scieee AI-readable full text Open interactive document viewer

Multi-species biofilms in bacterial vaginosis: ecological interactions and susceptibility to novel antimicrobial agents

Rosca, Aliona

Abstract

A vaginose bacteriana (VB), a causa mais comum de distúrbio vaginal, está associada a complicações ginecológicas e obstétricas graves. Durante a VB, um biofilme polimicrobiano é formado no epitélio vaginal, formado principalmente por espécies de Gardnerella, mas contendo também diversos outros microrganismos anaeróbios. No entanto, pouco se sabe sobre o papel destes microrganismos no desenvolvimento de VB, sendo, no entanto, evidente que os biofilmes polimicrobianos de VB apresentam uma maior capacidade de sobreviver ao tratamento clássico por antibióticos. Por essa razão, a busca por novas terapias contra VB tem vindo a aumentar. Nesta tese, investigou-se as interações entre Gardnerella vaginalis e outras espécies associadas à VB, com o objetivo de compreender como estas interações afetam a formação de biofilmes e qual o impacto no tratamento antimicrobiano. Foram usados dois modelos distintos de formação de biofilmes triplos, o que permitiu concluir que, in vitro, G. vaginalis é a espécie microbiana que constituiu a maior parte da biomassa de todos os consórcios testados, em ambos os modelos. Verificou-se também que, em alguns dos consórcios, a capacidade antimicrobiana quer de antibióticos comuns, quer do óleo essencial (OE) obtido da planta Thymbra capitata, sofreram reduções de atividade, o que ajuda a explicar a elevada taxa de recorrência nos casos de VB. No global deste estudo, destacou-se (i) o papel central da Gardnerella na formação de biofilmes polimicrobianos associados à VB, (ii) como as interações entre bactérias em biofilmes polimicrobianos impactam a formação de biofilme e a suscetibilidade antimicrobiana, e (iii) o potencial antimicrobiano do OE de T. capitata contra biofilmes polimicrobianos associados à VB. Os resultados obtidos nesta tese podem ajudar a desenvolver novas abordagens terapêuticas com base em OE de T. capitata, a fim de prevenir VB e reduzir a sua recorrência.

Full text

Universidade do Minho Escola de Engenharia Aliona Rosca março de 2021 Multi-species biofilms in bacterial vaginosis: ecological interactions and susceptibility to novel antimicrobial agents Aliona Rosca Multi-species biofilms in bacterial vaginosis: ecological interactions and susceptibility to novel antimicrobial agents UMinho|2021 março de 2021 Trabalho efetuado sob a orientação do Doutoramento Engenharia Química e Biológica Universidade do Minho Escola de Engenharia Aliona Rosca Multi-species biofilms in bacterial vaginosis: ecological interactions and susceptibility to novel antimicrobial agents Trabalho efetuado sob a orientação Doutor Nuno Cerca e do Prof. Dr. Mario Vaneechoutte Tese de Doutoramento Universidade do Minho Escola de Engenharia ii DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS Este é um trabalho académico que pode ser utilizado por terceiros desde que respeitadas as regras e boas práticas internacionalmente aceites, no que concerne aos direitos de autor e direitos conexos. Assim, o presente trabalho pode ser utilizado nos termos previstos na licença abaixo indicada. Caso o utilizador necessite de permissão para poder fazer um uso do trabalho em condições não previstas no licenciamento indicado, deverá contactar o autor, através do RepositóriUM da Universidade do Minho. Licença concedida aos utilizadores deste trabalho Atribuição-NãoComercial-SemDerivações CC BY-NC-ND https://creativecommons.org/licenses/by-nc-nd/4.0/ iii Acknowledgements I would like to express my sincere appreciation to many people without whom the accomplishment of this work would not have been possible. First and foremost, I am immensely grateful to Dr. Nuno Cerca for giving me the opportunity to be part of his research team, for his guidance, patience, support, his time and effort, and useful suggestions and critiques on my research works. Muito obrigada! I would like also to express my gratitude to my co-supervisor, Prof. Dr. Mario Vaneechoutte, for warmly receiving me at his lab (Laboratory Bacteriology Research) at the University of Ghent, for his constructive feedback and help, encouragement, assistance in writing articles, and the thesis. I also extend my sincere thanks to the “NC group” members, including Andreia, Ângela, Fernando, Joana, Lúcia, Luciana, Nathalie, Susana, and Vânia for generously sharing their knowledge, for their patience, support, and friendship. I am especially thankful to Joana Castro for helping me with the lab work, for her incredible kindness and patience, her valuable suggestions, and for her contribution in the part of the work presented here. I highly appreciate your dedication, Joana, and I will never forget your support! I would like also to thank the girls from “MOP group” for their willingness to help whenever necessary. To all my colleagues at LBR, namely Abel, Antonio, Hans, Kelly, Masha, Maya, and Tessa, I thank them for their scientific suggestions and friendship. My special thanks go to Leen Van Simaey for her kindness and promptness in helping me in the lab during my work at LBR. I also express my appreciation to all the people who, in a less direct, but no less important way, had a significant role in my PhD journey: the Centre of Biological Engineering and all those who are part of it; the Directive Board and my colleagues from Doctoral Program in Applied and Environmental Microbiology; my supervisor, Dr. Mihael-Cristin Ichim, and my colleagues from my previous research group from Romania; my previous and current flatmates in Braga, in particular Andreia, Gabriel, Joice, and Laís; my future brother-in-law, Apostolis; my friends from Moldova and Romania and the ones I have met in Portugal. My warmest appreciation goes to my “friends as family” Mahwish, Beatrice, and Samuel. You, guys, made me feel at home in Portugal. Saudades! Finally, I would like to thank the most important people in my life, my sister, my brother, and my parents. Your unconditional love and support, in spite of hundreds of kilometres between us, helped me during this challenging period in my life. Thank you for always believing in me, even in those moments when I cannot do that. Vă mulțumesc! This study was supported by the Portuguese Foundation for Science and Technology (FCT) through an individual PhD scholarship (PD/BD/128037/2016), the research project PTDC/BIA-MIC/28271/2017 under the scope of COMPETE 2020 (POCI-01-0145-FEDER-028271) and the strategic funding of UIDB/04469/2020 unit. iv STATEMENT OF INTEGRITY I hereby declare having conducted this academic work with integrity. I confirm that I have not used plagiarism or any form of undue use of information or falsification of results along the process leading to its elaboration. I further declare that I have fully acknowledged the Code of Ethical Conduct of the University of Minho. v Biofilmes polimicrobianos na vaginose bacteriana: interações ecológicas e suscetibilidade a novos agentes antimicrobianos Resumo A vaginose bacteriana (VB), a causa mais comum de distúrbio vaginal, está associada a complicações ginecológicas e obstétricas graves. Durante a VB, um biofilme polimicrobiano é formado no epitélio vaginal, formado principalmente por espécies de Gardnerella , mas contendo também diversos outros microrganismos anaeróbios. No entanto, pouco se sabe sobre o papel destes microrganismos no desenvolvimento de VB, sendo, no entanto, evidente que os biofilmes polimicrobianos de VB apresentam uma maior capacidade de sobreviver ao tratamento clássico por antibióticos. Por essa razão, a busca por novas terapias contra VB tem vindo a aumentar. Nesta tese, investigou-se as interações entre Gardnerella vaginalis e outras espécies associadas à VB, com o objetivo de compreender como estas interações afetam a formação de biofilmes e qual o impacto no tratamento antimicrobiano. Foram usados dois modelos distintos de formação de biofilmes triplos, o que permitiu concluir que, in vitro , G. vaginalis é a espécie microbiana que constituiu a maior parte da biomassa de todos os consórcios testados, em ambos os modelos. Verificou-se também que, em alguns dos consórcios, a capacidade antimicrobiana quer de antibióticos comuns, quer do óleo essencial (OE) obtido da planta Thymbra capitata, sofreram reduções de atividade, o que ajuda a explicar a elevada taxa de recorrência nos casos de VB. No global deste estudo, destacou-se (i) o papel central da Gardnerella na formação de biofilmes polimicrobianos associados à VB, (ii) como as interações entre bactérias em biofilmes polimicrobianos impactam a formação de biofilme e a suscetibilidade antimicrobiana, e (iii) o potencial antimicrobiano do OE de T. capitata contra biofilmes polimicrobianos associados à VB. Os resultados obtidos nesta tese podem ajudar a desenvolver novas abordagens terapêuticas com base em OE de T. capitata , a fim de prevenir VB e reduzir a sua recorrência. Palavras-chave: biofilmes polimicrobianos, Gardnerella , óleo essencial de Thymbra capitata , suscetibilidade antimicrobiana, vaginose bacteriana vi Multi-species biofilms in bacterial vaginosis: ecological interactions and susceptibility to novel antimicrobial agents Abstract Bacterial vaginosis (BV), the most common cause of vaginal discharge, is associated with serious gynaecologic and obstetric complications. The hallmark of BV is the presence of a polymicrobial biofilm on the vaginal epithelium, presumably initiated and mainly formed by Gardnerella species. However, the BV biofilm is also populated by many other anaerobes, but very little is known about their role in BV development. It has been shown that this polymicrobial biofilm may increase the survival of Gardnerella and other BV-associated species when exposed to antibiotics, as such causing high recurrence rates of BV. This triggered the interest in exploring agents that have been claimed to disrupt biofilms, such as plant-derived products, namely Thymbra capitata essential oil (EO). In this thesis, we investigated the interactions between Gardnerella vaginalis and other BV-associated species in BV biofilms, aiming to understand how they impact BV development and treatment outcome. First, two in vitro triple-species biofilm formation models were used, with and without allowing G. vaginalis to form an early biofilm before adding the other two species. The data from this study revealed that independent of the model used, all species were able to form triple-species biofilms, in which G. vaginalis was always the predominant species. Interestingly, we observed that in some triple-species consortia, synergistic interactions affected the antibiotic treatment outcome, leading to an enhanced tolerance. Second, when applying T. capitata EO against multi-species biofilms consisting of six cultivable BVassociated species, we observed that the interactions between the species also influenced, to some extent, the EO antimicrobial activity. The data collected in this study further highlight (i) the pivotal role of Gardnerella in BV polymicrobial biofilms, (ii) how interactions between bacteria in multi-species biofilms impact the biofilm formation and antimicrobial susceptibility, and (iii) the antimicrobial potential of T. capitata EO against multi-species BVassociated biofilms. These findings could help to further shape novel treatment approaches based on T. capitata EO in order to prevent BV and reduce its recurrence. Keywords: antimicrobial susceptibility, bacterial vaginosis, Gardnerella spp., multi-species biofilms, Thymbra capitata essential oil vii Table of contents CHAPTER 1 Introduction ....................................................................................................................................................... 1 1.1 Background ............................................................................................................................................ 2 1.2 Research questions ................................................................................................................................. 3 1.3 Hypothesis and aims............................................................................................................................... 3 1.3.1 Hypothesis ....................................................................................................................................... 3 1.3.2 Aims ................................................................................................................................................ 3 1.4 Significance ............................................................................................................................................ 4 1.5 Thesis outline ......................................................................................................................................... 4 1.6 References.............................................................................................................................................. 7 CHAPTER 2 Literature review .............................................................................................................................................. 10 2.1 Introduction ......................................................................................................................................... 11 2.2 The healthy vaginal microbiota ............................................................................................................. 11 2.3 The unbalanced vaginal microbiota ...................................................................................................... 13 2.3.1 Bacterial vaginosis ......................................................................................................................... 15 2.3.1.1 Clinical features and diagnosis of BV ....................................................................................... 15 2.3.1.2 Treatment of BV ..................................................................................................................... 17 2.3.1.3 Etiology of BV ......................................................................................................................... 18 2.3.1.4 Epidemiology of BV ................................................................................................................. 19 2.3.1.5 Bacteria implicated in BV ........................................................................................................ 21 2.3.2 Association of BV with vaginal infections ......................................................................................... 22 2.3.2.1 BV and aerobic vaginitis .......................................................................................................... 23 2.3.2.2 BV and vulvovaginal candidiasis .............................................................................................. 23 2.3.2.3 BV and trichomoniasis ............................................................................................................ 24 2.3.2.4 BV and chlamydia/ gonorrhea ................................................................................................ 24 2.3.2.5 BV and viral vaginitis ............................................................................................................... 25 2.4 Vaginal biofilms in BV .......................................................................................................................... 25 2.4.1 Microbial interactions in the vaginal environment ............................................................................ 27 2.4.1.1 Interactions between Gardnerella spp., BV-associated anaerobes, and commensal bacteria ..... 27 2.5 Polymicrobial interactions: impact on antimicrobial therapy .................................................................. 29 xiv Figure 5.3. Comparison of total biofilm biomass after 48 h of incubation in the two different experimental models. ....................................................................................................................................................................... 95 Figure 5.4. Relative composition of each triple-species biofilm consortium as quantified by PNA FISH. .............. 96 Figure 5.5. CLSM analysis of bacterial distribution in the intact structure of the triple-species BV-associated biofilms. ....................................................................................................................................................................... 97 Figure 5.6. Effect of clindamycin (A) or metronidazole (B) on total biomass of G. vaginalis single-species biofilms as well as triple-species biofilms from both in vitro models. .............................................................................. 99 CHAPTER 6 Figure 6.1. Characterization of singleand BV multi-species biofilms grown under in vitro conditions. .............. 111 Figure 6.2. Effect of T. capitata EO on biomass of singleand multi-species biofilms of BV-associated bacteria.. ..................................................................................................................................................................... 113 Figure 6.3. Effect of T. capitata EO on multi-species biofilms assessed by Live/ Dead staining. ....................... 113 Figure 6.4. Effect of T. capitata EO on cell culturability from singleand multi-species biofilms of BV-associated bacteria. ........................................................................................................................................................ 114 xv List of tables CHAPTER 2 Table 2.1. Main characteristics of the normal vaginal microbiota and of the most common vaginal infections. ... 14 Table 2.2. Scoring system for Gram-stained vaginal contents. .......................................................................... 16 Table 2.3. Regimens for BV treatment. ............................................................................................................ 18 Table 2.4. Koch s postulates. .......................................................................................................................... 19 Table 2.5. Interactions between bacteria in BV and their predictive ecological effects. ....................................... 30 Table 2.6. Potential treatment strategies used against BV. ............................................................................... 38 CHAPTER 3 Table 3.1. BV-associated species used for planktonic and biofilm growth assays. .............................................. 59 Table 3.2. Culture media used for the growth of BV-associated bacteria. .......................................................... 62 CHAPTER 4 Table 4.1. Primers used in qPCR experiments. ................................................................................................ 77 Table 4.2. Bacterial species used in PNA FISH assays and their specificity with PNA probes Gard162 and AtoITM1. ....................................................................................................................................................................... 78 Table 4.3. Equations used to quantify bacterial populations in biofilms. ............................................................ 79 CHAPTER 5 Table 5.1. Correlation between OD620nm and both flow cytometry and Neubauer counting for bacterial suspensions of the strains used in this chapter. ................................................................................................................... 89 Table 5.2. Mechanisms of action and peak serum concentration (PSC) of clindamycin and metronidazole. ....... 92 Table 5.3. Susceptibility to clindamycin and metronidazole of the species used in this chapter. ........................ 98 CHAPTER 6 Table 6.1. Composition of the EO extracted from T. capitata. ......................................................................... 108 Table 6.2. Minimal inhibitory concentration (MIC) and minimal lethal concentration (MLC) of T. capitata EO for planktonic cells of BV-associated bacteria. ..................................................................................................... 112 xvi List of publications An important part of the work described in this thesis has been published elsewhere. Articles in peer-reviewed journals: Castro J, Rosca AS, Muzny CA, Cerca N. Atopobium vaginae and Prevotella bivia are able to incorporate and influence gene expression in a pre-formed Gardnerella vaginalis biofilm. Pathogens. 2021;10:247. doi:10.3390/pathogens10020247 Rosca AS, Castro J, Cerca N. Evaluation of different culture media to support in vitro growth and biofilm formation of bacterial vaginosis-associated anaerobes. PeerJ. 2020;8:e9917. doi: 10.7717/peerj.9917. Rosca AS*, Castro J*, Sousa LGV, Cerca N. Gardnerella and vaginal health: the truth is out there. FEMS Microbiol Rev. 2020;44(1):73-105. doi: 10.1093/femsre/fuz027. *Both authors contributed equally. Book chapter Rosca A, Cerca N. Bacterial Vaginosis. In Diagnostics to Pathogenomics of Sexually Transmitted Infections, ed. Sunit K. Singh PhD. Chapter 13; 2018. p. 257–275. doi: 10.1002/9781119380924.ch13. Oral presentations Rosca A*, Vaneechoutte M, Cerca N. Ecological characterization of mixed species biofilms associated with bacterial vaginosis. Third Joint BIOTECnico and AEM PhD programs workshop, Instituto Superior Técnico, Campus Alameda, 11th of June 2018, Lisbon, Portugal (*presenting author). Poster presentations Rosca A*, Vaneechoutte M, Cerca N. Gardnerella spp. pre-conditioned vs competitive multi-species biofilm growth and the impact on the tridimensional biofilm structure. MICROBIOTEC'19, December 5 – 7, 2019, Coimbra, Portugal (*presenting author). Rosca A*, Castro J, Cerca N. The effect of culture media on in vitro growth and biofilm formation of Bacterial vaginosis (BV)-associated pathogens. MICROBIOTEC'19, December 5 – 7, 2019, Coimbra, Portugal (*presenting author). xvii Rosca A, Vaneechoutte M, Cerca N*. Probing for bacterial interactions in Bacterial Vaginosis using an in vitro tri-species biofilm model. IUSTI 2018 World & European Congress, June 27 – 30, 2018, Dublin, Ireland (*presenting author). Rosca A*, Cerca N, Vaneechoutte M. Interactions between Gardnerella vaginalis and other Bacterial Vaginosis (BV)-related species in an in vitro biofilm model. Research Day & Student Research Symposium, Ghent, Belgium, 19th of April 2018 (*presenting author). Rosca A*, Martins AP, Castro J, Cerca N. Development of an in vitro vaginal exudate adhesion model for Bacterial Vaginosis. MICROBIOTEC'17, December 7 – 9, 2017, Porto, Portugal (*presenting author). xviii To my family. CHAPTER 1 Introduction Summary This chapter provides information on the outline of the thesis. A brief background, research questions, hypothesis, aims, and significance are also presented. 2 1.1 Background Bacterial vaginosis (BV) is recognized as one of the most common vaginal infections in women of reproductive age which, if left untreated, may cause serious obstetric and gynecologic complications, including preterm delivery (1,2), spontaneous abortion (3,4), low birth weight (5,6), pelvic inflammatory disease (7,8), infertility (9), and which may also lead to an increased risk of acquisition and transmission of several sexually transmitted infectious agents (10,11). Although the understanding of BV etiology is still limited, it is known that BV is characterized by a shift in the vaginal microbiota from the beneficial lactobacilli to vaginal dysbiosis with a dense biofilm containing a complex mixture of strict and facultative anaerobic bacteria, such as Gardnerella spp., Fannyhessea vaginae (previously known as Atopobium vaginae ) (12), Prevotella bivia , Mobiluncus curtisii , Peptostreptococcus anaerobius and/or Lactobacillus iners (13–15). It is thought that this biofilm allows BV-associated bacteria to display a high resistance to the protective mechanisms of normal vaginal microbiota (16) as well as an increased tolerance to antibiotics (17), leading, therefore, to treatment failure and high recurrence rates of BV. Microbiological analysis of BV suggests that the predominant species in this biofilm belong to the genus Gardnerella , found in more than 95% of all BV cases (18). It has been shown that Gardnerella spp. have a significantly higher virulence potential than many other BV-associated species (19,20) and therefore, it has been suggested that Gardnerella plays a pivotal role in BV development (21–24). However, despite this suggestion, there is doubt whether Gardnerella spp. alone are capable of causing BV or whether they must interact with other anaerobic species to cause BV. To that matter, some ex vivo studies have shown a synergy between Gardnerella spp. and F. vaginae in BV biofilms (25–27). Recently, it has been also demonstrated that synergistic interactions between Gardnerella spp. and other BV-associated species can lead to increased biofilm formation in dual-species biofilms (28–30). These findings paved the way for the further study of bacterial relationships in tripleas well as multi-species in vitro BV biofilms. In this thesis, interactions between Gardnerella vaginalis and other BV-associated species in dual-, triple- , and multi-species BV biofilms were investigated. After characterizing the biofilms, we also set out to evaluate the impact of bacterial interactions on the susceptibility of triple-species biofilms to the first-line antibiotics used to treat BV. Furthermore, the effect of Thymbra capitata essential oil (EO), a promising new therapeutical agent that could be used to treat BV (31), was also assessed on multi-species BV biofilms. Together, the work performed in this thesis is expected to advance our knowledge on the impact that bacterial cooperation may have on BV etiology and antimicrobial tolerance, since a better 3 understanding of polymicrobial interactions may be essential for the development of novel treatment approaches to cure BV. 1.2 Research questions The following questions will be addressed in this thesis: 1. Are nonGardnerella BV-associated species able to form in vitro single-species biofilms under the same experimental conditions? 