Full text
Universidade do Minho Escola de Ciências Júlio Freire Metabolic engineering for the improvement of fatty acid synthesis in industrial Saccharomyces cerevisiae strains UMinho | 2024 abril 2024 Júlio Filipe Antunes Freire Metabolic engineering for the improvement of fatty acid synthesis in industrial Saccharomyces cerevisiae strains
2
Universidade do Minho Escola de Ciências Júlio Filipe Antunes Freire Metabolic engineering for the improvement of fatty acid synthesis in industrial Saccharomyces cerevisiae strains Dissertação de Mestrado Mestrado em Genética Molecular Trabalho efetuado sob a orientação do: Professor Doutor Bjӧrn Johansson abril 2024
i COPYRIGHT AND TERMS OF USE OF THE WORK BY THIRD PARTIES This is an academic work that can be used by third parties as long as they respect internationally accepted rules and good practices, with regard to copyright and related rights. Thus, the work may be used under the terms of the license indicated below. If the user needs permission to use the work under conditions not provided for in the licensing, should contact the author through the RepositóriUM of the University of Minho. https://creativecommons.org/licenses/by-nc-nd/4.0/
ii AGRADECIMENTOS Este trabalho não seria possível sem o apoio de um conjunto de pessoas que, de várias maneiras, contribuíram para a realização de mais uma etapa na minha vida. Deixo aqui os meus agradecimentos: Ao professor Doutor Björn Johansson por me ter aceitado neste projeto de braços abertos, por toda a orientação que prestou ao longo do ano, por toda a profissionalidade e rigor científico que sempre demonstrou e a confiança depositada no meu trabalho. Ao Paulo por ter desempenhado o papel de um orientador dentro e fora do laboratório. Toda a ajuda que disponibilizou durante a realização desta tese é inestimável. Ao Humberto por toda a ajuda prestada dentro do laboratório e por todas as ideias e conselhos que foram providenciados de boa vontade. Ao resto dos membros do LGM: Cláudia, Inês, Faezhe, Rosana, João e Vitor. Obrigado por contribuírem para o bom ambiente vivido dentro do laboratório e por toda a ajuda prestada ao longo do ano. Aos membros do LBM por me aturarem sempre que ia fazer lá uma visita. A todos os meus coleguinhas que sempre torceram por mim. Em especial aos meus colegas de casa Rui e Rúben que acompanharam de perto a realização desta tese. São todos igualmente especiais. Ao resto dos meus amigos todos. Não apenas aqueles que conheci na universidade, mas também aos ansianenses que me viram chegar até à universidade e que eu não pude ver tantas vezes durante estes anos. À minha namorada Ana Lope(s) por todo o apoio que me deu até chegar aqui. Não conseguiria ter acabado sem toda a motivação e ajuda. Estarei sempre grato. Em último e principalmente aos meus pais e irmã que permitiram que tudo isto fosse possível. Tenho completa noção de todo o sacrifício feito para que eu pudesse ter chegado aqui. Não há palavras para descrever a minha gratidão.
iii STATEMENT OF INTEGRITY I hereby declare having conducted this academic work with integrity. I confirm that I have not used plagiarism or any form of undue use of information or falsification of results along the process leading to its elaboration. I further declare that I have fully acknowledged the Code of Ethical Conduct of the University of Minho.
iv RESUMO A exploração da capacidade dos microrganismos na síntese industrial de uma ampla variedade de ácidos gordos emerge como uma estratégia promissora para impulsionar as indústrias biotecnológicas. Na natureza, existem dois mecanismos principais responsáveis pela produção de ácidos gordos: os sistemas de síntese de ácidos gordos do tipo I e do tipo II. S. cerevisiae é uma espécie um fungo unicelular com funções importantes em indústrias fermentativas e investigação em biologia. A robustez das suas estirpes industriais pode ser utilizada na produção de ácidos gordos. Contudo, o sistema nativo FAS de tipo I em S. cerevisiae representa um desafio para a produção de ácidos gordos não tipicamente produzidos em levedura. Por meio de recombinação homóloga, foi construído um vetor de expressão que contém um sistema FAS de tipo II e o marcador dominante KanMX em levedura. A natureza do marcador seletivo possibilitou a sua expressão em estirpes industriais de S. cerevisiae. No entanto, a expressão heteróloga desse plasmídeo em uma estirpe mutante Δfas2 de S. cerevisiae não complementou a produção de ácidos gordos e o seu crescimento em meio de cultura onde não foram adicionados ácidos gordos. A Enoyl-ACP reductase é a enzima que catalisa a última etapa do ciclo de elongação no sistema de síntese de ácidos gordos. Embora esta reação enzimática seja conservada na natureza, a estrutura e a organização da enzima varia consideravelmente entre organismos. Este estudo avaliou o impacto da atividade de diferentes Enoyl-ACP redutases no crescimento de uma estirpe de levedura Δfas2 cuja produção de ácidos gordos estava dependente de um sistema heterólogo FAS tipo II. A preferência dessas enzimas pelo uso de NADP ou NADPH como cofatores não impactou a produção de ácidos gordos na levedura. A melhoria mais significativa no crescimento foi observada com a sobreexpressão do gene MOD1 derivado da Arabidopsis thaliana. Ainda assim, a expressão adicional de uma enoyl-ACP redutase resultou em aumento do crescimento em todas as estirpes. Este passo na síntese de ácidos gordos em levedura é um potencial alvo para aumentar a produção desses compostos. Palavras-chave: Ácido gordo; ácido gordo sintetase; estirpes industriais; enoyl-ACP redutase; recombinação homóloga
v ABSTRACT Exploiting the industrial-scale proficiency of microorganisms in the synthesis of a wide array of fatty acids stands as a promising strategy for advancing bio-based industries. There are two main mechanisms in which fatty acids are produced in nature: type I and type II fatty acid synthase systems. S. cerevisiae is a unicellular fungus that has important functions in fermentative industries and biological research. The robust nature of industrial S. cerevisiae strains is advantageous in the production of fatty acids. However, the nature of the native type I FAS system in S. cerevisiae is a major setback in the production of fatty acids that aren’t normally produced in this organism. An expression vector containing a type II FAS system and the dominant KanMX marker was constructed in yeast by homologous recombination. The nature of the selective marker allowed for its expression in industrial S. cerevisiae strains. However, the heterologous expression of this plasmid in a Δfas2 mutant S. cerevisiae strain did not complement the production of fatty acids and its growth in media depleted of exogenous fatty acids. The enoyl-ACP reductase is the enzyme that catalyses the last reaction of the elongation cycle in the fatty acid synthase system. This enzymatic reaction is conserved in nature, however, the structure and organization of the enzyme is unusually diverse among organisms. This study assessed the impact of the activity of different Enoyl-ACP reductases on the growth of a Δfas2 yeast strain that relied on a heterologous type II FAS system for the production of fatty acids. The preference of the Enoyl-ACP reductases for the use of either NADP or NADPH as the cofactor didn’t seem to impact the production of fatty acids in yeast. The most substantial improvement in growth was observed with the overexpression of the MOD1 gene derived from Arabidopsis thaliana. However, the expression of an additional Enoyl-ACP reductase resulted in increased growth across all strains. This step in the synthesis of fatty acids in yeast is a potential target for the upscaling of the production of fatty acids in yeast. Keywords: Fatty acid; fatty acid synthase; industrial strains; Enoyl-ACP reductase; homologous recombination
vi TABLE OF CONTENTS AGRADECIMENTOS .................................................................................................................. ii RESUMO .................................................................................................................................. iv ABSTRACT ................................................................................................................................ v LIST OF ABBREVIATIONS ......................................................................................................... ix LIST OF FIGURES ....................................................................................................................... x LIST OF TABLES ....................................................................................................................... xii 1. INTRODUCTION ................................................................................................................ 1 1.1. Microorganisms for a greener future, big problems sometimes require micoscopical solutions .................................................................................................................................. 1 1.2. Saccharomyces cerevisiae, old but reliable ................................................................. 3 1.3. Saccharomyces cerevisiae as a model organism ......................................................... 4 1.4. Industrial S. cerevisiae strains, well-oiled machines ................................................... 5 1.5. Fatty acids .................................................................................................................... 6 1.6. Fatty acid synthesis ...................................................................................................... 6 1.7. In Saccharomyces cerevisiae ........................................................................................ 7 1.8. Heterologous FAS type II s33ystem in S. cerevisiae .................................................... 9 1.9. Enoyl-ACP reductases .............................................................................................. 10 1.10. Objectives .................................................................................................................. 11 2. MATERIALS AND METHODS ......................................................................................... 12 2.1. Yeast strains and growth conditions ....................................................................... 12 2.2. S. cerevisiae transformation using the lithium acetate method ............................. 13 2.3. E. coli transformation by the heat shock method ................................................... 14 2.4. Standard PCR conditions and Colony PCR ............................................................... 14 2.5. Plasmid DNA purification and rescue from S. cerevisiae transformant colonies .... 15 2.6. Genomic DNA extraction ......................................................................................... 15
1 1. INTRODUCTION 1.1. Microorganisms for a greener future, big problems sometimes require micoscopical solutions The increasing demand for basic human needs like food, clothes and medicine generates an immense amount of waste products and the increased employment of non-renewable sources of energy (Akinsemolu, 2018). Currently, anthropogenic activities are the leading cause of climate change (Abbass et al., 2022). As consequence, human health and food security are negatively impacted by the degradation and deterioration of the natural environment (Xin et al., 2022). However, climate change is a multidisciplinary problem that requires the combined efforts of several entities in order to effectively solve such a complex problem (Middleton, 2011). The mitigation of the environmental impacts caused by the industrial sector is a critical step in the prevention of climate change. In order to achieve optimal growth, industries consume natural resources and fossil fuels indiscriminately, making them the largest consumers of these raw materials worldwide (Xin et al., 2022). The uncontrolled use of natural resources, however, causes an increase in greenhouse gas emissions (Sovacool et al., 2021) and the loss of biodiversity (Seddon et al., 2016). Chemical industries are, particularly, responsible for the release of toxic chemicals and hazardous pollutants in the air and water, having a negative impact on the environment while causing adverse health problems to humans (Kätelhön et al., 2019). Chemical industries also consume large amounts of fossil fuels, mainly used for energy production and carbon feedstock (Lopez et al., 2023). Finally, these industries have the tendency to produce large amounts of waste products while utilising toxic reagents and highly reactive solvents. Still, a majority of chemical industries still focus most of their efforts in optimizing existent production processes, disregarding the change to greener alternative methods (Gunningham, 1995). In order to achieve environmental stability, there needs to be an increasing effort to gradually implement sustainable alternatives to common industrial practices that are harmful to the environment. However, a greener alternative has to accommodate the demand for a large variety of chemicals in a cost-effective manner (Walley & Whitehead, 1994). This makes the shift from traditional chemical processes to greener equivalents a time consuming and expensive
