R. H., Anderton, H., Brameld, J. M., & Sweetman, D. (2017). Effects of insulin like growth factors on early embryonic chick limb myogenesis. PLoS One , 12 (10), e0185775. https://doi.org/10.1371/journal.pone.0185775 Moore, L. E. (2018). Pathophysiology of Insulin Resistance. In L. E. Moore (Ed.), Diabetes in Pregnancy: The Complete Guide to Management (pp. 1-5). Springer International Publishing. https://doi.org/10.1007/978-3-319-65518-5_1 Murphy, H. R., Bell, R., Dornhorst, A., Forde, R., & Lewis-Barned, N. (2018). Pregnancy in Diabetes: challenges and opportunities for improving pregnancy outcomes. Diabetic Medicine , 35 (3), 292-299. https://doi.org/https://doi.org/10.1111/dme.13579 Negrato, C. A., Mattar, R., & Gomes, M. B. (2012). Adverse pregnancy outcomes in women with diabetes. Diabetology & Metabolic Syndrome , 4 (1), 41. https://doi.org/10.1186/1758-5996-441 Niaz, K., Khan, F., & Shah, M. A. (2020). Chapter 18 - Analysis of carbohydrates (monosaccharides, polysaccharides). In A. Sanches Silva, S. F. Nabavi, M. Saeedi, & S. M. Nabavi (Eds.), Recent Advances in Natural Products Analysis (pp. 621-633). Elsevier. https://doi.org/10.1016/B9780-12-816455-6.00018-4 Nogueira-Machado, J. A., & Chaves, M. M. (2008). From hyperglycemia to AGE-RAGE interaction on the cell surface: a dangerous metabolic route for diabetic patients. Expert Opin Ther Targets , 12 (7), 871-882. https://doi.org/10.1517/14728222.12.7.871 Ornoy, A., Avgil Tsadok, M., Yaffe, P., & Zangen, S. W. (2009). The Cohen diabetic rat as a model for fetal growth restriction: Vitamins C and E reduce fetal oxidative stress but do not restore normal growth. Reproductive Toxicology , 28 (4), 521-529. https://doi.org/https://doi.org/10.1016/j.reprotox.2009.06.005 Ozougwu, O. (2013). The pathogenesis and pathophysiology of type 1 and type 2 diabetes mellitus. Journal of Physiology and Pathophysiology , 4 (4), 46-57. https://doi.org/10.5897/jpap2013.0001 Parrettini, S., Caroli, A., & Torlone, E. (2020). Nutrition and Metabolic Adaptations in Physiological and Complicated Pregnancy: Focus on Obesity and Gestational Diabetes [Review]. Frontiers in Endocrinology , 11 . https://doi.org/10.3389/fendo.2020.611929 Paschou, S. A., Papadopoulou-Marketou, N., Chrousos, G. P., & Kanaka-Gantenbein, C. (2018). On type 1 diabetes mellitus pathogenesis. Endocrine Connections , 7 (1), R38-R46. https://doi.org/10.1530/ec-17-0347 Pasek, R. C., & Gannon, M. (2013). Advancements and challenges in generating accurate animal models of gestational diabetes mellitus. American Journal of Physiology-Endocrinology and Metabolism , 305 (11), E1327-E1338. https://doi.org/10.1152/ajpendo.00425.2013 Pasupuleti, M. K., Molahally, S. S., & Salwaji, S. (2016). Ethical guidelines, animal profile, various animal models used in periodontal research with alternatives and future perspectives. Journal 49 of Indian Society of Periodontology , 20 (4), 360-368. https://doi.org/10.4103/0972124X.186931 Penha, A. M., Schaeffel, F., & Feldkaemper, M. (2011). Insulin, insulin-like growth factor-1, insulin receptor, and insulin-like growth factor-1 receptor expression in the chick eye and their regulation with imposed myopic or hyperopic defocus. Mol Vis , 17 , 1436-1448. Plows, J. F., Stanley, J. L., Baker, P. N., Reynolds, C. M., & Vickers, M. H. (2018). The Pathophysiology of Gestational Diabetes Mellitus. International Journal of Molecular Sciences , 19 (11), 3342. https://www.mdpi.com/1422-0067/19/11/3342 Pouriamehr, S., Barmaki, H., Rastegary, M., Lotfi, F., & Nabi Afjadi, M. (2019). Investigation of insulinlike growth factors/insulin-like growth factor binding proteins regulation in metabolic syndrome patients. BMC Research Notes , 12 (1), 653. https://doi.org/10.1186/s13104-019-4492-9 Rashidi, H., & Sottile, V. (2009). The chick embryo: hatching a model for contemporary biomedical research. BioEssays , 31 (4), 459-465. https://doi.org/https://doi.org/10.1002/bies.200800168 Richards, M. P., Poch, S. M., & McMurtry, J. P. (2005). Expression of insulin-like growth factor system genes in liver and brain tissue during embryonic and post-hatch development of the turkey. