Full text
J Physiol 0.0 (2025) pp 1–20 1 The Journal of Physiology Unveiling protective mechanisms of wild olive (acebuche) oil in retinal pigment epithelial cells with hypertensive phenotype Álvaro Santana-Garrido1,2,3 , Claudia Reyes-Goya1,2 , Pablo Espinosa-Martín1, Rosa M. Troya-Toledo1, Helder André3,AlfonsoMate 1,2 and Carmen M. Vázquez1,2,3 1Departamento de Fisiología, Facultad de Farmacia, Universidad de Sevilla, Sevilla, Spain 2Epidemiología Clínica y Riesgo Cardiovascular, Instituto de Biomedicina de Sevilla (IBIS), Hospital Universitario Virgen del Rocío/Consejo Superior deInvestigacionesCientíficas/UniversidaddeSevilla,Sevilla,Spain 3Department of Clinical Neuroscience, St. Erik Eye Hospital, Karolinska Institutet, Stockholm, Sweden Handling Editors: Kim Barrett & Luis Sobrevia The peer review history is available in the Supporting Information section of this article (https://doi.org/10.1113/JP287367#support-information-section). Abstract figure legend Circulating extracellular vesicles (EVs) derived from acebuche (ACE) oiland extra virgin olive oil (EVOO)-fed mice modulate nitric oxide (NO) metabolism in the retinal pigment epithelial cell line (ARPE19) with a hypertensive phenotype induced by angiotensin II (AngII). These EVs regulate the production of reactive oxygen species (ROS) via NADPH oxidase and mitochondria, influence the activity and expression of l-arginine (l-Arg) transporter CAT-1 and arginase, modulate AngII receptors (AT1R, AT2R), and affect the levels of NO and asymmetric dimethylarginine (ADMA). Solid lines represent direct actions, while dashed lines indicate indirect actions. © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. DOI: 10.1113/JP287367 This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.
2 Á. Santana-Garrido J Physiol 0.0 Abstract Arterial hypertension leads to oxidative and inflammatory imbalances, triggering hypertensiveorgandamagethroughseveralpathways.Wehavepreviouslydescribedtheantioxidantand anti-inflammatory properties of olive oil extracted from the wild olive tree (Olea europaea var. sylvestris, acebuche, ACE) against hypertensive ocular damage. The aim of this study was to clarify the molecular mechanisms involved in the beneficial effect of ACE oil on hypertensive eyes, focusing on nitric oxide (NO)/arginine metabolism. To this end, we used retinal pigment epithelial cells (ARPE19) treated with angiotensin II as a hypertensive-like model. These cells were also incubated with extracellular vesicles (EVs) isolated from animals fed diets enriched in either ACE oil or extra virginoliveoil(EVOO),withthelatterservingasareferenceoilforcomparison.Ourresultsshowed that circulating ACE oiland EVOO-derived EVs can modulate the production of reactive oxygen species by both NADPH oxidase and mitochondria, the activity and expression of l-arginine transporter CAT-1, angiotensin AT1 and AT2 receptors, and arginases, as well as the levels of NO and asymmetric dimethylarginine. Our findings demonstrate that: (1) changes in NO metabolism are involved in the protective effects of wild olive oil against hypertension-related ocular oxidative stress, and(2)thesemodificationsappeartobemediatedbyEVs. (Received 24 July 2024; accepted after revision 7 February 2025; first published online 25 February 2025) Corresponding authors Alfonso Mate and Carmen M. Vázquez: Departamento de Fisiología, Facultad de Farmacia, Universidad de Sevilla, CL Profesor García González 2, E-41012 Sevilla, Spain. Email: ma[email protected] and [email protected] Key points rl-Argininetransportcontributes tothe beneficial effect ofwildolive oil onthe eyes ofhypertensive mice. rExtravesicular vesicles from wild olive oil (ACE-EVs) prevent changes in nitric oxide (metabolism in hypertensive-like retinal pigment epithelial cells. rReactive oxygen species produced by both NADPH oxidase and mitochondria can be mitigated by ACE-EV treatment. Introduction Oxidative stress is characterized by the excessive production of reactive oxygen species (ROS) and an imbalance in the oxidation–reduction (redox) state (Ghezzi et al., 2017). It is well known that oxidative stress and inflammation are two interrelated biological processes implicated in pathological conditions. The vicious cycle between them enhances ROS production, the release of inflammatory cytokines and dysregulation of nitric oxide (NO) metabolism, leading to vascular damage, among other effects (Guzik & Touyz, 2017). Increasing evidence indicates that oxidative damage is the 0Álvaro Santana-Garrido graduated in Pharmacy and Optics-Optometry in 2017 and earned a master’s degree in Physiology and Neuroscience in 2018, both from the University of Seville, Spain. In 2023, he completed his PhD in the Physiology department at the University of Seville, where his research yielded promising findings on the retinoprotective potential of ‘acebuchina’ (wild olive) oil as a nutraceutical agent in arterial hypertension. He also participated in developing an ophthalmic formulation of this oil in the form of nanoemulsions. Since early 2024, he has been a postdoctoral researcher in vision sciences at the Karolinska Institutet (Sweden), supported by a postdoctoral grant from the Alfonso Martín Escudero Foundation. underlying pathological process of many prevalent ocular diseases, including age-related macular degeneration (AMD) (Fleckenstein et al., 2021), glaucoma (Fan Gaskin et al., 2021) and diabetic retinopathy (DR) (Kang & Yang, 2020). However, more studies are needed to clarify the molecular pathways involved in this regard. Arterial hypertension is a risk factor for several vision-threatening eye conditions (Del Pinto et al., 2022; Katsi et al., 2012). Previous reports have described its harmfuleffectsonthehumaneye,especiallytheretina (Fraser-Bell et al., 2017), probably due to the eye’s highly vascularized nature. Recent findings in rodents suggest thattheNADPHoxidaseenzymeistheprimarysource © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
J Physiol 0.0 Extracellular vesicles convey eye protection exerted by wild olive oil 3 of ROS production in hypertensive eyes, with isoforms NOX1, 2 and 4 being overexpressed (Santana-Garrido et al., 2021a, 2022). Additionally, there is a growing trend to link mitochondrial dysfunction with various retinopathies, including AMD and DR (Sun et al., 2024), highlightingtheimportanceofunderstandingitsrolein ROS production in the eye. Angiotensin II (AngII), the main bioactive peptide of the renin–angiotensin system (RAS), plays a crucial role in regulating vascular function and structure via two receptors: AT1R, which induces vasoconstriction, elevates blood pressure and promotes renal tubular sodiumreabsorption (Szczepanska-Sadowskaetal.,2018); andAT2R,whichcounteractsAT1R’seffects(Patel et al., 2020). AngII activates NADPH oxidase (NOX), leading to oxidative stress and inflammation in various cells. Additionally, NOX-derived ROS modulate AngII receptors, especially by activating AT1R (Abdel Ghafar, 2020). For this reason, AngII has traditionally been used to study molecular pathways related to hypertension (Blanca et al., 2017; Lerman et al., 2019). In the eye, the RAS plays an important role in retinal homeostasis by regulating the diameter of retinal vessels, glial function and the activity of retinal neurons (Fletcher et al., 2010), andisinvolvedinvisualdiseasessuchashypertensive and diabetic retinopathies and AMD (Nagai et al., 