2. Can interactions between G. vaginalis and other BV-associated species in triple-species in vitro biofilms be key in BV development and antimicrobial susceptibility? 3. Do interactions in multi-species BV-associated biofilms affect T. capitata EO treatment outcomes? Answers to these research questions are expected to provide new insights into importance of microbial interactions in BV and their impact on BV development and antimicrobial therapy. 1.3 Hypothesis and aims 1.3.1 Hypothesis The importance of microbial interactions within biofilms is established for various polymicrobial biofilmassociated infections (32–35). In this study, considering BV as a polymicrobial infection, it was hypothesized that the interactions established between BV-associated species play a role in BV biofilm development and increase the antimicrobial tolerance. 1.3.2 Aims The main goal of this study was to better understand the importance of microbial interactions in BV and how they impact BV pathogenesis. To accomplish this, the following specific aims were addressed. Aim 1: To determine an optimal culture medium for the planktonic and biofilm growth of six cultivable anaerobes frequently associated with BV, namely F. vaginae , Gardnerella sp., L. iners , M. curtisii , P. anaerobius , and P. bivia . 4 Aim 2: To evaluate the ability of key BV-associated species to incorporate into a pre-formed G. vaginalis biofilm in dualand triple-species consortia. Aim 3: To assess how G. vaginalis pre-formed biofilms influence the ability of known BV-associated species to establish triple-species biofilms. Aim 4: To determine the impact of triple-species biofilms on antimicrobial tolerance. Aim 5: To evaluate the effect of T. capitata EO on single-species or multi-species biofilms formed by six relevant BV-associated species. 1.4 Significance It is known that BV is characterized by the presence of a high number of strict and facultative anaerobic bacteria and some of these species have been found to form a polymicrobial biofilm on the vaginal epithelium. Although some in vivo and in vitro studies have described the occurrence of possible relationships among these bacterial species in BV biofilms, this subject still needs more detailed investigation. The main concern is that the incomplete eradication of this highly structured biofilm by antibiotics or host defences allows BV-associated bacteria to develop resistance to the antibiotic treatment and contribute to recurrent BV. Therefore, it becomes essential to unveil how BV-associated bacteria interact in the vaginal environment and contribute to the formation of the characteristic BV biofilm. This could lead to a better understanding of bacterial interactions during BV as well as shed new light on BV etiology. Furthermore, the results generated by this work could represent a valuable contribution for the development of novel therapeutic strategies to cure BV and consequently to reduce its rates. 1.5 Thesis outline In this thesis, following this introductory chapter, a literature review (Chapter 2) is presented, which summarizes the known information on BV and its association with vaginal biofilms. Special attention is given to polymicrobial interactions present in BV-associated biofilms and their impact on antimicrobial therapy. Chapters 3 to 6 present all the experimental data obtained after addressing the five aims of this thesis. Each of these chapters can be read independently, providing a summary, brief introduction, materials and methods, results, discussion, and conclusions. 5 Chapter 3 demonstrates the effect of nine different culture media on the planktonic and biofilm growth of six cultivable BV-associated species considered in this thesis. Chapter 4 presents the interactions between G. vaginalis , F. vaginae , and P. bivia in in vitro dualand triple-species biofilms. The biomass of these biofilms and their bacterial composition and distribution were first analysed and then the expression of G. vaginalis key virulence genes was assessed. Chapter 5 is focused on evaluating the influence of G. vaginalis pre-formed biofilms on the ability of known BV-associated species to establish triple-species biofilms. Two different in vitro biofilm formation models where tested, and the differences in bacterial composition and integration was assessed. Special attention is given to the impact of the triple-species biofilms on antimicrobial tolerance. Chapter 6 addresses the antibacterial activity of T. capitata EO against six cultivable BV-associated species grown planktonically and as biofilms. Moreover, the effect of EO was also assessed on a newly described multi-species BV biofilm formed by all six species considered in this chapter. Finally, this thesis is concluded with Chapter 7, which presents a summary of the major findings and their significance as well as limitations and future directions in this field of research. Figure 1.1 presents the thesis outline with the connection between the different chapters. 12 In addition to Lactobacillus spp., the vaginal microbiota of asymptomatic women of childbearing-age also includes other distinct taxa (29). Based on the differences in the composition and abundance of bacterial species, the vaginal microbiota of reproductive-age women has been devised in five major types, known as community state types (CST). Four of these CST are dominated by Lactobacillus crispatus (CST I), Lactobacillus gasseri (CST II), Lactobacillus iners (CST III), and Lactobacillus jensenii (CST V), while the CST IV does not comprise a substantial number of lactobacilli, but contains a wide range of facultative and strict anaerobic bacteria, including Atopobium, Aerococcus , Corynebacterium , Eggerthella , Finegoldia , Gardnerella , Megasphaera , Mobiluncus , Peptoniphilus , Prevotella , and Sneathia (11,29). Each CST presents a different bacterial proportion that varies among the four ethnic groups (Asian, white, black, and Hispanic), as illustrated in Figure 2.1. These variations appear to be determined by a combination of genetic, behavioural, cultural, and other undescribed factors (30,31). Nevertheless, all CST are composed by members that have been assigned to genera known to produce lactic acid, including Lactobacillus , Atopobium , and Megasphaera , being suggested that this ability may be conserved among communities (11). Overall, these findings challenged the knowledge that “normal and healthy” is synonymous with the presence of a high number of lactobacilli as almost 30% of healthy women lack appreciable numbers of Lactobacillus spp. (11,32,33). Figure 2.1. Representation of vaginal bacterial community state types (CST) within each ethnic group of women proposed by Ravel and colleagues (11). The study cohort included 96 Asian women, 97 white women, 104 black women, and 97 Hispanic women, showing the relationship between vaginal bacterial community composition and ethnic background. Besides the protective effect of beneficial vaginal microbiota, the colonization of vaginal environment by pathogenic microbes is also prevented by local components of the immune system (34). In the vagina, the innate immune system, which represents the first line of response to infection (35), consists of several 13 components that provide specific protective barriers against the invasion of pathogens (36). The mucus lining and epithelial cells act as gatekeepers preventing the entry of pathogens into the vagina and forming a protective physical barrier (37). The mucus layer, besides entrapping the invasive pathogens, it also provides lubrication and serves as a source of nutrition for the vaginal microbiota (36). In addition to the physical barrier, pattern recognition receptors, especially Toll-like receptors (38) and natural antimicrobial peptides (39) form a chemical barrier. Toll-like receptors recognize conserved pathogen-associated molecular patterns synthesized by different microorganisms, and their expression by the vaginal epithelial cells is considered to play an important role in antigen detection and initiation of the immune response (40). As regards the antimicrobial peptides, these present broad-spectrum antibacterial activity as well as additional biological functions including cell proliferation, cytokine induction, chemotaxis, and modulation of innate and adaptive immunity (35). Altogether, the beneficial vaginal microbiota together with the immune system provide protection in the vaginal environment, which has a significant impact on the health of women, their partners, and their newborns (41). Changes in the composition of the vaginal microbiota have been associated to several adverse health outcomes, including BV, as discussed in the next section. 2.3 The unbalanced vaginal microbiota The dynamic equilibrium of the vaginal microbiota can be altered at any time by environmental factors and external interferences, such as the use of antibiotics (42), vaginal douching (43), sexual intercourse (44) or hormone therapy (45). These changes can lead to periods of increased host susceptibility that negatively impact the ability of the vaginal community to resist pathogen colonization (46). Also, these alterations can determine the occurrence of microbial unbalances or dysbiosis in the urogenital tract, resulting in an infection (47). Vaginal infections are often caused by bacteria (as is the case for BV and for aerobic vaginitis), by fungi (vulvovaginal candidiasis), and by protozoa (trichomoniasis) as listed in Table 2.1. It is also important to note that STIs, including chlamydia, gonorrhoea or viral vaginitis, can also influence the vaginal microbiome (48) and present a certain relationship with BV, which will be further discussed. 14 Table 2.1. Main characteristics of the normal vaginal microbiota and of the most common vaginal infections. Vaginal fluid Vaginal fluid pH Clinical inflammation and symptoms Microscopic features Sexually transmitted References Healthy White, no or milky odour, variable viscosity along the cycle 3.5 – 4.5 No Mainly normal intermediate and superficial vaginal cells, numerous lactobacilli, very scarce leukocytes Not applicable (49–51) Bacterial vaginosis Abundant, greyish white, fishy odour, low viscosity > 4.5 Odorous discharge (or no symptoms at all), absence of redness; no or slight inflammation Clue cells, scarce or no lactobacilli, no leukocytes, abundant bacteria Controversial (49–51) Aerobic vaginitis Abundant watery, yellow, no fishy odour, low viscosity > 4.5 Erythema Scarce or no lactobacilli, leukocytes, abundant bacteria No (49–52) Vulvovaginal candidiasis White, none or ferment odour, “cottage cheeselike”, creamy or floccular, high viscosity 3.5 – 4.5 Diffuse redness, swelling and fissuring to the vulva, burning and pruritus Presence of vaginal cells from deeper layers, variable number of lactobacilli and leukocytes, blastoconidia and pseudohyphae No (49–51,53) Trichomoniasis Yellow/ green aqueous discharge, fishy/ putrid odour, low viscosity > 4.5 Erythema, red plaques, vulvar irritation and pruritus Protozoa identification, particularly if motile, numerous bacteria and leukocytes, many parabasal cells Yes (50,51,54) 15 2.3.1 Bacterial vaginosis BV is the most common bacterial vaginal infection among women of childbearing age worldwide, affecting between 23% to 29% of women in the general population (55). Microbiologically, BV is characterized by a change in the vaginal microbiota from the dominant health-associated lactobacilli to a polymicrobial microbiota, including strict and facultative anaerobic pathogens, whereby Gardnerella vaginalis plays a key role (11,56–58). It is important to mention that an emended description of G. vaginalis was recently proposed with the delineation of 13 genomic species within the genus Gardnerella (59). Following this renewed taxonomy of the genus Gardnerella , in this thesis, the term Gardnerella spp. will be used when discussing previous publications, which use the designation “ G. vaginalis ” to address the 13 different species of the genus Gardnerella , as it cannot be excluded the fact that other Gardnerella species were involved. In the last years, BV has emerged as a global issue of concern due to its association with a wide range of adverse outcomes. It has been described that BV notably increases the risk of development of gynaecological postoperative infections (60), pelvic inflammatory disease (61), and infertility (62). Also, BV has been related with adverse pregnancy outcomes such as intra-amniotic infections (63,64), premature rupture of membranes (65), premature labour and delivery (66,67), spontaneous abortion (68), low birth weight (69), and increased neonatal morbidity (70). Moreover, BV enables the transmission of STI agents, including the human immunodeficiency virus (71), human papillomavirus (72), Neisseria gonorrhoeae , and Chlamydia trachomatis (73). 2.3.1.1 Clinical features and diagnosis of BV BV is typically characterized by the presence of a profuse, greyish white, thin, and homogenous vaginal discharge with a fishy odour in symptomatic women (49). However, BV has been also reported as being asymptomatic in almost half of the cases (74,75). BV-associated bacteria are responsible for the abnormal vaginal discharge as they produce mucin-degrading enzymes, such as sialidases, that degrade the normal vaginal mucin gel, thus increasing its volume (76). Also, the fishy odour happens because of the presence of BV-associated bacteria that are known to produce volatile polyamines as a result of their metabolism (77). The diagnosis of BV is usually made by using the Amsel criteria, which are assessed based on the presence of at least three out of the following four characteristics: (i) thin, greyish white homogenous vaginal discharge; (ii) vaginal pH exceeding a value of 4.5; (iii) presence of at least 20% of clue cells (vaginal epithelial cells coated with bacteria) on microscopic examination of vaginal fluid; (iv) positive “whiff or sniff test”: presence of amine odour that is best induced by mixing vaginal secretion 16 with a 10% KOH solution on a glass slide (78). However, these characteristics are not always present, making Amsel criteria to some extent subjective (79). In an effort to improve the accuracy of BV diagnosis, Nugent and colleagues proposed a Gram stain scoring system for examining vaginal smears (80). This method, considered the gold standard for BV diagnosis (79), is based on the Gram staining interpretation of the presence and relative amounts in the vaginal fluid of three bacterial morphotypes: large Gram-positive bacilli (corresponding to lactobacilli), small Gram-negative and Gram-variable rods (assumed to correspond to Gardnerella spp. and Bacteroides species), and curved Gram-variable rods, before assigned to Mobiluncus , but recently suggested to correspond to Candidatus Lachnocurva vaginae species, previously known as BV-associated bacteria-1 (BVAB1) (81). Each morphotype is scored in a scale from 0 to 4+, taking into account the number of morphotypes observed per oil immersion field. Therefore, a Nugent score of 0-3 is marked by the presence of a high number of Gram-positive bacilli, or at least no Gardnerella spp. and Bacteroides spp. or Candidatus Lachnocurva vaginae morphotypes and is considered normal (no BV). A Nugent score of 7-10 leads to the diagnosis of BV and is marked by the presence of high concentrations of Gardnerella spp. and Bacteroides spp. or Candidatus Lachnocurva vaginae species and the absence of Gram-positive bacilli. An intermediate microbiota corresponds to a Nugent score of 4-6 and has Gram staining characteristics between these two poles, as summarized in Table 2.2. Table 2.2. Scoring system for Gram-stained vaginal contents (80). Score Lactobacillus spp. morphotypes Gardnerella spp. and Bacteroides spp. morphotypes Curved Gram-variable rods 0 4+ 0 0 1 3+ 1+ 1+ or 2+ 2 2+ 2+ 3+ or 4+ 3 1+ 3+ - 4 0 4+ - Vaginal microbiota diagnosis by Nugent score system Total score a 0 – 3 4 – 6 7 – 10 Interpretation Normal vaginal microbiota Intermediate vaginal microbiota Bacterial vaginosis a Morphotypes are scored as the average number seen per oil immersion field. Quantification of each individual score: 0 for no morphotype present; 1+ for 1 morphotype present; 2+, 1 to 4 morphotypes present; 3+, 5 to 30 morphotypes present; 4+, 30 or more morphotypes present. The total score = Lactobacillus spp. + Gardnerella spp. and Bacteroides spp. + Candidatus Lachnocurva vaginae species. However, the Nugent score system, as Amsel criteria, has some disadvantages, particularly because it requires a well-trained technician to perform it and is associated with the interobserver variability. Therefore, alternative methods for BV diagnosis have been investigated and used aiming for higher 17 specificity, sensitivity, and reproducibility. Molecular technologies such as DNA microarray analysis (82,83), polymerase chain reaction (PCR) (56,84), quantitative PCR (qPCR) (85–88) or fluorescence in situ hybridization (FISH) (89,90) have permitted the detection or even quantification of the main BVassociated bacteria. However, most of these novel methods are expensive and still require validation (91). Importantly, a recent review about molecular methods for BV diagnosis has concluded that despite the wide variety of diagnostic assays available to diagnose BV, clinicians will need to consider costs, result time, and accuracy in their decision to select a specific assay to test for BV (92). 2.3.1.2 Treatment of BV The current BV treatment is based on antibiotics and is directed toward relief of symptoms and signs of infection and reduction of the risk of STIs acquisition and BV-associated complications, mainly in pregnancy (93,94). Conventionally, BV is treated with either metronidazole, clindamycin or tinidazole, as described in Table 2.3. Even though certain studies reported successful short-term cure rates of antibiotic therapy (95,96), high levels of recurrence have been noticed within 6-12 months of treatment (97,98). As a result, treatment of recurrent BV can be difficult and may need prolonged courses of antibiotic therapy to obtain a long-lasting cure (99). Currently, metronidazole, a member of the nitroimidazole drug class, represents the first-line therapy for BV infection, serving as drug of first choice (100). However, various side effects are associated with metronidazole therapy, including nausea, diarrhea, vomiting metallic taste as well as headache and dizziness (100,101). Another antimicrobial agent that can be used to treat BV is clindamycin (94). It was found that topical and oral clindamycin appeared to present a similar effect with that of topical and oral metronidazole (102), with the important advantage of causing a lower rate of adverse side effects (metallic taste in the mouth, nausea, vomiting), when compared to oral metronidazole (95,103). However, due to the oil-based composition of both clindamycin ovules and cream, it has been pointed out that their use might weaken latex condoms and diaphragms for 5 days after use (94). Furthermore, the administration of clindamycin seems to be a risk factor for the development of Clostridium difficile infection (104). Finally, tinidazole is currently considered an alternative antimicrobial agent for BV treatment, particularly when metronidazole and clindamycin are not tolerated (94). Tinidazole has a longer half-life than metronidazole and thus, it requires lower dosages and is administered less frequently. Also, its side effects have been reported at half the frequency when compared to metronidazole (105). 18 Table 2.3. Regimens for BV treatment. Antibiotic regimen a Dose RECOMMENDED Metronidazole 500 mg orally twice a day for 7 days Metronidazole gel 0.75%, one full applicator (5 g) intravaginally daily for 5 days Clindamycin cream 2%, one full applicator (5 g) intravaginally at bedtime for 7 days ALTERNATIVE Tinidazole 2 g orally once daily for 2 days Tinidazole 1 g orally once daily for 5 days Clindamycin 300 mg orally twice daily for 7 days Clindamycin ovules 100 mg intravaginally once at bedtime for 3 days a The regimens for treatment of BV are according to Workowski and Bolan 2015 (94). 2.3.1.3 Etiology of BV The exact mechanism of how BV is triggered remains a matter of controversy. The lack of basic information about etiopathogenesis of BV led to the postulation of two main hypotheses. The first is the “primary pathogen” hypothesis, which infers that a single pathogenic species, Gardnerella spp., is the etiological agent of BV, usually transmitted by sexual contact (106). In contrast, the second is the “polymicrobial pathogen” hypothesis, which argues that Gardnerella spp. act in concert with other bacteria, principally anaerobes, to cause BV (107,108). Historically, Gardner and Dukes (109) were the first to propose that a “small pleomorphic gram-negative bacillus”, which they called Haemophilus vaginalis (first classification attributed to G. vaginalis ), was the etiological agent of BV, as they claimed that H. vaginalis fulfilled all the Koch s postulates described in Table 2.4 (110). Nevertheless, a later study carried out by Criswell and colleagues (111) revealed some failures of the previous study, as they demonstrated that the inoculation of the volunteers with a pure culture of H. vaginalis did not always cause BV, whereas their inoculation with vaginal discharge infected with H. vaginalis , did in most of the cases. Therefore, the assumption was made that H. vaginalis was not the specific causative agent of BV, failing one of the Koch s postulates. Subsequently, other anaerobic bacteria were also found during BV episodes (112,113), and this led to the postulation of the “polymicrobial pathogen” hypothesis (114). This hypothesis is supported by the fact that BV is characterized by a high bacterial diversity (115), with other BV-associated species than Gardnerella spp. being also able to inhibit the growth of lactobacilli (116). However, as previously revealed in some studies, 19 many BV anaerobes may not be as virulent as pathogenic strains of Gardnerella spp., in terms of cytotoxicity, adherence, and biofilm formation (117–119). It has been also pointed out that current knowledge on BV etiology does not allow to decide whether the presence of multi-species biofilms is the cause or simply a consequence of BV (120). Furthermore, this hypothesis is still conflicting with the epidemiological profile of BV since several studies have been stating that BV reflects the behaviour of a sexually transmitted or sexually enhanced infection (121,122). Therefore, despite all these findings, more evidence is needed to reveal what is, in fact, the primary trigger that initiates BV. Table 2.4. Koch s postulates. The etiologic microbe must be present in each case of the disease. The etiologic microbe can be isolated from a diseased host and grown in pure culture. The etiologic microbe from the pure culture must cause the disease when inoculated into a healthy, susceptible host. The etiologic microbe must be reisolated from the experimentally inoculated host and shown to be the same as the originally inoculated pathogen. 2.3.1.4 Epidemiology of BV As mentioned above, there is evidence that BV might be sexually transmitted (123). Several epidemiologic studies have described many sexual risk factors that may enhance BV acquisition and according to those studies, women are more probable to have BV if they: (i) have a high number of lifetime sexual partners (124,125); (ii) report a new sexual partner (126); (iii) use oral contraception as an alternative to condom (127) or (iv) report a high frequency of intercourse (128). In addition, women who have sex with women (129–132), as well as asymptomatic male carriers (133–135) could be also considered responsible for the sexual transmission of BV (Figure 2.2). 