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology , 141 (1), 76-86. https://doi.org/https://doi.org/10.1016/j.cbpb.2005.04.006 Russell, W. M. S., Burch, R. L., & Hume, C. W. (1959). The principles of humane experimental technique (Vol. 238). Methuen London. https://doi.org/https://doi.org/10.5694/j.13265377.1960.tb73127.x Ryu, S., Ornoy, A., Samuni, A., Zangen, S., & Kohen, R. (2008). Oxidative stress in Cohen diabetic rat model by high-sucrose, low-copper diet: inducing pancreatic damage and diabetes. Metabolism - Clinical and Experimental , 57 (9), 1253-1261. https://doi.org/10.1016/j.metabol.2008.04.021 Salmanzadeh, M., Ebrahimnejad, Y., Shahryar, H. A., Gorbani, A., & Oskuei, H. R. (2019). The Effects of in ovo Glucose Administration on Hatching Results and Subsequent Blood Glucose Concentration in Newly-Hatched Chicks. Journal of Applied Biological Sciences , 5 (2), 21-22. https://www.jabsonline.org/index.php/jabs/article/view/246 Scott-Drechsel, D. E., Rugonyi, S., Marks, D. L., Thornburg, K. L., & Hinds, M. T. (2013). Hyperglycemia slows embryonic growth and suppresses cell cycle via cyclin D1 and p21. Diabetes , 62 (1), 234-242. https://doi.org/10.2337/db12-0161 Sireesha, M., Sambasivan, V., Kumar, V. K., Radha, S., Raj, A. Y., & Qurratulain, H. (2009). Relevance of insulin-like growth factor 2 in the etiopathophysiology of diabetic nephropathy: Possible roles of phosphatase and tensin homolog on chromosome 10 and secreted protein acidic and rich in cysteine as regulators of repair. Journal of Diabetes , 1 (2), 118-124. https://doi.org/https://doi.org/10.1111/j.1753-0407.2009.00025.x Skrha, J., Hodinár, A., Kvasnicka, J., & Hilgertová, J. (1996). Relationship of oxidative stress and fibrinolysis in diabetes mellitus. Diabet Med , 13 (9), 800-805. https://doi.org/10.1002/(sici)1096-9136(199609)13:9<800::Aid-dia178>3.0.Co;2-q Smith, C. P. (1992). Animal models in biomedical research: Poultry. In (pp. 1). National Agricultural Library. Sneddon, L. U., Halsey, L. G., & Bury, N. R. (2017). Considering aspects of the 3Rs principles within experimental animal biology. Journal of Experimental Biology , 220 (17), 3007-3016. https://doi.org/10.1242/jeb.147058 Stöckli, J., Fazakerley, D. J., & James, D. E. (2011). GLUT4 exocytosis. Journal of cell science , 124 (Pt 24), 4147-4159. https://doi.org/10.1242/jcs.097063 50 Sugrue, R., & Zera, C. (2018). Pregestational Diabetes in Pregnancy. Obstetrics and Gynecology Clinics , 45 (2), 315-331. https://doi.org/10.1016/j.ogc.2018.01.002 Tan, R. R., Li, Y. F., Zhang, S. J., Huang, W. S., Tsoi, B., Hu, D., Wan, X., Yang, X., Wang, Q., Kurihara, H., & He, R. R. (2017). Abnormal O-GlcNAcylation of Pax3 Occurring from HyperglycemiaInduced Neural Tube Defects Is Ameliorated by Carnosine But Not Folic Acid in Chicken Embryos. Mol Neurobiol , 54 (1), 281-294. https://doi.org/10.1007/s12035-015-9581-8 Tan, R. R., Li, Y. F., Zhang, X. T., Huang, Y. H., Wu, Y. P., Ouyang, S. H., Tsoi, B., Yi, R. N., Yang, X., Kurihara, H., & He, R. R. (2013). Glucose metabolism disorder is a risk factor in ethanol exposure induced malformation in embryonic brain. Food Chem Toxicol , 60 , 238-245. https://doi.org/10.1016/j.fct.2013.07.059 Tattersall, R. B. (2017). The