2020; Reichhart et al., 2016; Tonade & Kern, 2021). Extracellular vesicles (EVs) are membranous sacs that regulate physiological processes due to their cargo, which is rich in bioactive molecules such as proteins, lipids, mRNA and non-coding RNAs (e.g. microRNA, miRNA) (Buzas, 2023). Their potential role in regulating cell-to-cell communication has made EVs emerge as biomarkers, targets and therapeutic tools for various diseases (Zhang et al., 2023), including those associated with oxidative stress (Chiaradia et al., 2021). Although the physiological role of EVs in the eye is not yet fully understood, it has been suggested that EVs mediate mechanisms in several eye conditions (Rudraprasad et al., 2022; van derMerwe & Steketee,2017),andpreliminarystudieshave demonstrated the beneficial effects of their administration in improving ocular diseases (Moisseiev et al., 2017; Samaeekia et al., 2018). Extra virgin olive oil (EVOO), a liquid fat derived from pressing whole olives of the cultivated olive tree (Olea europaea var. europaea), is widely consumed for its renowned health benefits. In addition to these well-established properties, wild olive (acebuche, ACE) oil,auniquetypeofEVOOextractedfromprimitive Spanish olive tree lineages (Olea europaea var. sylvestris), has demonstrated notable antioxidant, anti-inflammatory and anti-fibrotic effects on the retina, along with systemic and ocular anti-hypertensive properties, in hypertensive (Santana-Garrido et al., 2020, 2021b; Santana-Garrido et al., 2024) and glaucoma mouse models (Lucchesi et al., 2024). These effects have been attributed to the minor bioactive compounds of ACE oil, which is rich in tocopherols, triterpene acids and polyphenols (Santana-Garrido et al., 2020). Their properties through the modulation of oxidative stress-related pathways such as the NOX system or NO metabolism have been observed in the retina, although there are still many uncertainties about how ACE oil can modulate retinal cell physiology. The present study aimed to evaluate the mechanism involved in the beneficial effects of ACE oil on hypertensive eyes, focusing on NO metabolism. To conduct these experiments, EVs isolated from the plasma of mice fed with ACE oilor EVOO-enriched diets were used, with the latter serving as a comparison. The activity and expression of the l-arginine (l-Arg) transporter CAT-1, NOXs and arginases were assayed in AngII-treated, hypertensive-like retinal pigment epithelium cells (ARPE19), along with the expression of AngII receptors (AT1R and AT2R). Mitochondrial ROS, NO and asymmetric dimethylarginine (ADMA) levels were also evaluated in ARPE19 cells incubated with ACE oilor EVOO-derived EVs, where appropriate. Methods Ethical approval All procedures were conducted in compliance with the European Union (EU) Directive 2010/63/EU and theNationalGuidelinesfortheCareandUseof Laboratory Animals (RD 53/2013). The protocol was reviewed and approved by the Institutional Animal Care and Use Committee, with approval reference 02/08/2023/65, issued by the Junta de Andalucía, Dirección General de la Producción Agrícola y Ganadera. The investigators also adhered to the ethical principles for animal research as outlined by the journal (accesible at https://doi.org/10.1113/JP286666). Male C57B/6J mice, aged 10–12 weeks and obtained from the Centre for Animal Production and Experimentation at the University of Seville (Spain), were used to isolate circulating plasma EVs, as described below. All animals were housed under standard conditions in a controlled environment (23 ±1°C, 12 h light/dark cycles). Blood samples were collected via cardiac puncture under anaesthesia (75 mg/kg ketamine and 10 mg/kg diazepam, administered intraperitoneally). Following blood collection, the mice were euthanized immediately by cervical dislocation, excluding its use for future experiments. Isolation of circulating EVs EVswereobtainedfromhealthyanimals(n=20 per group)fedeitherastandarddiet(controlEVs),oradiet © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
4 Á. Santana-Garrido J Physiol 0.0 supplemented with 12% (w/w) ACE oil (ACE EVs), or 12% (w/w) EVOO (EVOO EVs) for 6 weeks, as previously established by our group (Santana-Garrido et al., 2020, 2021b) and according to the technique described by Burger et al. (2011). Briefly, blood was collected in tubes containing 0.129 M buffered citrate as an anticoagulant. The blood was then centrifuged at 2500 gfor 15 min at 20°C to obtain platelet-poor plasma (PPP). This was further centrifuged under the same conditions to obtain platelet-free plasma (PFP) containing the circulating EVs (Vila-liante et al., 2016). PFP was frozen in liquid N2 and stored at −80°C until use. EVs were obtained after three consecutive centrifugations of the PFP at 17,000 g for 30 min at 20°C, with 1×phosphate buffer (PBS, Sigma-Aldrich, Madrid, Spain, P4417) washes between each step. Pooling of blood samples, PPP, PFP or EVs from different animals within the same experimental group was not performed in subsequent experiments. Consequently, a single EV sample was obtained from each animal at the end of the isolation process. EVs were resuspended in sterile PBS with DNase/RNase-free water for immediate use, and aliquots were separated for protein determination using the Bradford method (Bradford, 1976). Cell culture and treatments Spontaneously arising human retinal pigment epithelial (ARPE19) cells were purchased from ATCC® (CRL-2302TM, Manassas, VA, USA, RRID:CVCL_0145). Cultures were grown in 1×DMEM/F12 Medium (ATCC 30-2006) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin antibiotics (ThermoFisher Scientific Inc., Waltham, MA, USA). When the monolayer became confluent, cells were incubated with 100–0.1 μM AngII (AngII group) with or without concomitant incubation with plasma EVs (equivalent to 65–500 μg protein/mL) obtained as described above. Unless otherwise indicated, further experiments were performed using a 24 h incubation period with 10 μM AngII and, where appropriate, 130 μg protein/mL of either control EVs (Ang+CT EVs group), ACE EVs (Ang+ACE EVs group) or EVOO EVs (Ang+EVOO EVs group). MTT assay The thiazolyl blue tetrazolium bromide (MTT; Biochemica, PanReac Applichem, Barcelona, Spain, A2231) colorimetry assay was used to determine cell viability after the treatments. Cells were seeded in 96-well plates and, after the treatments, were washed with 1× PBS and then incubated with MTT for 4 h. Dimethyl sulphoxide (DMSO) was then added to each well, and the absorbance was measured at 550 nm using a microplate reader (SynergyTM HT, BioTek®Instruments, Vinooski, VT, USA). Intracellular ROS measurement After the cell culture treatments, intracellular ROS levels were measured in ARPE19 using the 2,7-dichlorodihydrofluorescein diacetate (DCFHDA, ThermoFisher, InvitrogenTM, D399) assay. In brief, DCFHDA is freely permeable to cells, where it is de-esterified to its ionized free acid (DCFH) thatreactswithROStoformthefluorescentdye 2,7-dichlorofluorescein (DCF). The protocol involved incubating confluent ARPE19 cells with 10 μM DCFHDA at 37°C for 30 min. DCF was measured using a fluorescence plate reader (SynergyTM HT, BioTek® Instruments) with excitation/emission at 490 nm and 530 nm, respectively. Representative fluorescent images were taken with a Nikon Eclipse Ti-E microscope using the same acquisition time and conditions. A positive control of 40 μM H2O2was included to confirm