2 process. In recent times, one of the most popular alternatives is the use of microorganisms to replace traditional chemical processes and products. Microorganisms have long impacted the lives of humans, plants and animals in one way or the other (N. Singh et al., 2018). Being present in the most diverse habitats, microorganisms have acquired extreme adaptations and capabilities that contribute to their success in survivability and also as potential tools for human applications (Niehaus et al., 1999). While the majority of microbes haven’t been identified yet, there are some who have a long record of impacting human lives across history. While being essential in the production of fermentative drinks like wine and beer, microorganisms have also been responsible for all pandemics across human history, earning them a negative reputation (Rodríguez-Frías et al., 2021). This narrative started to change at the same time that more and more information was collected regarding their ecological role and their uses in everyday life (Cockrell, 2005). Microorganisms such as fungi, microalgae and bacteria are currently being used as indispensable tools in industries ranging from biotechnology to agriculture. For example, microbial biofertilizers and biopesticides offer a solution to agricultural problems that used to heavily rely on chemical substances that are harmful to the environment (Seiber et al., 2014). In biotechnology and industrial production, microorganisms are employed in the synthesis of bio-based materials like biofuels, biopharmaceuticals and bioplastics – Table1. Actinomycetes, for example, are gram-positive bacteria that have long aided humanity in the discovery and production of all classes of antibiotics (De Simeis & Serra, 2021). Organic acids like citric acid or lactic acid are two economically important products which production mainly derives from microorganisms as well (Chen & Nielsen, 2016). Microbes are also employed in the production of industrial enzymes, food additives and numerous therapeutical agents. By utilizing renewable resources and general waste from other industries, the use of microbes contributes to a circular economy with low environmental impact. Table 1 – Examples of products with high market value that are produced using engineered microorganisms. Organism Name Applications Reference
3 Saccharomyces cerevisiae Artemisinin Anti-malarial drug (Westfall et al., 2012) Taxomyces andreanae Taxadiene Precursor of taxol – an anticancer agent (Malcı et al., 2023) Aspergillus terreus Lovastatin Cholesterol lowering agent (Mulder et al., 2015) Streptomyces cinnamonensis Monensin Antibiotic used in livestock farming (Beckett et al., 1998) Propionibacterium shermanii Vitamin B12 Health supplements (Piwowarek et al., 2018) Bacillus sp. Proteases Detergents component (Vojcic et al., 2015) Aspergillus niger Citric acid Food additive and preservative (Yang et al., 2017) Saccharomyces cerevisiae Bioethanol Biofuel (Buijs et al., 2013) Escherichia coli L-Threonine Essential aminoacid (Dong et al., 2011) 1.2. Saccharomyces cerevisiae, old but reliable Saccharomyces cerevisiae, commonly known as baker’s yeast, is a unicellular eukaryotic microorganism belonging to the fungi kingdom. Even though it was only identified in 1859, it has played an important role throughout human history, being present in the first forms of biotechnology, through the production of different beverages and in bread baking techniques (Sicard & Legras, 2011). In recent times, Saccharomyces cerevisiae has proven to be a multi-function tool as it still is widely used in fermentative industries but also as a model organism for biological research (Botstein et al., 1997). Its effectiveness in the fermentative industry is partially due to its unique cellular energy metabolism, mostly caused by the Crabtree effect (Nielsen, 2019). This strategy allows the yeast cells to grow under aerobic conditions while still producing ethanol and energy, through pyruvate. Since ethanol is toxic, yeast cells create an environment with very limited competition where they thrive due to its
4 remarkable robustness (De Deken, 1966). Additionally, S. cerevisiae has a high tolerance to sugar rich environments and can produce a high variety of aromatic compounds, making it a valuable asset in a wide range of fermentative industries (Suástegui & Shao, 2016). Besides the bread and alcoholic beverages industries, one of the most distinct applications of yeast fermentation is in the production of bioethanol from plant based raw materials (Rodionova et al., 2017). In this process, starchy raw materials like corn and sugar cane, serve as feedstock in the alcoholic fermentation that ultimately results in ethanol production. The produced bioethanol is mostly used as fuel, usually combined in a mixture with either gasoline or isobutylene (Bušić et al., 2018). As a result, bioethanol is by far the most used biofuel worldwide (Balat, 2011), providing a greener alternative to the use of fossil fuels. Apart from bioethanol, genetically modified yeast strains have the potential to also produce propanol and butanol, suitable for jets and rockets that require fuels with higher density. Moreover, S. cerevisiae has been employed in the production of other chemicals with high market potential. The production of organic acids like lactic acid (Lee et al., 2015), succinic acid (Xiberras et al., 2020) and 3-Hydroxypropionic acid (Ferreira et al., 2019) is already possible at an industrial scale by yeast. Yeast has also the potential to produce isoprenoids with high commercial value (Sun et al., 2014) at a larger scale. This group of secondary metabolites derive from isopentenyl diphosphate (IPP) and include carotenoids, sterols, terpenes, ubiquinone and polyprenyl alcohols. Their properties include their use as food colorant, aroma and flavour enhancers as well as anticarcinogenic agents (Chemler et al., 2006). With the growing understanding of yeast’s cellular mechanisms and the advances in genetic engineering techniques, the range of products is limitless. 1.3. Saccharomyces cerevisiae as a model organism Saccharomyces cerevisiae has had a remarkable role as a model organism in a wide variety of biological research fields. When it comes to maintenance, yeast cells are relatively easy to grow in cheap media, their duplication time is only about ninety minutes under optimal conditions and it is considered a “generally regarded as safe” (GRAS) organism. In addition, S. cerevisiae has been leading the way as a powerful genetic system (Hanson, 2018). In fact, it was the first eukaryotic organism to have its genome sequenced (Goffeau et al., 1996), leading
5 the way to the development of other important genetic tools. The successful transformation of yeast with a prokaryotic plasmid (Hinnen et al., 1978) paved the way for the creation of numerous vectors and selection markers (Vanderwaeren et al., 2022). One of the most advantageous attributes of yeast is its homologous recombination machinery. This selfrepairing process allowed for the integration of DNA fragments in very specific locations of the yeast genome and lead the way to the manipulation of the yeast genome (Kevin R. et al., 1997). From then on, new techniques emerged and more data has been collected which made S. cerevisiae one of the best understood organisms in science. The ease of manipulation combined with the extensive array of technologies optimised in yeast further improved the use of yeast as a model organism in the study of human related diseases. Because many key cellular processes are highly conserved between higher eukaryotes and yeast, the latter is often preferred as an alternative to the testing of novel therapeutic agents and the understanding of cellular mechanisms in animal cells (Lum et al., 2004). In addition, 30% of known genes involved in human diseases have orthologs in yeast (Foury, 1997). By using a collection of yeast deletion mutants, it has been possible to screen the effect of multiple drugs on a genome wide level. This method has helped with the identification of genes involved in specific cellular processes and also new targets for therapeutic treatments. The robustness and simplicity of S. cerevisiae has resulted in major advances in the understanding of complex human diseases like cancer, aging, neurological conditions, infectious diseases and many others (Matuo et al., 2012). 1.4. Industrial S. cerevisiae strains, well-oiled machines Many fundamental studies prefer the use of tamed laboratory yeast strains, this is due to the fact that their growth has been optimised in standard conditions, they have been carefully sexually selected and are overall easier to handle (Steensels et al., 2014). These characteristics, however, don’t hold up when faced with industrial bioreactor conditions, making these strains unsuitable for industrial use. Thus, the common practice is to genetically engineer industrial strains using applicable techniques and research conducted on laboratory strains. However, the applicability of such techniques is dependent on the strain genetic background. Most industrial strains possess a more complex genetic architecture when compared to laboratory
6 strains. For instance, laboratory strains are usually haploid while industrial strains can exist as polyploid, diploidy and aneuploid (Codón et al., 1998). Additionally, industrial strains are characterized by having poor sporulation efficiency, unstable mating types (Codón et al., 1995) and are prototrophic. Such characteristics limit the use of traditional auxotrophic markers which have an important role in genetic engineering. One way to counter this impediment is to use selection markers that are based around antibiotic resistance. The KanMX selective marker grants resistance to geneticin and has proven to work in industrial S. cerevisiae strains (M. E. Walker et al., 2003). This marker does not have a significant impact on the growth rate of industrial strains unlike some auxotrophic markers (Baganz et al., 1997), making it a suitable selection approach in industrial yeast strains. 1.5. Fatty acids Fatty acids (FA), prevalent in all living beings, hold pivotal significance in numerous biological mechanisms. Chemically, they consist of a carboxylic acid linked to a hydrocarbon chain, varying in length and saturation – either saturated or unsaturated. Consequently, organisms harbour a diverse array of these acids, each performing distinct functions. These compounds act as primary energy stores and constitute a fundamental element within cell membranes. The composition of FA in membranes contributes to the compositional diversity in cell membranes by changing the physical properties of phospholipids that constitute most bilayer membranes (De Carvalho & Caramujo, 2018). Moreover, they undertake crucial roles as signalling molecules, integral to cellular membrane structure and function (He et al., 2020). FA are also economically important as they can be used as precursors of high value chemicals in oleochemical industries (Biermann et al., 2021). Thus, their synthesis constitutes an important process in which optimisation has high marker potential. 1.6. Fatty acid synthesis Having an essential role in all organisms, the synthesis of fatty acids is, therefore, a highly regulated and complex mechanism in nature. Moreover , the pathway in which FAs are synthesised is highly conserved between all kingdoms of life (De Carvalho & Caramujo, 2018).