20 Figure 2.2. A schematic representation for understanding the epidemiology of BV. As proposed by Kenyon and Osbak 2014 (136), the vaginal microbiota of person A is interconnected to her oral and rectal microbiota and can also be connected to the oral and penile microbiota of person B. If person B has a simultaneous relationship with person C, the vaginal microbiota of person A can influence the microbiota of person C. These pathways can be influenced by several factors, including the frequency and type of sex, the use of oral contraception, and circumcision status. Similar connections occur with women who have sex with women. Although BV might be considered sexually transmitted, there are also some criticisms and controversial studies (124,137). Hence, Gardnerella spp. has also been found in adolescent women with no sexual activity (138), and recurrent BV has also been reported in a virgin adolescent woman (139). Further, an alternative model was proposed (121), in which BV was defined as a sexually enhanced rather than a sexually transmitted infection (Figure 2.3). According to this model, it was suggested that the unprotected sexual intercourse is responsible for the alteration of the physico-chemical vaginal environment, thereby also affecting the vaginal microbiota. In particular, as the alkaline ejaculate raises the vaginal pH, it makes the environment less favourable for lactobacilli and more suitable for the growth of BV-associated anaerobes. Condom utilization would protect against BV development by preventing the alkalinisation of the vaginal environment. However, this hypothesis has not been verified yet. Also, it was suggested that both protected and unprotected vaginal sex could, somewhat, promote the transfer of perianal, perineal, and perivulvar bacteria to the vagina, inducing BV (121). In addition, non-coital sexual behaviours, including receptive oral (140) and anal sex (141) and non-penetrative digito-genital contact (142), might also alter the balance of vaginal microbiota through the transfer of BV-associated pathogens from rectal and perineal areas to the vulvar area and vagina, perhaps enhancing BV development. 21 Figure 2.3. Representation of the epidemiological profile of BV in relation to sexual behaviour. This figure was created based on the information presented by Verstraelen and colleagues (121). Taken together, BV epidemiology in relation to sexual behaviour still remains controversial and it is not surprising that BV has been referred to as “one of the great enigmas in the field of medicine” (143). Even if BV is of high clinical importance, the exact global prevalence is still unknown as it varies according to the characteristics of the studied population (144). As mentioned above, this could be partially explained by the evidence that there exist at least 13 genomic species within the genus Gardnerella (59) and that there are differences in virulence potential between virulent and avirulent strains of these species (145), which, therefore, might play distinct roles in vaginal microbiota. Nevertheless, these findings demand further investigation. 2.3.1.5 Bacteria implicated in BV Although the current understanding of BV etiology is still scarce, the most common agreement is that BV is always associated with the overgrowth of numerous bacterial species, such as Gardnerella spp., F. vaginae , P. bivia , M. curtisii, Bacteroides fragilis , Fusobacterium nucleatum , Mobiluncus mulieris , Mycoplasma genitalium , Mycoplasma hominis or Ureaplasma urealyticum (146). The development of culture-independent profiling methods to detect fastidious or non-cultivable microorganisms has determined the broadening of the spectrum of anaerobes identified in women having BV with the addition of Bifidobacterium , Dialister , Eggerthella , Leptotrichia , and Megasphaera organisms (147,148), as well 28 Gardnerella spp., while others presented antagonistic activity (231). Subsequently, by performing confocal laser scanning microscopy, it was possible to observe among bacterial consortia differentiated biofilm structures in at least three unique dual-species biofilm morphologies (232). Also, the impact of the second BV-associated species on Gardnerella spp. virulence was assessed by quantifying the key genes, such as genes encoding for vaginolysin and sialidase, and significant variations were found, suggesting that some, but not all species, can modulate the virulence features of Gardnerella spp. as well as contribute to enhanced symptoms associated with BV (232). Several studies addressing synergistic interactions in BV have described specific nutritional pathways involving BV-associated bacteria. Back in 1979, an in vitro study identified nutritional pathways to maintain the synergistic relationship observed between Gardnerella spp. and P. bivia . Growth of P. bivia in a medium supplemented with amino acids or peptone resulted in ammonia production while the growth of Gardnerella spp. under the same conditions was accompanied by ammonia utilization (233). As a result, ammonia flow from P. bivia to Gardnerella spp. was suggested as a mechanism to support this interaction (234). Moreover, such commensal interaction was supported by another in vitro study in which it was demonstrated that Gardnerella spp. growth increased in the presence of P. bivia , and P. bivia reached higher numbers when incubated together with Gardnerella spp. (235). More recently, using a mice model, it has been shown that the presence of Gardnerella spp. enhanced the invasive potential of P. bivia , supporting its ascension into the uterus (236). Also, growth of Peptostreptococcus anaerobius has been shown to be enhanced in the presence of P. bivia , but not in pure culture (237). After analysing P. bivia culture supernatant, an elevated concentration of amino acids was observed compared to controls, followed by the growth of P. anaerobius and amino acids consumption. Moreover, the addition of amino acids to the growth medium, in concentrations similar to those produced after prior growth with P. bivia , had a stimulatory effect on the growth of P. anaerobius . Consequently, it has been proposed that the increased availability of amino acids supports the commensal synergism between P. bivia and P. anaerobius . In addition to these in vitro observations, there are studies conducted in vivo also demonstrating the existence of potential synergies among vaginal microorganisms present in BV. By investigating the composition and spatial distribution of bacteria in biopsy specimens from patients with BV, Swidsinski and colleagues (215) found that F. vaginae was homogeneously intermixed with Gardnerella spp. in an adherent specific biofilm. Later, Hardy and colleagues (238) confirmed the synergy between Gardnerella spp. and F. vaginae in samples containing biofilms from women with BV. Additionally, synergistic 29 interactions between Gardnerella spp. and M. hominis (239) or F. vaginae and Prevotella spp. (240) have been also identified in clinical samples. Contrary to synergistic interactions that are beneficial for the microorganisms, antagonistic interactions result in a negative effect for at least one species (230). The occurrence of antagonistic interactions among microorganisms within a community is almost unavoidable due to competition for nutrients, with effects on the viability and growth of competitors, or preference for colonization of new surfaces (241). In the vaginal environment, this type of interrelationships has been also identified, whereby the production of lactic acid by lactobacilli had a negative effect on many BV-associated pathogens (6). Although this effect has been only addressed in a few in vivo studies, there are many in vitro experiments that have demonstrated the antagonistic effect between lactobacilli and BV anaerobes, as presented in Table 2.5. 2.5 Polymicrobial interactions: impact on antimicrobial therapy Considering BV as a polymicrobial biofilm-associated infection, there is an emergent need to start focusing on exploring the effect of antibiotics on in vivo and in vitro BV biofilms in order to improve treatment options. Unfortunately, existing studies addressing this matter are still limited, and up to now, to our knowledge, no investigations have been reported about how polymicrobial interactions can increase the antimicrobial resistance of BV-associated bacteria (218,242). Nevertheless, important information can be deduced from studies that have explored antimicrobial activity in other polymicrobial infections, such as otitis media or cystic fibrosis. Studying otitis media, Perez and colleagues (243) showed that Moraxella catarrhalis and Streptococcus pneumoniae presented a higher resistance to the applied antibiotics when grown in polymicrobial biofilms, as compared to single-species biofilms. They demonstrated that a β-lactamase produced by M. catarrhalis provided passive protection to S. pneumoniae from β-lactam antibiotic killing, while S. pneumoniae protected M. catarrhalis from azithromycin killing. Similarly, as demonstrated by Lopes and colleagues (244), Dolosigranulum pigrum and Inquilinus limosus , two species isolated from the airways of patients with cystic fibrosis, became significantly more resistant to several antibiotics upon culture in dual-species biofilms with Pseudomonas aeruginosa . Also, multi-species biofilms composed of P. aeruginosa , Pseudomonas protegens , and Klebsiella pneumoniae were more resistant to tobramycin and sodium dodecyl sulfate compared to single-species biofilms, suggesting that enhanced resistance derives from a cross-protection that is beneficial to the entire community (245). 30 Table 2.5. Interactions between bacteria in BV and their predictive ecological effects. Microorganisms Interaction Mechanism Effect in host References SYNERGISTIC INTERACTIONS BETWEEN MICROORGANISMS FROM VAGINAL ECOSYSTEM Gardnerella spp . and Prevotella bivia P. bivia produced ammonia which was utilized by Gardnerella spp . which produced amino acids that were utilized by P. bivia Ammonia and amino acids cycle Presence of high vaginal pH (234) Gardnerella spp. and P. bivia Gardnerella spp . facilitated uterine infection by P. bivia The presence of Gardnerella spp . enhanced the invasive potential of P. bivia , facilitating its ascension into the uterus BV bacteria may actively inhibit inflammatory responses (236) Gardnerella spp. and Fannyhessea vaginae F. vaginae was homogeneously intermixed with Gardnerella spp. in specific BV-associated biofilms Unknown Presence of clue cells (215) Gardnerella spp. and F. vaginae Gardnerella spp. and F. vaginae are important constituents of the vaginal biofilm Unknown Presence of clue cells (238) Gardnerella spp. and Peptostreptococcus anaerobius Gardnerella spp . strains were able to enhance the growth of P. anaerobius Production of synergistic compounds by Gardnerella spp . Bacterial interactions have an important role in the ecology of vaginal microbiota (246) Gardnerella spp. and Eggerthella, Dialister sp. type 2 , F. vaginae , and Aerococcus christensenii Metabolic co-dependencies between these bacteria Unknown Possible contribution to enhance the incidence of BV (115) F. vaginae and Prevotella spp. Both bacterial species might have metabolic co-dependencies Unknown The combination of Prevotella spp. and/ or F. vaginae seems to help diagnose BV with high accuracy (240) 31 Table 2.5. Continued Microorganisms Interaction Mechanism Effect in host References SYNERGISTIC INTERACTIONS BETWEEN MICROORGANISMS FROM VAGINAL ECOSYSTEM Gardnerella spp. and Fusobacterium nucleatum, Mobiluncus mulieris, F. vaginae or P. bivia Gardnerella spp . biofilms derived a growth benefit from the addition of a second species, regardless of the species, in in vitro dual-species biofilms. Presence of Gardnerella spp. in the biofilms enhanced the growth of P. bivia and to a minor extent of F. nucleatum F. nucleatum was shown to be able to join an initial Gardnerella spp . biofilm (intermediate colonizer) The symbiotic relationships established between Gardnerella spp . and other anaerobes in BV biofilms could contribute to the progression of BV (235) Gardnerella spp. and Actinomyces neuii, Brevibacterium ravenspurgense, Corynebacterium amycolatum, Corynebacterium tuscaniense, Enterococcus faecalis, Escherichia coli, Nosocomiicoccus ampullae, Propionibacterium acnes, Staphylococcus saprophyticus, Staphylococcus simulans, Staphylococcus warnerii and Streptococcus anginosus These bacterial species were able to cause an enhancement of the biomass of a pre-formed Gardnerella spp. biofilm Unknown Could be associated with a high number of clue cells (231) Gardnerella spp. and E. coli or E. faecalis E. coli and E. faecalis were able to incorporate and enhance a preformed Gardnerella spp. biofilm In dual-species biofilms, each of these bacterial species seems to be able to coaggregate with Gardnerella spp. Uropathogens can associate in BV biofilm (247) Gardnerella spp. and Mycoplasma hominis Strong association between Gardnerella spp. and M. hominis were found in women with BV A potential quorum sensing-like interaction or co-response to an environmental stimulus The transmission of one of these bacteria could trigger the outgrowth of the other and start a process leading to BV (239) 32 Table 2.5. Continued Microorganisms Interaction Mechanism Effect in host References SYNERGISTIC INTERACTIONS BETWEEN MICROORGANISMS FROM VAGINAL ECOSYSTEM Gardnerella spp. and F. vaginae, A. neuii, C. tuscaniense, M. mulieris, S. anginosus, P. bivia, C. amycolatum, N. ampullae, P. acnes, B. ravenspurgense, E. faecalis, S. saprophyticus, S. simulans, S. hominis, S. warnerii Despite all BV-associated species were able to increase the cell number of a pre-formed Gardnerella spp. biofilm, not all bacterial species enhanced Gardnerella spp. virulence, according to transcriptomic findings Increased expression of genes associated with cytotoxicity, biofilm formation, antimicrobial resistance, and evasion of immune response by Gardnerella spp. in the presence of specific BV-associated bacteria in dual-species biofilms Bacterial interactions between coinfecting bacteria can profoundly affect the progress of BV and its clinical outcome (232) P. anaerobius and P. bivia Amino acids accumulation in P. bivia culture supernatants and subsequent growth of P. anaerobius in the conditioned supernatants P. anaerobius enhanced its growth in the presence of P. bivia , but not in pure culture. Amino acids served as a growth source for P. anaerobius Increased risk for female pelvic infections and adverse pregnancy outcome (237) ANTAGONISTIC INTERACTIONS BETWEEN MICROORGANISMS FROM VAGINAL ECOSYSTEM Lactobacillus spp. and Gardnerella spp., Mobiluncus spp., Bacteroides , and anaerobic cocci Lactobacillus inhibited the growth of bacteria isolated from women with BV The capacity of Lactobacillus to acidify the medium with a consequent decrease of pH and inhibition of pathogens growth Lactobacilli prevent the growth of bacteria associated with BV (248) Lactobacillus spp. and Gardnerella spp., Mobiluncus spp., Peptostreptococcus spp., Bacteroides spp. Lactobacillus inhibited the growth of Peptostreptococcus , M. curtisii , Gardnerella spp., and other anaerobes The inhibition by Lactobacillus was influenced by the pH of the growth medium The interactions between Lactobacillus and other bacteria may regulate the microbiological ecosystem of the vagina (116) Lactobacillus spp. and Gardnerella spp., Bacteroides spp., P. bivia Lactobacillus inhibited the growth of BV-associated bacteria Production of acids and hydrogen peroxide (H2O2) by lactobacilli Lactobacilli would prevent vaginal colonization by other bacteria associated with BV (249) 33 Table 2.5. Continued Microorganisms Interaction Mechanism Effect in host References ANTAGONISTIC INTERACTIONS BETWEEN MICROORGANISMS FROM VAGINAL ECOSYSTEM Lactobacillus acidophilus and Gardnerella spp. L. acidophilus produced a bacteriocin that inhibited the growth of Gardnerella spp. isolates Production of a bacteriocin by L. acidophilus Lactobacilli, by the production of bacteriocins, have the capacity to prevent the growth of pathogenic bacteria (250) Lactobacillus helveticus and Gardnerella spp. and P. bivia L. helveticus inhibited the growth and viability of Gardnerella spp. and P. bivia and also decreased the capacity of adhesion of Gardnerella spp. to HeLa cells The antagonistic activity is due to the compounds produced by L. helveticus L. helveticus is a potential probiotic (251) Lactobacillus spp. and Gardnerella spp. and P. bivia Lactobacillus strains isolated from vaginal cavity of healthy women showed antagonistic activity against Gardnerella spp. and P. bivia in coculture and also inhibited viability and adhesion of bacteria to HeLa cells Production of H2O2 and proteolytic enzyme-resistant compounds by Lactobacillus spp. Lactobacillus can control the vaginal microbiota and compete with other organisms for the adherence to epithelial cells (252) Lactobacillus spp. and Gardnerella spp. Lactobacillus has the capacity to displace and kill Gardnerella spp. growing as biofilm The production of H2O2 by some Lactobacillus strains seems to be the primary effect, however for some nonproducer strains, the production of biosurfactants, bacteriocins and signalling molecules may have effect on the displacement and viability of Gardnerella spp. Lactobacillus strains have the ability to disrupt biofilms that occur during BV and potentially reduce the need to antibiotics. Indigenous lactobacilli may have a restorative function to maintain a healthy vaginal microbiota (253) 34 Table 2.5. Continued Microorganisms Interaction Mechanism Effect in host References ANTAGONISTIC INTERACTIONS BETWEEN MICROORGANISMS FROM VAGINAL ECOSYSTEM Lactobacillus rhamnosus and Gardnerella spp. and P. bivia Lactobacillus showed bactericidal activity against Gardnerella spp. and P. bivia It probably includes the production of H2O2, lactic acid, and antibacterial compounds by Lactobacillus L. rhamnosus is considered a probiotic strain - a promising candidate for use in BV therapy (254) Lactobacillus spp. and Gardnerella spp., P. bivia , Mobiluncus spp., and Bacteroides fragilis Lactobacillus species inhibited the growth of Gardnerella spp., P. bivia , and Mobiluncus spp., but did not show effect against B. fragilis Production by Lactobacillus spp. of lactic acid, H2O2, and bacteriocins Potential role of lactobacilli against BV pathogens (255) Lactobacillus johnsonii , Lactobacillus gasseri and Gardnerella spp. Lactobacilli inhibited the growth of Gardnerella spp. Production by lactobacilli of lactic acid, H2O2, and heat-stable molecules The main metabolites of Lactobacillus spp. act cooperatively to kill BVassociated bacteria (22) Lactobacillus spp. and Gardnerella spp. Lactobacillus showed antagonistic activity against Gardnerella spp. Unknown Success in the BV development depends on the presence of Lactobacillus species (256) Lactobacillus crispatus and Gardnerella spp. L. crispatus produced lactic acid and inhibited the growth of Gardnerella spp. in an ex vivo porcine vaginal mucosal model Production by L. crispatus of antimicrobial compounds A stable L. crispatus colonization of live vaginal mucosa is able to prevent colonization by Gardnerella spp. in a pH-dependent manner (257) L. acidophilus , L. rhamnosus , and Gardnerella spp. and F. vaginae Lactobacillus was able to inhibit the growth of both Gardnerella spp. and F. vaginae The effect could be due to the production of lactic acid, H2O2, and bacteriocins L. acidophilus alone or combined with L. rhamnosus can be used in probiotic products to prevent bacterial infections (258) 35 In addition to bacterial-bacterial interactions, studies on bacterial-fungal interactions, also showed increased resistance to antibiotics. In this regard, by using an in vitro dual-species biofilm model of P. aeruginosa and Aspergillus fumigatus , both microorganisms highly prevalent in the airways of cystic fibrosis patients, Manavathu and colleagues (259) showed that P. aeruginosa cells associated with dualspecies biofilms were less susceptible to cefepime compared to those in the single-species biofilm, whereas A. fumigatus presented similar antifungal drug susceptibility in singleand dual-species biofilms. Increased antimicrobial resistance was also observed in the studies with E. coli and C. albicans (260) and S. aureus and C. albicans (261). Accordingly, E. coli and S. aureus cells embedded within C. albicans biofilm were found to have increased resistance to ofloxacin and vancomycin, respectively, when compared to their single-species biofilms. Taking into account the previously mentioned studies, we hypothesize that in BV biofilms similar interactions could also occur. Furthermore, several in vivo studies support this possibility. Bradshaw and colleagues (97) followed up 139 women with BV that were treated with oral metronidazole and found that recurrence rates of BV were significantly higher in women colonized with both Gardnerella spp. and F. vaginae , when compared to women infected with Gardnerella spp. only, suggesting that the association between these two bacterial taxa increased the tolerance to metronidazole, with direct impact on treatment failure. In another in vivo study, in which 18 patients diagnosed with BV were treated with metronidazole for 1 week, it was observed that the vaginal polymicrobial Gardnerella spp. biofilm was provisionally inhibited, but it quickly recovered its activity following treatment interruption (262). Remarkably, the authors found that high numbers of Gardnerella spp. and F. vaginae were present on the vaginal epithelium during follow-up analysis, further suggesting a potential synergism between these two bacterial taxa. Regarding the effect of clinically approved antibiotics, only a few studies on BV-associated in vitro biofilms have been reported so far. The first study to determine the effect of clindamycin on Gardnerella spp. biofilms showed that the concentration of 1600 μg·mL-1 was able to reduce up to 2-log of the viable cell count in the pre-established biofilms (263). Higher concentrations of both clindamycin (20000 μg·mL-1) and metronidazole (2000 μg·mL-1) were able to kill biofilm-associated Gardnerella spp. cells after 8 h of incubation (264). Subsequently, another study demonstrated that concentrations of 100 μg·mL-1 and 600 μg·mL-1 of clindamycin and metronidazole respectively, administered on 72 h Gardnerella spp. biofilms were sufficient to achieve 100% mortality (265). Although these in vitro experiments showed promising results, the used concentrations were significantly higher than the peak serum concentrations (266,267) 36 and thus, cannot be taken into consideration as treatment options. Indeed, when Gottschick and colleagues (268) used clinically achievable concentrations, they found that metronidazole (0.001 μg·mL1) was able to prevent the formation of Gardnerella spp. biofilms, when used preventively, but could not disrupt the existing biofilms and did not affect the viability of the cells. Interestingly, the information obtained from the in vitro biofilm studies was supported by a recent investigation, which found that the expression of genes involved in antimicrobial resistance was upregulated in Gardnerella spp. biofilm cells (214). In addition, it was observed that this up-regulation of genes was also enhanced in dual-species biofilms (232), as such providing some mechanistic evidence which clarifies to a certain degree why some polymicrobial communities might have enhanced antimicrobial resistance, and consequently, lead to BV recurrence. Taken together, understanding the molecular basis and biological influence of these bacterial interrelationships may offer new information essential for defining novel therapeutics for BV control. 2.5.1 Novel therapeutic strategies in the treatment of BV As it is acknowledged, increased antimicrobial resistance is responsible for high rates of BV recurrence (269). This is of particular concern as we are already heading toward a post-antibiotic era in which many bacterial infections will be untreatable (270). In relation to this issue, there are several attempts to use diverse compounds as alternative therapeutic strategies in order to treat and prevent BV. One of the most suggested non-antibiotic therapies for BV are oral or vaginal probiotics which have the aim to restore and maintain the normal vaginal microbiota (41). In the vaginal environment, some lactobacilli species can behave as probiotics, inhibiting the growth of pathogenic microorganisms by the production of antimicrobial compounds (12), but also by a competition for adherence, combined with a general stimulation of the immune system (271). Based on this, various pharmaceutical preparations (e.g. vaginal probiotic capsules) containing lactobacilli are generally well‐tolerated and used to control BV symptoms and restore the physiological vaginal pH (272). Probiotics have been also used in an attempt to specifically deal with BV biofilms, and it was shown that lactobacilli were able to infiltrate BV biofilms and cause bacterial cells death (273). In addition, probiotics have been also recommended as a complementary approach to antibiotic therapy. Some studies evaluated the use of vaginal probiotics after metronidazole and/ or clindamycin treatment in order to manage and prevent BV recurrence, with promising results (274,275). 