specificity in ROS production. L-Arginine transport Theuptakeof12.5μMl-arginine(l-Arg,3μCi/mL l-[3H]-arginine; PerkinElmer, NET112350UC, Waltham, MA, USA) was measured after a 1 min incubation at 37°C in Krebs solution (NaCl 118.5 mM, KCl 4.7 mM, NaHCO3 25 mM, CaCl22.5 mM, KH2PO41.2 mM, MgSO41.2 mM, d-glucose 5.5 mM, pH 7.4) following ARPE19 treatments, based on a previously described protocol (Salsoso et al., 2021). The initial uptake rates (Vi) were calculated from the slope of the linear phase of 12.5 μM l-Arg overall uptake, fitted to a one-phase exponential association equation using a least-square approach: Vi=Vm·(1 −e−k.t) where Viis the initial velocity, Vmis maximum velocity at a given time (t) and l-Arg concentration, eis the base of the natural logarithm and kis a rate constant. The overall transport of l-Arg across the 0–1000 μM concentration range comprised a saturable component and a non-saturable, linear component (referred to as KD). KDwas defined as m·[l-Arg],wheremis theslopeofthelinearphaseoftransportatagiven l-Arg concentration ([l-Arg]). The saturable transport of l-Arg was determined by subtracting the m·[l-Arg] components from the overall transport, as described by Salsoso et al. (2015). The kinetic parameters for saturable l-Arg transport, including the maximal velocity (Vmax) andtheapparent Michaelis–Mentenconstant(Km), © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
J Physiol 0.0 Extracellular vesicles convey eye protection exerted by wild olive oil 5 were determined by fitting the data to the classical Michaelis–Menten equation: V=Vmax ∗L−Arg Km +L−Arg where Vrepresents the total rate of uptake and [l-Arg] denotes the substrate concentration of l-Arg. l-Arg transportwasstoppedwithice-coldKrebssolution,andthe radioactivity was measured in formic acid cell digests using a liquid scintillation counter (QuantaSmartTM, PerkinElmer). The protein content of each sample was measured by the Bradford method (Bradford, 1976). Each transport assay was performed in triplicate, with transport activity expressed as pmol/μg protein/min. Determination of NADPH oxidase activity NADPH oxidase activity was evaluated using a lucigenin-enhanced chemiluminescence (CL) assay in cell homogenates. Cell lysates were homogenized in sucrose buffer (sucrose 150 mM, EGTA 1 mM, KH2PO450 mM) containing a protease inhibitor cocktail. Reactions were initiated by adding lucigenin (5 μM) to luminescence test tubes containing NADPH (0.1 mM) and samples [equivalent to 25 μg of protein homogenates, previously measured by the Bradford method (Bradford, 1976)] in afinalvolumeof300μL.CLintensitywasquantifiedat 4 min and reported in relative arbitrary units using a CL reader (Junior LB9509, Berthold, Germany). Results were expressed as percentages of the control group after subtracting a buffer blank from each reading. Responses to AngII were measured in the absence or presence of NOX1/4 inhibitor GKT136901 (0.1 μM; Sigma-Aldrich, 5.34032), specific NOX1 inhibitor ML171 (0.5 μM; Sigma-Aldrich, 492002) and the pan-NADPH oxidase inhibitor VAS2870 (10 μM; Sigma-Aldrich, SML0273). Additionally, 0.1 mM diphenyleneiodonium (DPI, inhibitor of flavoproteins; Sigma-Aldrich, 300260) and rotenone (ROT, mitochondrial electron transport chain inhibitor; Sigma-Aldrich, 557368) were used to confirmthesourceofsuperoxideanion(O 2·−). Mitochondria-associated ROS measurements Mitochondrial ROS were assessed by MitoSOXTM red (M36008; Invitrogen, ThermoFisher Scientific) staining following the manufacturer’s instructions. Briefly, cells wereincubatedwith5μMMitoSOX TM dissolved in DMEM/F12 medium for 10 min at 37°C, protected from light. After washing three times with 1×PBS, a drop of DAPI Fluoromount-G®(DAPI, Southern Biotech, Birmingham, AL, USA; Art. 0100-20) was added per well to counterstain the nuclei. Pictures were taken with the same acquisition settings in parallel images from the different experimental groups using an Olympus DP73 fluorescence microscope (Tokyo, Japan). The ratio of MitoSOX/DAPI staining was measured using ImageJ-NIH freeware (v.2.0.0, RRID:SCR_003070). Arginase activity Arginase activitywasmeasuredincellculturelysates using the human arginase activity assay kit from Sigma-Aldrich (MAK112). The enzyme catalyses the conversion of l-Arg to urea and ornithine, the former reacting with a dye to generate a coloured product proportional to the arginase activity present. One unit of arginase is defined as the amountoftheenzymethatconverts1μmoll-Argto ornithine and urea per minute, as per the manufacturer’s instructions. Absorbance was read using a Synergy H1 microplate reader. Intracellular NO determination IntracellularNOwasdeterminedusingthefluorescentdye DAF-FM (Invitrogen, Madrid, Spain, D-23841) following the manufacturer’s protocol. Confluent cells grown on 9.6 cm2culture plates were incubated with AngII/EVs as detailed above and exposed to 10 μM DAF-FM (30 min, 37°C). Cells were then incubated in 1×PBS (30 min, 37°C) to complete de-esterification of the intracellular diacetates. Fluorescence (λexc/λem: 495/515 nm) was measured in a Synergy H1 microplate reader (Biotek). ADMA concentration measurement The concentration of ADMA was measured in cell culture supernatants using a Human Asymmetric dimethylarginine ELISA Kit (MBS264847, MyBioSource, Vancouver, Canada), following the manufacturer’s instructions with slight modifications. Absorbance readings were made using a Synergy H1 microplate reader. Real-time PCR Total RNA was isolated and retro-transcribed from confluent ARPE19 cells using previously described protocols (Plastino et al., 2021). The cDNA obtained was dilutedinDEPCwaterandusedforPCRamplification. The primers used in this study (Table 1) were designed using the application PerlPrimer v.1.1.20 (O. J. Marshall). A CFX96 real-time PCR system (Bio-Rad, Madrid, Spain) was used to amplify gene products. Relative mRNA expression was quantified by the standard 2−Ct method using GAPDH as a housekeeping gene. RNA isolation and PCR product integrity were checked by observing the relevant bands on agarose gels and determining A260/280 © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
6 Á. Santana-Garrido J Physiol 0.0 Table 1. Primers used for real-time PCR Gene Forward primer (5→3) Reverse primer (5→3) Arginase 1 ACAAAACAGGGCTACTCTCAGG CGAGCAAGTCCGAAACAAGC Arginase 2 TCAGTGCTGCGGATCATGT CACTCCTTTTCTTTTCTGCCCTT AT1R CCAAAGTCACCTGCATCATC CACAATCGCCTAATTATCCTA AT2R TCCATTGGTCTTCTGTCACCCG AGACCATCCACCTCCACTTCTC CAT-1 TGCGCTCTTTCCGCCAGTCT GGTGCTTGCCAATTCATTTT NOX1 CACCCCAAGTCTGTAGTGGGAG CCAGACTGGAATATCGGTGACA NOX2 GGACAGGAATCTCACCTTTCATAA TCGGGCATTCACACACCAT NOX4 AGAGGAACACGACAATCAGCCTTAG CTCAGCGGAATCAATCAGCTGTG NOX5 GGACAAACTCAAATTCCTCTTCCA CAGACACGACTGCAGCACAGT GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC and A260/230 ratios in a NanoDrop (Thermo Fisher Scientific). Western blotting In total, 15 mg of protein from ARPE19 cell lysates prepared in RIPA lysis buffer (Millipore, Madrid, Spain, 20-188) was subjected to SDS-PAGE (4–20% gradient gel) and transferred to a nitrocellulose membrane using previously described protocols (Blanca et al., 2017). The following mouse monoclonal antibodies from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and Novus Biological (Bio-Techne, Minneapolis, MN, USA) were used: anti-arginase 1 (sc-166920, 1:1000 dilution, RRID:AB_10609486), anti-arginase 2 (sc-271443, 1:1000 dilution, RRID:AB_10647774), anti-AT1R (sc-1173, 1:3000 dilution, RRID:AB_2305402), anti-AT2R (NBP1-77368, 1:2000 dilution, RRID:AB_11018151), anti-CAT1 (sc-515782, 1:1000 dilution, RRID:AB_3668742), anti-NOX1 (sc-518023, 1:1000 dilution, RRID:AB_3668743), anti-NOX2 (sc-130543, 1:2000 dilution, RRID:AB_2261483), anti-NOX4 (ab133303, 1:8000 dilution, RRID:AB_11155321) and anti-NOX5 (sc-518114, 1:500 dilution, RRID:AB_3668744). Quantitative analysis was performed using a Bio-Rad ChemiDocTM Imager, with β-actin (sc-47778, 1:20,000 dilution, RRID:AB_626632) serving as a loading control on the same membranes. In cases where antibodies targeted proteins with non-overlapping molecular weights and were derived from different host species, some membranes were stripped and reused. Statistical analyses All results are presented as means ±SD. One-way ANOVA followed by post hoc Tukey multiple comparison test was performed using GraphPad InStat Software (San Diego, CA, USA, v.3.10, RRID:SCR_000306), and differences were considered statistically significant at P<0.05. The stability of the variable values ensured that each of the samples was representative of its respective group. The application of the Central Limit Theorem guaranteed the validity of the hypotheses prior to applying ANOVA and post hoc tests for mean comparisons. Results Cell viability ToassesstheeffectofAngIIoncellviability, confluent ARPE19 cells were incubated with different concentrations of this peptide (100, 10, 1 and 0.1 μM AngII) for 24 h. No significant differences in cell viability wereobservedbetween AngII-treated cells andthe control group (Fig. 1A). On the other hand, ROS production showed a decrease with lower AngII concentrations, with a notable reduction from 10 μM (Fig. 1B). Thus, a concentration of 10 μM for 24 h was chosen for subsequent experiments to balance ROS production and cell viability. The specificity of ROS production was confirmed using H2O2and the DCFHDA dye. L-Arg transport and CAT-1 expression modulated by ACE oil EVs AngIItreatmentledtoanincreaseinoverall(Fig.2A)and saturable (Fig. 2B) l-Arg transport in ARPE19 cells, as evidenced by increased KDand Vmax for saturable transport.ThisresultedinahigherVmax/Kmratio without changes in Kmvalues compared to control cells (Fig. 2C). The administration of ACE oil prevented the increase in l-Arg uptake, returning the values to those measured in untreated cells. No significant differences were observed between the AngII group and the Ang+CT EVs or Ang+EVOO EVs groups, although the latter showed a trend toward values closer to those of the control group. © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
J Physiol 0.0 Extracellular vesicles convey eye protection exerted by wild olive oil 7 Figure 1. Effect of angiotensin II on cell viability and ROS production A, cell viability of ARPE19 cultures incubated with angiotensin II (AngII) at different concentrations (100, 10, 1 and 0.1 μM) for 24 h. No statistical differences were found between the groups after ordinary one-way ANOVA: Control vs. 100 (P= 0.141), Control vs.10 (P= 0.0592), Control vs.1(P= 0.976), Control vs.0.1(P= 0.107), 100 vs.10(P= 0.999), 100 vs.1(P= 0.726), 100 vs.0.1(P= 0.999), 10 vs.1(P= 0.440), 10 vs.0.1(P= 0.999) and 1 vs.0.1(P= 0.634). B, reactive oxygen species (ROS) production measured using the 2,7-dichlorodihydrofluorescein diacetate (DCFHDA) assay in ARPE19 cells incubated with different concentrations (100, 10, 1 and 0.1 μM) of AngII or 40 μM hydrogen peroxide (H2O2) for 24 h. Ordinary one-way ANOVA displayed significant differences as follows: Control vs. 100 (P<0.001), Control vs.10(P<0.001), Control vs.1(P= 0.00825), Control vs.H 2O2(P<0.001), 100 vs.1 (P= 0.00754), 100 vs.0.1(P<0.001), 100 vs.H 2O2(P<0.001), 10 vs.1(P= 0.00737), 10 vs.0.1(P<0.001), 10 vs.H 2O2(P<0.001), 1vs.H 2O2(P<0.001) and 0.1 vs.H 2O2(P<0.001). No differences were found between Control and 0.1 (P= 0.966), 100 vs.10 (P= 0.999) and 1 vs.0.1(P= 0.0506). Values are expressed as mean ±SD of five experiments per group. CP<0.05 vs. Control; HP<0.05 vs.H 2O2;∗P<0.05 vs. AngII 100 μM; #P<0.05 vs. AngII 10 μM. Additionally, the initial velocity (Vi) was higher in the AngII group compared to untreated cells. Parallel results were observed for CAT-1 expression, which was upregulated in the presence of AngII, showing an increase at both mRNA (∼1.7-fold) and protein (∼2.6-fold) levels compared to the control group (Fig. 2D, E). Treatment with ACE oil and EVOO EVs significantly downregulated CAT-1 expression compared to the AngII group (∼72% and ∼80% reduction in the Ang+ACE EVs group; ∼58% and ∼67% in the Ang+EVOO EVs group, at mRNA andprotein levels respectively). The Ang+CT EVs group also exhibited lower CAT-1 expression (∼22% and 42% reduction at mRNA and protein levels) compared to the AngII group. ACE oil EVs reduce AngII-induced oxidative stress in retinal pigment epithelium cells Various concentrations of EV proteins were tested to determine the optimal amount for reducing AngII-induced ROS production. Incubation with 10 μM AngII and different concentrations of EV proteins (65, 130, 330 and 500 μg protein/mL) for 24 h resulted in a significant reduction in ROS production, with no differences observed between the various concentrations (Fig. 3A). Therefore, 130 μg protein/mL was chosen for subsequent experiments for methodological ease. ROSproductionwasevaluatedinuntreatedand AngII-treated ARPE19 cells incubated with EVs from each experimental group. Cells treated with 10 μM AngII for 24 h (AngII group) showed a significant increase in DCFHDA signal compared to other groups, with visible differences even between EV groups (Fig. 3B). Quantitative analysis revealed a significant (∼1.6-fold) increase in ROS production in the AngII group relative to the control (Fig. 3C), which was mitigated by both ACE oil EVs (∼42% reduction compared to the AngII group) and EVOO EVs (∼34% reduction). This suggests antioxidant properties in ACE oil and EVOO EV treatments. Evaluation of AT1 and AT2 receptors TheexpressionofAngIIreceptors(AT1RandAT2R)was assessed due to their role in regulating ROS production (Fig.3D–G).In theAngIIgroup,AT1RmRNAandprotein expression increased by ∼2.46-/∼1.42-fold while AT2R expression decreased by ∼63%/∼21.4%, respectively, compared to the control. Interestingly, ACE oil EV treatment reduced AT1R mRNA expression below control levels (∼73% reduction compared to the AngII group), © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
8 Á. Santana-Garrido J Physiol 0.0 Figure 2. Effect of ACE oil EVs on L-Arg transport and CAT-1 expression Aand B,overall(A) and saturable (B)L-arginine (L-Arg) transport in ARPE19 cells for each experimental group. C, kinetics parameters for L-Arg transport shown in A: maximal velocity (Vmax) and apparent Michaelis–Menten constant (Km) of saturable transport, calculated assuming a single Michaelis–Menten hyperbola. Vmax/Km represents maximal L-Arg transport capacity. The lineal phase of overall transport (KD) was obtained from transport © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