7 The synthesis requires a substantial amount of ATP, metabolites, acetyl-CoA and NADPH. The first step in the synthesis of fatty acids is the conversion of acetyl-CoA to malonyl-CoA by the acetyl-CoA carboxylase (ACC). Malonyl-CoA is converted to malonyl-ACP by transferring the malonate group to the prosthetic group of an acyl carrier protein (ACP). The elongation phase is characterized by the repeated condensation, reduction, dehydration and again reduction of malonyl-ACP that adds two carbons to the fatty acyl chain. The number of cycles in the elongation step determines the length of the resultant fatty acid. The final step involves a thioesterase that releases the newly synthesised FA from the FA synthase system. In Nature, there are two main systems in which fatty acids are synthesised: type I and type II fatty acid synthases (FAS). Eukaryotes and advanced prokaryotes possess a type I synthase that is characterized by the activity of large heterodimeric enzyme complexes which carry out multiple enzymatic reactions. Meanwhile, Bacteria and mitochondria utilise a type II FAS system in which the necessary enzymatic reactions are carried out by a set of separated enzymes which, together, compose the metabolic pathway. 1.7. In Saccharomyces cerevisiae Fatty acids are naturally produced in yeast as they carry out important functions as structural and signalling molecules (Roermund et al., 2003). Yeast mainly produces saturated and monounsaturated fatty acids with 16 or 18 carbons in length (Uemura, 2012). Though, being an extensively studied model organism, the utilisation of genetic engineering techniques has allowed the production of economically relevant fatty acids that are not naturally produced in yeast. For example, the production of polyunsaturated fatty acids (PUFAs) in yeast has been achieved by expressing exogenous genes that express the required desaturases (Beaudoin et al., 2000). Just like in other eukaryotes, the synthesis of fatty acids in S. cerevisiae is carried out through a type I fatty acid synthase complex. This mechanism is made up of a hexamer with two non-identical multifunctional subunits, α and β (Figure 1), encoded by the FAS2 and FAS1 genes, respectively (Schweizer et al., 1978). Unless the medium is supplemented with an exogenous fatty acid, like myristic acid, fas1 or fas2 mutants are not viable. Additionally, when there are exogenous fatty acids in the medium, the de novo synthesis of fatty acids decreases
8 substantially in yeast. Like any other FAS system, the production of fatty acids in yeast is mainly dependent on the availability of the main carbon precursor, acetyl-CoA, the general activity of the responsible enzymes, energy in the form of ATP and NAD(P)H (Sheng and Feng, 2014). The first limiting step in the fatty acid pathway is the activity of Acc1, a carboxylase that converts acetyl-CoA to malonyl-CoA. Several studies have been done around the improvement of the activity of this enzyme (Chen et al., 2018) or its overexpression (Choi et al., 2014) which translated in effectively increasing fatty acid production in yeast. There are several other challenges that need to be surpassed in order to produce fatty acids at an industrial level. The availability of cytosolic acetyl-CoA, the main building block of fatty acids, is conditioned by the fact that this molecule is also the precursor of other major metabolic pathways. The suppression of key enzymes that enhance the carbon flux to the production of acetyl-CoA has shown an increase in the fatty acid accumulation in yeast (Schadeweg & Boles, 2016). One of the major setbacks of the de novo synthesis of FAs is the overall molecular complex in the cytosol. From a metabolic engineering standpoint, because the native type I FAS system is highly regulated and its reactions are catalysed in only two separate domains (Leibundgut et al., 2008), it is harder to optimise and diversify the production of FAs in S. cerevisiae. Figure 1 – Overall structure of the D-3 symmetric yeast FAS. Six a-subunits (ochre) form a central wheel, three b-subunits (blue) each form the two domes of the barrellike structure. The 2-fold axis dissects the central wheel perpendicularly, whereas the 3-fold axis runs down the length of the molecule, where the b-subunits join. Adapted from K. Singh et al., 2020.
9 1.8. Heterologous FAS type II system in S. cerevisiae One of the most promising strategies to overcome the setback caused by the structural nature of the native FAS system is the expression of a heterologous FAS type II system. The expression of a type II FAS system allows for a greater level of manipulation and the possible outcome of a larger variety of fatty acids that wouldn’t normally be synthesised. The changes in chain length and level of unsaturation of fatty acids result in unique properties that can be economically relevant. Expressing a FAS type II system in yeast was first achieved by (Fernandez-Moya et al., 2015), through the insertion of eight E. coli genes in the genome of a yeast strain that lacked the FAS2 gene. This was the first time a heterologous FAS II type system complemented the production of fatty acids in yeast. More recently, the same feat was accomplished, but this time, all the required genes were expressed in an heterologous expression plasmid containing E. coli and Arabidopsis thaliana genes (Pozdniakova et al., 2023). The use of an expression vector instead of the insertion in the yeast genome allows for an easier manipulation of each gene, which lays the foundation for the specialized production of desired fatty acids. This plasmid goes by the name of pTA1_FASIIb and is made up of nine genes from E. coli and three genes from Arabidopsis thaliana – Table 2. The assembly was done through the Yeast Pathway Kit protocol (Pereira et al., 2016) which uses intergenic elements that serve as both as a promoter and a terminator (TP). This allows for the homologous recombination of cassettes in which a terminator serves as the promoter of the consecutive gene. Table 2 – All the genes that make up the pTA1_FASIIb plasmid, along with origin, function and respective promoters and terminators. Source Name Promoter / Terminator Function E. coli EcfabH PDC1 / TF1 β-ketooacyl-ACP synthase III E. coli EcfabD TF1 / FBA1 ACP S-malonyl transferase E. coli EcfabG FBA1 / RPL22A 3-oxoacylACP reductase
10 1.9. Enoyl-ACP reductases The enoyl-acyl carrier protein reductase (ER) is the enzyme involved in the last step of the elongation cycle in the fatty acid synthesis. This enzyme catalyses the reduction of the trans-2-acyl-ACP to the fully saturated acyl-ACP species. Despite being conserved among all organisms, the enzyme required for this reaction varies in structure and action between species. Both NADH and NADPH can be used as the primary reductant in this reaction. However, some ERs have an higher affinity to one of these cofactors whereas other ERs don’t have a preference for neither NADH or NADPH (Massengo-Tiassé & Cronan, 2009). The ER used in the pTA1_FASIIb plasmid, Athmod1, comes from the plant Arabidopsis thaliana and can use both NADPH and NADH as cofactors. Though, it has been observed that this reductase highly favours the NADH dependent activity (de Boer et al., 1998). Because S. cerevisiae has a higher availability of NADPH in the cytosol when compared to NADH (Zhang et al., 2015), the activity of this enzyme can be a limiting factor in the process of fatty acid synthesis. This aspect alone can have a bottleneck effect in the production of fatty acids by the pTA1_FASIIB plasmid. Thus, there’s the possibility of improving the total fatty acid production by using an ER that is in line with the cofactor abundance. The ER responsible for this reaction in Bacillus subtilis, BsfabL, has a higher affinity for NADPH (Heath, Su, et al., 2000). The same happens with the ER in E. coli EcacpP RPL22A / pTDH3 Acyl carrier protein E. coli EcfabF pTDH3 / UTR2 β-ketooacyl-ACP synthase II E. coli EcfabB UTR2 / PTI1 3-oxoacylACP synthase I E. coli EcfabA PTI1 / PMP3 3-Hidroxyacyl ACP dehydrogenase E. coli EcfabZ PMP3 / ENO2 3-Hidroxyacyl ACP dehydrogenase A. thaliana Athmod1 ENO2 / RPL5 Enoyl-ACP reductase A. thaliana Athfat1 RPL5 / RPL16A Thioesterase A. thaliana Athfatb RPL16A / RPL17A Thioesterase E. coli EcacpS RPL17A / TMA19 Holo-acp synthase
17 3. RESULTS 3.1. Construction of the pTA5 plasmid This work required the construction of an expression vector with the KanMX dominant marker that could be used in industrial S. cerevisiae strains. This plasmid, named pTA5, was constructed through the assembly of five different DNA fragments, each serving a functional purpose. The required DNA fragments were obtained by PCR (Table 5). Each primer carried a 30 bp long tail that allowed for the homologous recombination between adjacent fragments (Figure 2). The pBR E. coli origin of replication was amplified from the pBR322 vector and retained the ROP gene which limits the number of copies in E. coli. The yeast 2µ origin of replication was amplified from the YEplac181 vector. The bacterial selective marker, amp, was amplified from the pUG35 CYC1-GFP vector. A deletion allele of the E. coli CRP gene was amplified from the pTA1 vector. The dominant selection marker in yeast, KanMX4, was amplified from the pFA6a-GFPS65T-KanMX6 vector. Table 5 – DNA segments used in the construction of the pTA5 plasmid and the respective PCR conditions for their amplification by PCR. Source Target feature Forward primer Reverse primer Annealing temperature Extension time (min) Size (bp) YEplac181 2µ 984 983 53°C 1:13 1644 pFA6a-GFPS65TKanMX6 KanMX 1350 1349 56°C 1:03 1417 pBR322 pBR ori 1196 1195 57°C 1:07 1497 pUG35 CYC1-GFP amp 1113 987 55°C 0:48 1072 pTA1 ΔCRP 978 977 65°C 0:30 445
18 Figure 2 – Schematic representation of the construction of the pTA5 plasmid by homologous recombination. This plasmid is made up of five DNA fragments: pBR322 bacterial origin of replication; amp selective marker; ΔCRP multi cloning site; KanMX selective marker; 2µ yeast origin of replication. All fragments are amplified by PCR, using primers that carry a tail that allows for the recombination between all PCR products (pictured in respective colours). The simultaneous transformation of all PCR products in yeast leads to the coordinated assembly of the final plasmid. The PCR products were analysed by gel electrophoresis. All resulting PCR products appeared to have the predicted size in the gel (Figure 3). The comparison of the different bands in the gel helped confirm the amplification of the PCR products that shared a similar size. This confirmation was a powerful indicative of the success of the amplification.