History of Diabetes Mellitus. In Textbook of Diabetes (pp. 1-22). https://doi.org/https://doi.org/10.1002/9781118924853.ch1 Vergara, M. N., & Canto-Soler, M. V. (2012). Rediscovering the chick embryo as a model to study retinal development. Neural development , 7 , 22-22. https://doi.org/10.1186/1749-8104-7-22 Wagstaff, P., Kang, H. Y., Mylott, D., Robbins, P. J., & White, M. K. (1995). Characterization of the avian GLUT1 glucose transporter: differential regulation of GLUT1 and GLUT3 in chicken embryo fibroblasts. Mol Biol Cell , 6 (11), 1575-1589. https://doi.org/10.1091/mbc.6.11.1575 Wang, X. Y., Li, S., Wang, G., Ma, Z. L., Chuai, M., Cao, L., & Yang, X. (2015). High glucose environment inhibits cranial neural crest survival by activating excessive autophagy in the chick embryo. Sci Rep , 5 , 18321. https://doi.org/10.1038/srep18321 Weksler-Zangen, S., Yagil, C., Zangen, D. H., Ornoy, A., Jacob, H. J., & Yagil, Y. (2001). The Newly Inbred Cohen Diabetic Rat: A Nonobese Normolipidemic Genetic Model of Diet-Induced Type 2 Diabetes Expressing Sex Differences. Diabetes , 50 (11), 2521-2529. https://doi.org/10.2337/diabetes.50.11.2521 Wender-Ozegowska, E., Koźlik, J., Biczysko, R., & Ozegowski, S. (2004). Changes of oxidative stress parameters in diabetic pregnancy. Free radical research , 38 (8), 795-803. https://doi.org/10.1080/10715760410001700479 West, D. C., Thompson, W. D., Sells, P. G., & Burbridge, M. F. (2001). Angiogenesis assays using chick chorioallantoic membrane. Methods Mol Med , 46 , 107-129. https://doi.org/10.1385/159259-143-4:107 World Health, O. (2013). Diagnostic criteria and classification of hyperglycaemia first detected in pregnancy . https://apps.who.int/iris/handle/10665/85975 World Health, O. (2019). Classification of diabetes mellitus . World Health Organization. https://apps.who.int/iris/handle/10665/325182 Xuan, L., Ma, J., Yu, M., Yang, Z., Huang, Y., Guo, C., Lu, Y., Yan, L., & Shi, S. (2019). Insulin-like growth factor 2 promotes adipocyte proliferation, differentiation and lipid deposition in obese type 2 diabetes. Journal of Translational Science , 6 (5). https://doi.org/10.15761/jts.1000362 Younus, H. (2018). Therapeutic potentials of superoxide dismutase. International journal of health sciences , 12 (3), 88-93. Zhang, S. J., Li, Y. F., Tan, R. R., Tsoi, B., Huang, W. S., Huang, Y. H., Tang, X. L., Hu, D., Yao, N., Yang, X., Kurihara, H., Wang, Q., & He, R. R. (2016). A new gestational diabetes mellitus model: hyperglycemia-induced eye malformation via inhibition of Pax6 in the chick embryo. Dis Model Mech , 9 (2), 177-186. https://doi.org/10.1242/dmm.022012 51 Chapter 7. Supplementary Material Annex 1 Table 13: Values of blood glucose concentration of embryos after yolk injection of varying concentrations of DGlucose at day 0 Experimental Condition n Mean ± S.D. Minimum Maximum Sham 4 87.00 ± 20.18 58 103 CveCRS (300) 11 96.64 ± 10.66 78 118 CveCRS (450) 9 88.44 ± 3.97 82 94 CveCRS (600) 3 83.00 ± 6.93 79 91 D-Glucose 0.03 mmol 5 84.40 ± 4.28 78 90 D-Glucose 0.3 mmol 9 94.25 ± 11.89 76 111 D-Glucose 0.45 mmol 10 103.70 ± 4.66 98 112 D-Glucose 0.6 mmol 5 87.75 ± 3.86 82 90 D-Glucose 1.2 mmol 5 101.00 ± 6.56 92 108 CveCRS(xxx) where xxx is the volume injected in µL Table 14: Values of blood glucose concentration of embryos after air sac injection, without membrane, of varying concentrations of D-Glucose at day 0. Experimental Condition n Mean ± S.D. Minimum Maximum Sham 3 96.33 ± 9.29 86 104 CveCRS (250) 2 109.50 ± 2.12 108 111 D-Glucose 0.375 mmol 1 154.00 ± 0.00 154 154 D-Glucose 0.5 mmol 1 105.00 ± 0.00 105 105 CveCRS(250) where 250 is the volume injected in µL 52 Table 15: Values of blood glucose