J Physiol 0.0 Extracellular vesicles convey eye protection exerted by wild olive oil 9 data fitted to a Michaelis–Menten equation increased in a lineal component. Initial velocity (Vi) was calculated at 30 s with 12.5 μM L-Arg. Significant statistical differences in Vmax were found between Control and AngII (P<0.001), Control vs.Ang+CT EVs (P<0.001), AngII vs.Ang+ACE EVs (P<0.001), AngII vs.Ang+EVOO EVs (P<0.001), Ang+CT EVs vs.Ang+ACE EVs (P<0.001), Ang+CT EVs vs.Ang+EVOO EVs (P= 0.00991), and Ang+ACE EVs vs.Ang+EVOO EVs (P= 0.00492); but not between Control and Ang+ACE EVs (P= 0.556), Control vs.Ang+EVOO EVs (P= 0.0896) and AngII vs.Ang+CT EVs (P= 0.830). No differences were found regarding Km values: Control vs. AngII (P= 0.0922), Control vs.Ang+CT EVs (P= 0.655), Control vs.Ang+ACE EVs (P= 0.999), Control vs.Ang+EVOO EVs (P= 0.986), AngII vs.Ang+CT EVs (P= 0.684), AngII vs.Ang+ACE EVs (P= 0.560), AngII vs.Ang+EVOO EVs (P= 0.228), Ang+CT EVs vs.Ang+ACE EVs (P= 0.503), Ang+CT EVs vs.Ang+EVOO EVs (P= 0.907) and Ang+ACE EVs vs.Ang+EVOO EVs (P= 0.940). However, Vmax/Kmdisplayed significant differences between Control and AngII (P<0.001), AngII vs.Ang+CT EVs (P= 0.0296), AngII vs.Ang+ACE EVs (P<0.001), AngII vs.Ang+EVOO EVs (P<0.001) and Ang+CT EVs vs.Ang+ACE EVs (P= 0.0184). No differences were observed when comparing the rest of the groups: Control vs.Ang+CT EVs (P= 0.0534), Control vs.Ang+ACE EVs (P= 0.986), Control vs.Ang+EVOO EVs (P= 0.704), Ang+CT EVs vs.Ang+EVOO EVs (P= 0.469) and Ang+ACE EVs vs.Ang+EVOO EVs (P= 0.407). Statistical analysis of KDand Vifollowing ordinary one-way ANOVA produced the following resuls: (1) KD: Control vs. AngII (P= 0.00381), Control vs.Ang+CT EVs (P= 0.0112), Control vs. Ang+ACE EVs (P= 0.999), Control vs.Ang+EVOO EVs (P= 0.409), AngII vs.Ang+CT EVs (P= 0.988), AngII vs. Ang+ACE EVs (P= 0.00609), AngII vs.Ang+EVOO EVs (P= 0.160), Ang+CT EVs vs.Ang+ACE EVs (P= 0.0177), Ang+CT EVs vs.Ang+EVOO EVs (P= 0.0346), Ang+ACE EVs vs.Ang+EVOO EVs (P= 0.528); (2) Vi: Control vs. AngII (P<0.001), Control vs.Ang+CT EVs (P= 0.00126), Control vs.Ang+ACE EVs (P= 0.892), Control vs. Ang+EVOO EVs (P= 0.00143), AngII vs.Ang+CT EVs (P<0.001), AngII vs.Ang+ACE EVs (P<0.001), AngII vs.Ang+EVOO EVs (P<0.001), Ang+CT EVs vs.Ang+ACE EVs (P= 0.00912), Ang+CT EVs vs.Ang+EVOO EVs (P= 0.999), Ang+ACE EVs vs.Ang+EVOO EVs (P= 0.0104). Dand E,mRNA(D) and protein (E) expression of CAT-1 in ARPE19 homogenates from each experimental group. In (E), the representative bands for CAT-1 and β-actin were detected on the same membrane. Non-consecutive lanes have been deliberately separated to prevent any potential confusion. Both mRNA and protein expression analysis revealed significant differences between the groups: Control vs. AngII (P<0.001; P<0.001 for mRNA and protein, respectively), Control vs.Ang+CT EVs (P= 0.0162; P= 0.0165), Control vs.Ang+ACE EVs (P<0.001; P= 0.0228), AngII vs.Ang+CT EVs (P= 0.0310; P<0.001), AngII vs.Ang+ACE EVs (P<0.001; P<0.001), AngII vs.Ang+EVOO EVs (P<0.001; P<0.001), Ang+CT EVs vs.Ang+ACE EVs (P<0.001; P<0.001), Ang+CT EVs vs.Ang+EVOO EVs (P<0.001; P= 0.00181). On the other hand, when Control and Ang+EVOO EVs groups were compared, RNA expression was significantly different (P= 0.0284) while protein expression was not (P= 0.857). No significant differences were observed between Ang+ACE EVs and Ang+EVOO EVs, (P= 0.126; P= 0.163). ARPE19 cells in A–E, were incubated with 10 μM angiotensin II (AngII), with or without extracellular vesicles (EVs, 130 μg protein/mL) isolated from the plasma of different animal groups, for 24 h. The control group received no AngII or EV treatment. Values are expressed as mean ±SD of five experiments per group. CP<0.05 vs. Control; AP<0.05 vs. AngII; ACVP<0.05 vs.Ang+CT EVs; AEVP<0.05 vs.Ang+EVOO EVs. while protein expression remained similar to the control group. In turn, EVOO EVs restored these parameters to control values. The Ang+CT EVs group showed lower AT1R mRNA expression compared to the AngII group (∼36% reduction), but no significant difference in protein expression. No noticeable changes were observed for AT2R expression in this group. On the other hand, EVs from oil-treated animals restored AT2R levels to those of the control group. ACE oil EVs regulate NOX activity and expression AngII treatment significantly increased NOX activity (3.68-fold) and NOX mRNA expression (2.22-, 1.86-, 1.92and 2.43-fold for NOX1, NOX2, NOX4 and NOX5 isoforms, respectively) compared to untreated cells (Fig. 4Aand C). These increases were significantly reduced (2to 6-fold) by oil EVs, reaching values similar to untreated cells for NOX1 and NOX4, and even lower for NOX2 and NOX5 isoforms. The Ang+CT EVs group also showed a decrease in these parameters, though to a lesser extent (∼44% and ∼20–40% for NADPH oxidase activity and NOX expression, respectively, compared to the AngII group). At the protein level, AngII treatment significantly upregulatedNOX1,NOX4andNOX5expressionby ∼1.59-, 1.73and 1.48-fold respectively, compared to untreated cells (Fig. 4D–G). These alterations were effectively reversed after incubation with oil-derived EVs. InthepresenceofROT,superoxideproductionwas reduced by ∼48%comparedtotheAngIIgroup,whileDPI preincubation almost entirely abolished O2·−generation, indicating the involvement of a flavoprotein (Fig. 4B). In turn, preincubation with NOX inhibitors ML171, GKT136901 and VAS2870 reduced AngII-induced superoxide production by ∼15, ∼52 and ∼77%, respectively. These findings suggest a minimal effect of ML171 (a specific NOX1 inhibitor) but significant reduction with GKT136901 (NOX1/NOX4 inhibitor) and VAS2870 (a pan-NADPH oxidase inhibitor). Collectively, these results confirm that NADPH oxidase is the primary source of ROS generation in AngII-treated ARPE19 cells, with NOX4 emerging as the predominant isoform involved in this process. © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
16 Á. Santana-Garrido J Physiol 0.0 uncover the underlying mechanisms involved in the antioxidant properties of the oils used in our studies. A decrease in NO levels was observed in AngII-incubated ARPE19 cells, which was reversed by preincubation with circulating EVs isolated from the plasma of animals fed with ACE oilor EVOO-enriched diets. Previous studies both in vivo (Crassous et al., 2012) and in vitro (Ding et al., 2020) have reported that AngII administration reduces NO levels by modulating endothelial nitric oxide synthase (eNOS) activity. Although eNOS activity and expression were not directly measured in this study, our prior research found impaired eNOS activation in the retina of hypertensive mice (Santana-Garrido et al., 2020). In ARPE19 cells, inducible nitric oxide synthase (iNOS) is generally overexpressed in response to oxidative or inflammatory stimuli (Fang et al., 2012). However, given the demonstrated antioxidant properties of EVs, which are expected to mitigate oxidative stress and thereby reduce iNOS activation, we hypothesize that the observed increase in NO levels following EV treatment may be more closely associated with enhanced eNOS activation. This aligns with our previous in vivo findings showing increased eNOS activity in response to ACE oil-enriched diets (Santana-Garrido et al., 2020). Moreover, the reduction in AT1R expression and the significant upregulation of AT2R by ACE oil-related EVs might also counteract the harmful effects of AngII on ARPE19 cells. Curiously, plant extracts with a composition similar to that of our oils (i.e. rich in phenolic and terpenoid compounds) have been proposed as natural angiotensin receptor inhibitors with anti-hypertensive, antioxidant, anti-diabetic, anti-hyperlipidaemic and anti-inflammatory activities (Chakraborty & Roy, 2021). Therefore, the key to ACE oil’s properties