19 Figure 3– Agarose gel of the DNA fragments resulting from the five different PCR reactions used to obtain the necessary fragments for the construction of the pTA5 plasmid. The different fragments are represented from the letter A to E and their expected size is displayed in the table above. The molecular weight marker used was the GeneRuler 1kb DNA ladder (Thermo Scientific). The plasmid was assembled by transforming the yeast strain CEN.PK2-1C with 10 µL of each PCR product and plating the cells in YPD + G418 selective media. Simultaneously, the same cells were transformed in other conditions to serve as controls. These included the transformations in which the cells were transformed with only the KanMX PCR product and with all the PCR products but the ΔCRP fragment (Figure 4). The results showed that both the cells transformed with all PCR products and the cells transformed with four of the products were able to grow in media with geneticin. In theory, the transformation with four of the five fragments should not results in cell growth due to the lack of homologous regions between two of the fragments. However, the cells have found a way to reconstruct a truncated plasmid containing the KanMX selection marker, but with less efficiency than the transformation with the five fragments. This was observed more clearly when the remaining transformed cells stored at 4 ºC were diluted 100x and plated again in selective media. The culture transformed with the five fragments resulted in substantially more transformants than the cultures transformed with only four.
20 Figure 4 – Resulting colonies from the transformation of the CEN.PK2-1C yeast strain with the five PCR fragments that compose the pTA5 plasmid, in YPD + G418 media. (1) Transformation with five PCR products. (2) Transformation with all fragments but the ΔCRP PCR products. (3) Transformation with the KanMX PCR product. (4) Negative control (only water) The construction of the plasmid was first confirmed through Colony PCR in which a set of primers was strategically used so that one primer annealed in the middle of the ΔCRP fragment, because of its importance as a Multi Cloning Site (MCS), and the other primer annealed in the middle of the adjacent KanMX gene (Figure 5). The screening by Colony PCR allowed us to identify the colonies that had the right plasmid orientation by using primers that hybridized in two adjacent DNA fragments.
21 Figure 5– Colony PCR conditions and representation to test the pTA5 construction. The pair of primers used were the 977 (forward) and 1481 (reverse) primers. The 977 primer annealed inside the ΔCRP fragment while the 1481 primer annealed in the adjacent KanMX gene. The PCR product was 1345bp long. The results displayed in the gel showed that more than half of the colonies had the right plasmid orientation out of 21 tested colonies (Figure 6). The 13,17 and 18 colonies were picked based on the intensity of the respective band and had their plasmid rescued. Figure 6 – Agarose gel displaying the DNA fragments that resulted from the colony PCR performed in the colonies transformed with all five fragments that form the pTA5 plasmid. The PCR products from the 13,17 and 18 colonies are marked on the gel. The plasmid constructions were then tested by enzymatic digestion, PCR and finally sequenced (Figure 7). The plasmids were first digested with the BglI, Eco321 and ScaI restriction enzymes. A series of digestions were carried out: only the BglI enzyme, only the Eco321 enzyme, both BglI and Eco321 enzymes and only the ScaI enzyme. The digestions were analysed in gel electrophoresis and compared to an in silico prediction made in Benchling®.
22 Upon confirming the digestions, several PCR reactions were carried out to confirm the construction. Three pairs of primers were used so that each pair flanked a determined gene. Finally, the ΔCRP fragment was sequenced as it was crucial to know if there were any mutations in the cloning site of the plasmid. Mutations in the multi cloning site can lead to errors in the insertion of DNA sequences. Two primers flanking the ΔCRP fragment were used and the results were matched to the nucleotide sequence. Figure 7 – Schematic representation of different methods used to test the construction of the pTA5 plasmid by enzymatic digestion, PCR and sequencing. A – Enzymatic digestion of the pTA5 plasmid using the BglI, Eco32I and ScaI enzymes. The BglI enzyme cuts once, inside the amp gene. The Eco32I cuts in the multi cloning site, inside the ΔCRP fragment. The ScaI enzyme cuts twice, inside the KanMX gene and inside the amp gene. B – The construction was tested by PCR. Three pairs of primers were used and divided by colours. The 1499 and 1481 primers (in red) amplified the region between the ΔCRP and KanMX genes. The 1564 and 378 primers (in yellow) amplified the region between the KanMX and the 2µ origin of replication genes. The 1642 and 1150 primers (in blue) amplified the region between the 2µ origin of replication and the pBR origin of replication. C – The ΔCRP fragment was sequenced using the 195 and the 255 primers.
23 The use of either the Eco32I or the BglI enzyme results in the linearization of the plasmid, as each enzyme has one cutting site inside the plasmid. Meanwhile, ScaI cuts the plasmid in two different sites. We performed four different digestions: Eco32I; BglI; Eco32I and BglI; ScaI (Figure 8). The results depicted in the gel match in silico prediction of the digestions. Both the Eco32I and the BglI enzymes linearized the plasmid. The simultaneous use of both enzymes resulted in two DNA fragments similar to those produced by the digestion of the plasmid with the ScaI enzyme. Figure 8 – Confirmation of the pTA5 construction by enzymatic digestion. A – Tabel representing the different enzymatic digestions, the enzymes involved and the size of the produced fragments. B – In silico prediction of the agarose gel containing the fragments produced by the enzymatic digestions. C – Agarose gel displaying the fragments produced by the enzymatic digestions. The molecular weight marker used was the GeneRuler 1kb DNA ladder (Thermo Scientific). The construction of the plasmid was confirmed by amplifying regions between adjacent genes. The PCR products were analysed by gel electrophoresis. All the resulting bands appear as being between 1000bp and 1500bp long, which matches the expected size for all of the products (Figure 9). This confirms the order in which the DNA fragments were assembled.
24 Figure 9 – Confirmation of the pTA5 construction by PCR. The table above shows the three different PCR reactions, with their respective primers and the expected size of the PCR product. The results are displayed in the agarose gel below, each reaction is represented by their respective numbers. The molecular weight marker used was the GeneRuler 1kb DNA ladder (Thermo Scientific). The results given by PCR and enzymatic digestions suggested that the pTA5 plasmid was well constructed, however, it was still crucial to know if there were any mutations in the plasmid, especially in the MCS. The primers chosen for the sequencing analysis flanked the ΔCRP fragment which contains the MCS. The sequencing results matched the predicted nucleotide sequence of the plasmid except for two nucleotide mutations( a deletion and a substitution) inside the terminator region of the KanMX gene (Figure 10). Looking at the sequencing results, we could see that these mutations occurred in a repetitive stretch of the DNA chain. It has been documented that high throughput sequencing techniques are often accompanied by errors in repetitive areas of the DNA sequence(Treangen & Salzberg, 2012). Therefore, the errors in the sequencing data could be caused by the nature of the DNA sequence. The mutations don’t belong to the coding sequence of the gene which means that the protein is not affected by them. Primers Expected size(bp) 1 1499/1481 1345 2 378/1564 1392 3 1150/1642 1464
25 Figure 10 – Nucleotide sequence obtained from the sequencing of the pTA5 plasmid. The segment ranging from the 2689 to the 3024 nucleotides of the theoretical pTA5 sequence is aligned with the results from the sequencing of the constructed plasmid. The mutations are highlighted in orange. 3.2. Construction of the pYPKpw_ENO2_BsfabL_RPL5, pYPKpw_ENO2_SafabI_RPL5 and pYPKpw_ENO2_Athmod1_RPL5 Transcription Unit vectors 3.2.1 Construction of the pYPKa_BsfabL and pYPKa_SafabI vectors To determine whether the expression of different Enoyl-ACP reductases had an impact on the growth of a Δfas2 S. cerevisiae strain, we simultaneously expressed the pTA1_FASIIb plasmid and a vector expressing two different Enoyl-ACP reductases. To serve as our controls, we also tested the expression of a copy of the AthMOD1 gene and an empty vector that served as the backbone of the other vectors. This work required S. cerevisiae expression vectors with single gene transcription units (TUs). This was achieved through the Yeast Pathway Kit (Pereira et al., 2016) cloning strategy . We started by cloning the fabL (from Bacillus subtilis) and the fabI (from S. aureus) genes in the pYPKa vector (Figure 11). The pYPKa plasmid is a positive selection vector for cloning in E. coli that serves the function of providing building blocks for expression vectors in S. cerevisiae. Both the BsfabL and SafabI genes were amplified by PCR from purified genomic DNA and cloned in the pYPKa vector linearized by AjiI. The ligation mixture containing all PCR products along with the linear pYPKa plasmid was transformed in E.coli and left to grow in LB+ ampicillin media.