concentration of embryos after air sac injection, without membrane, of varying concentrations of D-Glucose at day 1. Experimental Condition n Mean ± S.D. Minimum Maximum Sham 1 118.00 ± 0.00 118 118 CveCRS (200) 2 100.50 ± 12.02 92 109 D-Glucose 0.4 mmol 1 106.00 ± 0.00 106 106 CveCRS(200) where 200 is the volume injected in µL Table 16: Values of egg glucose concentration of embryos after air sac injection, with membrane, of varying concentrations of D-Glucose at day 0. Experimental Condition n Mean ± S.D. Minimum Maximum Sham 39 129.50 ± 25.11 85 203 CveCRS (200) 37 132.70 ± 30.54 73 203 D-Glucose 0.1 mmol 32 156.00 ± 35.70 85 241 D-Glucose 0.15 mmol 35 160.70 ± 38.84 101 251 D-Glucose 0.2 mmol 32 204.90 ± 37.42 124 280 D-Glucose 0.3 mmol 33 241.00 ± 43.21 150 310 D-Glucose 0.4 mmol 29 274.70 ± 53.51 154 353 CveCRS(200) where 200 is the volume injected in µL 53 Table 17: Values of blood glucose concentration of embryos after air sac injection, with membrane, of varying concentrations of D-Glucose at day 0. Experimental Condition n Mean ± S.D. Minimum Maximum Sham 17 102.80 ±10.16 89 128 CveCRS (200) 21 94.71 ± 18.73 49 131 D-Glucose 0.1 mmol 15 98.93 ± 6.99 84 109 D-Glucose 0.15 mmol 17 100.10 ± 9.31 90 117 D-Glucose 0.2 mmol 5 91.00 ± 9.35 84 107 D-Glucose 0.3 mmol 5 112.30 ± 6.40 105 119 D-Glucose 0.4 mmol 3 97.33 ± 5.51 92 103 CveCRS(200) where 200 is the volume injected in µL Table 18: Values of egg environment glucose concentration of embryos after air sac injection, with membrane, of varying concentrations of D-Glucose at day 1. Experimental Condition n Mean ± S.D. Minimum Maximum Sham 29 122.70 ± 35.21 35 188 CveCRS (200) 14 118.80 ± 31.39 68 173 D-Glucose 0.05 mmol 4 127.00 ± 24.99 90 145 D-Glucose 0.06 mmol 7 143.00 ± 39.60 86 209 D-Glucose 0.08 mmol 5 132.60 ± 25.23 107 167 D-Glucose 0.1 mmol 5 151.40 ± 30.74 111 184 D-Glucose 0.4 mmol 3 266.30 ± 20.43 243 281 CveCRS(200) where 200 is the volume injected in µL 54 Table 19: Values of blood glucose concentration of embryos after air sac injection, with membrane, of varying concentrations of D-Glucose at day 1. Experimental Condition n Mean ± S.D. Minimum Maximum Sham 43 92.40 ± 13.91 59 122 CveCRS (200) 24 97.38 ± 9.03 87 119 D-Glucose 0.05 mmol 3 88.67 ± 8.33 82 98 D-Glucose 0.06 mmol 5 90.00 ± 26.12 47 112 D-Glucose 0.08 mmol 1 90.00 ± 0.00 90 90 D-Glucose 0.1 mmol 3 101.00 ± 17.00 84 118 D-Glucose 0.4 mmol 1 107.00 ± 0.00 107 107 CveCRS(200) where 200 is the volume injected in µL Table 20: Values of egg environment glucose concentration of embryos after air sac injection, with membrane, of varying concentrations of D-Glucose at day 1. Experimental Condition n Mean ± S.D. Minimum Maximum Sham 29 122.70 ± 35.21 35 188 Cve NaCl(200) 33 136.70 ± 33.80 58 227 D-Glucose 0.2 mmoL 36 255.50 ± 50.00 150 378 D-Glucose 0.4 mmol 35 330.90 ± 62.04 183 456 CveNaCl(200) where 200 is the volume injected in µL 55 Table 21: Values of blood glucose concentration of embryos after air sac injection, with membrane, of varying concentrations of D-Glucose at day 1. Experimental Condition n Mean ± S.D. Minimum Maximum Sham 43 92.40 ± 13.91 59 122 Cve NaCl(200) 35 85.80 ± 16.16 47 115 D-Glucose 0.2 mmoL 32 94.06 ± 13.93 59 121 D-Glucose 0.4 mmol 20 95.40 ± 26.19 52 156 CveNaCl(200) where 200 is the volume injected in µL 56 Annex 2 Figure 16: Conventional PCR, with different annealing temperatures, for igf1 and igf2 gene in the liver of chicken embryos. MDNA molecular weight ladder (MassRuler DNA Ladder Mix,ThermoFisher). Figure 17: Conventional PCR, with different annealing temperatures, for igf1 gene in the heart of chicken embryos. MDNA molecular weight ladder (MassRuler DNA Ladder Mix,ThermoFisher).