37 Other studies have also described the use of antiseptics as an alternative therapy for BV. These compounds present an antibacterial activity against a large number of bacteria, causing disruption of their cell membrane, followed by cell death (276). A wide range of antiseptics including octenidine hydrochloride/ phenoxyethanol (277), nifuratel (278) or benzydamine hydrochloride (279), have been used in the last few years to treat BV, and most interest has gone to dequalinium chloride (DQC) which was recently listed in an international guideline as an alternative treatment for BV (51). DQC demonstrated an in vitro antimicrobial activity against different pathogens that are relevant for vaginal infections, such as anaerobic and aerobic bacteria, as well as Candida species (280). In addition, Lopes dos Santos Santiago and colleagues (281) found in their study that DQC not only inhibited the growth of F. vaginae , but also killed the bacterial cells at concentrations similar to those of clindamycin and lower than those of metronidazole. More recently, another study also showed that DQC presented an antibacterial effect on BV comparable to that of clindamycin therapy, with no systemic effects on the patient (282). Another alternative therapeutic approach used in the treatment of vaginal infections is represented by plant‐derived compounds. One of the primary findings regarding this subject dates back three decades ago when Blackwell (283) reported the first therapeutic success of using plant extracts to cure BV. Other studies have been performed in this regard, including the one of Braga and colleagues (284), which showed that thymol, one of the major components of thyme oil and a widely known antimicrobial and antifungal agent, had an in vitro inhibitory effect on both newly formed and mature Gardnerella spp. biofilms. In an in vivo study, thymol was combined with eugenol and the efficacy of the mixture was compared with that of metronidazole. After 7 days of application, a similar reduction in symptoms with the mixture of thymol and eugenol was observed as that obtained with metronidazole (285). In addition, more recently, the antibacterial activity of Thymbra capitata essential oil was evaluated against Gardnerella spp. grown planktonically and as biofilms. The obtained results showed that T. capitata essential oil exhibited strong activity against Gardnerella spp. planktonic cells and had an evident inhibitory effect against Gardnerella spp. biofilms with reduced action on lactobacilli (286). Taken together, these studies support the importance of exploring essential oils and their main constituents as a therapeutic alternative to treat BV. Taking into account the above‐mentioned potential therapies against BV as well as others listed in Table 2.6, it becomes clear that still many of them only address a reduction of the symptoms, but do not target directly the causative agents, with little attention being paid to the microbial interactions. As described before, the vaginal milieu throughout infection is a complex niche being governed by still poorly 44 86. Hilbert DW, Smith WL, Chadwick SG, Toner G, Mordechai E, Adelson ME, et al. Development and validation of a highly accurate quantitative realtime PCR assay for diagnosis of bacterial vaginosis. J Clin Microbiol. 2016;54(4):1017–24. 87. Jespers V, Crucitti T, van de Wijgert J, Vaneechoutte M, Delany-Moretlwe S, Mwaura M, et al. A DNA tool for early detection of vaginal dysbiosis in African women. Res Microbiol. 2016;167(2):133–41. 88. Singh R, Ramsuran V, Mitchev N, Niehaus AJ, Han KSS, Osman F, et al. Assessing a diagnosis tool for bacterial vaginosis. Eur J Clin Microbiol Infect Dis. 2020;39(8):1481–5. 89. Machado A, Castro J, Cereija T, Almeida C, Cerca N. Diagnosis of bacterial vaginosis by a new multiplex peptide nucleic acid fluorescence in situ hybridization method. PeerJ. 2015;3:e780. 90. Hardy L, Jespers V, Dahchour N, Mwambarangwe L, Musengamana V, Vaneechoutte M, et al. Unravelling the bacterial vaginosis-associated biofilm: a multiplex Gardnerella vaginalis and Atopobium vaginae fluorescence in situ hybridization assay using peptide nucleic acid probes. PLoS One. 2015;10(8):e0136658. 91. Africa CWJ. Efficacy of methods used for the diagnosis of bacterial vaginosis. Expert Opin Med Diagn. 2013 Mar 3;7(2):189–200. 92. Coleman JS, Gaydos CA. Molecular diagnosis of bacterial vaginosis: an update. Kraft CS, editor. J Clin Microbiol. 2018 May 16;56(9):e00342-18. 93. Sherrard J, Donders G, White D, Jensen JS. European (IUSTI/WHO) guideline on the management of vaginal discharge, 2011. Int J STD AIDS. 2011 Aug;22(8):421–9. 94. Workowski K, Bolan G. Sexually transmitted diseases treatment guidelines, 2015. MMWR Recomm Rep. 2015;64(3):1–137. 95. Paavonen J, Mangioni C, Martin MA, Wajszczuk CP. Vaginal clindamycin and oral metronidazole for bacterial vaginosis: a randomized trial. Obstet Gynecol. 2000;96(2):256–60. 96. Thulkar J, Kriplani A, Agarwal N. A comparative study of oral single dose of metronidazole, tinidazole, secnidazole and ornidazole in bacterial vaginosis. Indian J Pharmacol. 2012 Mar;44(2):243–5. 97. Bradshaw CS, Morton AN, Hocking J, Garland SM, Morris MB, Moss LM, et al. High recurrence rates of bacterial vaginosis over the course of 12 months after oral metronidazole therapy and factors associated with recurrence. J Infect Dis. 2006;193(11):1478–86. 98. Bilardi J, Walker S, McNair R, Mooney-Somers J, Temple-Smith M, Bellhouse C, et al. Women’s management of recurrent bacterial vaginosis and experiences of clinical care: a qualitative study. PLoS One. 2016;11(3):e0151794. 99. Sobel JD, Ferris D, Schwebke J, Nyirjesy P, Wiesenfeld HC, Peipert J, et al. Suppressive antibacterial therapy with 0.75% metronidazole vaginal gel to prevent recurrent bacterial vaginosis. Am J Obstet Gynecol. 2006;194:1283–9. 100. Sobel R, Sobel JD. Metronidazole for the treatment of vaginal infections. Expert Opin Pharmacother. 2015;16(7):1109–15. 101. Miljkovic V, Arsic B, Bojanic Z, Nikolic G, Nikolic L, Kalicanin B, et al. Interactions of metronidazole with other medicines: a brief review. Pharmazie. 2014 Aug;69(8):571–7. 102. Oduyebo O, Anorlu R, Ogunsola F. The effects of antimicrobial therapy on bacterial vaginosis in 45 non-pregnant women (Review). Cochrane Database Syst Rev. 2009;3(3):1–79. 103. Menard JP. Antibacterial treatment of bacterial vaginosis: Current and emerging therapies. Int J Womens Health. 2011;3(1):295–305. 104. Mullish B, Williams HR. Clostridium difficile infection and antibiotic-associated diarrhoea. Clin Med (Northfield Il). 2018;18(3):237–41. 105. Wood BA, Monro AM. Pharmacokinetics of tinidazole and metronidazole in women after single large oral doses. Br J Vener Dis. 1975;51(1):51–3. 106. Muzny CA, Schwebke JR. Gardnerella vaginalis : still a prime suspect in the pathogenesis of bacterial vaginosis. Curr Infect Dis Rep. 2013;15(2):130–5. 107. Muzny CA, Taylor CM, Swords WE, Tamhane A, Chattopadhyay D, Cerca N, et al. An updated conceptual model on the pathogenesis of bacterial vaginosis. J Infect Dis. 2019;220(9):1399– 405. 108. Muzny CA, Łaniewski P, Schwebke JR, Herbst-kralovetz MM. Host – vaginal microbiota interactions in the pathogenesis of bacterial vaginosis. Curr Opin Infect Dis. 2019;33(1):59–65. 109. Gardner HL, Dukes CD. Haemophilus vaginalis vaginitis. Am J Obstet Gynecol. 1955;69(5):962– 76. 110. Koch R. The etiology of anthrax, based on the life history of Bacillus anthracis . Contrib to Biol plants. 1876;2(2):277–310. 111. Criswell BS, Ladwig CL, Gardner HL, Dukes CD. Haemophilus vaginalis : vaginitis by inoculation from culture. Obstet Gynecol. 1969;33(2):195–9. 112. Spiegel CA, Davick P, Totten PA, Chen KC, Eschenbach DA, Amsel R, et al. Gardnerella vaginalis and anaerobic bacteria in the etiology of bacterial (nonspecific) vaginosis. Scand J Infect Dis Suppl. 1983;40:41–6. 113. Holst E, Svensson L, Skarin A, Weström L, Mårdh PA. Vaginal colonization with Gardnerella vaginalis and anaerobic curved rods. Scand J Urol Nephrol Suppl. 1984;86:147–52. 114. Josey WE, Schwebke JR. The polymicrobial hypothesis of bacterial vaginosis causation: a reassessment. Int J STD AIDS. 2008;19(3):152–4. 115. Srinivasan S, Hoffman NG, Morgan MT, Matsen FA, Fiedler TL, Hall RW, et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PLoS One. 2012;7(6):e37818. 116. Nagy E, Petterson M, Mardh P. Antibiosis between bacteria isolated from the vagina of women with and without signs of bacterial vaginosis. APMIS. 1991;99:739–44. 117. Patterson JL, Stull-Lane A, Girerd PH, Jefferson KK. Analysis of adherence, biofilm formation and cytotoxicity suggests a greater virulence potential of Gardnerella vaginalis relative to other bacterialvaginosis-associated anaerobes. Microbiology. 2010;156(2):392–9. 118. Machado A, Salgueiro D, Harwich M, Jefferson KK, Cerca N. Quantitative analysis of initial adhesion of bacterial vaginosis-associated anaerobes to ME-180 cells. Anaerobe. 2013;23:1–4. 119. Alves P, Castro J, Sousa C, Cereija TB, Cerca N. Gardnerella vaginalis outcompetes 29 other bacterial species isolated from patients with bacterial vaginosis, using in an in vitro biofilm formation model. J Infect Dis. 2014;210(4):593–6. 120. Cerca N. Could targeting neighboring bacterial populations help combat bacterial vaginosis? Future 46 Microbiol. 2019;1–4. 121. Verstraelen H, Verhelst R, Vaneechoutte M, Temmerman M. The epidemiology of bacterial vaginosis in relation to sexual behaviour. BMC Infect Dis. 2010;10:81. 122. Leppäluoto PA. Bacterial vaginosis: what is physiological in vaginal bacteriology? An update and opinion. Acta Obstet Gynecol Scand. 2011;90:1302–6. 123. Muzny CA, Schwebke JR. Pathogenesis of bacterial vaginosis: discussion of current hypotheses. J Infect Dis. 2016;214(Suppl 1):S1-5. 124. Fethers KA, Fairley CK, Hocking JS, Gurrin LC, Bradshaw CS. Sexual risk factors and bacterial vaginosis: a systematic review and meta-analysis. Clin Infect Dis. 2008 Dec 1;47(11):1426–35. 125. Schwebke JR. Abnormal vaginal flora as a biological risk factor for acquisition of HIV infection and sexually transmitted diseases. J Infect Dis. 2005;192(8):1315–7. 126. Schwebke JR, Desmond R. Risk factors for bacterial vaginosis in women at high risk for sexually transmitted diseases. Sex Transm Dis. 2005;32(11):654–8. 127. Silva D, Henriques A, Cereija T, Martinez-de-Oliveira J, Miranda M, Cerca N. Prevalence of Gardnerella vaginalis and Atopobium vaginae in Portuguese women and association with risk factors for bacterial vaginosis. Int J Gynaecol Obstet. 2014 Feb;124(2):178–9. 128. Vallor AC, Antonio MAD, Hawes SE, Hillier SL. Factors associated with acquisition of, or persistent colonization by, vaginal lactobacilli: role of hydrogen peroxide production. J Infect Dis. 2001;184(11):1431–6. 129. Bradshaw CS, Walker SM, Vodstrcil LA, Bilardi JE, Law M, Hocking JS, et al. The influence of behaviors and relationships on the vaginal microbiota of women and their female partners: the WOW health study. J Infect Dis. 2014;209(10):1562–72. 130. Vodstrcil LA, Walker SM, Hocking JS, Law M, Forcey DS, Fehler G, et al. Incident bacterial vaginosis (BV) in women who have sex with women is associated with behaviors that suggest sexual transmission of BV. Clin Infect Dis. 2015 Apr 1;60(7):1042–53. 131. Muzny CA, Lensing SY, Aaron KJ, Schwebke JR. Incubation period and risk factors support sexual transmission of bacterial vaginosis in women who have sex with women. Sex Transm Infect. 2019;1–5. 132. Plummer EL, Vodstrcil LA, Fairley CK, Tabrizi SN, Garland SM, Law MG, et al. Sexual practices have a significant impact on the vaginal microbiota of women who have sex with women. Sci Rep. 2019;9(1):1–14. 133. Swidsinski A, Doerffel Y, Loening-Baucke V, Swidsinski S, Verstraelen H, Vaneechoutte M, et al. Gardnerella biofilm involves females and males and is transmitted sexually. Gynecol Obstet Invest. 2010;70:256–63. 134. Liu CM, Hungate BA, Tobian AAR, Ravel J, Prodger JL, Serwadda D, et al. Penile microbiota and female partner bacterial vaginosis in Rakai, Uganda. MBio. 2015;6(3):17–20. 135. Zozaya M, Ferris MJ, Siren JD, Lillis R, Myers L, Nsuami MJ, et al. Bacterial communities in penile skin, male urethra, and vaginas of heterosexual couples with and without bacterial vaginosis. Microbiome. 2016 Apr 19;4(1):16. 136. Kenyon CR, Osbak K. Recent progress in understanding the epidemiology of bacterial vaginosis. Curr Opin Obstet Gynecol. 2014;26(6):448–54. 47 137. Morris MC, Rogers PA, Kinghorn GR. Is bacterial vaginosis a sexually transmitted infection? Sex Transm Infect. 2001;77(5):63–8. 138. Bump RC, Buesching WJ. Bacterial vaginosis in virginal and sexually active adolescent females: evidence against exclusive sexual transmission. Am J Obstet Gyne. 1988;158(4):935–9. 139. Papanikolaou EG, Tsanadis G, Dalkalitsis N, Lolis D. Recurrent bacterial vaginosis in a virgin adolescent: a new method of treatment. Infection. 2002;30(6):403–4. 140. Marrazzo JM, Thomas KK, Fiedler TL, Ringwood K, Fredricks DN. Risks for acquisition of bacterial vaginosis among women who report sex with women: a cohort study. PLoS One. 2010;5(6):1–6. 141. Cherpes TL, Hillier SL, Meyn LA, Busch JL, Krohn MA. A delicate balance: risk factors for acquisition of bacterial vaginosis include sexual activity, absence of hydrogen peroxide-producing lactobacilli, black race, and positive herpes simplex virus type 2 serology. Sex Transm Dis. 2008;35(1):78– 83. 142. Fethers KA, Fairley CK, Morton A, Hocking JS, Hopkins C, Kennedy LJ, et al. Early sexual experiences and risk factors for bacterial vaginosis. J Infect Dis. 2009;200(11):1662–70. 143. Schwebke JR. Bacterial vaginosis-more questions than answers. Genitourin Med. 1997;73:333–4. 144. Kenyon C, Colebunders R, Crucitti T. The global epidemiology of bacterial vaginosis: a systematic review. Am J Obstet Gynecol. 2013;209(6):505–23. 145. Janulaitiene M, Gegzna V, Baranauskiene L, Bulavaite A, Simanavicius M, Pleckaityte M. Phenotypic characterization of Gardnerella vaginalis subgroups suggests differences in their virulence potential. PLoS One. 2018;13(7):e0200625. 146. Livengood CH. Bacterial vaginosis: an overview for 2009. Rev Obstet Gynecol. 2009;2(1):28–37. 147. Zozaya-Hinchliffe M, Martin DH, Ferris MJ. Prevalence and abundance of uncultivated Megasphaera -Like bacteria in the human vaginal environment. Appl Environ Microbiol. 2008;74(5):1656–9. 148. Xia Q, Cheng L, Zhang H, Sun S, Liu F, Li H, et al. Identification of vaginal bacteria diversity and it’s association with clinically diagnosed bacterial vaginosis by denaturing gradient gel electrophoresis and correspondence analysis. MEEGID. 2016;44:479–86. 149. Burton JP, Cadieux PA, Reid G. Improved understanding of the bacterial vaginal microbiota of women before and after probiotic instillation. Appl Environ Microbiol. 2003;69(1):97–101. 150. Fredricks DN, Fiedler TL, Marrazzo JM. Molecular identification of bacteria associated with bacterial vaginosis. N Engl J Med. 2005;353(18):1899–911. 151. Austin MN, Rabe LK, Srinivasan S, Fredricks DN, Wiesenfeld HC, Hillier SL. Mageeibacillus indolicus gen. nov., sp. nov.: a novel bacterium isolated from the female genital tract. Anaerobe. 2015;32:37–42. 152. Fettweis JM, Paul Brooks J, Serrano MG, Sheth NU, Girerd PH, Edwards DJ, et al. Differences in vaginal microbiome in African American women versus women of European ancestry. Microbiol (United Kingdom). 2014;160:2272–82. 153. Wertz J, Isaacs-Cosgrove N, Holzman C, Marsh TL. Temporal shifts in microbial communities in nonpregnant African-American women with and without bacterial vaginosis. Interdiscip Perspect Infect Dis. 2008;2008:181253. 154. Shipitsyna E, Roos A, Datcu R, Hallén A, Fredlund H, Jensen JS, et al. Composition of the vaginal 48 microbiota in women of reproductive age - sensitive and specific molecular diagnosis of bacterial vaginosis is possible? PLoS One. 2013;8(4):e60670. 155. Witkin SS, Mendes-soares H, Linhares IM, Jayaram A, Ledger WJ, Forney J. Influence of vaginal bacteria and D - and L -lactic acid isomers on vaginal extracellular matrix metalloproteinase inducer: implications. MBio. 2013;4(4):e00460-13. 156. Leizer J, Nasioudis D, Forney LJ, Schneider GM, Gliniewicz K, Boester A, et al. Properties of epithelial cells and vaginal secretions in pregnant women when Lactobacillus crispatus or Lactobacillus iners dominate the vaginal microbiome. Reprod Sci. 2018;25(6):854–60. 157. Vaneechoutte M. Lactobacillus iners , the unusual suspect. Res Microbiol. 2017;168(9–10):826– 36. 158. Macklaim JM, Gloor GB, Anukam KC, Cribby S, Reid G. At the crossroads of vaginal health and disease, the genome sequence of Lactobacillus iners AB-1. Proc Natl Acad Sci USA. 2011;108:4688–95. 159. Macklaim JM, Fernandes AD, Di Bella JM, Hammond J-A, Reid G, Gloor GB. Comparative metaRNA-seq of the vaginal microbiota and differential expression by Lactobacillus iners in health and dysbiosis. Microbiome. 2013;1(1):12. 160. Jakobsson T, Forsum U. Lactobacillus iners : a marker of changes in the vaginal flora? J Clin Microbiol. 2007;45(9):3145. 161. Petrova MI, Lievens E, Malik S, Imholz N, Lebeer S. Lactobacillus species as biomarkers and agents that can promote various aspects of vaginal health. Front Physiol. 2015;6:1–18. 162. Ferris MJ, Norori J, Zozaya-hinchliffe M, Martin DH. Cultivation-independent analysis of changes in bacterial vaginosis flora following metronidazole treatment. J Clin Microbiol. 2007;45(3):1016–8. 163. Anukam KC, Osazuwa EO, Ahonkhai I, Reid G. Lactobacillus vaginal microbiota of women attending a reproductive health care service in Benin City, Nigeria. Sex Transm Dis. 2006;33(1):59–62. 164. Sobel JD, Subramanian C, Foxman B, Fairfax M, Gygax SE. Mixed vaginitis - more than coinfection and with therapeutic implications. Curr Infect Dis Rep. 2013;15(2):104–8. 165. Brotman RM. Vaginal microbiome and sexually transmitted infections: an epidemiologic perspective. J Clin Invest. 2011;121(12):4610–7. 166. Tansarli GS, Kostaras EK, Athanasiou S, Falagas ME. Prevalence and treatment of aerobic vaginitis among non-pregnant women: evaluation of the evidence for an underestimated clinical entity. Eur J Clin Microbiol Infect Dis. 2013 Aug 27;32(8):977–84. 167. Donders G, Van Calsteren K, Bellen G, Reybrouck R, Van den Bosch T, Riphagen I, et al. Predictive value for preterm birth of abnormal vaginal flora, bacterial vaginosis and aerobic vaginitis during the first trimester of pregnancy. BJOG. 2009 Sep;116(10):1315–24. 168. MacPhee RA, Miller WL, Gloor GB, McCormick JK, Hammond J-A, Burton JP, et al. Influence of the vaginal microbiota on toxic shock syndrome toxin 1 production by Staphylococcus aureus . Appl Environ Microbiol. 2013 Mar 15;79(6):1835–42. 169. Jahic M, Mulavdic M, Nurkic J, Jahic E, Nurkic M. Clinical characteristics of aerobic vaginitis and its association to vaginal candidiasis, trichomonas vaginitis and bacterial vaginosis. Med Arch. 2013;67(6):428. 170. Vieira-Baptista P, Lima-Silva J, Pinto C, Saldanha C, Beires J, Martinez-de-Oliveira J, et al. Bacterial 49 vaginosis, aerobic vaginitis, vaginal inflammation and major Pap smear abnormalities. Eur J Clin Microbiol Infect Dis. 2016 Apr 25;35(4):657–64. 171. Donders GGG, Bellen G, Grinceviciene S, Ruban K, Vieira-Baptista P. Aerobic vaginitis: no longer a stranger. Res Microbiol. 2017 Nov;168(9–10):845–58. 172. Ilkit M, Guzel AB. The epidemiology, pathogenesis, and diagnosis of vulvovaginal candidosis: a mycological perspective. Crit Rev Microbiol. 2011 Aug 20;37(3):250–61. 173. Anderson MR, Klink K, Cohrssen A. Evaluation of vaginal complaints. Jama. 2004;291(11):1368– 79. 174. Zhou X, Westman R, Hickey R, Hansmann MA, Kennedy C, Osborn TW, et al. Vaginal microbiota of women with frequent vulvovaginal candidiasis. Infect Immun. 2009 Sep 1;77(9):4130–5. 175. Bradford LL, Ravel J, Bruno V. Understanding vulvovaginal candidiasis through a community genomics approach. Curr Fungal Infect Rep. 2013;7(2):126–31. 176. Pirotta M V, Gunn JM, Chondros P. Not thrush again! Women’s experience of post-antibiotic vulvovaginitis. Med J Aust. 2003 Jul 7;179(1):43–6. 177. Jeng HS, Yan TR, Chen JYI. Treating vaginitis with probiotics in non ‑ pregnant females: A systematic review and meta ‑ analysis. Exp Ther Med. 2020;20(40):3749–65. 178. Brotman RM, Klebanoff MA, Nansel TR, Yu KF, Andrews WW, Zhang J, et al. Bacterial vaginosis assessed by gram stain and diminished colonization resistance to incident gonococcal, chlamydial, and trichomonal genital infection. J Infect Dis. 2010 Dec 15;202(12):1907–15. 179. Sutton M, Sternberg M, Koumans EH, McQuillan G, Berman S, Markowitz L. The prevalence of Trichomonas vaginalis infection among reproductive-age women in the United States, 2001-2004. Clin Infect Dis. 2007 Nov 15;45(10):1319–26. 180. van Schalkwyk J, Yudin MH. Vulvovaginitis: screening for and management of trichomoniasis, vulvovaginal candidiasis, and bacterial vaginosis. J Obstet Gynaecol Canada. 2015 Mar;37(3):266– 74. 181. Mirmonsef P, Krass L, Landay A, Spear GT. The role of bacterial vaginosis and trichomonas in HIV transmission across the female genital tract. Curr HIV Res. 2012 Apr;10(3):202–10. 182. Fichorova RN, Buck OR, Yamamoto HS, Fashemi T, Dawood HY, Fashemi B, et al. The villain teamup or how Trichomonas vaginalis and bacterial vaginosis alter innate immunity in concert. Sex Transm Infect. 2013 Sep;89(6):460–6. 183. Balkus JE, Richardson BA, Rabe LK, Taha TE, Mgodi N, Kasaro MP, et al. Bacterial vaginosis and the risk of Trichomonas vaginalis acquisition among HIV-1–negative women. Sex Transm Dis. 2014 Feb;41(2):123–8. 184. Brotman RM, Bradford LL, Conrad M, Gajer P, Ault K, Peralta L, et al. Association between Trichomonas vaginalis and vaginal bacterial community composition among reproductive-age women. Sex Transm Dis. 2012 Oct;39(10):807–12. 185. Hong KH, KukHong S, Sung ImCho MT, EunkyungRa MT, Han KH, Kang SB, et al. Analysis of the vaginal microbiome by next-generation sequencing and evaluation of its performance as a clinical diagnostic tool in vaginitis. Ann Lab Med. 2016;36(5):441–9. 186. Vasilevsky S, Greub G, Nardelli-Haefliger D, Baud D. Genital Chlamydia trachomatis : understanding the roles of innate and adaptive immunity in vaccine research. Clin Microbiol Rev. 2014 Apr 50 1;27(2):346–70. 187. Haggerty CL, Gottlieb SL, Taylor BD, Low N, Xu F, Ness RB. Risk of sequelae after Chlamydia trachomatis genital infection in women. J Infect Dis. 2010 Jun 15;201(S2):S134-55. 188. Malhotra M, Sood S, Mukherjee A, Muralidhar S, Bala M. Genital Chlamydia trachomatis : an update. Indian J Med Res. 2013;138(3):303–16. 189. Quillin SJ, Seifert HS. Neisseria gonorrhoeae host adaptation and pathogenesis. Nat Rev Microbiol. 2018 Apr 12;16(4):226–40. 190. Joesoef MR, Wiknjosastro G, Norojono W, Sumampouw H, Linnan M, Hansell MJ, et al. Coinfection with chlamydia and gonorrhoea among pregnant women and bacterial vaginosis. Int J STD AIDS. 1996;7(1):61–4. 191. Keane FE, Thomas BJ, Whitaker L, Renton A, Taylor-Robinson D. An association between nongonococcal urethritis and bacterial vaginosis and the implications for patients and their sexual partners. Genitourin Med. 1997 Oct;73(5):373–7. 192. Allsworth JE, Peipert JF. Severity of bacterial vaginosis and the risk of sexually transmitted infection. Am J Obstet Gynecol. 2011 Aug;205(2):113.e1-113.e6. 193. Bautista CT, Wurapa EK, Sateren WB, Morris SM, Hollingsworth BP, Sanchez JL. Association of bacterial vaginosis with chlamydia and gonorrhea among women in the U.S. Army. Am J Prev Med. 2017 May;52(5):632–9. 194. Allsworth JE, Lewis VA, Peipert JF. Viral sexually transmitted infections and bacterial vaginosis: 2001-2004 National Health and Nutrition Examination Survey data. Sex Transm Dis. 2008 Sep;35(9):791–6. 195. Esber A, Vicetti Miguel RD, Cherpes TL, Klebanoff MA, Gallo MF, Turner AN. Risk of bacterial vaginosis among women with herpes simplex virus type 2 infection: a systematic review and metaanalysis. J Infect Dis. 2015 Jul 1;212(1):8–17. 196. Burd EM, Dean CL. Human papillomavirus. Microbiol Spectr. 2016;4(4):1–17. 197. Watts DH, Fazzari M, Fazarri M, Minkoff H, Hillier SL, Sha B, et al. Effects of bacterial vaginosis and other genital infections on the natural history of human papillomavirus infection in HIV-1infected and high-risk HIV-1-uninfected women. J Infect Dis. 2005 Apr 1;191(7):1129–39. 198. King CC, Jamieson DJ, Wiener J, Cu-Uvin S, Klein RS, Rompalo AM, et al. Bacterial vaginosis and the natural history of human papillomavirus. Infect Dis Obstet Gynecol. 2011;2011:319460. 199. Lee JE, Lee S, Lee H, Song Y-M, Lee K, Han MJ, et al. Association of the vaginal microbiota with human papillomavirus infection in a Korean twin cohort. Medeiros R, editor. PLoS One. 2013 May 22;8(5):e63514. 200. Brotman RM, Shardell MD, Gajer P, Tracy JK, Zenilman JM, Ravel J, et al. Interplay between the temporal dynamics of the vaginal microbiota and human papillomavirus detection. J Infect Dis. 2014 Dec 1;210(11):1723–33. 201. Sturm-Ramirez K, Gaye-Diallo A, Eisen G, Mboup S, Kanki PJ. High levels of tumor necrosis factoralpha and interleukin-1beta in bacterial vaginosis may increase susceptibility to human immunodeficiency virus. J Infect Dis. 2000 Aug;182(2):467–73. 202. Pyles RB, Vincent KL, Baum MM, Elsom B, Miller AL, Maxwell C, et al. Cultivated vaginal microbiomes alter HIV-1 infection and antiretroviral efficacy in colonized epithelial multilayer 51 cultures. Reeves RK, editor. PLoS One. 2014 Mar 27;9(3):e93419. 203. McKinnon LR, Achilles SL, Bradshaw CS, Burgener A, Crucitti T, Fredricks DN, et al. The evolving facets of bacterial vaginosis: implications for HIV transmission. AIDS Res Hum Retroviruses. 2019 Mar;35(3):219–28. 204. Atashili J, Poole C, Ndumbe PM, Adimora AA, Smith JS. Bacterial vaginosis and HIV acquisition: a meta-analysis of published studies. AIDS. 2008 Jul;22(12):1493–501. 205. Kolter R, Greenberg EP. The superficial life of microbes. Nature. 2006;441(May):300–2. 206. Besemer K. Biodiversity, community structure and function of biofilms in stream ecosystems. Res Microbiol. 2015;166(10):774–81. 207. Pippo F Di, Gregorio L Di, Congestri R, Tandoi V, Rossetti S. Biofilm growth and control in cooling water industrial systems. FEMS Microbiol Ecol. 2018;94(5):fiy044. 208. Veerachamy S, Yarlagadda T, Manivasagam G. Bacterial adherence and biofilm formation on medical implants: a review. J Eng Med. 2014;228(10):1083–99. 209. Yaron S, Romling U. Biofilm formation by enteric pathogens and its role in plant colonization and persistence. Microb Biotechnol. 2014;7(6):496–516. 