26 Figure 11 – Schematic representation of the cloning of the BsfabL and SafabI genes in the pYPKa plasmid. The pYPKa plasmid was first linearized using the AjiI enzyme that cuts a specific site that is flanked by two specific sequences pictures in red and green. The linearized plasmid is then ligated with either the BsfabL or the SafabI genes, producing the pYPKa_A_BsfabL/SafabI vector that will be used as a building block for single gene expression vectors. Both transformations were successful so we proceeded to screen the cloning of both genes by colony PCR (Figure 12). The used primers amplified a region that included the insert and the adjacent regions belonging to the pYPKa vector. The linearized plasmid carried blunt ends which limits the maximum theoretical cloning efficiency to 50% given the equal probability of insertion in one of either direction. As expected, about half of the tested colonies gave PCR products with the expected length indicating the presence of the insert in the correct orientation within the vector. The confirmation of both constructions by PCR along with the lack of colonies in the negative control transformation highlighted the success of this cloning strategy. The resulting vectors, pYPKa_BsfabL and pYPKa_SafabI, were used as building blocks for the construction of expression vectors.
33 Figure 17 – Graphic display of the results obtained from the OD600 measurements of the growth curves. Each graph accounts for one of the three growth curves done on the exact same condition. Each growth curve had a time span of 24 hours in a total of twelve OD600 measurements. Figure 18 – Specific growth rate of the four different strains. Each point represents the mean of the three absorbances obtained in the same timepoints, between all growth curves. 3.4 Deletion of the FAS1 gene using the Cre/loxP method and recycling of the KanMX marker To prevent the interaction between the native FAS machinery and the heterologous type II FAS system in yeast , the deletion of both the FAS1 and FAS2 genes was required. The use of a double mutant strain prevents this possibility and guarantees that the heterologous FAS system complements the synthesis of fatty acids. The u1483 yeast strain lacks the FAS2 gene. This deletion was carried out by replacing the gene with the KanMX marker. In order to delete the FAS1 gene with the same marker, KanMX was recycled using the Cre/loxP recombination system . Traditionally, the deletion of yeast genes involves the cloning of the DNA fragments flanking the gene of interest, left and right of a yeast marker gene (Szostak et al., 1983). After transformation, this deletion cassette is inserted by homologous recombination in the yeast genome, resulting in the deletion of the target gene (Orr-Weaver et al., 1981). The required length of the flanking regions is usually small, allowing the construction of gene disruption cassettes by PCR (Baker Brachmann et al., 1998). The following recycling of the marker is also
34 of great importance due to the limited availability of markers and the attributes they grant to the mutant strain. The Cre-loxP recombination system is often a preferred option to the deletion of yeast genes because of its efficiency in rescuing the selective marker (Guldener, 1996). The Loxp/Cre recombinase deletion method involves two main components: the Cre protein, usually expressed in a vector, is a site-specific recombinase that mediates intramolecular recombination events between cis-linked loxP sites (Abremski & Hoess, 1984). The loxP sequence is 34bp in length and serves as the DNA binding site to the Cre recombinase. This sequence is made up of two 13bp palindromic inverted sequences and an 8bp spacer sequence that confers directionality of the lox site (Ghosh & Van Duyne, 2002). The gene disruption cassette is produced by PCR and consists of a selective marker flanked by two 34bp long loxP sequences. The transformation of the cassette induces the excision of the target gene and the hybridization of the designated selective marker in the genome. 3.4.1 Recycling of the KanMX gene We started out by thawing the u839 E. coli strain that had the pSH47 plasmid. This plasmid is characterized by expressing the Cre protein, under the control of the GAL1 promoter. The plasmid DNA was purified from the E. coli culture and then tested by PCR. The primers used flanked the Cre gene. Upon confirming the presence of the Cre gene, we transformed 10 µL of the pSH47 plasmid in the u1483 yeast strain(Δfas2 , KanMX4) and selected the transformants in SC-URA + Hmy media since pSH47 has the URA3 auxotrophic marker. The transformant colonies were then grown in 5mL of YPD + Hmy liquid culture to induce Cre expression. A 10-4 dilution of the liquid culture was plated on YPD + Hmy media as a way to test single colonies. We then picked 25 colonies and grew them in YPD + Hmy + G418 solid media to test their resistance to geneticin. The colonies that didn’t grow in YPD + Hmy + G418 media were believed to have lost the KanMX cassette. To further confirm the removal of the cassette, a PCR was conducted using three primers (Figure 19). Two of the primers annealed in the flanking regions of the FAS2 gene while the other primer hybridized inside the KanMX cassette. The size of the produced fragment would indicate the presence or absence of the KanMX gene. As a control, the genomic DNA of a colony that grew in YPD + Hmy + G418 media was also tested.
35 Figure 19 – Schematic representation of the PCR reaction to confirm the recycling of the KanMX gene. A – When the KanMX gene is present, the 1564 primer will hybridize inside this gene B – When the KanMX gene is not present, the 1564 primer cannot hybridize C – Depending on the presence of the KanMX gene, the final PCR product can be either 1450bp long or 995bp long. The results showed that both colonies didn’t effectively have the cassette inside the genome while the colony used as a control still had the KanMX cassette (Figure 20). In order to lose the pSH47 plasmid, both colonies were grown in non-selective media YPD + Hmy. After reaching the stationary phase, the cells were recovered and grown again in YPD + Hmy. The resulting cultures were diluted and plated in YPD + Hmy media. The presence of the plasmid was tested by plating the resulting colonies in SC-URA + Hmy. Most of the colonies didn’t grow in this media, meaning they had lost the pSH47 plasmid. The final strain was named u1767.
36 Figure 20 – Gel agarose showing the resulting DNA fragments from the PCR reactions used to confirm the presence of the KanMX gene. The 4 and 7 columns contain the PCR products from the genomic DNA of the two colonies that didn’t grow in geneticin media. The column number 1 contains the PCR product from the genomic DNA of a colony before inducing the excision of the KanMX gene. The used molecular weight marker was the GeneRuler 1kb DNA ladder (Thermo Scientific). 3.4.2 Deletion of the FAS1 gene and recycling of the KanMX marker In order to obtain a Δfas1 Δfas2 yeast strain, the FAS1 gene was deleted in the u1767 yeast strain. The deletion was done using the Cre/loxP deletion method. We started by amplifying the KanMX cassette that to replace the FAS1 gene, by homologous recombination. The pUG6 plasmid was used as the template for the PCR reaction (Figure 21). In this reaction, a large quantity of insert was used maximise the number of transformants as genomic substitutions tend to be inefficient. Therefore, we did three identical 100uL PCR reactions. The three PCR products were pooled together followed by precipitation and resuspension in the maximum volume allowed for the transformation. All DNA was used to transform the u1767 yeast strain. The transformed cells were grown in YPD + Hmy + G418 media.
37 Figure 21 – Schematic representation of the PCR reaction used to obtain the FAS1 deletion cassette. To delete the FAS1 gene, the Cre/loxP method was used. This method uses deletion cassettes that have homology with the flanking regions of the target gene. In order to delete this gene, a deletion cassette containing the KanMX selective marker was used. This cassette was obtained by PCR, using the 1394 and 1393 primers and using the pUG plasmid as a template. The final PCR product was 1703bp long, was homologous to the flanking regions of the FAS1 gene and had the loxP sequence. The transformation was successful and 10 transformants were again plated in YPD + Hmy + G418( 600mg/L) media. All colonies appeared to have the KanMX cassette inserted in their genome, as they were able to grow in media with geneticin. From this petri dish, 4 colonies were picked and had their genomic DNA extracted to confirm the deletion by PCR (Figure 22). Two PCR reactions were performed, one that confirmed the absence of the FAS1 gene and the other to confirm the presence of the KanMX cassette in its place. The 1418 forward primer annealed in the flanking region of the FAS1 gene and was used in both PCR reactions. The 1564 reverse primer annealed inside the KanMX gene and was used to test for the insertion of the cassette in the genome. When using the 1459 reverse primer that anneals inside the FAS1 gene, no PCR products were produced in the Δfas1 mutant strains. The results displayed in the agarose gels indicate that all the colonies tested positive for the presence of the KanMX gene. Simultaneously, the PCR reaction used to test the presence of the FAS1 gene produced no results in any of the colonies. The combined results of both gels indicate the successful deletion of the FAS1 gene in all the tested colonies.