might lie in its rich profile of these compounds. l-ArgisthesubstrateofeNOSandthereforenecessary for NO production (Boilard, 2018). Previous reports have demonstrated a high-affinity uptake system for l-Arg in RPE (Jwala et al., 2012; Salceda et al., 2008) with a Kmof ∼50–90 μM, slightly lower than the 120–200 μM observed in the current study. Additional Kmvalues of 35–140 μM have been observed in the hamster retina (Sáenz et al., 2002) and in other non-ocular tissues (Salsoso et al., 2021). We also found an increase in bothl-Arguptake(Vmax) and in the protein and gene expression of CAT-1 in AngII-treated cells. These results might be due to a physiological response to counteract the high oxidative environment and the reduction of NO levels observed in these cells, as AngII not only decreases NO levels but also increases ROS production mediated by NADPH oxidase activation, in which AngII/AT1R participates (Ding et al., 2020). Interestingly, both Vmax for l-Arg transport and CAT-1 expression were significantly reduced in AngII-treated cells preincubated with oil EVs, withahighereffectinthecaseofACEoilEVs. Furthermore, the activity and expression of arginase (the enzyme that competes with NOS for the common substrate, l-Arg) and ADMA (an endogenous inhibitor of NOS) levels were increased in cells incubated with AngII, consistent with the NO levels measured in these cells. Preincubation with oil EVs modulated the activity and expression of the two relevant arginase isoforms. These findings align with those observed in the retinas of mice with arterial hypertension induced by l-NAME, which were balanced by ACE oil and EVOO diets (Santana-Garrido et al., 2020). Several reports highlight that the modulation of arginase activity and expression is crucial for the development of retinopathies such as DR (Patel, 2013) or retinal ischaemia (Shosha et al., 2016). In fact, silencing arginase-1 activity has been proposed as a potential therapeutic strategy to alleviate DR (Shosha et al., 2016). Regarding ADMA levels, high concentrations of this l-Arg analogue have been linked to the aggravation of ocular conditions, for instance through activation of the RAS and ROS production (Chen et al., 2009), or by contributing to the breakdown of blood retinal barriers in DR (Huang et al., 2019). Higher serum ADMA levels are also associated with a greater risk of severe glaucoma (Yoshikawa et al., 2022). Therefore, ADMA depletion due to oil EV treatment might help prevent some of these conditions. Modulating all these components of NO metabolism at the ocular level through oil EVs opens the possibility of using them as comprehensive therapeutic agents for various NO-related ocular pathologies, including ocular surface wound healing, intraocular pressure (IOP) control in glaucoma, alleviating retinal disease and myopia suppression (Lee & Park, 2023). Taken together, all these results reaffirm the antioxidant properties of ACE oil and EVOO and show that oil EVs can convey the characteristics of oil compounds. EVs provide a unique approach by packaging and transferring bioactive molecules, such as lipids, phenolic compounds, proteins and miRNAs, which are naturally absorbed and processed by the body during dietary intake. This approach allows us to simulate the systemic effects of dietary oils in a biologically relevant and reproducible manner. Our findings provide insight into the role of EVs in the regulation of NO metabolism, which might be attributed to either a reduction in the oxidative environment within ARPE19 cells in the presence of EVs, as previously reported (Mahmoud et al., 2017), or modifications in the EV cargo, particularly those derived from plasma following ACE oil administration. EVs are known to carry active and functional eNOS, which can enhance NO production and reduce oxidative stress (Mahmoud et al., 2017; Motta-Mejia et al., 2017). Consequently, EVs associated with ACE oil and EVOO might contain components involved in NO metabolism, © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
J Physiol 0.0 Extracellular vesicles convey eye protection exerted by wild olive oil 17 among other bioactive molecules, potentially bypassing theneedtoincreasel-ArgtransporttostimulateNO production foroxidativestressmitigation.Byemphasizing the differences in EVs derived from ACE oiland EVOO-fed animals, this study may offer valuable insights into their distinct bioactivities. These findings may have potential therapeutic implications, particularly in eye diseases characterized by disruptions in NO metabolism and oxidative stress. References Abdel Ghafar, M. T. (2020). An overview of the classical and tissue-derived renin-angiotensin-aldosterone system and its genetic polymorphisms in essential hypertension. Steroids, 163, 108701. Blanca, A. J., Ruiz-Armenta, M. V., Zambrano, S., Miguel-Carrasco, J. L., González-Roncero, F. M., Fortuño, A., Revilla, E., Mate, A., & Vázquez, C. M. (2017). L-carnitine ameliorates the oxidative stress response to angiotensin II by modulating NADPH oxidase through a reduction in protein kinase c activity and NF-κbtranslocation to the nucleus. Food Chemistry,228, 356–366. Blanco-Benítez, M., Calderón-Fernández, A., Canales-Cortés, S., Alegre-Cortés, E., Uribe-Carretero, E., Paredes-Barquero, M., Gimenez-Bejarano, A., Duque González, G., Gómez-Suaga, P., Ortega-Vidal, J., Salido, S., Altarejos, J., Martínez-Chacón, G., Niso-Santano, M., Fuentes, J. M., González-Polo, R. A., & Yakhine-Diop, S. M. S. (2022). Biological effects of olive oil phenolic compounds on mitochondria. Molecular & Cellular Oncology,9(1), 1–7. Bodega, G., Alique, M., Puebla, L., Carracedo, J., & Ramírez, R. M. (2019). Microvesicles: ROS scavengers and ROS producers. Journal of Extracellular Vesicles,8(1), 1626654. Boilard, E. (2018). Thematic Review Series: Exosomes and microvesicles: Lipids as key components of their biogenesis and functions extracellular vesicles and their content in bioactivelipidmediators:MorethanasackofmicroRNA. Journal of Lipid Research,59(11), 2037–2046. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry, 72(1–2), 248–254. Burger, D., Montezano, A. C., Nishigaki, N., He, Y., Carter, A., & Touyz, R. M. (2011). Endothelial microparticle formation by Angiotensin II is mediated via Ang II receptor type I/NADPH oxidase/rho kinase pathways targeted to lipid rafts. Arteriosclerosis, Thrombosis, and Vascular Biology, 31(8), 1898–1907. Buzas, E. I. (2023). The roles of extracellular vesicles in the immune system. Nature Reviews Immunology,23(4), 236–250. Chakraborty, R., & Roy, S. (2021). Angiotensin-converting enzyme inhibitors from plants: A review of their diversity, modes of action, prospects, and concerns in the management of diabetes-centric complications. Journal of Integrative Medicine,19(6), 478–492. Chen, Y., Xu, X., Sheng, M., Zhang, X., Gu, Q., & Zheng, Z. (2009). PRMT-1 and DDAHs-induced ADMA upregulation is involved in ROSand RAS-mediated diabetic retinopathy. Experimental Eye Research,89(6), 1028–1034. Chiaradia, E., Tancini, B., Emiliani, C., Delo, F., Pellegrino, R. M., Tognoloni, A., Urbanelli, L., & Buratta, S. (2021). Extracellular vesicles under oxidative stress conditions: Biological properties and physiological roles. Cells,10(7), 1763. Crassous,P.