210. Lebeaux D, Chauhan A, Rendueles O, Beloin C. From in vitro to in vivo models of bacterial biofilmrelated infections. Pathogens. 2013;2:288–356. 211. Wolcott R, Costerton JW, Raoult D, Cutler SJ. The polymicrobial nature of biofilm infection. Clin Microbiol Infect. 2013;19(2):107–12. 212. Romero-Lastra P, Sánchez MC, Ribeiro-Vidal H, Llama-Palacios A, Figuero E, Herrera D, et al. Comparative gene expression analysis of Porphyromonas gingivalis ATCC 33277 in planktonic and biofilms states. PLoS One. 2017;12(4):1–18. 213. Kot B, Sytykiewicz H, Sprawka I. Expression of the biofilm-associated genes in methicillin-resistant Staphylococcus aureus in biofilm and planktonic conditions. Int J Mol Sci. 2018;19(11):e3487. 214. Castro J, França A, Bradwell KR, Serrano MG, Jefferson KK, Cerca N. Comparative transcriptomic analysis of Gardnerella vaginalis biofilms vs. planktonic cultures using RNA-seq. npj Biofilms Microbiomes. 2017;3(1):1–7. 215. Swidsinski A, Mendling W, Loening-Baucke V, Ladhoff A, Swidsinski S, Hale LP, et al. Adherent biofilms in bacterial vaginosis. Obstet Gynecol. 2005;106(5 Pt 1):1013–23. 216. Swidsinski A, Dörffel Y, Loening-Baucke V, Mendling W, Verstraelen H, Dieterle S, et al. Desquamated epithelial cells covered with a polymicrobial biofilm typical for bacterial vaginosis are present in randomly selected cryopreserved donor semen. FEMS Immunol Med Microbiol. 2010;59(3):399–404. 217. Swidsinski A, Loening-Baucke V, Mendling W, Dörffel Y, Schilling J, Halwani Z, et al. Infection through structured polymicrobial Gardnerella biofilms (StPM-GB). Histol Histopathol. 2014;29(5):567–87. 218. Hardy L, Cerca N, Jespers V, Vaneechoutte M, Crucitti T. Bacterial biofilms in the vagina. Res Microbiol. 2017;168(9–10):865–74. 219. Jung H-S, Ehlers MM, Lombaard H, Redelinghuys MJ, Kock MM. Etiology of bacterial vaginosis and polymicrobial biofilm formation. Crit Rev Microbiol. 2017;43(6):651–67. 220. Verstraelen H, Swidsinski A. The biofilm in bacterial vaginosis: implications for epidemiology, 52 diagnosis and treatment. Curr Opin Infect Dis. 2013;26(1):86–9. 221. Salo J, Pietikäinen A, Söderström M, Auvinen K, Salmi M, Ebady R, et al. Flow-tolerant adhesion of a bacterial pathogen to human endothelial cells through interaction with biglycan. J Infect Dis. 2016;213(10):1623–31. 222. Johnson AP, Boustouller YL. Extra-vaginal infection caused by Gardnerella vaginalis . Epidemiol Infect. 1987;98(2):131–7. 223. Scott TG, Curran B, Smyth CJ. Electron microscopy of adhesive interactions between Gardnerella vaginalis and vaginal epithelial cells, McCoy cells and human red blood cells. J Gen Microbiol. 1989;135:475–80. 224. Cook RL, Reid G, Pond DG, Schmitt CA, Sobel JD. Clue cells in bacterial vaginosis: immunofluorescent identification of the adherent gram-negative bacteria as Gardnerella vaginalis . J Infect Dis. 1989;160(3):490–6. 225. Nelson DB, Macones G. Bacterial vaginosis in pregnancy: current findings and future directions. Epidemiol Rev. 2002;24(2):102–8. 226. Kriebel K, Hieke C, Müller-Hilke B, Nakata M, Kreikemeyer B. Oral biofilms from symbiotic to pathogenic interactions and associated disease - connection of periodontitis and rheumatic arthritis by peptidylarginine deiminase. Front Microbiol. 2018;9(JAN):1–14. 227. von Rosenvinge EC, O´May GA, Macfarlane S, Macfarlane GT, Shirtliff ME. Microbial biofilms and gastrointestinal diseases. Pathog Dis. 2013;67(1):25–38. 228. Boisvert AA, Cheng MP, Sheppard DC, Nguyen D. Microbial biofilms in pulmonary and critical care diseases. Ann Am Thorac Soc. 2016;13(9):1615–23. 229. Pybus V, Onderdonk AB. Microbial interactions in the vaginal ecosystem, with emphasis on the pathogenesis of bacterial vaginosis. Microbes Infect. 1999;1(4):285–92. 230. Moons P, Michiels CW, Aertsen A. Bacterial interactions in biofilms. Crit Rev Microbiol. 2009;35(3):157–68. 231. Castro J, Cerca N. BV and non-BV associated Gardnerella vaginalis establish similar synergistic interactions with other BV-associated microorganisms in dual-species biofilms. Anaerobe. 2015;36:56–9. 232. Castro J, Machado D, Cerca N. Unveiling the role of Gardnerella vaginalis in polymicrobial bacterial vaginosis biofilms: the impact of other vaginal pathogens living as neighbors. ISME J. 2019;13(5):1306–17. 233. Chen KCS, Forsyth PS, Buchanan TM, Holmes KK. Amine content of vaginal fluid from untreated and treated patients with nonspecific vaginitis. J Clin Invest. 1979;63(5):828–35. 234. Pybus V, Onderdonk AB. Evidence for a commensal, symbiotic relationship between Gardnerella vaginalis and Prevotella bivia involving ammonia: potential significance for bacterial vaginosis. J Infect Dis. 1997;175(2):406–13. 235. Machado A, Jefferson KK, Cerca N. Interactions between Lactobacillus crispatus and bacterial vaginosis (BV)-associated bacterial species in initial attachment and biofilm formation. Int J Mol Sci. 2013;14(6):12004–12. 236. Gilbert NM, Lewis WG, Li G, Sojka DK, Lubin JB, Lewis AL. Gardnerella vaginalis and Prevotella bivia trigger distinct and overlapping phenotypes in a mouse model of bacterial vaginosis. J Infect 53 Dis. 2019;220(7):1099–108. 237. Pybus V, Onderdonk AB. A commensal symbiosis between Prevotella bivia and Peptostreptococcus anaerobius involves amino acids: potential significance to the pathogenesis of bacterial vaginosis. FEMS Immunol Med Microbiol. 1998;22(July):317–27. 238. Hardy L, Jespers V, Abdellati S, De Baetselier I, Mwambarangwe L, Musengamana V, et al. A fruitful alliance: the synergy between Atopobium vaginae and Gardnerella vaginalis in bacterial vaginosisassociated biofilm. Sex Transm Infect. 2016;92(7):487–91. 239. Cox C, Watt AP, McKenna JP, Coyle P V. Mycoplasma hominis and Gardnerella vaginalis display a significant synergistic relationship in bacterial vaginosis. Eur J Clin Microbiol Infect Dis. 2016 Mar 21;35(3):481–7. 240. Datcu R, Gesink D, Mulvad G, Montgomery-Andersen R, Rink E, Koch A, et al. Vaginal microbiome in women from Greenland assessed by microscopy and quantitative PCR. BMC Infect Dis. 2013 Oct 16;13(1):480. 241. Stubbendieck RM, Vargas-Bautista C, Straight PD. Bacterial communities: Interactions to scale. Front Microbiol. 2016;7(AUG):1–19. 242. Jung H-S, Ehlers MM, Lombaard H, Redelinghuys MJ, Kock MM. Etiology of bacterial vaginosis and polymicrobial biofilm formation. Crit Rev Microbiol. 2017;43(6):651–67. 243. Perez AC, Pang B, King LB, Tan L, Murrah KA, Reimche JL, et al. Residence of Streptococcus pneumoniae and Moraxella catarrhalis within polymicrobial biofilm promotes antibiotic resistance and bacterial persistence in vivo . Pathog Dis. 2014;70(3):280–8. 244. Lopes SP, Ceri H, Azevedo NF, Pereira MO. Antibiotic resistance of mixed biofilms in cystic fibrosis: Impact of emerging microorganisms on treatment of infection. Int J Antimicrob Agents. 2012;40(3):260–3. 245. Lee KWK, Periasamy S, Mukherjee M, Xie C, Kjelleberg S, Rice SA. Biofilm development and enhanced stress resistance of a model, mixed-species community biofilm. ISME J. 2014;8(4):894– 907. 246. Teixeira GS, Soares-Brandão KLK, Branco KMGR, Sampaio JLM, Nardi RMD, Mendonça M, et al. Antagonism and synergism in Gardnerella vaginalis strains isolated from women with bacterial vaginosis. J Med Microbiol. 2010 Aug 1;59(Pt 8):891–7. 247. Castro J, Machado D, Cerca N. Escherichia coli and Enterococcus faecalis are able to incorporate and enhance a pre-formed Gardnerella vaginalis biofilm. Pathog Dis. 2016;74(3):ftw007. 248. Skarin A, Sylwan J. Vaginal lactobacilli inhibiting growth of Gardnerella vaginalis , Mobiluncus and other bacterial species cultured from vaginal content of women with bacterial vaginosis. Acta Pathol Microbiol Immunol Scand B. 1986 Dec;94(6):399–403. 249. McLean NW, Rosenstein IJ. Characterisation and selection of a Lactobacillus species to re-colonise the vagina of women with recurrent bacterial vaginosis. J Med Microbiol. 2000;49(6):543–52. 250. Aroutcheva AA, Simoes JA, Faro S. Antimicrobial protein produced by vaginal Lactobacillus acidophilus that inhibits Gardnerella vaginalis . Infect Dis Obstet Gynecol. 2001;9(1):33–9. 251. Atassi F, Brassart D, Grob P, Graf F, Servin AL. In vitro antibacterial activity of Lactobacillus helveticus strain KS300 against diarrhoeagenic, uropathogenic and vaginosis-associated bacteria. J Appl Microbiol. 2006;101(3):647–54. 60 and incubated for 72 h, at 37 ºC under anaerobic conditions. To quantify the biofilm biomass, we used the crystal violet (CV) method, which is the most frequently employed approach for this purpose (15,16). In brief, following 72 h of incubation, the biofilms were washed once with 200 µL of 1X phosphatebuffered saline (PBS) and allowed to air dry. After, the biofilms were fixed with 100 µL of 100% (v/v) methanol (Thermo Fisher Scientific, UK) for 20 min, and then stained with 100 µL of 1% (v/v) CV solution (Merck, Darmstadt, Germany) for 20 min. Subsequently, each well was washed twice with 200 µL of 1X PBS, and the bound CV was released with 150 µL of 33% (v/v) acetic acid (Thermo Fisher Scientific). To assess the biomass, the OD of the resulting solution was measured at 595 nm. Biofilm experiments were repeated at least three times with eight technical replicates. 3.2.4 Statistical analysis The data were analysed using the statistical package GraphPad Prism version 7 (La Jolla, CA, USA) by one-way ANOVA (Dunnett’s multiple comparison test) and two-way ANOVA (Sidak’s multiple comparisons test). Values with a p < 0.05 were considered statistically significant. 3.3 Results 3.3.1 Planktonic growth assays As shown in Figure 3.1, BV-associated anaerobes had variable ability to grow planktonically in the tested culture media. Accordingly, P. anaerobius and P. bivia had higher metabolic flexibility and were able to grow in most of the tested media, while M. curtisii had more restrictive growth requirements and presented low levels of growth in all of them. Interestingly, NYC III broth showed high levels of planktonic growth for the tested species, being overpassed only by NYC.Aa for L. iners , SB and SB.Aa for P. anaerobius , and by sBHI.Aa for P. bivia . The mGTS supported very low levels of bacterial growth, with only G. vaginalis , P. anaerobius , and P. bivia showing moderate levels of growth. Since it was previously shown that L-ascorbic acid could enhance the growth of several anaerobic bacteria, including F. vaginae , Finegoldia magna , Fusobacterium necrophorum , Prevotella nigrescens , Ruminococcus gnavus , and Solobacterium moorei (17), we repeated the experiments with the culture media supplemented with 0.1% (w/v) L-ascorbic acid. However, contrary to what was described before, the addition of 0.1% (w/v) L-ascorbic acid had a very variable effect on bacterial growth, with only 33.3% (n=8; cut-off ≥ 1.25 – fold change) of the total combinations tested yielding a significant increase in bacterial growth, while in 4.17% (n=1; cut-off < 0.75-fold change) an inhibition of the growth was observed. 61 In most of the tested combinations (n=15; 0.75 ≤ fold change < 1.25) no effect was observed (Figure 3.1). The most notable case was observed for P. bivia growth in SB, in which L-ascorbic acid increased almost seven-fold the growth rate. 3.3.2 Biofilm assays We observed that similar to planktonic growth, biofilm formation was also strongly affected by the culture media composition, as depicted in Figure 3.2. Importantly, there was not a direct relationship between higher planktonic growth and higher biofilm formation, which further confirms that the requirements for biofilm formation are distinct than the requirements for planktonic growth, as showed before for many other bacterial species (18–21). Further differences between biofilm formation and planktonic growth were observed when adding L-ascorbic acid to the growth media, with 20.8% (n=5) of the tested combinations species/ growth medium resulting in a statistically significant decrease in the biofilmforming capacity ( p < 0.05) and 37.5% (n=9) of the situations also presenting a visible biofilm reduction, however not statistically significant. Moreover, in none of the combinations, a significant increase in biofilm biomass was noted upon addition of L-ascorbic acid to the culture media (Figure 3.2). 62 Table 3.2. Culture media used for the growth of BV-associated bacteria. Culture medium Composition Supplementation Abbreviation Brain heart infusion broth (Liofilchem, Italy) As described by the manufacturer 2% (w/w) Gelatine (Liofilchem, Italy) 0.1% (w/w) Starch (Panreac, Spain) 0.5% (w/w) Yeast extract (Liofilchem, Italy) sBHI/ sBHI.Aa Brucella broth (Liofilchem, Italy) As described by the manufacturer 0.0005% (w/v) Hemin (Sigma, China) 0.0001% (w/v) Vitamin K1 (Sigma, China) BHV/ BHV.Aa New York City III broth 1.5% (w/v) Bacto proteose peptone no. 3 (BD, France) 0.5% (w/v) Glucose (Fisher Scientific, UK) 0.24% (w/v) HEPES (VWR, USA) 0.5% (w/v) NaCl (VWR, USA) 0.38% (w/v) Yeast extract (Liofilchem, Italy) 10% (v/v) Inactivated horse serum (Biowest, France) NYC III/ NYC.Aa Schaedler broth (Liofilchem, Italy) As described by the manufacturer - SB/ SB.Aa Chemically defined medium simulating genital tract secretions (22) Part I: 0.35% NaCl; 0.15% KCl; 0.174% K2HPO4; 0.136% KH2PO4; 1.08% glucose; 0.05% cysteine HCl Part II: 0.1% glycogen; 0.03% mucin; 0.02% tween 20; 0.05% urea; 0.0005% hemin; 0.0001% vitamin K1; 0.2% bovine serum albumin; 0.03% MgSO4; 0.004% NaHCO3; 0.1% sodium acetate; 0.005% MnCl2 Part III: 0.0005% biotin; 5.0% myo -inositol; 0.05% niacinamide; 0.05% pyridoxine HCI; 0.05% thiamine HCI; 0.05% D-calcium pantothenate; 0.05% folic acid; 0.001% p -aminobenzoic acid; 0.05% choline chloride; 0.01% riboflavin; 0.1% L-ascorbic acid; 0.0005% vitamin A (retinol); 0.0005% vitamin D (cholecalciferol); 0.001% vitamin B12 Part IV (amino acids): 0.032% alanine; 0.008% arginine; 0.076% aspartic acid; 0.036% glutamic acid; 0.04% glutamine; 0.02% glycine; 0.016% histidine; 0.012% isoleucine; 0.02% leucine; 0.02% lysine; 0.004% methionine; 0.004% phenylalanine; 0.028% proline; 0.012% serine; 0.012% threonine; 0.004% tryptophan; 0.02% tyrosine; 0.068% valine Part V (UPI): 0.05% uracil; 0.01% sodium pyruvate; 0.02% inosine - mGTS 63 3.4 Discussion Despite the fact that BV is an increasingly important health problem, there is a lack of studies addressing multi-species interactions that might occur during BV and their role in its development. Most attempts to understand the microbiology behind BV have been focused mainly on Gardnerella spp., perhaps because this species has long been associated with BV development (23,24) and it has been now hypothesized that this microorganism is the initial colonizer of the vaginal epithelium, being able to establish an early biofilm structure to which other BV-associated species can attach (1). However, the role of these species in the development and progress of BV is still poorly understood and therefore, more studies are needed to unravel this matter. It has been previously shown that BV-associated species have different abilities to grow as biofilms, and this was strongly dependent on the growth media (18). As such, the first step in facilitating BV multispecies biofilm studies is to determine optimal culture medium conditions suitable for multiple BVassociates species, considering to further investigate the interactions that might exist between them in BV multi-species biofilms and their implications in BV process. Although sBHI has been widely used as a medium that supports Gardnerella spp. growth (25–31), it did not facilitate the planktonic growth or biofilm formation for some of the tested species, including F. vaginae , L. iners , and M. curtisii . The same was observed for these three species in SB medium, even though the manufacturer describes it as a medium suitable for the cultivation of anaerobic microorganisms, providing them an important amount of amino acids, nitrogen, vitamins as well as the energy necessary for growth. In an early study, after evaluating nine broth media in varied CO2 atmospheres for their ability to support growth of anaerobic bacteria including Bacteroides fragilis subspecies fragilis , Clostridium perfringens , Eubacterium alactolyticum , and Peptostreptococcus CDC group 2, Stalons and colleagues (32) found that SB in an atmosphere of 5% CO2, 10% hydrogen, and 85% nitrogen exhibited the fastest and highest growth response. However, in our in vitro conditions, we obtained high levels of planktonic growth only for P. anaerobius , probably because this medium is not appropriate for the growth of all species of anaerobic microorganisms. Still, SB was a good medium to support in vitro biofilm formation with high levels of the biomass for Gardnerella sp., P. anaerobius , and P. bivia . 64 Figure 3.1. Fold change in planktonic growth of BV-associated bacteria in the nine different culture media relative to OD620nm values measured at T 0h. (A) Experiments performed with Gardnerella sp. (B) Experiments performed with F. vaginae . (C) Experiments performed with L. iners . (D) Experiments performed with M. curtisii . (E) Experiments performed with P. anaerobius . (F) Experiments performed with P. bivia . Results represent the average ± the standard deviation of at least three independent experiments. Statistical analysis was performed using one-way ANOVA and Dunnett’s multiple comparisons test. Significant differences between NYC III medium (our culture medium of choice) and other culture media are depicted with * p < 0.05 and ** p < 0.01. The effect of L-ascorbic acid on bacterial growth is presented as fold change relative to the growth in the medium without L-ascorbic acid (fold change = 1, control). This effect was classified as inhibitory (cut-off < 0.75 – fold change), neutral (0.75 ≤ fold change < 1.25), and stimulatory (cut-off ≥ 1.25 – fold change). Curiously, Gardnerella sp. and P. bivia showed in SB the lowest levels of planktonic growth, but the highest biofilm formation ability. As mentioned, SB is a complex medium and perhaps the presence of certain growth factors determined these two species to turn on the expression of biofilm-related genes. Another of the tested media, BHV, also described by the manufacturer as suitable for the cultivation of anaerobes, 65 was not appropriate for the growth of the tested species, with the exception of planktonic growth by P. anaerobius and biofilm formation by P. bivia . Interestingly, NYC III facilitated the planktonic growth of all tested species, despite M. curtisii presented a very slow growth rate. Nevertheless, even M. curtisii was able to form high biofilm biomass in this medium. In fact, together with F. vaginae and L. iners, significant biofilm formation was only detected in NYC III (Figure 3.2). A particularity of NYC III medium, compared to the other tested media, is the presence of proteose peptone no. 3, which has been described by the manufacturer as offering high nutritional benefits to fastidious anaerobic species by providing the necessary amount of nitrogen, carbon, amino acids, and essential growth factors. To assess if, in fact, the enhancement of biofilm formation in NYC III was mainly due to the presence of proteose peptone no. 3, we carried out an experiment by evaluating the biofilm-formation ability of the six tested bacterial species in the original recipe of NYC III versus an altered version of NYC III [with regular peptone from meat (Acros Organics, UK) replacing the proteose peptone no. 3]. Interestingly, while we did find that proteose peptone no. 3 was essential to the biofilm formation by M. curtisii , no significant differences were found for the other species (Figure 3.3), which suggests that the ability of NYC III to enhance biofilm formation is not only related to the presence of proteose peptone no. 3. Besides the commercially available media, we also tested a chemically defined medium that simulates the genital tract fluid, mGTS (22). Since mGTS is a minimal medium without rich nutrient sources, it was not surprising that the growth of the tested BV-associated species was negligent or very slow in this medium. Nevertheless, biofilm formation by Gardnerella sp. and P. anaerobius was significant under mGTS, further being confirmed that biofilm formation requires specific conditions, different from planktonic growth. 66 Figure 3.2. Biofilm formation of BV-associated bacteria in the nine different culture media over a 72 h period. Biofilm biomass was quantified using the CV staining assay. (A) represents the total biofilm biomass formed by Gardnerella sp. in the tested growth media. (B) represents the total biofilm biomass formed by F. vaginae . (C) represents the total biofilm biomass formed by L. iners . (D) represents the total biofilm biomass formed by M. curtisii . (E) represents the total biofilm biomass formed by P. anaerobius . (F) represents the total biofilm biomass formed by P. bivia . Results are expressed as average ± standard deviation of at least three independent experiments performed with eight technical replicates. Statistical analysis was performed using one-way ANOVA and Dunnett’s multiple comparisons test. Significant differences between biofilm biomass formed in NYC III medium (our culture medium of choice) and other culture media are represented with * p < 0.05 and ** p < 0.01. We also tested another variable in our growth conditions optimization. The addition of L-ascorbic acid had the advantage of reducing the oxidation potential of the growth media by removing the oxygen (17). However, the effect of adding L-ascorbic acid was very variable, depending not only on the bacterial 67 species but also on the respective growth media. Nevertheless, there was a tendency to slightly or highly suppress biofilm formation. Interestingly, the inhibition of biofilm formation by ascorbic acid has been described before in biofilms of Bacillus subtilis , Escherichia coli , Pseudomonas aeruginosa (33) as well as of methicillin-resistant Staphylococcus aureus (34). It should be noted that at higher concentrations, L-ascorbic acid has been reported as a possible adjuvant for antibiotic treatment of BV, playing a role in maintaining a low vaginal pH, which favours the recolonization of the vaginal environment with lactic acidproducing bacteria, decreasing, thereby, the risk of BV recurrence (35,36). Our data further expand these previous findings by demonstrating that, while sometimes favouring planktonic growth, L-ascorbic acid often impairs biofilm formation. Figure 3.3. Biofilm formation of BV-associated bacteria in NYC III (with proteose peptone no. 3) and altered version of NYC III (with peptone from meat) over a 72 h period. Biofilm biomass was quantified using the CV staining assay. Results represent the average ± the standard deviation of three independent experiments performed with eight technical replicates. Statistical analysis was performed using two-way ANOVA and Sidak’s multiple comparisons test. No significant difference was found between biofilm-formation ability of BV-associated bacteria in the two tested culture media. A limitation of this study was the fact that we only tested a yet unidentified Gardnerella sp. isolate, but at least three new species have been recently reported. Previously, it was assessed biofilm formation by seven clinical isolates from BV-women and seven from healthy microbiota and found no significant differences between the ability to form biofilms by the 2 groups, using different growth media (11). We now know that from those 14 isolates, some belong to G. vaginalis , G. leopoldii , G. piotii , and G. swidsinskii (13). As such, we hypothesized that the four Gardnerella species would have similar biofilm formation abilities in our growth medium of choice: NYC III. To test this hypothesis, we selected one isolate of each species, previously found to form similar biofilms in sBHI (13,14) and compared its biofilms with NYC III medium. As shown in Figure 3.4, all the tested species had a similar biofilm-formation ability as compared 68 to Gardnerella sp. UM241, with G. leopoldii showing a slight decrease in biomass, but within the expected variation found in different Gardnerella strains (11). Figure 3.4 . Biofilm formation of Gardnerella sp., G. leopoldii , G. piotii , G. swidsinskii , and G. vaginalis in NYC III and sBHI over a 72 h period. Biofilm biomass was quantified using the CV staining assay. Results represent the average ± the standard deviation of three independent experiments performed with eight technical replicates. Statistical analysis was performed using two-way ANOVA and Sidak’s multiple comparisons test. Significant differences between biofilm biomass formed in NYC III and sBHI are represented with * p < 0.05. Overall, our work has shed new light on the optimal conditions required for in vitro growth and biofilm formation of bacteria associated with BV. Although we tested nine different growth conditions, including a medium simulating genital tract secretions (mGTS), none of them is able to account for all growth factors present in the vaginal environment, including components of the host immune system, that are known to interfere in bacterial growth (12). Nevertheless, this work highlighted that under the appropriate in vitro conditions, some of the most common species found in BV can form single-species biofilms, contrary to what was shown before (13,26). NYC III medium revealed to be an ideal candidate for future studies addressing multi-species biofilm formation since this growth medium allowed significant levels of single-species biofilm formation. Understanding microbial interactions that occur during BV development is crucial for the development of novel antimicrobial strategies, and future work will help to clarify some of these crucial interactions in multi-species biofilms. 