38 Figure 22 – Confirmation of the yeast FAS1 deletion by PCR. ATable representing both PCR reactions( B and C), represented in the agarose gels below; The used molecular weight marker was the GeneRuler 1kb DNA ladder (Thermo Scientific). 3.4.3 Recycling of the KanMX cassette Having confirmed the deletion of the FAS1 gene, KanMX gene remaining in the genome, was removed. The approach was identical to the one mentioned previously in this work. The strain was first transformed with the pSH47 plasmid and grown in SC-U + Hmy media. Two of the transformant colonies were then transferred to a YPD + Hmy liquid culture to induce the expression of the Cre protein. To select individual colonies, the liquid culture was diluted and the cells were plated in solid YPD + Hmy media. From that petri dish, we picked twenty colonies that were plated in YPD + Hmy + G418 media. The colonies that didn’t grow
39 in this media were selected and their genomic DNA was extracted in order to test their genotype. By using three primers, we were able to confirm the KanMX gene by PCR (Figure 23). Figure 23 – Graphical representation of the PCR reactions used to confirm the recycling of the KanMX cassette. 3.5 Construction of the pTA5_FASIIb plasmidfirst strategy The pTA1 and pTA5 are identical with exception to the selective markers, which are LEU2 and KanMX, respectively. We hypothesised that this homology between the two plasmids can theoretically allow for the transfer of the genes belonging to the FASII pathway from the pTA1_FASIIb plasmid into the pTA5 plasmid. By transforming a yeast strain with both the pTA1_FASIIb plasmid and the linearized pTA5 plasmid, we aimed to clone the FASIIb pathway inside the pTA5 plasmid. The pTA5 plasmid was linearized with the EcoRV restriction enzyme, which cuts the plasmid in the multi cloning site, inside the ΔCRP fragment (Figure 24). The multi cloning site is homologous to the flanking regions of the FAS genes in the pTA1_FASIIb plasmid.
40 Figure 24 – Results from the linearization of the pTA5 plasmid by the EcoRV enzyme. All the different reactions are numbered from 1 to 3 and displayed in the agarose gel. The used molecular weight marker was the GeneRuler 1kb DNA ladder (Thermo Scientific). Both the linearized pTA5 plasmid and the pTA1_FASIIb plasmid were simultaneously transformed in the yeast strain CEN.PK2-1C. The transformed cells were selected in YPD + G418 media. The petri dish with cells transformed with both plasmids had about 10 colonies while the petri dish with cells transformed with only the linear pTA5 didn’t have any transformant colonies. The construction was first tested by Colony PCR (Figure 25). In this reaction, the 714 and 715 primers were used to amplify the fabG gene, part of the FASIIb pathway. Template Primers Expected size(bp) pTA5_FASIIb 714/715 749 Figure 25 – Confirmation of the pTA5_FASIIb construction by Colony PCR. The agarose gel shows the resulting fragments from six different colonies. The used molecular weight marker was the GeneRuler 1kb DNA ladder (Thermo Scientific).
41 To further test the construction, we started by rescuing the plasmids from the transformant colonies (Figure 21). During the rescue process, LB + Kanamycin media was used in the competent E. coli transformation. The pTA5_FASIIb plasmids were first analysed by gel electrophoresis while using the pTA1_FASIIb plasmid as a control since their size and composition are very similar. The results in the agarose gel display a big disparity between the plasmids of all the transformed colonies. Additionally, there were no plasmids that appeared to have a similar composition to the pTA1_FASIIb plasmid (C+) . Figure 26 – Agarose gel displaying the comparison between the extracted plasmids from the pTA5_FASIIb construction and the pTA1_FASIIb plasmid. The different constructions are numbered from 1 to 9. The positive control (C+) is made up of the pTA1_FASIIb plasmid. The used molecular weight marker was the GeneRuler 1kb DNA ladder (Thermo Scientific). 3.6 Construction of the pTA5_FASIIb by homologous recombination – Second strategy The second attempt at constructing the pTA5_FASIIb plasmid by homologous recombination was done by only replacing the selective marker in the pTA1_FASIIb plasmid instead of the whole vector backbone . In this approach, a Δfas yeast strain plasmid was transformed with the KANMX gene , obtained from the pTA5 plasmid. This strain was first transformed with the pTA1_FASIIb plasmid and plated in SC-LEU + Hmy media. The transformant colonies were then plated in YPD media, successfully complementing the synthesis of fatty acids by the native type I FAS system. To switch the LEU2 auxotrophic marker to a KanMX dominant selective marker, we transformed this strain with a PCR product from pTA5 (Figure 27). This PCR reaction involved the amplification of the KanMX gene along with its flanking regions that have homology with the adjacent regions of the LEU2 marker in the
42 pTA1_FASIIb plasmid. The pTA5 template was diluted 10x, 100x, 1000x and 10000x in order to minimise the risk of having false positives transformants. Template Forward primer Reverse primer Expected size(bp) pTA5 1742 1748 1417 Figure 27 – Graphical representation of the construction of the pTA5_FASIIb plasmid by homologous recombination. In this process, the KanMX gene was amplified by PCR from the pTA5 plasmid. The transformation of this PCR product in a Δfas2 mutant yeast strain containing the pTA1_FASIIb plasmid results in the homologous recombination between the flanking regions of both
49 6. REFERENCES Abbass, K., Qasim, M. Z., Song, H., Murshed, M., Mahmood, H., & Younis, I. (2022). A review of the global climate change impacts, adaptation, and sustainable mitigation measures. Environmental Science and Pollution Research, 29(28), 42539–42559. https://doi.org/10.1007/s11356-022-19718-6 Abremski, K., & Hoess, R. (1984). Bacteriophage P1 site-specific recombination. Purification and properties of the Cre recombinase protein. JournalofBiologicalChemistry, 259(3), 1509– 1514. https://doi.org/10.1016/S0021-9258(17)43437-5 Akinsemolu, A. A. (2018). The role of microorganisms in achieving the sustainable development goals. Journal of Cleaner Production, 182, 139–155. https://doi.org/10.1016/j.jclepro.2018.02.081 Baganz, F., Hayes, A., Marren, D., Gardner, D. C. J., & Oliver, S. G. (1997). Suitability of replacement markers for functional analysis studies in Saccharomyces cerevisiae. Yeast, 13(16), 1563–1573. https://doi.org/10.1002/(SICI)1097-0061(199712)13:16<1563::AIDYEA240>3.0.CO;2-6 Baker Brachmann, C., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P., & Boeke, J. D. (1998). Designer deletion strains derived from Saccharomyces cerevisiae S288C: A useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast, 14(2), 115–132. https://doi.org/10.1002/(SICI)1097-0061(19980130)14:2<115::AIDYEA204>3.0.CO;2-2 Balat, M. (2011). Production of bioethanol from lignocellulosic materials via the biochemical pathway: A review. Energy Conversion and Management, 52(2), 858–875. https://doi.org/10.1016/j.enconman.2010.08.013 Beaudoin, F., Michaelson, L. V., Hey, S. J., Lewis, M. J., Shewry, P. R., Sayanova, O., & Napier, J. A. (2000). Heterologous reconstitution in yeast of the polyunsaturated fatty acid biosynthetic pathway. Proceedings of the National Academy of Sciences, 97(12), 6421–6426. https://doi.org/10.1073/pnas.110140197