-A.,Couloubaly,S.,Huang,C.,Zhou,Z.,Baskaran, P., Kim, D. D., Papapetropoulos, A., Fioramonti, X., Durán, W. N., & Beuve, A. (2012). Soluble guanylyl cyclase is a target of angiotensin II-induced nitrosative stress in a hypertensive rat model. American Journal of Physiology-Heart and Circulatory Physiology,303(5), H597–H604. Del Pinto, R., Mulè, G., Vadalà, M., Carollo, C., Cottone, S., Agabiti Rosei, C., De Ciuceis, C., Rizzoni, D., Ferri, C., & Muiesan, M. L. (2022). Arterial hypertension and the hidden disease of the eye: Diagnostic tools and therapeutic strategies. Nutrients,14(11), 2200. Ding, J., Yu, M., Jiang, J., Luo, Y., Zhang, Q., Wang, S., Yang, F., Wang, A., Wang, L., Zhuang, M., Wu, S., Zhang, Q., Xia, Y., & Lu, D. (2020). Angiotensin II decreases endothelial nitric oxide synthase phosphorylation via AT1R nox/ROS/PP2A pathway. Frontiers in Physiology,11, 566410. Fang, I.-M., Yang, C.-H., Yang, C.-M., & Chen, M.-S. (2012). The expression of inducible nitric oxide synthase in human retinal pigment epithelial cells under stimulation of proinflammatory cytokine tumor necrosis factor-α.Taiwan Journal of Ophthalmology,2(1), 13–17. Fan Gaskin, J. C., Shah, M. H., & Chan, E. C. (2021). Oxidative stress and the role of NADPH oxidase in glaucoma. Antioxidants,10(2), 238. Figueira, I., Bastos, P., González-Sarrías, A., Espín, J. C., Costa-Silva, B., & Nunes dos Santos, C. (2023). Can exosomes transfer the preconditioning effects triggered by (poly)phenol compounds between cells? Food & Function, 14(1), 15–31. Fleckenstein, M., Keenan, T. D. L., Guymer, R. H., Chakravarthy, U., Schmitz-Valckenberg, S., Klaver, C. C., Wong, W. T., & Chew, E. Y. (2021). Age-related macular degeneration. Nature Reviews Disease Primers,7(1), 31. Fletcher,E.L.,Phipps,J.A.,Ward,M.M.,Vessey,K.A.,& Wilkinson-Berka, J. L. (2010). The renin–angiotensin system in retinal health and disease: Its influence on neurons, glia and the vasculature. Progress in Retinal and Eye Research,29(4), 284–311. Fraser-Bell, S., Symes, R., & Vaze, A. (2017). Hypertensive eye disease: A review. Clinical & Experimental Ophthalmology, 45(1), 45–53. Ghezzi, P., Jaquet, V., Marcucci, F., & Schmidt, H. (2017). The oxidativestresstheoryofdisease:Levelsofevidenceand epistemological aspects. British Journal of Pharmacology, 174(12), 1784–1796. Guzik, T. J., & Touyz, R. M. (2017). Oxidative stress, inflammation, and vascular aging in hypertension. Hypertension,70(4), 660–667. © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
18 Á. Santana-Garrido J Physiol 0.0 Huang, C.-Y., Zhou, T., Li, G., Li, M.-Y., Xiong, X.-M., Wu, M.-T., & Jiang, J.-L. (2019). Asymmetric dimethylarginine aggravates blood-retinal barrier breakdown of diabetic retinopathy via inhibition of intercellular communication in retinal pericytes. Amino Acids,51(10–12), 1515–1526. Jwala, J., Vadlapatla, R. K., Vadlapudi, A. D., Boddu, S. H. S., Pal, D., & Mitra, A. K. (2012). Differential expression of folate receptor-alpha, sodium-dependent multivitamin transporter, and amino acid transporter (B (0, +)) in Human retinoblastoma (Y-79) and retinal pigment epithelial (ARPE-19) cell lines. Journal of Ocular Pharmacology and Therapeutics,28(3), 237–244. Kang, Q., & Yang, C. (2020). Oxidative stress and diabetic retinopathy: Molecular mechanisms, pathogenetic role and therapeutic implications. Redox Biology,37, 101799. Katsi, V., Marketou, M., Vlachopoulos, C., Tousoulis, D., Souretis, G., Papageorgiou, N., Stefanadis, C., Vardas, P., & Kallikazaros, I. (2012). Impact of arterial hypertension on the eye. Current Hypertension Reports,14(6), 581–590. Lee, S., & Park, C. Y. (2023). Nitric oxide: An old drug but with new horizons in ophthalmology—A Narrative review. Annals of translational medicine,11(10), 352–352. Lerman,L.O.,Kurtz,T.W.,Touyz,R.M.,Ellison,D.H., Chade, A. R., Crowley, S. D., Mattson, D. L., Mullins, J. J.,Osborn,J.,Eirin,A.,Reckelhoff,J.F.,Iadecola,C.,& Coffman, T. M. (2019). Animal models of hypertension: A scientific statement from the American Heart Association ed. Krantz DS, Baum A, Singer JE & Singer JL. Hypertension,73(6), 155–197. Lucchesi, M., Marracci, S., Amato, R., Lapi, D., Santana-Garrido, Á., Espinosa-Martín, P., Vázquez, C. M., Mate, A., & Dal Monte, M. (2024). The anti-inflammatory and antioxidant properties of Acebuche oil exert a retinoprotective effect in a murine model of high-tension glaucoma. Nutrients,16(3), 409. Mahmoud,A.M.,Wilkinson,F.L.,Mccarthy,E.M., Moreno-Martinez, D. M., Langford-Smith, A., Romero, M., Duarte, J., & Alexander, M. Y. (2017). Endothelial microparticles prevent lipid-induced endothelial damage via Akt/eNOS signaling and reduced oxidative stress. Federation of American Societies of Experimental Biology Journal,31(10), 4636–4648. Mantilla-Escalante, D. C., López de las Hazas, M.-C., Crespo, M. C., Martín-Hernández, R., Tomé-Carneiro, J., del Pozo-Acebo, L., Salas-Salvadó, J., Bulló, M., & Dávalos, A. (2021). Mediterranean diet enriched in extra-virgin olive oil or nuts modulates circulating exosomal non-coding RNAs. European Journal of Nutrition,60(8), 4279–4293. Moisseiev, E., Anderson, J. D., Oltjen, S., Goswami, M., Zawadzki, R. J., Nolta, J. A., & Park, S. S. (2017). Protective effect of intravitreal administration of exosomes derived from mesenchymal stem cells on retinal ischemia. Current Eye Research,42(10), 1358–1367. Motta-Mejia, C., Kandzija, N., Zhang, W., Mhlomi, V., Cerdeira, A. S., Burdujan, A., Tannetta, D., Dragovic, R., Sargent,I.L.,Redman,C.W.,Kishore,U.,&Vatish,M. (2017). Placental vesicles carry active endothelial nitric oxide synthase and their activity is reduced in preeclampsia. Hypertension,70(2), 372–381. Nagai, N., Kawashima, H., Toda, E., Homma, K., Osada, H.,Guzman,N.A.,Shibata,S.,Uchiyama,Y.,Okano, H., Tsubota, K., & Ozawa, Y. (2020). Renin–angiotensin system impairs macrophage lipid metabolism to promote age-related macular degeneration in mouse models. Communications Biology,3(1), 767. Patel, C. (2013). Arginase as a mediator of diabetic retinopathy. Frontiers in Immunology,4, 1–11. Patel, S. N., Fatima, N., Ali, R., & Hussain, T. (2020). Emerging role of Angiotensin AT2 receptor in anti-inflammation: An update. Current Pharmaceutical Design,26(4), 492–500. Plastino,F.,Santana-Garrido,Á.,Pesce,N.A.,Aronsson,M., Lardner, E., Mate, A., Kvanta, A., Vázquez, C. M., & André, H. (2021). Echinomycin mitigates ocular angiogenesis by transcriptional inhibition of the hypoxia-inducible factor-1. Experimental Eye Research,206, 108518. Qiu,Y.,Tao,L.,Lei,C.,Wang,J.,Yang,P.,Li,Q.,&Lei,B. (2015). Downregulating p22phox ameliorates inflammatory response in Angiotensin II-induced oxidative stress by regulating MAPK and NF-κbpathwaysinARPE-19cells. Scientific Reports,5(1), 14362. Reichhart, N., Haase, N., Crespo-Garcia, S., Skosyrski, S., Herrspiegel, C., Kociok, N., Fuchshofer, R., Dillinger, A., Poglitsch,M.,Müller,D.N.,Joussen,A.M.,Luft,F.C., Dechend, R., & Strauß, O. (2016). Hypertensive retinopathy in a transgenic angiotensin-based model. Clinical Science, 130(13), 1075–1088. Rudraprasad, D., Rawat, A., & Joseph, J. (2022). Exosomes, extracellular vesicles and the eye. Experimental Eye Research,214, 108892. Sáenz, D. A., Cymeryng, C. B., De Nichilo, A., Sacca, G. B., Keller Sarmiento, M. I., & Rosenstein, R. E. (2002). Photic regulation of L-arginine uptake in the golden hamster retina. Journal of Neurochemistry,80(3), 512–519. Salceda, R., Hernández-Espinosa, C., & Sánchez-Chávez, G. (2008). L-arginine uptake in normal and diabetic rat retina and retinal pigment epithelium. Neurochemical Research, 33(8), 1541–1545. Salsoso, R., Guzmán-Gutiérrez, E., Sáez, T., Bugueño, K., Ramírez, M. A., Farías, M., Pardo, F., Leiva, A., Sanhueza, C., Mate, A., Vázquez, C., & Sobrevia, L. (2015). Insulin restores l-arginine transport requiring adenosine receptors activation in umbilical vein endothelium from late-onset preeclampsia. Placenta,36(3), 287–296. Salsoso, R., Mate, A., Toledo, F., Vázquez, C. M., & Sobrevia, L. (2021). Insulin requires A2B adenosine receptors to modulate the L-arginine/nitric oxide signalling in the human fetoplacental vascular endothelium from late-onset preeclampsia. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease,1867(1), 165993. Samaeekia, R., Rabiee, B., Putra, I., Shen, X., Park, Y. J., Hematti, P., Eslani, M., & Djalilian, A. R. (2018). Effect of Human corneal mesenchymal stromal cell-derived exosomes on corneal epithelial wound healing. Investigative Opthalmology & Visual Science,59(12), 5194. Santana-Garrido, Á., Reyes-Goya, C., André, H., Vázquez, C. M., & Mate, A. (2024). Exploring the potential of wild olive (Acebuche) oil as a pharm-food to prevent ocular hypertension and fibrotic events in the retina of hypertensive mice. Molecular Nutrition & Food Research,68(3), 1–16. © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
J Physiol 0.0 Extracellular vesicles convey eye protection exerted by wild olive oil 19 Santana-Garrido, Á., Reyes-Goya, C., Arroyo-Barrios, A., André, H., Vázquez, C. M., & Mate, A. (2022). Hypertension secondary to nitric oxide depletion produces oxidative imbalance and inflammatory/fibrotic outcomes in the cornea of C57BL/6 mice. Journal of Physiology and Biochemistry,78(4), 915–932. Santana-Garrido, Á., Reyes-Goya, C., Fernández-Bobadilla, C., Blanca, A. J., André, H., Mate, A., & Vázquez, C. M. (2021a). NADPH oxidase-induced oxidative stress in the eyes of hypertensive rats. Molecular Vision,27, 161–178. Santana-Garrido, Á., Reyes-Goya, C., Milla-Navarro, S., de la Villa, P., André, H., Vázquez, C. M., & Mate, A. (2021b). Anti-inflammatory action of dietary wild olive (Acebuche) oil in the retina of hypertensive mice. Foods,10(9), 1993. Santana-Garrido, Á., Reyes-Goya, C., Pérez-Camino, M. C., André, H., Mate, A., & Vázquez, C. M. (2020). Retinoprotective effect of wild olive (Acebuche) oil-enriched diet against ocular oxidative stress induced by arterial hypertension. Antioxidants,9(9), 885. Shosha, E., Xu, Z., Yokota, H., Saul, A., Rojas, M., Caldwell, R. W., Caldwell, R. B., & Narayanan, S. P. (2016). Arginase 2 promotes neurovascular degeneration during ischemia/reperfusion injury. Cell Death & Disease,7(11), e2483–e2483. Sun, G.-F., Qu, X.-H., Jiang, L.-P., Chen, Z.-P., Wang, T., & Han, X.-J. (2024). The mechanisms of natural products for eye disorders by targeting mitochondrial dysfunction. Frontiers in Pharmacology,15, 1–13. Szczepanska-Sadowska, E., Czarzasta, K., & Cudnoch-Jedrzejewska, A. (2018). Dysregulation of the Renin-Angiotensin System and the vasopressinergic system interactions in cardiovascular disorders. Current Hypertension Reports,20(3), 19. Tonade, D., & Kern, T. S. (2021). Photoreceptor cells and RPE contribute to the development of diabetic retinopathy. Progress in Retinal and Eye Research,83, 100919. Tsou,S.,Chuang,C.,Hsu,C.,Chen,T.,Yeh,J.,Wang, M., Wang, I., Chang, Y., & Lin, H. (2024). The novel application of EUK-134 in retinal degeneration: Preventing mitochondrial oxidative stress-triggered retinal pigment epithelial cell apoptosis by suppressing MAPK/p53 signaling pathway. Environmental Toxicology,40(1), 88–100. van der Merwe, Y., & Steketee, M. B. (2017). Extracellular vesicles: Biomarkers, therapeutics, and vehicles in the visual system. Current Ophthalmology Reports,5(4), 276–282. Vila-liante, V., Sánchez-lópez, V., Martínez-sales, V., Ramón-nuñez, L. A., Arellano-orden, E., Cano-ruiz, A., Rodríguez-martorell, F. J., & Gao, L. (2016). Impact of sample processing on the measurement of circulating microparticles: Storage and centrifugation parameters. Clinical Chemistry and Laboratory Medicine (CCLM), 54(11), 1759–1767. Yoshikawa, T., Obayashi, K., Miyata, K., Saeki, K., & Ogata, N. (2022). Association between postillumination pupil response and glaucoma severity: A cross-sectional analysis of the LIGHT study. Investigative Opthalmology & Visual Science,63(3), 2–6. Zhang, Z., Yu, K., You, Y., Jiang, P., Wu, Z., DeTure, M. A., Dickson, D. W., Ikezu, S., Peng, J., & Ikezu, T. (2023). Comprehensive characterization of human brain-derived extracellular vesicles using multiple isolation methods: Implications for diagnostic and therapeutic applications. Journal of Extracellular Vesicles,12(8), e12358. Additional information Data availability statement Thedatathatsupportthefindingsofthisstudyareavailableon request from the corresponding authors. Competing interests None declared. Author contributions Á.S.-G.: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Data curation, Writing – original draft. C.R.-G.: Investigation, Writing – review & editing. P.E.-M.: Investigation. R.M.T.-T.: Investigation. H.A.: Methodology, Resources, Supervision. C.M.V.: Conceptualization, Methodology, Formal analysis, Writing – review & editing, Supervision, Project administration, Funding acquisition. A.M.: Conceptualization, Methodology, Writing – review & editing, Supervision, Project administration, Funding acquisition. Funding Ministerio de Ciencia, Innovación y Universidades (MCIU): Alfonso Mate, Carmen M. Vázquez, PID2019-109002RB-I00; JuntadeAndalucia,ConsejeriadeUniversidad, Investigacion e Innovacion: Alfonso Mate, Carmen M. Vázquez, ProyExcel_00516. This research was supported by Grant PID2019-109002RB-I00 funded by MCIN/AEI/10.13039/501100011033; Junta de Andalucía, Consejería de Universidad, Investigación e Innovación, Secretaría General de Investigación e Innovación, ProyExcel_00516; and CTS-584. During the development of this publication, Á.S.G. has been a recipient of: (1) a research contract supported by PROYEXCEL_00516; and (2) a postdoctoral fellowship funded by Fundación Alfonso Martín Escudero. C.R.G. was supported by Ayudas para la Recualificación del Sistema Universitario Español – Margarita Salas from the University of Seville (SOL-20006). P.E.M. was supported by Ministerio de Ciencia e Innovación, Ayudas para la Promoción de Empleo Joven e Implantación de la Garantía Juvenil en I+D+i 2017–2020 (PEJ5-2020-662). Acknowledgements WearegratefulforthetechnicalsupportfromCentrode Innovación, Tecnología e Innovación de la Universidad de Sevilla (CITIUS, Servicio de Biología, Servicio de Microscopía). The authors are also grateful to Alcazarín Reunidos FP, S.L. © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
20 Á. Santana-Garrido J Physiol 0.0 (Monda,Málaga, Spain)forprovidingtheextravirginolive[wild (ACE)/cultivated (EVOO)] oils used in this study. Keywords acebuche oil, angiotensin II, ARPE19, extracellular vesicles, l-arginine, oxidative stress Supporting information Additional supporting information can be found online in the Supporting Information section at the end of the HTML view of the article. Supporting information files available: Peer Review History © 2025 The Author(s). The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society. 14697793, 0, Downloaded from https://physoc.onlinelibrary.wiley.com/doi/10.1113/JP287367 by Readcube (Labtiva Inc.), Wiley Online Library on [28/07/2025]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License