3.5 References 1. Muzny CA, Taylor CM, Swords WE, Tamhane A, Chattopadhyay D, Cerca N, et al. An updated conceptual model on the pathogenesis of bacterial vaginosis. J Infect Dis. 2019;220(9):1399– 405. 69 2. Castro J, Machado D, Cerca N. Unveiling the role of Gardnerella vaginalis in polymicrobial bacterial vaginosis biofilms: the impact of other vaginal pathogens living as neighbors. ISME J. 2019;13(5):1306–17. 3. Rodriguez Jovita M, Collins MD, Sjodén B, Falsen E. Characterization of a novel Atopobium isolate from the human vagina: description of Atopobium vaginae sp. nov. Int J Syst Bacteriol. 1999;49:1573–6. 4. Falsen E, Pascual C, Sjoden B, Ohlén M, Collins MD. Phenotypic and phylogenetic characterization of a novel Lactobacillus species from human sources: description of Lactobacillus iners sp. nov. Int J Syst Bacteriol. 1999;49(1 999):217–21. 5. Spiegel CA, Roberts M. Mobiluncus gen. nov., Mobiluncus curtisii subsp. curtisii sp. nov., Mobiluncus curtisii subsp. holmesii subsp. nov., and Mobiluncus mulieris sp. nov., curved rods from the human vagina. Int J Syst Bacteriol. 1984;34(2):177–84. 6. Ng J, Ng L-K, Chow AW, Dillon J-AR. Identification of five Peptostreptococcus species isolated predominantly from the female genital tract by using the R rapid ID32A system. J Clin Microbiol. 1994;32(5):1302–7. 7. Holdeman L V, Johnson JL. Bacteroides disiens sp. nov. and Bacteroides bivius sp. nov. from Human Clinical Infections. Int J Syst Bacteriol. 1977;27(4):337–45. 8. Ravel J, Gajer P, Abdo Z, Schneider GM, Koenig SSK, McCulle SL, et al. Vaginal microbiome of reproductive-age women. Proc Natl Acad Sci. 2011;108(Suppl. 1):4680–7. 9. Onderdonk AB, Delaney ML, Fichorova N. The human microbiome during bacterial vaginosis. Clin Microbiol Rev. 2016;29(2):223–38. 10. Diop K, Dufour J-C, Levasseur A, Fenollar F. Exhaustive repertoire of human vaginal microbiota. Hum Microbiome J. 2019;11(January):100051. 11. Castro J, Alves P, Sousa C, Cereija T, França Â, Jefferson KK, et al. Using an in-vitro biofilm model to assess the virulence potential of bacterial vaginosis or non-bacterial vaginosis Gardnerella vaginalis isolates. Sci Rep. 2015;5:11640. 12. Castro J, Jefferson K, Cerca N. Innate immune components affect growth and virulence traits of bacterial vaginosis-associated and non-BV associated Gardnerella vaginalis strains similarly. Pathog Dis. 2018;76(9):fty089. 13. Castro J, Rosca AS, Cools P, Vaneechoutte M, Cerca N. Gardnerella vaginalis enhances Atopobium vaginae viability in an in vitro model. Front Cell Infect Microbiol. 2020;10(83):1–9. 14. Vaneechoutte M, Guschin A, Van Simaey L, Gansemans Y, Van Nieuwerburgh F, Cools P. Emended description of Gardnerella vaginalis and description of Gardnerella leopoldii sp. nov., Gardnerella piotii sp. nov. and Gardnerella swidsinskii sp. nov., with delineation of 13 genomic species within the genus Gardnerella . Int J Syst Evol Microbiol. 2019;69(3):679–87. 15. Azeredo J, Azevedo NF, Briandet R, Cerca N, Coenye T, Costa AR, et al. Critical review on biofilm methods. Crit Rev Microbiol. 2017;43(3):313–51. 16. Peeters E, Nelis HJ, Coenye T. Comparison of multiple methods for quantification of microbial biofilms grown in microtiter plates. J Microbiol Methods. 2008;72(2):157–65. 17. La Scola B, Khelaifia S, Lagier JC, Raoult D. Aerobic culture of anaerobic bacteria using antioxidants: a preliminary report. Eur J Clin Microbiol Infect Dis. 2014;33(10):1781–3. 76 the triple-species biofilms). The CLSM images were acquired with an OlympusTM FluoView FV1000 confocal laser scanning microscope (Olympus, Tokyo, Japan) using a 40× objective. Microscopic visualization was performed using lasers capable of detecting the PNA Gard162 probe (Laser 559, excitation wavelength 559 nm, emission wavelength 618 nm, BA575-675, sensitive to the Alexa Fluor 594 molecule attached to the Gard162 probe), the PNA AtoITM1 probe (Laser 488, excitation wavelength 488 nm, emission wavelength 520 nm, BA505-540, sensitive to the Alexa Fluor 488 molecule attached to the AtoITM1 probe), and DAPI (Laser 405, excitation wavelength 405 nm, emission wavelength 461 nm, BA430-470). Images were acquired with 640 × 640 resolution of each surface analysed. The CLSM images were analysed using the FV10-ASW 4.0 Viewer Software (Olympus). The assays were repeated three times with two technical replicates. 4.2.6 Gene expression quantification Gene expression of three potential G. vaginalis virulence genes, namely vaginolysin ( vly ), sialidase ( sld ), and HMPREF0424_0821 , was determined in 48 h single-, dual-, and triple-species biofilms. For each tested condition, total RNA was extracted using an E.Z.N.A.® Bacterial RNA Kit (Omega Bio-tek, GA, USA) with minor changes, as optimized before (16). Following, genomic DNA was degraded with one step of DNase treatment (Fermentas, Vilnius, Lithuania) according to the manufacturer’s instructions. RNA concentration, purity, and integrity were determined as previously described (17). The same amount of total RNA (300 ng.µL-1) was reverse transcribed using the RevertAidTM First Strand cDNA synthesis kit (Fermentas), as previously optimized, and gene-specific reverse transcription primers as a priming strategy. Quantitative PCR (qPCR) was prepared by mixing together 5 µL of iQ SYBR green supermix (BioRad, CA, USA), 2 µL of 1:100 diluted cDNA, 0.5 µL of 5 µM Forward and Reverse primers (Table 4.1), and water up to 10 µL. The run was performed in a CFX96TM thermal cycler (Bio-Rad) with the following cycling parameters: 3 min at 95 °C, followed by 45 cycles of 10 s at 95 °C, 10 s at 60 °C, and 15 s at 72 °C. Reaction efficiency was determined by the dilution method (18). At 60 °C, all set of primers used (Table 4.1) had similar efficiencies. Furthermore, the analysis of the obtained melting curves confirmed the presence of a single peak, demonstrating the specificity of the tested primers. Normalized gene expression was determined by using the delta C t method ( E Δ C t), a variation of the Livak method, where Δ C t = C t (reference gene) − C t (target gene) and E stands for the reaction efficiency experimentally determined. A non-reverse transcriptase control was included in each reaction. All assays were repeated at least three independent times with three technical replicates. 77 Table 4.1. Primers used in qPCR experiments. Target gene Gene description Primer sequence (5ʼ to 3ʼ) Tmelting (°C) Efficiencya (%) Amplicon size (bp) 16S RNA 16S ribosomal RNA of G. vaginalis Fw TGAGTAATGCGTGACCAACC Rv AGCCTAGGTGGGCCATTACC 55.2 59.3 100 167 vly Thiol-activated cytolysin vaginolysin Fw GAACAGCTGGGCTAGAGGTG Rv AATTCCATCGCATTCTCCAG 60.01 60.04 100 153 sld Sialidase Fw CCGAATTTGCGATTTCTTCT Rv CGTACGGAAGTTTTGGAAGC 54.00 58.00 86 189 HMPREF0424_0821 Glycosyltransferase, group 2 family protein Fw CAACGAAGGCATAGGTTTCC Rv GCGCTTGGAACTGCTTTAAC 59.57 60.02 100 156 a PCR amplification efficiency ( E ) for each gene was determined from the slope of a standard curve ( E =10 [-1/slope]), generated with a 10-fold dilution series of cDNA. 4.2.7 Statistical analysis The data were analysed using the statistical package GraphPad Prism version 7 (La Jolla) by Paired t test, Mann-Whitney U test, or one-way ANOVA with Dunnett’s multiple comparison test. Values with a p < 0.05 were considered statistically significant. 4.3 Results 4.3.1 Biofilm biomass quantification We observed that in our in vitro conditions, G. vaginalis was able to form a biofilm with significantly higher biomass than F. vaginae or P. bivia after 24 h of incubation (Figure 4.1A). Furthermore, dual-species biofilms total biomass was not significantly augmented after adding F. vaginae or P. bivia to the preformed G. vaginalis biofilms (when compared to 48 h single-species biofilms of G. vaginalis ) (Figure 4.1B). Interestingly, similar results were obtained for the triple-species biofilms after F. vaginae and P. bivia were simultaneously added to the pre-established G. vaginalis biofilms. 78 Figure 4.1. Single-, dual-, and triple-species biofilms biomass quantification by CV staining. (A) represents the 24 h singlespecies biofilms controls. (B) represents the 48 h G. vaginalis single-species biofilms control as well as the 48 h dualand triple-species biofilms. Results are expressed as average ± standard deviation of three independent assays, with two technical replicates assessed each time. Statistical analysis was performed using one-way ANOVA and Dunnett’s multiple comparisons test. * Values are significantly different between 24 h G. vaginalis single-species biofilms and 24 h F. vaginae or P. bivia singlespecies biofilms ( p < 0.05). Fv : Fannyhessea vaginae ; Gv : Gardnerella vaginalis ; Pb : Prevotella bivia . 4.3.2 Testing specificity and efficiency of the PNA probes Gard162 and AtoITM1 To confirm that the PNA probes Gard162 and AtoITM1 could differentially detect the G. vaginalis and F. vaginae strains used in this study, we analysed if any of these two probes would cross-hybridize with any of the tested strains. According to the FISH results (Table 4.2), Gard162 probe hybridized with G. vaginalis while AtoITM1 probe hybridized with F. vaginae , and no cross-hybridization was observed with other species, confirming the high specificity as before reported (8,14). Table 4.2. Bacterial species used in PNA FISH assays and their specificity with PNA probes Gard162 and AtoITM1. Species Gard162 probe specificity a AtoITM1 probe specificity a G. vaginalis ATCC 14018T ++++ - F. vaginae ATCC BAA-55T - +++ P. bivia ATCC 29303T - - a The specificity of PNA probes Gard162 and AtoITM1 was tested for each species with the following hybridization PNA FISH qualitative evaluation: (−) absence of hybridization; (++) moderate hybridization; (+++) good hybridization; (++++) optimal hybridization. Since no P. bivia PNA probe currently exists, the estimation of P. bivia counts could only be evaluated indirectly by DAPI counterstaining, assuming that all cells with unlabelled PNA probes were P. bivia ; however, this needs to be experimentally determined (19). Therefore, we compared the data obtained for FISH and DAPI counts for both G. vaginalis and F. vaginae single-species biofilms. Not surprisingly, each 79 probe failed to detect 100% of the respective total cells. By performing serial dilutions of each sample, calibration curves were obtained for G. vaginalis (Figure 4.2A) and for F. vaginae (Figure 4.2B). Figure 4.2. Correlation between FISH and DAPI counts for single-species biofilms of G. vaginalis and F. vaginae at different bacterial concentrations. (A) G. vaginalis biofilm cells that were identified indirectly by DAPI coincided with the populations quantified by PNA FISH using the PNA probe Gard162. (B) F. vaginae biofilm cells that were identified indirectly by DAPI coincided with the populations quantified by PNA FISH using the PNA probe AtoITM1. Each data point represents the average ± standard deviation of three independent assays. For each assay, twenty fields were randomly acquired in each sample and the number of bacteria per image was counted using ImageJ Software . Taking into consideration these results, it was possible to calculate the efficiency of each probe and obtain an equation that would correct FISH counts, to prevent the overestimation of DAPI counts and consider them as P. bivia counts (Table 4.3). Table 4.3. Equations used to quantify bacterial populations in biofilms. Bacteria Equation Efficiency of PNA probe (%) G. vaginalis G. vaginalis counts = [log (FISH counts/area) + 0.1892]/ 1.0224 92.08 F. vaginae F. vaginae counts = [log (FISH counts/area) – 0.0495]/ 0.9878 91.59 4.3.3 Discriminating bacterial populations in dualand triple-species biofilms by PNA FISH Our results showed that although F. vaginae and P. bivia did not significantly enhance the dual-species biofilms biomass, as aforesaid, these species were able to incorporate G. vaginalis pre-formed biofilm, comprising for up to respectively 25% and 40% of the total number of cells in the dual-species biofilms (Figure 4.3). Interestingly, these percentages changed in the triple-species biofilms with F. vaginae 80 showing only about 8% biofilm cells while P. bivia about 22%, and G. vaginalis maintaining almost the same number of cells as in the dual-species biofilms. Figure 4.3. Total percentage of cells detected by PNA FISH for 48 h dualand triple-species biofilms. Results are expressed as average ± standard deviation. For each assay, twenty fields were randomly acquired in each sample and the number of bacteria per image was counted using ImageJ Software . * Values are significantly different between bacterial populations of G. vaginalis and F. vaginae in dual-species (Paired t test, p < 0.05) and triple-species (one-way ANOVA and Dunnett’s multiple comparisons test, p < 0.05) biofilms. τ Values are significantly different between bacterial populations of F. vaginae and P. bivia in triple-species biofilms (one-way ANOVA and Dunnett’s multiple comparisons test, p < 0.05). Fv : Fannyhessea vaginae ; Gv : Gardnerella vaginalis ; Pb : Prevotella bivia . 4.4.4 Analysis of biofilm populations’ distribution by CLSM After determining the percentage of each species in the dualand triple-species biofilms, we sought to analyse their spatial distribution in these biofilms taking advantage of the robustness of PNA FISH/ DAPI method combined with CLSM. As shown in Figure 4.4, on average, in both dualand triple-species biofilms, F. vaginae and P. bivia were found well distributed across G. vaginalis biofilm, in small clusters of cells. 81 Figure 4.4. An example of data set on the organization of the 48 h dualand triple-species biofilms by CLSM. G. vaginalis is labelled with PNA probe Gard162 (red/ purple colour when coupled with DAPI), F. vaginae is labelled with PNA probe AtoITM1 (green/ green-blue colour when coupled with DAPI), and P. bivia is stained with DAPI (blue colour). Fv : Fannyhessea vaginae ; Gv : Gardnerella vaginalis ; Pb : Prevotella bivia . 4.4.5 Quantification of the expression of virulence genes in G. vaginalis In order to elucidate the influence of F. vaginae , P. bivia or both species on G. vaginalis virulence, we evaluated the expression of G. vaginalis genes associated to cytotoxicity, vaginal epithelial exfoliation, and biofilm formation in cells from single-, dual-, and triple-species biofilms. It is known that G. vaginalis produces vaginolysin, a pore-forming toxin that might induce vaginal cells lysis (20,21). Under our tested conditions, the expression levels of the gene for vaginolysin, vly , was slightly reduced only in the triplespecies biofilms consortium (Figure 4.5A). Regarding sialidase, sld , which is known to facilitate the destruction of the protective mucus layer on the vaginal epithelium (22), similar results were obtained whenever F. vaginae was included in the dualor triple-species consortia (Figure 4.5B). Conversely, the expression of HMPREF0424_0821 transcript, which codes type II glycosyltransferase, likely to be important for the biosynthesis of exopolysaccharide which in turn might be important for biofilm formation (23), was upregulated in all consortia, however statistically significant only for the triple-species biofilms (Figure 4.5C). 82 Figure 4.5. Quantification of the expression of virulence genes related to cytotoxicity, vaginal epithelial exfoliation, and biofilm formation, by G. vaginalis cultured in 48 h single-, dual-, and triple-species biofilms. (A) Quantification of vaginolysin ( vly ) transcript. (B) Quantification of sialidase ( sld ) transcript. (C) Quantification of HMPREF0424_0821 transcript, which codes type II glycosyltransferase. The data show the fold-change expression of genes in G. vaginalis singlecompared to dualand triple-species biofilm cells. For qPCR experiments, the bars represent the mean, and the error bars the standard error of the mean (mean ± SEM). * Values are significantly different between the singleand the triple-species G. vaginalis biofilm under the same conditions (Mann-Whitney U test, p < 0.05). Fv : Fannyhessea vaginae ; Gv : Gardnerella vaginalis ; Pb : Prevotella bivia . 4.4 Discussion While BV is often associated with multiple bacterial species, most in vitro biofilms are focused on Gardnerella spp. single-species studies (24). A dual-species biofilm model has been described before, where Gardnerella spp. is first allowed to form a biofilm and then other species are incorporated in this early stage biofilm (12,13,25,26). However, in vivo BV biofilms are composed of more than two species (7,8,27), and as such, it is important to develop more complex biofilm models. Here, we selected three prominent bacterial species associated with BV (28) to develop the first in vitro triple-species biofilms. Our results indicate that even F. vaginae and P. bivia were able to incorporate the pre-established in vitro G. vaginalis biofilms in both dualand triple-species consortia, G. vaginalis was the predominant species 83 in all consortia tested, similar to what occurs in vivo (7,29). In addition, the relative composition of F. vaginae and P. bivia decreased in the triple-species biofilms comparing to the dual-species biofilms, suggesting that different relationships are established in these distinct consortia. Furthermore, if comparing the ability of F. vaginae and P. bivia to incorporate the pre-formed G. vaginalis biofilm in dualspecies biofilms, in our tested conditions, P. bivia was better fit to grow in the biofilm than F. vaginae . This suggests that G. vaginalis modifies the local environment, making it more favourable for the growth of P. bivia. This might not be surprising, since an early in vitro study reported nutritional pathways that maintain a synergistic relationship observed between Gardnerella spp. and P. bivia . Growth of P. bivia in a vaginal defined medium supplemented with amino acids or peptone resulted in ammonia production while the growth of Gardnerella spp. under the same conditions was accompanied by ammonia utilization (30). Also, more evidence of such bacterial cooperation was supported by a more recent study, where it was demonstrated that Gardnerella spp. growth increased in the presence of P. bivia , and P. bivia reached higher numbers when co-cultured with Gardnerella spp. (25). In our study, F. vaginae and P. bivia were simultaneously added to the pre-formed G. vaginalis biofilm, and perhaps this led to a competition between these two species over the metabolites produced by G. vaginalis , being therefore somewhat explained why F. vaginae was present in such low concentration in the triple-species biofilms. However, these results are to some extent contradictory to what has been described in vivo BV biofilms. A study conducted by Swidsinski and colleagues (7) on vaginal biopsies specimens using a broad range of FISH probes demonstrated that the adherent BV-biofilms were mainly composed by Gardnerella spp. (~60%) and F. vaginae (~40%). Afterwards, Hardy and colleagues (8) carried out a study on vaginal samples in which they observed that when F. vaginae was part of the BV biofilm, compared to a biofilm of only Gardnerella spp., both species were present in higher concentrations. In a following study, also carried on vaginal samples, Hardy and colleagues (9) showed that F. vaginae is almost always accompanied by Gardnerella spp. in BV, but that Gardnerella spp. can be found without F. vaginae in the BV vaginal milieu. Therefore, all these findings support that Gardnerella spp. and F. vaginae could indeed establish a relationship in BV-associated biofilms (9), but to better understand the obtained results and also bacterial interactions in BV biofilms, further detailed studies are needed. In this study, we selected a very rich nutrient culture medium (NYC III), that we recently showed to be an ideal candidate to form single-species in vitro biofilms of fastidious bacteria (31). This selection was based on the purpose to better compare dualand triple-species biofilms with single-species biofilms. However, being such a rich medium, NYC III might be masking possible synergistic growth effects that have been reported in other in vitro conditions (13). Still, despite no growth synergistic effects were found under 84 these conditions, relevant microbial interactions were in fact observed: our PNA FISH demonstrated that in the triple-species consortium, F. vaginae decreased the relative concentration of P. bivia , as compared with the other consortium. These data support the idea that the development of a BV-associated biofilm reflects the interactions established by the different species over time. Further interactions were also detected when analysing key G. vaginalis gene expression. As observed by our qPCR experiments, the expression of HMPREF0424_0821 , a gene coding for a type II glycosyltransferase thought to be involved in biofilm formation, was increased in G. vaginalis in the presence of the other two species in both dualand triple-species consortia. Interestingly, the higher expression levels were found when in the presence of both F. vaginae and P. bivia. Taken together, this study highlights the idea that the interactions between BV-associated bacteria can impact the biofilm structure, which will likely influence BV progress as well as the clinical outcome. Since BV etiology is poorly understood and there is still a lack of studies addressing the polymicrobial bacterial communities found in BV, further studies are needed to investigate the complex interplay between BVassociated species. 4.5 References 1. Hill GB. The microbiology of bacterial vaginosis. Am J Obstet Gynecol. 1993;169:450–4. 2. Gardner HL, Dukes CD. Haemophilus vaginalis vaginitis. Am J Obstet Gynecol. 1955;69(5):962– 76. 3. Castro J, Alves P, Sousa C, Cereija T, França Â, Jefferson KK, et al. Using an in-vitro biofilm model to assess the virulence potential of bacterial vaginosis or non-bacterial vaginosis Gardnerella vaginalis isolates. Sci Rep. 2015;5:11640. 4. Alves P, Castro J, Sousa C, Cereija TB, Cerca N. Gardnerella vaginalis outcompetes 29 other bacterial species isolated from patients with bacterial vaginosis, using in an in vitro biofilm formation model. J Infect Dis. 2014;210(4):593–6. 5. Hickey RJ, Forney LJ. Gardnerella vaginalis does not always cause bacterial vaginosis. J Infect Dis. 2014;210:1682–3. 6. Muzny CA, Blanchard E, Taylor CM, Aaron KJ, Talluri R, Griswold ME, et al. Identification of key bacteria involved in the induction of incident bacterial vaginosis: a prospective study. J Infect Dis. 2018 Aug 14;218(6):966–78. 7. Swidsinski A, Mendling W, Loening-Baucke V, Ladhoff A, Swidsinski S, Hale LP, et al. Adherent biofilms in bacterial vaginosis. Obstet Gynecol. 2005;106(5 Pt 1):1013–23. 8. Hardy L, Jespers V, Dahchour N, Mwambarangwe L, Musengamana V, Vaneechoutte M, et al. Unravelling the bacterial vaginosis-associated biofilm: a multiplex Gardnerella vaginalis and Atopobium vaginae fluorescence in situ hybridization assay using peptide nucleic acid probes. PLoS One. 2015;10(8):e0136658. 85 9. Hardy L, Jespers V, Abdellati S, De Baetselier I, Mwambarangwe L, Musengamana V, et al. A fruitful alliance: the synergy between Atopobium vaginae and Gardnerella vaginalis in bacterial vaginosisassociated biofilm. Sex Transm Infect. 2016;92(7):487–91. 10. Pybus V, Onderdonk AB. Evidence for a commensal, symbiotic relationship between Gardnerella vaginalis and Prevotella bivia involving ammonia: potential significance for bacterial vaginosis. J Infect Dis. 1997;175(2):406–13. 11. Nikolaitchouk N, Andersch B, Falsen E, Strömbeck L, Mattsby-Baltzer I. The lower genital tract microbiota in relation to cytokine-, SLPIand endotoxin levels: Application of checkerboard DNADNA hybridization (CDH). Apmis. 2008;116(4):263–77. 12. Castro J, Machado D, Cerca N. Unveiling the role of Gardnerella vaginalis in polymicrobial bacterial vaginosis biofilms: the impact of other vaginal pathogens living as neighbors. ISME J. 2019;13(5):1306–17. 13. Castro J, Rosca AS, Cools P, Vaneechoutte M, Cerca N. Gardnerella vaginalis enhances Atopobium vagina e viability in an in vitro model. Front Cell Infect Microbiol. 2020;10(83):1–9. 14. Machado A, Almeida C, Salgueiro D, Henriques A, Vaneechoutte M, Haesebrouck F, et al. Fluorescence in situ Hybridization method using Peptide Nucleic Acid probes for rapid detection of Lactobacillus and Gardnerella spp. BMC Microbiol. 2013;13:82. 15. Rasband W. ImageJ Software. Bethesda, MD: National Institutes of Health. 1997. https://imagej.nih.gov/ij/. 16. França A, Freitas AI, Henriques AF, Cerca N. Optimizing a qPCR gene expression quantification assay for S. epidermidis biofilms: A comparison between commercial kits and a customized protocol. PLoS One. 2012;7(5):e37480. 17. Carvalhais V, Delgado-Rastrollo M, Melo LDR, Cerca N. Controlled RNA contamination and degradation and its impact on qPCR gene expression in S. epidermidis biofilms. J Microbiol Methods. 2013;95(2):195–200. 18. Pfaffl MW. Quantification strategies in real-time PCR. In: Bustin SA, editor. A-Z of quantitative PCR. International University Line (IUL), La Jolla, CA, USA; 2004. p. 87–112. 19. Almeida C, Azevedo NF, Santos S, Keevil CW, Vieira MJ. Discriminating multi-species populations in biofilms with peptide nucleic acid fluorescence in situ hybridization (PNA FISH). PLoS One. 2011;6(3). 