50 Beckett, S., Lean, I., Dyson, R., Tranter, W., & Wade, L. (1998). Effects of Monensin on the Reproduction, Health, and Milk Production of Dairy Cows. JournalofDairyScience, 81(6), 1563–1573. https://doi.org/10.3168/jds.S0022-0302(98)75722-4 Biermann, U., Bornscheuer, U. T., Feussner, I., Meier, M. A. R., & Metzger, J. O. (2021). Fatty Acids and their Derivatives as Renewable Platform Molecules for the Chemical Industry. Angewandte Chemie InternationalEdition, 6(37), 20144–20165. https://doi.org/10.1002/anie.202100778 Botstein, D., Chervitz, S. A., & Cherry, M. (1997). Yeast as a Model Organism. Science, 277(5330), 1259–1260. https://doi.org/10.1126/science.277.5330.1259 Buijs, N. A., Siewers, V., & Nielsen, J. (2013). Advanced biofuel production by the yeast Saccharomyces cerevisiae. Current Opinion in Chemical Biology, 17(3), 480–488. https://doi.org/10.1016/j.cbpa.2013.03.036 Bušić, A., Marđetko, N., Kundas, S., Morzak, G., Belskaya, H., Ivančić Šantek, M., Komes, D., Novak, S., & Šantek, B. (2018). Bioethanol Production from Renewable Raw Materials and Its Separation and Purification: A Review. FoodTechnologyandBiotechnology, 56(3), 289–311. https://doi.org/10.17113/ftb.56.03.18.5546 Chemler, J. A., Yan, Y., & Koffas, M. A. (2006). Biosynthesis of isoprenoids, polyunsaturated fatty acids and flavonoids in Saccharomyces cerevisiae. Microbial Cell Factories, 5(1), 20. https://doi.org/10.1186/1475-2859-5-20 Chen, Y., & Nielsen, J. (2016). Biobased organic acids production by metabolically engineered microorganisms. Current Opinion in Biotechnology, 37, 165–172. https://doi.org/10.1016/j.copbio.2015.11.004 Cockrell, C. (2005). The Value of Microorganisms. EnvironmentalEthics, 27(4), 375–390. https://doi.org/10.5840/enviroethics20052744 Codón, A. C., Benítez, T., & Korhola, M. (1998). Chromosomal polymorphism and adaptation to specific industrial environments of Saccharomyces strains. Applied Microbiology and Biotechnology, 49(2), 154–163. https://doi.org/10.1007/s002530051152
51 Codón, A. C., Gasent-Ramírez, J. M., & Benítez, T. (1995). Factors which affect the frequency of sporulation and tetrad formation in Saccharomyces cerevisiae baker’s yeasts. Applied and Environmental Microbiology, 61(2), 630–638. https://doi.org/10.1128/ aem.61.2.630-638.1995 Dale, J. W., & Greenaway, P. J. (1984). The Use of Alkaline Phosphatase to Prevent Vector Regeneration. Em J. M. Walker (Ed.), NucleicAcids (pp. 231–236). Humana Press. https://doi.org/10.1385/0-89603-064-4:231 de Boer, G.-J., Kater, M. M., Fawcett, T., Slabas, A. R., Nijkamp, H. J. J., & Stuitje, A. R. (1998). The NADH-specific enoyl-acyl carrier protein reductase: Characterization of a housekeeping gene involved in storage lipid synthesis in seeds of arabidopsis and other plant species. Plant PhysiologyandBiochemistry, 36(7), 473–486. https://doi.org/10.1016/S0981-9428(98)801721 De Carvalho, C. C. C. R., & Caramujo, M. J. (2018). The Various Roles of Fatty Acids. Molecules, 23(10), Artigo 10. https://doi.org/10.3390/molecules23102583 De Deken, R. H. (1966). The Crabtree Effect: A Regulatory System in Yeast. Microbiology, 44(2), 149–156. https://doi.org/10.1099/00221287-44-2-149 De Simeis, D., & Serra, S. (2021). Actinomycetes: A Never-Ending Source of Bioactive Compounds—An Overview on Antibiotics Production. Antibiotics, 10(5), Artigo 5. https://doi.org/10.3390/antibiotics10050483 Dong, X., Quinn, P. J., & Wang, X. (2011). Metabolic engineering of Escherichia coli and Corynebacterium glutamicum for the production of l-threonine. BiotechnologyAdvances, 29(1), 11–23. https://doi.org/10.1016/j.biotechadv.2010.07.009 Entian, K. D., & Kötter, P. (2007). 25 yeast genetic strain and plasmid collections. Methods in microbiology, 36, 629-666. Fernandez-Moya, R., Leber, C., Cardenas, J., & Da Silva, N. A. (2015). Functional replacement of the Saccharomyces cerevisiae fatty acid synthase with a bacterial type II system allows flexible product profiles. Biotechnology and Bioengineering, 112(12), 2618–2623. https://doi.org/10.1002/bit.25679
52 Ferreira, R., Skrekas, C., Hedin, A., Sánchez, B. J., Siewers, V., Nielsen, J., & David, F. (2019). Model-Assisted Fine-Tuning of Central Carbon Metabolism in Yeast through dCas9Based Regulation. ACS Synhetic Biology, 8(11), 2457–2463. https://doi.org/10.1021/acssynbio.9b00258 Foury, F. (1997). Human genetic diseases: A cross-talk between man and yeast. Gene, 195(1), 1–10. https://doi.org/10.1016/S0378-1119(97)00140-6 Ghosh, K., & Van Duyne, G. D. (2002). Cre–loxP biochemistry. Methods, 28(3), 374–383. https://doi.org/10.1016/S1046-2023(02)00244-X Guldener, U. (1996). A new efficient gene disruption cassette for repeated use in budding yeast. NucleicAcidsResearch, 24(13), 2519–2524. https://doi.org/10.1093/nar/24.13.2519 Gunningham, N. (1995). Environment, Self-Regulation, and the Chemical Industry: Assessing Responsible Care*. Law & Policy, 17(1), 57–109. https://doi.org/10.1111/j.14679930.1995.tb00139.x Hanson, P. K. (2018). Saccharomycescerevisiae: A Unicellular Model Genetic Organism of Enduring Importance. Current Protocols Essential LaboratoryTechniques, 16(1), e21. https://doi.org/10.1002/cpet.21 He, J., Zhang, P., Shen, L., Niu, L., Tan, Y., Chen, L., Zhao, Y., Bai, L., Hao, X., Li, X., Zhang, S., & Zhu, L. (2020). Short-Chain Fatty Acids and Their Association with Signalling Pathways in Inflammation, Glucose and Lipid Metabolism. International JournalofMolecularSciences, 21(17), Artigo 17. https://doi.org/10.3390/ijms21176356 Heath, R. J., Li, J., Roland, G. E., & Rock, C. O. (2000). Inhibition of the Staphylococcus aureus NADPH-dependent Enoyl-Acyl Carrier Protein Reductase by Triclosan and Hexachlorophene *. Journal of Biological Chemistry, 275(7), 4654–4659. https://doi.org/10.1074/jbc.275.7.4654 Heath, R. J., Su, N., Murphy, C. K., & Rock, C. O. (2000). The Enoyl-[acyl-carrier-protein] Reductases FabI and FabL fromBacillus subtilis *. JournalofBiologicalChemistry, 275(51), 40128–40133. https://doi.org/10.1074/jbc.M005611200
53 Kätelhön, A., Meys, R., Deutz, S., Suh, S., & Bardow, A. (2019). Climate change mitigation potential of carbon capture and utilization in the chemical industry. Proceedingsof the NationalAcademyofSciences, 116(23), 11187–11194. https://doi.org/10.1073/pnas.1821029116 Kevin R., O., Vo, K. T., Michaelis, S., & Paddon, C. (1997). Recombination-mediated PCRdirected plasmid construction in vivo in yeast. NucleicAcidsResearch, 25(2), 451–452. https://doi.org/10.1093/nar/25.2.451 Lee, J. Y., Kang, C. D., Lee, S. H., Park, Y. K., & Cho, K. M. (2015). Engineering cellular redox balance in Saccharomycescerevisiae for improved production of L-lactic acid. Biotechnology andBioengineering, 112(4), 751–758. https://doi.org/10.1002/bit.25488 Leibundgut, M., Maier, T., Jenni, S., & Ban, N. (2008). The multienzyme architecture of eukaryotic fatty acid synthases. CurrentOpinioninStructuralBiology, 18(6), 714–725. https://doi.org/10.1016/j.sbi.2008.09.008 Lopez, G., Keiner, D., Fasihi, M., Koiranen, T., & Breyer, C. (2023). From fossil to green chemicals: Sustainable pathways and new carbon feedstocks for the global chemical industry. Energy& EnvironmentalScience, 16(7), 2879–2909. https://doi.org/10.1039/D3EE00478C Lum, P. Y., Armour, C. D., Stepaniants, S. B., Cavet, G., Wolf, M. K., Butler, J. S., Hinshaw, J. C., Garnier, P., Prestwich, G. D., Leonardson, A., Garrett-Engele, P., Rush, C. M., Bard, M., Schimmack, G., Phillips, J. W., Roberts, C. J., & Shoemaker, D. D. (2004). Discovering Modes of Action for Therapeutic Compounds Using a Genome-Wide Screen of Yeast Heterozygotes. Cell, 116(1), 121–137. https://doi.org/10.1016/S0092-8674(03)01035-3 Malcı, K., Santibáñez, R., Jonguitud-Borrego, N., Santoyo-Garcia, J. H., Kerkhoven, E. J., & Rios-Solis, L. (2023). Improved production of Taxol® precursors in S. cerevisiae using combinatorial in silico design and metabolic engineering. Microbial Cell Factories, 22(1), 243. https://doi.org/10.1186/s12934-023-02251-7 Massengo-Tiassé, R. P., & Cronan, J. E. (2009). Diversity in enoyl-acyl carrier protein reductases. CellularandMolecularLifeSciences, 66(9), 1507–1517. https://doi.org/10.1007/s00018-0098704-7
54 Matuo, R., Sousa, F. G., Soares, D. G., Bonatto, D., Saffi, J., Escargueil, A. E., Larsen, A. K., & Henriques, J. A. P. (2012). Saccharomyces cerevisiae as a model system to study the response to anticancer agents. Cancer Chemotherapy and Pharmacology, 70(4), 491–502. https://doi.org/10.1007/s00280-012-1937-4 Middleton, B. A. (2011). Multidisciplinary Approaches to Climate Change Questions. Em B. A. LePage (Ed.), Wetlands: IntegratingMultidisciplinaryConcepts (pp. 129–136). Springer Netherlands. https://doi.org/10.1007/978-94-007-0551-7_7 Mulder, K. C. L., Mulinari, F., Franco, O. L., Soares, M. S. F., Magalhes, B. S., & Parachin, N. S. (2015). Lovastatin production: From molecular basis to industrial process optimization. Biotechnology Advances, 33(6, Part 1), 648–665. https://doi.org/10.1016/j.biotechadv.2015.04.001 Niehaus, F., Bertoldo, C., Kähler, M., & Antranikian, G. (1999). Extremophiles as a source of novel enzymes for industrial application. AppliedMicrobiologyandBiotechnology, 51(6), 711– 729. https://doi.org/10.1007/s002530051456 Nielsen, J. (2019). Yeast Systems Biology: Model Organism and Cell Factory. Biotechnology Journal, 14(9), 1800421. https://doi.org/10.1002/biot.201800421 Orr-Weaver, T. L., Szostak, J. W., & Rothstein, R. J. (1981). Yeast transformation: A model system for the study of recombination. ProceedingsoftheNationalAcademyofSciences, 78(10), 6354–6358. https://doi.org/10.1073/pnas.78.10.6354 Pereira, F., Azevedo, F., Parachin, N. S., Hahn-Hägerdal, B., Gorwa-Grauslund, M. F., & Johansson, B. (2016). Yeast Pathway Kit: A Method for Metabolic Pathway Assembly with Automatically Simulated Executable Documentation. ACSSynthetic Biology, 5(5), 386–394. https://doi.org/10.1021/acssynbio.5b00250 Piwowarek, K., Lipińska, E., Hać-Szymańczuk, E., Kieliszek, M., & Ścibisz, I. (2018). Propionibacterium spp.—Source of propionic acid, vitamin B12, and other metabolites important for the industry. Applied Microbiology and Biotechnology, 12(2), 515–538. https://doi.org/10.1007/s00253-017-8616-7 Pozdniakova, T. A., Cruz, J. P., Silva, P. C., Azevedo, F., Parpot, P., Domingues, M. R., Carlquist, M., & Johansson, B. (2023). Optimization of a hybrid bacterial/Arabidopsis thaliana fatty acid