20. Gelber SE, Aguilar JL, Lewis KLT, Ratner AJ. Functional and phylogenetic characterization of vaginolysin, the human-specific cytolysin from Gardnerella vaginalis . J Bacteriol. 2008;190(11):3896–903. 21. Harwich MD, Alves JM, Buck GA, Strauss JF, Patterson JL, Oki AT, et al. Drawing the line between commensal and pathogenic Gardnerella vaginalis through genome analysis and virulence studies. BMC Genomics. 2010;11:375. 22. Hardy L, Jespers V, Van den Bulck M, Buyze J, Mwambarangwe L, Musengamana V, et al. The presence of the putative Gardnerella vaginalis sialidase A gene in vaginal specimens is associated with bacterial vaginosis biofilm. Mitchell C, editor. PLoS One. 2017 Feb 27;12(2):e0172522. 23. Yeoman CJ, Yildirim S, Thomas SM, Durkin AS, Torralba M, Sutton G, et al. Comparative genomics of Gardnerella vaginalis strains reveals substantial differences in metabolic and virulence potential. PLoS One. 2010;5(8). 92 5.2.8 Antibiotics Clindamycin and metronidazole, two antibiotics recommended for the treatment of BV (22), were used in this study. Antibiotic solutions were prepared on the day of use according to the recommendations of the Clinical and Laboratory Standards Institute (CLSI) (23). The mechanisms of action and the peak serum concentration (PSC) value of each antibiotic used herein are shown in Table 5.2. Table 5.2. Mechanisms of action and peak serum concentration (PSC) of clindamycin and metronidazole. Antibiotics Mechanism of action PSC (µg.mL-1) a Clindamycin Inhibition of protein synthesis (24) 4.8 (25) Metronidazole Inhibition of DNA replication (26) 11.5 (27) a In this study, for biofilm assays, each antibiotic was used in a concentration of 4 × PSC. 5.2.9 Determination of the minimal inhibitory concentration (MIC) and minimal lethal concentration (MIC) of antibiotics MIC and MLC values of clindamycin and metronidazole were determined by the broth microdilution method in 96-well tissue culture plates (28), with some minor modifications. Both antibiotics were initially diluted in NYC III broth. Then, serial dilutions of clindamycin and metronidazole, ranging between 0.008 µg.mL-1 and 16 µg.mL-1 and respectively between 0.125 µg.mL-1 and 256 µg.mL-1, were also prepared in NYC III broth. Bacterial suspensions of 24 h cultures corresponding to each tested species were adjusted to an OD of 0.10 ± 0.05 at 620 nm. Subsequently, the adjusted bacterial suspensions were added to 96well tissue culture plates containing the prepared antibiotics dilutions. Also, MIC determination assays included a negative (only NYC III) and a positive (bacterial suspensions without antibiotics) control. The 96-well tissue culture plates were incubated for 48 h at 37 °C in anaerobic conditions created by the anaerobic gas generating sachets, as described above. After incubation, the MICs were determined by reading the OD at 620 nm of bacterial suspensions from the 96-well plates. MIC value was defined as the lowest concentration of the antibiotic that inhibited the growth of treated bacteria (23). All assays were repeated at least three times on separate days with technical replicates. 5.2.10 Determination of the antibiotics effect on triple-species biofilms biomass Biofilms were formed in 24-well tissue culture plates as mentioned above and afterward challenged with clindamycin and metronidazole. Clindamycin was adjusted to a final concentration of 19.2 µg.mL-1 (4 × PSC), while metronidazole to a final concentration of 46 µg.mL-1 (4 × PSC) (Table 5.2), in NYC III broth, being, therefore added to the biofilms, and incubated for 24 h at 37 ºC under anaerobic conditions as 93 previously mentioned. Next, the medium with planktonic cells was removed and biofilms biomass were quantified by the CV method. Negative and positive controls, represented by NYC III and triple-species biofilms without exposition to the antibiotics, respectively, were included in each experimental assay. All assays were repeated at least three times with technical replicates. 5.2.11 Statistical analysis All numerical data were analysed using statistical package GraphPad Prism version 7 (La Jolla) by oneway and two-way ANOVA with multiple comparisons tests. Values with a p < 0.05 were considered statistically significant. 5.3 Results 5.3.1 Biofilm biomass quantification In order to better understand the role of G. vaginalis in multi-species biofilms formation, we first started to quantify total biomass formed in triple-species biofilms using two distinct models, whereby the main difference was allowing (or not) the establishment of a G. vaginalis biofilm before introducing the other species. Triple-species biofilms were compared to both dual-species biofilms of G. vaginalis and F. vaginae and single-species biofilms of G. vaginalis , incubated for the same period. It should be noted that a direct comparison between the two experimental models is not possible due to the first 24 h of G. vaginalis incubation in the pre-conditioned model, that could not be compensated in the competitive model. Interestingly, in the pre-conditioned model, no differences were observed between the total biomass accumulated in the tripleor dual-species consortia as compared with 48 h G. vaginalis single-species biofilms, suggesting that the other two species did not enhance the ability of G. vaginalis biofilm formation, under these experimental conditions (Figure 5.2A). Conversely, in the competitive model, a significant increase of the total biomass was observed for all four triple-species consortia when comparing to the 24 h G. vaginalis single-species biofilms but only in the triple-species consortium with P. anaerobius this increase was significant when compared to the G. vaginalis and F. vaginae dual-species biofilms (Figure 5.2B). 94 Figure 5.2. Biomass quantification of the single-, dual-, and triple-species biofilms using CV method. (A) represents the total biomass of 24 h and 48 h G. vaginalis single-species biofilms as well as the 48 h dualand triple-species biofilms formed using the G. vaginalis pre-conditioned model. (B) represents the total biomass of 24 h single-species biofilms as well as the 24 h dualand triple-species biofilms formed using the competitive model. Results are expressed as average OD595nm ± standard deviation of at least three independent experiments performed with two technical replicates. Statistical analysis was performed using one-way ANOVA and Dunnett s multiple comparisons test. γ Values are significantly different between 24 h and 48 h G. vaginalis single-species biofilms for the pre-conditioned model ( p < 0.05). * Values are significantly different between dualspecies biofilms of Fv + Gv and singleor triple-species biofilms for the competitive model ( p < 0.05). τ Values are significantly different between triple-species biofilms and single-species biofilms for the competitive model ( p < 0.05). Fv : Fannyhessea vaginae ; Gv : Gardnerella vaginalis ; Li : Lactobacillus iners ; Mc : Mobiluncus curtisii ; Pa : Peptostreptococcus anaerobius ; Pb : Prevotella bivia . While the pre-conditioned model yielded biofilms with higher biomass, it should be taken into consideration that those biofilms benefit from the added biomass of the 24 h initial G. vaginalis biofilms. We hypothesized that this increased yield was not a result of a specific contribution by G. vaginalis , but a direct consequence of enhanced incubation time, as show before (29). To test this hypothesis, we performed another experiment where we allowed the triple-species biofilms formed in the competitive model to be incubated for another 24 h (total of 48 h), which led to an enhanced biofilm formation in all consortia tested, superior to the total biomass obtained in the pre-conditioned model (Figure 5.3). Again, attention should be given when directly comparing both models, since in the 48 h pre-conditioned biofilms, nonG. vaginalis isolates were only incubated for 24 h. 95 Figure 5.3. Comparison of total biofilm biomass after 48 h of incubation in the two different experimental models. The biofilm biomass was quantified by the CV method. Results are expressed as average of the OD at 595 nm ± standard deviation of at least three independent experiments performed with two technical replicates. * Represents a statistically significant difference (two-way ANOVA and Sidakʼs multiple comparisons test, p < 0.05). 5.3.2 Testing specificity and efficiency of the PNA probes Gard162 and AtoITM1 As determined in Chapter 4, Gard162 and AtoITM1 probes hybridized with G. vaginalis and F. vaginae , respectively, and no cross-hybridization was observed with P. bivia . Thus, it was also important to verify if the two PNA probes would cross-hybridize with any of the other species used in this chapter. Based on FISH results, no hybridization of the two probes was observed for L. iners , M. curtisii or P. anaerobius strains used herein, showing a specificity of 100% as previously reported (13,21). 5.3.3 Discriminating bacterial populations in triple-species biofilms by PNA FISH Taking into consideration each PNA probe efficiency (as described in Chapter 4), we quantified G. vaginalis , F. vaginae , and the third BV-associated species in each consortium from both experimental models. Interestingly, as shown in Figure 5.4, for all consortia and for both models tested, G. vaginalis was the dominant species. Furthermore, different bacterial compositions were observed within the same consortium when grown in each of the two distinct in vitro models. Also, G. vaginalis presented a significant higher number of cells in all consortia of the pre-conditioned model, while F. vaginae , conversely, showed a significant higher number of cells in all consortia of the competitive model. Curiously, the other tested species were able to better integrate the triple-species biofilms formed under the pre-conditioned model, suggesting that perhaps in the competitive model, these species might be outcompeted by F. vaginae , which prospers better in this model. 96 Figure 5.4. Relative composition of each triple-species biofilm consortium as quantified by PNA FISH. Results are expressed as average of cells ± standard deviation. Statistical analysis was performed using two-way ANOVA and Tukey’s multiple comparisons test. Statistically significant differences between both models are represented with τ for G. vaginalis , * for F. vaginae , and with γ for the other BV-associated species in each consortium ( p < 0.05). Fv : Fannyhessea vaginae ; Gv : Gardnerella vaginalis ; Li : Lactobacillus iners ; Mc : Mobiluncus curtisii ; Pa : Peptostreptococcus anaerobius ; Pb : Prevotella bivia . GvPC.Model: G. vaginalis pre-conditioned biofilm formation model; C.Model: competitive biofilm formation model. 5.3.4 CLSM in situ observation of the bacterial species integration in the triple-species biofilms By using PNA FISH/ DAPI method combined with CLSM, we sought to analyse the integration of the tested bacterial species in the triple-species biofilms. We noted that, on average, bacterial species appeared more equally distributed in the pre-conditioned model, while in the competitive model, they had more the tendency to aggregate in clusters (Figure 5.5A). The three microscopic fields whose superposition resulted in the triple-species biofilm organization for each consortium are shown in Figure 5.5B. 97 Figure 5.5. CLSM analysis of bacterial distribution in the intact structure of the triple-species BV-associated biofilms (A). Separate microscopic fields that form the structure of the triple-species biofilms (B). G. vaginalis is labelled with PNA probe Gard162 (red/ purple colour when coupled with DAPI), F. vaginae is labelled with PNA probe AtoITM1 (green/ green-blue colour when coupled with DAPI), and DAPI (blue colour) is used as a counterstain. The images were acquired with a 10× objective and with a resolution of 800 × 800 pixels. Fv : Fannyhessea vaginae ; Gv : Gardnerella vaginalis ; Li : Lactobacillus iners ; Mc : Mobiluncus curtisii ; Pa : Peptostreptococcus anaerobius ; Pb : Prevotella bivia . 98 5.3.5 Impact of clindamycin and metronidazole on the different biofilm consortia biomass Taking into consideration the differences observed between the two biofilm-forming models, we further wanted to determine whether those differences could influence the outcome of bacterial susceptibility to antibiotics. First, we determined the MIC and MLC of the planktonic cells of the six different strains used herein for clindamycin and metronidazole (Table 5.3), and then assessed their effect against all consortia characterized above. Table 5.3 . Susceptibility to clindamycin and metronidazole of the species used in this chapter. Species a Clindamycin, µg.mL-1 a Metronidazole, µg.mL-1 MIC b MLC c MIC MLC F. vaginae ATCC BAA-55T < 0.0625 0.0625 ≥ 128 > 128 G. vaginalis ATCC 14018T < 0.0625 0.125 > 128 > 128 L. iners CCUG 28746T 1 1 > 128 > 128 M. curtisii ATCC 35241T > 128 > 128 > 128 ≥ 128 P. anaerobius ATCC 27337T > 128 > 128 4 4 P. bivia ATCC 29303T < 0.0625 < 0.0625 [4-8] 8 a To interpret the MIC results, the microbiological susceptibility and resistance breakpoints for clindamycin (≤ 2 μg.mL-1 and ≥ 8 μg.mL-1) and metronidazole (≤ 8 μg.mL-1 and ≥ 32 μg.mL-1) were used as defined by CLSI (23). b MIC, minimal inhibitory concentration c MLC, minimal lethal concentration. Hence, we determined if the addition of each antibiotic would have an influence on the reduction of the total biomass of the mature biofilms (Figure 5.6). Interestingly, despite the differences in total biomass and relative bacterial composition in both models, no significant differences were observed for the antibiotics used between the two models, in most tested conditions, with two exceptions. The most striking difference occurred in the P. anaerobius consortium treated with metronidazole: while in the competitive model metronidazole only slightly reduced the growth rate of the biofilm, in the pre-conditioned model it was able to significantly reduce the total biomass of the consortium. The other exception occurred for the P. bivia consortium, where metronidazole slightly reduced the growth rate of the biofilm in the competitive model while in the pre-conditioned model, it only prevented the increase of total biomass growth. Not surprisingly, none of the antibiotics was able to completely eradicate the biofilms at the tested concentrations. We also compared the impact of these two antibiotics on each consortium to the impact on G. vaginalis 24 h or 48 h single-species biofilm controls (Figure 5.6). Interestingly, when comparing to G. vaginalis single-species biofilms, having more species in the biofilm resulted in a lower metronidazole efficiency. 99 This was observed in all consortia formed in the competitive model and in two out of four consortia formed in the pre-conditioned model. Conversely, the same effect was not observed when using clindamycin. Figure 5.6. Effect of clindamycin (A) or metronidazole (B) on total biomass of G. vaginalis single-species biofilms as well as triple-species biofilms from both in vitro models. Biofilm biomass was quantified by the CV method and results are expressed as average OD at 595 nm ± standard deviation. The i.CT stands for initial control, before the medium replacement while the f.CT stands for final control, after incubation with fresh medium. Statistical analysis was performed using two-way ANOVA and Tukey’s multiple comparisons test. * Values are significantly different between i.CT and f.CT ( p < 0.05). φ Values are significantly different between i.CT and antibiotic ( p < 0.05). γ Values are significantly different between f.CT and antibiotic ( p < 0.05). CM: clindamycin; MD: metronidazole. Fv : Fannyhessea vaginae ; Gv : Gardnerella vaginalis ; Li : Lactobacillus iners ; Mc : Mobiluncus curtisii ; Pa : Peptostreptococcus anaerobius ; Pb : Prevotella bivia . 5.4 Discussion The vaginal environment hosts a multitude of microbial species in variable quantities and relative proportions, which form a dynamic ecosystem and provide defence against infections (30). In BV, the components of this ecosystem undergo changes, usually being a lactobacilli-dominated microbiota replaced by a polymicrobial microbiota, consisting of strict and facultative anaerobic bacteria. It has been suggested that Gardnerella spp. play a pivotal role, initiating BV biofilm on the vaginal epithelium (1,11,13). It has also been described that F. vaginae is often associated with Gardnerella spp. biofilms during BV and is rarely detected without Gardnerella (11–13). Moreover, recent data indicate that at least in some cases, P. bivia is also detected in women with BV before or at the same time as Gardnerella (20). 100 However, not much is known how, in fact, bacterial species interact and contribute to the formation of the multi-species BV biofilm. An important limitation preventing such relevant studies is the fact that many BV-associated species are currently uncultivable (31–33). It has been previously revealed that bacterial interactions within dual-species BV-biofilms are very specific, with some species enhancing biofilm growth, some reducing it, and others showing no interactions (15,18). These interactions also occur at the molecular level, as observed by up-regulation of key virulence gene expression in Gardnerella spp. (16). Furthermore, in Chapter 4 we found that the triple-species biofilms of G. vaginalis , F. vaginae , and P. bivia resulted in a unique consortium that promoted a relevant shift in the overall bacterial biofilm composition, as compared to dual-species biofilms. As BV is a polymicrobial condition, more complex biofilms need to be characterized, since it is expected that with bigger consortia, interactions might become more complex, with less predictable outcomes. Accordingly, in the present study, we selected G. vaginalis , F. vaginae , and one representative out of four of a third prominent species in BV (32,34) and aimed to understand how the interactions that might occur between these species would impact biofilm formation and antibiotic susceptibility. Furthermore, to better understand the role of G. vaginalis in the process of multi-species biofilm formation during BV, we introduced a new biofilm formation model that does not allow preceding biofilm formation by G. vaginalis . Interestingly, we showed that independently of the model used, (i) all three species in each consortium were able to form triple-species biofilms and (ii) G. vaginalis formed between 50 - 70% of the total number of cells in any of the biofilm conditions tested. These results suggest that, at least in vitro , the role of G. vaginalis in BV multi-species biofilm formation might be more relevant than just as the initial colonizer, as previously proposed (10). It should be taken into consideration that biofilm formation can generally be divided in 3 main stages: initial adhesion, biofilm maturation, and detachment (35). It was previously shown that while many BV-associated species can form a mature biofilm in vitro , they lack the ability to strongly adhere to a HeLa cell line (9), especially if HeLa cells were previously coated with L. crispatus (36,37). Due to technical limitations, namely the effect of bacterial cytotoxicity in cell cultures (36), it is not feasible to incubate 24 h biofilms on human vaginal cell lines. As such, current biofilm formation models fail to address, simultaneously, the ability to displace the resident lactobacilli from the vaginal epithelium (initial adhesion stage) and the ability to grow in clusters of cells (biofilm maturation stage). Despite these limitations, our current work provided further evidence of the pivotal role of G. vaginalis in BV 101 development, not only due to its ability to dominate all tested consortia, but also taken into consideration the antimicrobial susceptibility experiments performed, as discussed next. It has been suggested that interactions between species in biofilms can influence bacterial survival within the biofilm when it is exposed to antimicrobial compounds (38). In an in vitro dual-species biofilm model containing Pseudomonas aeruginosa and Staphylococcus aureus , two major species associated with cystic fibrosis biofilms, it was observed that antimicrobial tolerance in the dual-species biofilms could not be predicted from the single-species susceptibility testing (39). In the current study, the MIC and MLC determinations failed to predict the outcome of the antimicrobial activity on biofilms. For instance, despite most isolates being sensitive, clindamycin was only able to prevent an increase in total biofilm biomass growth. Furthermore, when comparing the triple-species biofilms to G. vaginalis single-species biofilm, we observed evidence of synergistic interactions between the species, which promoted an increased tolerance to antibiotics: while metronidazole significantly reduced the total biomass of G. vaginalis biofilms, it was only able to slightly reduce the total biomass of the triple-species biofilms. In vivo , evidence of bacterial synergism towards antimicrobial increased tolerance has been previously pointed out. Bradshaw and colleagues (40) followed up 139 women with BV that were treated with oral metronidazole and examined at 1, 3, 6, and 12 months, and they concluded that recurrence rates of BV were very high (83%) in women colonized with both Gardnerella spp. and F. vaginae , suggesting that the association between these two bacteria enhanced the tolerance to metronidazole, with direct impact on treatment failure. Swidsinski and colleagues (41) also found high numbers of Gardnerella spp. and F. vaginae present on the vaginal epithelial cells after completion of metronidazole treatment, which led to BV recurrence. Collectively, the evidence from this study points towards the idea that the way bacteria interact in BV together with the way the multi-species BV biofilms are formed can profoundly affect the treatment outcome. Therefore, interventions that could modify or block the synergistic relationships between coinfecting bacteria should be the target of future research. 5.5. References 1. Muzny CA, Taylor CM, Swords WE, Tamhane A, Chattopadhyay D, Cerca N, et al. An updated conceptual model on the pathogenesis of bacterial vaginosis. J Infect Dis. 2019;220(9):1399– 405. 2. Danielsson D, Teigen PK, Moi H. The genital econiche: focus on microbiota and bacterial vaginosis. Ann N Y Acad Sci. 2011 Aug;1230(1):48–58. 108 6.2.5 Analysis of G. vaginalis distribution in multi-species biofilms by CLSM To analyse the distribution of G. vaginalis in the intact structure of the multi-species biofilms, we used CLSM as described in Chapter 4. Briefly, after fixing the intact biofilms, these were first stained with PNA probe Gard162 and DAPI and then analysed by an OlympusTM FluoView FV1000 (Olympus) confocal laser scanning microscope, using a 40× objective and with a resolution of 640 × 640 pixels. The CLSM images were analysed using the FV10-ASW 4.0 Viewer Software (Olympus). All assays were repeated three times with two technical replicates. 6.2.6 EO extracted from T. capitata T. capitata EO was used in this study in order to evaluate its antimicrobial activity against BV-associated species tested herein grown planktonically and as biofilms. The EO was provided by the Chemical Process Engineering and Forest Products Research Centre (CIEPQPF), Faculty of Pharmacy, University of Coimbra. The composition of the tested EO is described in Table 6.1. The EO was stored in glass vials at 4 °C, protected from light. Table 6.1. Composition of the EO extracted from T. capitata . Thymbra capitata EO Composition of the EO (%) Carvacrol α-Terpinene γ-Terpinene Linalool ρ-Cymene A a 75 1.5 5.1 2.0 5.0 a Sample A of the EO extracted from T. capitata . 6.2.7 Determination of the minimal inhibitory concentration (MIC) and minimal lethal concentration (MLC) of T. capitata EO MIC and MLC values of T. capitata EO were determined by broth macrodilution method in glass flasks (McCartney type), as previously performed (15), with some minor modifications. T. capitata EO in a concentration of 5 µL.mL-1 was diluted together with 5 µL.mL-1 of dimethyl-sulfoxide (DMSO, Scharlau, Spain) in 990 µL of NYC III broth. DMSO had the role to improve the solubility of EO in the culture medium. Then, serial dilutions of EO ranging between 2.5 µL.ml-1 and 0.08 µL.ml-1 were prepared in 500 µL of NYC III medium. Bacterial suspensions of 24 h cultures corresponding to each species considered in this study were adjusted to an OD of 0.10 ± 0.05 (Biochrom EZ Read 800 Plus) at 620 nm. Afterwards, 500 µL of the adjusted bacterial suspensions were added into the glass flasks with the prepared EO dilutions resulting a total volume of 1 mL. All glass flasks were incubated for 48 h at 37 °C in anaerobic conditions created by the anaerobic gas generating sachets (Thermo Fisher Scientific), as described 109 above. Negative and positive controls were also included being represented by, respectively, NYC III medium and bacterial suspensions. After incubation, the MICs were evaluated by observing the turbidity, macroscopically, compared to the negative and positive controls. MIC value was defined as the lowest concentration of EO that inhibited visible bacterial growth (absence of turbidity). Moreover, MIC results were confirmed by reading the OD at 620 nm of the tested dilutions. Subsequently, 10 µL from each dilution were inoculated on CBA plates in order to determine the MLC. The CBA plates were further incubated for up to 72 h at 37 °C in anaerobic condition, as aforementioned. MLC value was defined as the lowest concentration of EO that prevented the growth of treated bacteria on agar plates. The MIC and MLC assays were repeated at least three times on separate days. 6.2.8 Effect of T. capitata EO on singleand multi-species biofilm biomass Biofilms were formed in 24-well tissue culture plates as above described and challenged with T. capitata EO in a concentration of 0.63 µL.mL-1 (Table 6.2) for 24 h at 37 ºC under anaerobic conditions, as previously mentioned. Next, the spent medium was carefully removed, and the biofilms biomass were quantified by the CV method. Initial and final controls represented by singleand multi-species biofilms were included in each experimental assay. All assays were repeated at least three independent times with technical duplicates. 