55 synthase system II in Saccharomyces cerevisiae. Metabolic Engineering Communications, 17, e00224. https://doi.org/10.1016/j.mec.2023.e00224 Rodionova, M. V., Poudyal, R. S., Tiwari, I., Voloshin, R. A., Zharmukhamedov, S. K., Nam, H. G., Zayadan, B. K., Bruce, B. D., Hou, H. J. M., & Allakhverdiev, S. I. (2017). Biofuel production: Challenges and opportunities. InternationalJournalofHydrogenEnergy, 42(12), 8450–8461. https://doi.org/10.1016/j.ijhydene.2016.11.125 Rodríguez-Frías, F., Quer, J., Tabernero, D., Cortese, M. F., Garcia-Garcia, S., Rando-Segura, A., & Pumarola, T. (2021). Microorganisms as Shapers of Human Civilization, from Pandemics to Even Our Genomes: Villains or Friends? A Historical Approach. Microorganisms, 9(12), Artigo 12. https://doi.org/10.3390/microorganisms9122518 Schadeweg, V., & Boles, E. (2016). N-Butanol production in Saccharomyces cerevisiae is limited by the availability of coenzyme A and cytosolic acetyl-CoA. Biotechnology for Biofuels, 9(1), 44. https://doi.org/10.1186/s13068-016-0456-7 Schweizer, E., Werkmeister, K., & Jain, M. K. (1978). Fatty acid biosynthesis in yeast. Molecular andCellularBiochemistry, 21(2), 95–107. https://doi.org/10.1007/BF00240280 Seddon, N., Mace, G. M., Naeem, S., Tobias, J. A., Pigot, A. L., Cavanagh, R., Mouillot, D., Vause, J., & Walpole, M. (2016). Biodiversity in the Anthropocene: Prospects and policy. Proceedings of the Royal Society B: Biological Sciences, 283(1844), 20162094. https://doi.org/10.1098/rspb.2016.2094 Seiber, J. N., Coats, J., Duke, S. O., & Gross, A. D. (2014). Biopesticides: State of the Art and Future Opportunities. JournalofAgriculturalandFoodChemistry, 62(48), 11613–11619. https://doi.org/10.1021/jf504252n Sicard, D., & Legras, J.-L. (2011). Bread, beer and wine: Yeast domestication in the Saccharomyces sensu stricto complex. Comptes Rendus Biologies, 334(3), 229–236. https://doi.org/10.1016/j.crvi.2010.12.016 Singh, K., Graf, B., Linden, A., Sautner, V., Urlaub, H., Tittmann, K., Stark, H., & Chari, A. (2020). Discovery of a Regulatory Subunit of the Yeast Fatty Acid Synthase. Cell, 18(6), 11301143.e20. https://doi.org/10.1016/j.cell.2020.02.034
56 Singh, N., Singh, J., & Singh, K. (2018). Small at Size, Big at Impact: Microorganisms for Sustainable Development. Em J. Singh, D. Sharma, G. Kumar, & N. R. Sharma (Eds.), Microbial Bioprospecting forSustainableDevelopment (pp. 3–28). Springer. https://doi.org/10.1007/978-981-13-0053-0_1 Sovacool, B. K., Griffiths, S., Kim, J., & Bazilian, M. (2021). Climate change and industrial Fgases: A critical and systematic review of developments, sociotechnical systems and policy options for reducing synthetic greenhouse gas emissions. RenewableandSustainableEnergy Reviews, 141, 110759. https://doi.org/10.1016/j.rser.2021.110759 Steensels, J., Snoek, T., Meersman, E., Nicolino, M. P., Voordeckers, K., & Verstrepen, K. J. (2014). Improving industrial yeast strains: Exploiting natural and artificial diversity. FEMS MicrobiologyReviews, 38(5), 947–995. https://doi.org/10.1111/1574-6976.12073 Suástegui, M., & Shao, Z. (2016). Yeast factories for the production of aromatic compounds: From building blocks to plant secondary metabolites. JournalofIndustrialMicrobiologyand Biotechnology, 43(11), 1611–1624. https://doi.org/10.1007/s10295-016-1824-9 Sun, Z., Meng, H., Li, J., Wang, J., Li, Q., Wang, Y., & Zhang, Y. (2014). Identification of Novel Knockout Targets for Improving Terpenoids Biosynthesis in Saccharomyces cerevisiae. PLOS ONE, 9(11), e112615. https://doi.org/10.1371/journal.pone.0112615 Szostak, J. W., Orr-Weaver, T. L., Rothstein, R. J., & Stahl, F. W. (1983). The double-strand-break repair model for recombination. Cell, 33(1), 25–35. https://doi.org/10.1016/00928674(83)90331-8 Treangen, T. J., & Salzberg, S. L. (2012). Repetitive DNA and next-generation sequencing: Computational challenges and solutions. NatureReviewsGenetics, 13(1), Artigo 1. https://doi.org/10.1038/nrg3117 Uemura, H. (2012). Synthesis and production of unsaturated and polyunsaturated fatty acids in yeast: Current state and perspectives. AppliedMicrobiologyandBiotechnology, 95(1), 1–12. https://doi.org/10.1007/s00253-012-4105-1 Vanderwaeren, L., Dok, R., Voordeckers, K., Nuyts, S., & Verstrepen, K. J. (2022). Saccharomyces cerevisiae as a Model System for Eukaryotic Cell Biology, from Cell Cycle
57 Control to DNA Damage Response. International JournalofMolecularSciences, 23(19), Artigo 19. https://doi.org/10.3390/ijms231911665 Vojcic, L., Pitzler, C., Körfer, G., Jakob, F., Ronny Martinez, Maurer, K.-H., & Schwaneberg, U. (2015). Advances in protease engineering for laundry detergents. NewBiotechnology, 32(6), 629–634. https://doi.org/10.1016/j.nbt.2014.12.010 Walker, M. E., Gardner, J. M., Vystavelova, A., McBryde, C., de Barros Lopes, M., & Jiranek, V. (2003). Application of the reuseable, KanMX selectable marker to industrial yeast: Construction and evaluation of heterothallic wine strains of Saccharomyces cerevisiae, possessing minimal foreign DNA sequences. FEMS Yeast Research, 4(3), 339–347. https://doi.org/10.1016/S1567-1356(03)00161-2 Walley, N., & Whitehead, B. (1994, maio 1). It’s Not Easy Being Green. HarvardBusiness Review. https://hbr.org/1994/05/its-not-easy-being-green Westfall, P. J., Pitera, D. J., Lenihan, J. R., Eng, D., Woolard, F. X., Regentin, R., Horning, T., Tsuruta, H., Melis, D. J., Owens, A., Fickes, S., Diola, D., Benjamin, K. R., Keasling, J. D., Leavell, M. D., McPhee, D. J., Renninger, N. S., Newman, J. D., & Paddon, C. J. (2012). Production of amorphadiene in yeast, and its conversion to dihydroartemisinic acid, precursor to the antimalarial agent artemisinin. ProceedingsoftheNationalAcademyofSciences, 19(3), E111–E118. https://doi.org/10.1073/pnas.1110740109 Xiberras, J., Klein, M., de Hulster, E., Mans, R., & Nevoigt, E. (2020). Engineering Saccharomyces cerevisiae for Succinic Acid Production From Glycerol and Carbon Dioxide.FrontiersinBioengineeringandBiotechnology,8.https://www.frontiersin.org/ articles/10.3389/fbioe.2020.00566 Xin, D., Ahmad, M., & Khattak, S. I. (2022). Impact of innovation in climate change mitigation technologies related to chemical industry on carbon dioxide emissions in the United States. Journal of Cleaner Production, 379, 134746. https://doi.org/10.1016/j.jclepro.2022.134746 Yang, L., Lübeck, M., & Lübeck, P. S. (2017). Aspergillus as a versatile cell factory for organic acidproduction.FungalBiologyReviews,31(1),33–49. https://doi.org/10.1016/j.fbr.2016.11.001
58 Zhang, J., Pierick, A. ten, van Rossum, H. M., Maleki Seifar, R., Ras, C., Daran, J.-M., Heijnen, J. J., & Aljoscha Wahl, S. (2015). Determination of the Cytosolic NADPH/NADP Ratio in Saccharomyces cerevisiae using Shikimate Dehydrogenase as Sensor Reaction. Scientific Reports, 5(1), Artigo 1. https://doi.org/10.1038/srep12846
65 7.5 pTA5_FASIIb construction 7.5.1 Used primers Primer name Sequence (5’—> 3’) 714 AAATGAATTTTGAAGGAAAAATC 715 TCAGACCATGTACATCCC 408 TTTAAACTTTTGAATATGTATTACTTGGTTATGGT 411 TTAAATACGCGGCGTTATGTCAC 417 TTAAATAACAATGCATACTTTGTACGTTCA 713 TTAGATCTTTTTAAAGATCAAAGAAC 717 TCAGAAGGCAGACGTATC 719 TCAGGCCTCCCGGCTA 729 TTAACTTTCAATAATTACCGTGG 763 TTAAATCTACATAAGTGCAATTAAAGCAT 829 TAATTAATGTTGCTGAGATTTGTG 856 TTAAATTGTAATGTTCTAACAAAAATTT 1020 TTAAATAGATACTAAAAAGAAACCTTC 1026 TTAAATCGATTTCCCACATCCT
66 7.5.2 pTA5_FASIIb sequencing
67
68
69
70
71
72
73
74
81
82
83
84