6.2.9 Effect of T. capitata EO on cell viability from multi-species biofilms assessed by Live/ Dead staining combined with CLSM LIVE/DEAD® Bac LightTM Bacterial Viability Kit (Thermo Fisher Scientific), consisting of SYTO 9 and propidium iodide, was used to determine the viability of cells from multi-species biofilms exposed to EO. The multi-species biofilms were formed in 24-well culture plates for a period of 24 h, as previously described, and then, challenged with EO (Table 6.2) for 24 h at 37 ºC in anaerobic conditions. At the bottom of each well of the 24-well culture plate, a sterile plastic coverslip with a diameter of 13 mm (Thermo Fisher Scientific™ Nunc™ Thermanox™) was placed. After incubation, the biofilms coating the coverslips were gently washed with 1X PBS and then, the coverslips were removed from the wells and placed on microscope glass slides (VWR). Two types of controls represented by live and dead biofilm cells not treated with EO were considered for this experiment. The dead control was obtained by covering the coverslips with the biofilms with 200 µL of 100% (v/v) methanol (Thermo Fisher Scientific) for 30 min. Then, all the coverslips with the live, dead, and EO treated biofilms were covered with 100 µL of the Live/ Dead staining mix, with SYTO 9 and propidium iodide used each in a concentration of 3 µL.mL-1. 110 Subsequently, the coverslips were incubated for 15 min. in the dark at room temperature. Biofilm image stacks were acquired with an OlympusTM FluoView FV1000 (Olympus) confocal laser scanning microscope, using a 40× objective and a resolution of 640 × 640 pixels. Microscopic visualization was performed using lasers capable of detecting SYTO 9 (Laser 488, excitation wavelength 488 nm, emission wavelength 520 nm, BA505-540) and propidium iodide (Laser 559, excitation wavelength 559 nm, emission wavelength 618 nm, BA575-675). The CLSM images were analysed using the FV10-ASW 4.0 Viewer Software (Olympus). The experiment was performed in duplicate and repeated three times. 6.2.10 Effect of T. capitata EO on cell culturability from singleand multi-species biofilms assessed by CFU counting To determine the culturability of cells from biofilms exposed to EO, we used CFU counting method. The singleand multi-species biofilms were formed in 24-well culture plates as mentioned above and exposed to EO (Table 6.2) for 24 h at 37 °C in anaerobic conditions. After 24 h, the biofilms were gently washed with 1X PBS, disrupted, and resuspended in NYC III. From each obtained biofilm suspension, 100 µL were transferred to a 1.5 mL tube with 900 µL of 0.9% (v/v) NaCl (VWR) and then, 10-fold serial dilutions were performed and plated onto CBA plates to allow CFU counting. The CBA plates were further incubated for up to 72 h at 37 °C in anaerobic condition, as aforementioned. Controls were represented by biofilms not exposed to the EO. At least three independent assays, with technical duplicates, were performed. 6.2.11 Statistical analysis Statistical analysis was performed with GraphPad Prism version 7 (La Jolla). For comparisons among different groups, one-way and two-way ANOVA with multiple comparisons tests were used. A p < 0.05 was considered statistically significant. 6.3 Results 6.3.1. Multi-species biofilms characterization As the multi-species biofilm consortia used in this chapter were not previously described, we first performed a preliminary characterization of the multi-species biofilms and then assess their response to the T. capitata EO. We started by quantifying the biomass of the multi-species biofilms in comparison to the single-species biofilms. We observed that in our in vitro conditions, independent of the incubation time used, the multi-species biofilms presented a significantly higher total biomass than the single-species biofilms, with exception of L. iners grown for 24 h (Figure 6.1A). Interestingly, G. vaginalis was the 111 dominant species in the multi-species biofilms, accounting for up to ~65% of the total number of cells, as determined by PNA FISH (Figure 6.1B), similar to what we found in triple-species biofilms (Chapter 5). CLSM analysis further confirmed the dominance of G. vaginalis in the biofilm structure and revealed that this species was well distributed across the biofilm, in small clusters of cells (Figure 6.1C). Figure 6.1. Characterization of singleand BV multi-species biofilms grown under in vitro conditions. (A) Total biomass of singleand multi-species BV-associated biofilms was determined by staining with CV. Results represent the mean ± standard deviation of at least three independent assays, with two technical replicates assessed each time. (B) Percentage of G. vaginalis cells detected by PNA FISH from 48 h multi-species biofilm. Results are expressed as mean ± standard deviation of three independent assays. (C) Example of data set on the organization of the multi-species BV-associated biofilms by CLSM. a G. vaginalis single-species biofilm labelled with PNA-probe Gard162 (purple colour when combined with DAPI) and DAPI (blue). b CLSM images of z-stacks acquired from multi-species biofilms stained with the probe Gard162 for G. vaginalis (purple colour when combined with DAPI) and DAPI (blue) for other BV-associated species. Statistically significant differences between multispecies and single-species biofilms are represented with * for 24 h incubation time and with τ for 48 h incubation time (oneway ANOVA and Dunnett’s multiple comparisons test, p < 0.05). Fv : Fannyhessea vaginae ; Gv : Gardnerella vaginalis ; Li : Lactobacillus iners ; Mc : Mobiluncus curtisii ; Pa : Peptostreptococcus anaerobius ; Pb : Prevotella bivia . 6.3.2 Susceptibility of BV-associated species planktonic cells to T. capitata EO In vitro antibacterial activity of the EO against each species tested herein was evaluated by determining both MIC and MLC values. As can be seen in Table 6.2, the EO showed a moderate antimicrobial effect against BV-associated bacteria, with slight variations in some cases. Taking into account that for all six 112 species tested, the EO highest MLC value was 0.63 µL.mL-1, this was the concentration further considered for the work performed in this chapter. Table 6.2. Minimal inhibitory concentration (MIC) and minimal lethal concentration (MLC) of T. capitata EO for planktonic cells of BV-associated bacteria. Bacteria MIC (µL.mL-1) MLC (µL.mL-1) a F. vaginae ATCC BAA-55T [0.16 - 0.31] [0.31 - 0.63] G. vaginalis ATCC 14018T 0.31 0.63 L. iners CCUG 28746T 0.31 [0.31 - 0.63] M. curtisii ATCC 35241T [0.16 - 0.31] [0.31 - 0.63] P. anaerobius ATCC 27337T 0.63 0.63 P. bivia ATCC 29303T 0.31 [0.31 - 0.63] a The MLC concentration of 0.63 µL.mL-1 was considered for the work performed in this chapter. 6.3.3 Impact of T. capitata EO on biomass of singleand multi-species biofilms As BV is a biofilm-associated infection, we further sought to determine whether EO at MLC concentration (0.63 µL.mL-1) could have an impact on the total biomass of in vitro BV-associated biofilms, assessing first the effect of EO on biomass of single-species biofilms. We observed that for all tested species, the reduction of the total biomass of the single-species biofilms was significantly elevated, with exception of P. bivia and M. curtisii , for which it was not possible to determine the EO effect due to a very low amount of biofilm biomass formed under these conditions (Figure 6.2). Additionally, our results revealed that the EO at MLC concentration had a significant reduction effect on the total biomass of the multi-species biofilms, however only when compared to the corresponding multi-species biofilm controls. 6.3.4 T. capitata EO effect on cell viability from multi-species biofilms assessed by Live/ Dead staining Despite T. capitata EO strong ability to reduce most single-species biofilms biomass, a significant amount of biomass remained in the multi-species biofilms. To better address this phenomena, multi-species biofilms were observed with CLSM using Live/ Dead staining method. As can be observed in Figure 6.3, while the most of the remaining cells (after EO challenge) within the multi-species biofilms showed some level of cell wall damage (as noted by the yellow or orange colour), there were still some totally viable cells (as noted by the green colour), especially in the lower layers of the biofilm. 113 Figure 6.2. Effect of T. capitata EO on biomass of singleand multi-species biofilms of BV-associated bacteria. Biofilm biomass was quantified using the CV staining assay. i.CT stands for initial control, before the medium replacement; f.CT stands for final control, after incubation with fresh medium. Results represent the mean ± standard deviation of at least three independent assays. Values are significantly different for * i.CT versus f.CT, τ i.CT versus EO, and γ f.CT versus EO (two-way ANOVA and Tukey’s multiple comparisons test, p < 0.05). Fv : Fannyhessea vaginae ; Gv : Gardnerella vaginalis ; Li : Lactobacillus iners ; Mc : Mobiluncus curtisii ; Pa : Peptostreptococcus anaerobius ; Pb : Prevotella bivia . Figure 6.3. Effect of T. capitata EO on multi-species biofilms assessed by Live/ Dead staining. (A) 48 h multi-species biofilm without EO treatment with viable cells visualized in fluorescent green. (B) 48 h multi-species biofilm without EO treatment with dead cells appearing in red/ orange. (C) Multi-species biofilm exposed to EO at 0.63 µL.mL-1 for 24 h. Example of two sets (C.1 and C.2) of z-stack CLSM images acquired with a 40× objective in different biofilm regions. 114 6.3.5 T. capitata EO influence on cell culturability from singleand multi-species biofilms As we showed that multi-species biofilms exposed to the T. capitata EO still contained viable cells, we decided to also quantify bacterial culturability after EO challenge. Interestingly, both on singleand multispecies biofilms, the EO had the ability to reduce in 100% cell culturability (Figure 6.4). Figure 6.4. Effect of T. capitata EO on cell culturability from singleand multi-species biofilms of BV-associated bacteria. The effect of EO on cell culturability was determined by performing CFU. i.CT stands for initial control, before the medium replacement; f.CT stands for final control, after incubation with fresh medium. Results represent the mean ± standard deviation of at least three independent assays. Statistical analysis was performed using two-way ANOVA and Tukey’s multiple comparisons test. Values are significantly different for * i.CT versus f.CT, τ i.CT versus EO, and γ f.CT versus EO ( p < 0.05). Fv : Fannyhessea vaginae ; Gv : Gardnerella vaginalis ; Li : Lactobacillus iners ; Mc : Mobiluncus curtisii ; Pa : Peptostreptococcus anaerobius ; Pb : Prevotella bivia . 6.4 Discussion In spite of the fact that existing antibiotics against BV are somewhat effective, management of this infection continue to be challenging (16,17). The polymicrobial BV biofilm is considered one of the major factors responsible for the treatment failure since it becomes metabolically inactive upon treatment, leading to decreased susceptibility to antibiotics, and this may be further contributing to high BV recurrence rates (18). As described in Chapter 2, some alternative approaches to existing antibiotics are being studied against BV, showing promising results (19–21). One of these therapies emerges from plant-derived compounds, namely T. capitata EO. As this EO previously showed a potent antibacterial activity against Gardnerella spp. growing in planktonic cultures and in biofilms (13), in this chapter, we aimed to assess its effect on other BV-associated species also grown planktonically and as biofilms. Furthermore, in order to 115 understand if bacterial interactions in BV polymicrobial biofilms would influence the EO effect, we used herein a multi-species biofilm consisting of six BV-associated species and tested the EO against it. As such, we first performed a preliminary characterization of the multi-species biofilms since these were not previously described. Interestingly, we found that independent of the incubation time (i) the multispecies biofilms showed a considerably higher biofilm biomass than the single-species biofilms, with only one exception, and (ii) G. vaginalis was the predominant species in the multi-species biofilms, similar to what has been described for dualand triple-species biofilms (Chapter 4 and Chapter 5). Unfortunately, since no PNA FISH probes exist for most of the other species, we could not differentiate the relative composition of all species using this experimental technique. While there are other alternative techniques for bacterial discrimination (22–24), due to time limitations, those experiments could not be performed. Thus, while all six species were inoculated in the biofilm, we cannot claim that after the 24 h and 48 h incubation period, all six species were present. Indeed, cumulating evidence from experimental and metabolic model-based studies demonstrated that often microorganisms compete for limited resources, such as space and nutrients (25–27). However, cooperation between certain species in the community are still present, leading to enhanced biomass production (28,29), access to complex nutrient sources (30) or stress resistance (31,32). Therefore, in the future, we need to experimentally determine if all six species were present at the end of the incubation period. As shown in Chapter 5, interactions between the species in some triple-species biofilm consortia promoted an increased tolerance to antibiotics, and, as such, we hypothesized that a similar effect could happen in the present study. Indeed, T. capitata EO at 0.63 µL.mL-1 was effective in reducing most biomass of single-species biofilms, but lost some efficiency when applied in multi-species biofilms, which further demonstrates synergisms between BV-associated species that enhance tolerance to antimicrobial agents. A similar effect has been demonstrated for other multi-species bacterial biofilms after exposure to various antibacterial agents (29,32). It is acknowledged that CV staining method used in this study for biofilm quantification is an easy and fast-performing procedure to analyse bacterial biofilm formation ability (33). However, as it stains the extracellular matrix and all cells, including the dead ones, CV staining does not give a measure of biofilm cells viability and therefore, other methods must be used to evaluate the EO antimicrobial effect on multispecies BV biofilms (34). Consequently, we further aimed to reveal if there are still viable cells, using the Live/ Dead staining method combined with CLSM, in particular in the multi-species biofilms, which had a higher amount of total biomass after EO challenge. The Live/ Dead kit consists of a mixture of two 116 stains, SYTO 9 and propidium iodide, which differ both in their spectral characteristics and in their ability to penetrate bacterial cells. While, when both dyes are used, SYTO 9 labels bacteria with intact cell membranes which then become fluorescent green, propidium iodide penetrates only bacteria with damaged membranes, staining them in fluorescent red/ yellow-orange (35). According to this method, we noticed that in our tested conditions, the EO affected the multi-species biofilms in a relative different way: while upper biofilm layers had regions with a high number of damaged cells, the bottom layers still presented some regions with viable cells. These results might explain the high recurrence rates of BV after the antimicrobial treatment. It is acknowledged that the biofilm can serve as a protective barrier, and its thickness and chemical composition can limit the perfusion and/ or activity of antimicrobial compounds (36). This specific feature may lead to the protection of a minor fraction of cells which, in most cases, will be further able to reinitiate the biofilm formation, and as such, contribute to recurrent infections. The presence of viable cells in the biofilms challenged with EO led us to perform the CFU counting method in order to assess bacterial culturability. Curiously, the EO inhibited in 100% the culturability of biofilm cells, being thought that perhaps the viable cells noticed with the CLSM were cells in a viable but nonculturable (VBNC) state, as has been demonstrated for other bacterial biofilms after antibiotic exposure (37). It is believed that VBNC cells are cells in a stage preceding cell death or adaptation to stress (38), but can eventually recover and initiate cell division (38). Taken together, our data suggest that the relationships among co-infecting bacteria present in the vaginal environment during BV can impact the treatment outcome. Our results also show that T. capitata EO may represent a potent agent against BV biofilm. However, further investigations are required to determine if the EO would maintain the antimicrobial activity in vivo . In this sense, an ex vivo vaginal mucosa model would be an adequate approach to assess that. 6.5 References 1. Jung H-S, Ehlers MM, Lombaard H, Redelinghuys MJ, Kock MM. Etiology of bacterial vaginosis and polymicrobial biofilm formation. Crit Rev Microbiol. 2017;43(6):651–67. 2. Alves P, Castro J, Sousa C, Cereija TB, Cerca N. Gardnerella vaginalis outcompetes 29 other bacterial species isolated from patients with bacterial vaginosis, using in an in vitro biofilm formation model. J Infect Dis. 2014;210(4):593–6. 3. Machado D, Castro J, Palmeira-de-Oliveira A, Martinez-de-Oliveira J, Cerca N. Bacterial vaginosis biofilms: Challenges to current therapies and emerging solutions. Front Microbiol. 2016;6:1528. 117 4. Falconi‐McCahill A. Bacterial vaginosis: a clinical update with a focus on complementary and alternative therapies. J Midwifery Womens Health. 2019;64(5):578–91. 5. Palmeira-de-Oliveira A, Silva BM, Palmeira-de-Oliveira R, Martinez-deOliveira J, Salgueiro L. Are plant extracts a potential therapeutic approach for genital infections? Curr Med chem. 2013;20:2914–28. 6. Bakkali F, Averbeck S, Averbeck D, Idaomar M. Biological effects of essential oils - A review. Food Chem Toxicol. 2008;46(2):446–75. 7. Hammer KA, Carson CF, Rileya T V. Effects of Melaleuca alternifolia (tea tree) essential oil and the major monoterpene component terpinen-4-ol on the development of singleand multistep antibiotic resistance and antimicrobial susceptibility. Antimicrob Agents Chemother. 2012;56(2):909–15. 8. Proença-da-Cunha A, Ribeiro JA, Roque OR. Plantas aromáticas em Portugal – Caracterização e utilizações. Fundação Calouste Gulbenkian, Lisboa, Portugal. 2014. 228–230 p. 9. Figueiredo A, Barroso J, Pedro L, Salgueiro L, Miguel M, Faleiro M. Portuguese Thymbra and Thymus species volatiles: Chemical composition and biological activities. Curr Pharm Des. 2008;14(29):3120–40. 10. Palmeira-De-Oliveira A, Gaspar C, Palmeira-De-Oliveira R, Silva-Dias A, Salgueiro L, Cavaleiro C, et al. The antiCandida activity of Thymbra capitata essential oil: Effect upon pre-formed biofilm. J Ethnopharmacol. 2012;140(2):379–83. 11. Faleiro L, Miguel G, Gomes S, Costa L, Venâncio F, Teixeira A, et al. Antibacterial and antioxidant activities of essential oils isolated from Thymbra capitata L. (Cav.) and Origanum vulgare L. J Agric Food Chem. 2005;53(21):8162–8. 12. Salgueiro LR, Pinto E, Gonçalves MJ, Pina-Vaz C, Cavaleiro C, Rodrigues AG, et al. Chemical composition and antifungal activity of the essential oil of Thymbra capitata . Planta Med. 2004;70(6):572–5. 13. Machado D, Gaspar C, Palmeira-de-Oliveira A, Cavaleiro C, Salgueiro L, Martinez-de-Oliveira J, et al. Thymbra capitata essential oil as potential therapeutic agent against Gardnerella vaginalis biofilm-related infections. Future Microbiol. 2017;12(5):407–16. 14. Rasband W. ImageJ Software. Bethesda, MD: National Institutes of Health. 1997. https://imagej.nih.gov/ij/. 15. Wiegand I, Hilpert K, Hancock REW. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 2008;3(2):163–75. 16. Muzny CA, Kardas P. A narrative review of current challenges in the diagnosis and management of bacterial vaginosis. Sex Transm Dis. 2020;47(7):441–6. 17. Bilardi J, Walker S, McNair R, Mooney-Somers J, Temple-Smith M, Bellhouse C, et al. Women’s management of recurrent bacterial vaginosis and experiences of clinical care: a qualitative study. PLoS One. 2016;11(3):e0151794. 18. Swidsinski A, Mendling W, Loening-Baucke V, Swidsinski S, Dörffel Y, Scholze J, et al. An adherent Gardnerella vaginalis biofilm persists on the vaginal epithelium after standard therapy with oral metronidazole. Am J Obstet Gynecol. 2008;198(1):1–6. 19. Sherrard J, Wilson J, Donders G, Mendling W, Jensen JS. 2018 European (IUSTI/WHO) International Union against sexually transmitted infections (IUSTI) World Health Organisation (WHO) guideline on the management of vaginal discharge. Int J STD AIDS. 2018 Nov 124 in order to assess the possible differences between them in terms of bacterial interactions with the other BV-associated species and role in multi-species biofilm formation, compared to G. vaginalis . Lastly, to confirm the findings from this study as well as to perform future work, an ex vivo vaginal model should be used, such as porcine vaginal mucosa (17), which could allow a closer imitation of in vivo conditions. 7.4 References 1. Swidsinski A, Mendling W, Loening-Baucke V, Ladhoff A, Swidsinski S, Hale LP, et al. Adherent biofilms in bacterial vaginosis. Obstet Gynecol. 2005;106(5 Pt 1):1013–23. 2. Muzny CA, Taylor CM, Swords WE, Tamhane A, Chattopadhyay D, Cerca N, et al. An updated conceptual model on the pathogenesis of bacterial vaginosis. J Infect Dis. 2019;220(9):1399– 405. 3. Hardy L, Jespers V, Dahchour N, Mwambarangwe L, Musengamana V, Vaneechoutte M, et al. Unravelling the bacterial vaginosis-associated biofilm: a multiplex Gardnerella vaginalis and Atopobium vaginae fluorescence in situ hybridization assay using peptide nucleic acid probes. PLoS One. 2015;10(8):e0136658. 4. Machado D, Gaspar C, Palmeira-de-Oliveira A, Cavaleiro C, Salgueiro L, Martinez-de-Oliveira J, et al. Thymbra capitata essential oil as potential therapeutic agent against Gardnerella vaginalis biofilm-related infections. Future Microbiol. 2017;12(5):407–16. 5. Fredricks DN, Fiedler TL, Marrazzo JM. Molecular identification of bacteria associated with bacterial vaginosis. N Engl J Med. 2005;353(18):1899–911. 6. Fredricks DN, Fiedler TL, Thomas KK, Oakley BB, Marrazzo JM. Targeted PCR for detection of vaginal bacteria associated with bacterial vaginosis. J Clin Microbiol. 2007;45(10):3270–6. 7. Srinivasan S, Hoffman NG, Morgan MT, Matsen FA, Fiedler TL, Hall RW, et al. Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria. PLoS One. 2012;7(6):e37818. 8. Castro J, Alves P, Sousa C, Cereija T, França Â, Jefferson KK, et al. Using an in-vitro biofilm model to assess the virulence potential of bacterial vaginosis or non-bacterial vaginosis Gardnerella vaginalis isolates. Sci Rep. 2015;5(November 2014):11640. 9. Peeters E, Nelis HJ, Coenye T. Comparison of multiple methods for quantification of microbial biofilms grown in microtiter plates. J Microbiol Methods. 2008;72(2):157–65. 10. Haney EF, Trimble MJ, Cheng JT, Vallé Q, Hancock REW. Critical assessment of methods to quantify biofilm growth and evaluate antibiofilm activity of host defence peptides. Biomolecules. 2018;8(2):1–22. 11. Flemming H, Wingender J. The biofilm matrix. Nat Rev Microbiol. 2010;8(9):623–33. 12. Castro J, Machado D, Cerca N. Unveiling the role of Gardnerella vaginalis in polymicrobial bacterial vaginosis biofilms: the impact of other vaginal pathogens living as neighbors. ISME J. 2019;13(5):1306–17. 13. Kommerein N, Doll K, Stumpp NS, Stiesch M. Development and characterization of an oral multispecies biofilm implant flow chamber model. PLoS One. 2018;13(5):1–15. 125 14. Kommerein N, Stumpp SN, Musken M, Ehlert N, Winkel A, Haussler S, et al. An oral multispecies biofilm model for high content screening applications. PLoS One. 2017;12(3):1–21. 15. An JS, Kim K, Cho S, Lim BS, Ahn SJ. Compositional differences in multi-species biofilms formed on various orthodontic adhesives. Eur J Orthod. 2017;39(5):528–33. 16. Vaneechoutte M, Guschin A, Van Simaey L, Gansemans Y, Van Nieuwerburgh F, Cools P. Emended description of Gardnerella vaginalis and description of Gardnerella leopoldii sp. nov., Gardnerella piotii sp. nov. and Gardnerella swidsinskii sp. nov., with delineation of 13 genomic species within the genus Gardnerella . Int J Syst Evol Microbiol. 2019;69(3):679–87. 17. Breshears LM, Edwards VL, Ravel J, Peterson ML. Lactobacillus crispatus inhibits growth of Gardnerella vaginalis and Neisseria gonorrhoeae on a porcine vaginal mucosa model. BMC Microbiol. 2015;15(1):276.