Full text
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 1 of 18 MOLECULAR BIOLOGY Metabolic dysfunction–associated steatotic liver disease alters brain function and behavior: Insights from livertargeted siRNA therapy Teresa Cardoso Delgado1,2,3,4*†, Celia MartínCuevas5,6†, Ana C. Sánchez Hidalgo5,6†, Antonio Gil Gómez7,8,9‡, Claudia M. Rejano Gordillo1‡, Jon Landa10, Rocío Gallego Durán7,8, Naroa GoikoetxeaUsandizaga1,8, Irene GonzálezRecio1, Clàudia GilPitarch1, L. Estefanía ZapataPavas1, Jon Ander BarrenecheaBarrenechea1, Carolina Conter1, Luis Alfonso MartínezCruz1, Víctor D. Ramos Herrero5, Rubén Nogueiras11, Mikel Azkargorta12, Felix Elortza12, Verónica MonchoAmor10, Javier Crespo13, Ander Matheu3,10,14, Manuel Romero Gómez7,8, Benedicto CrespoFacorro5,6,15, María Luz MartínezChantar1,8* Metabolic dysfunction–associated steatotic liver disease (MASLD), a livercentric condition, is associated with cognitive impairment and sensorimotor alterations. However, it remains unclear whether MASLD is sufficient to drive central nervous system deficits. Here, using dietinduced mouse models, we showed that MASLD was associated with alterations in social memory, sensorimotor processing, and hippocampal function, including decreased parvalbuminpositive interneurons, reduced dendritic spine density, and diminished dentate gyrus neurogenesis and neuronal differentiation. Then, we selectively modulated liver metabolism through Nacetylgalactosamine small interfering RNA (siRNA) therapy against Cyclin M4 (CNNM4), a magnesium transporter dysregulated in MASLD. Liverspecific intervention with siRNACnnm4 reversed impaired social memory and sensorimotor processing in association with recovery of hippocampal synaptogenesis and mitochondrial function pathways, alongside activation of neurogenesisassociated transcriptional programs. Our findings demonstrate that liver pathology is sufficient to drive neurobehavioral and hippocampal dysfunction in MASLD. Hepaticspecific intervention restores brain function, strongly supporting the existence of a causal and therapeutically targetable liverbrain axis for MASLDassociated neurological complications. INTRODUCTION Metabolic dysfunction–associated steatotic liver disease (MASLD), previously known as nonalcoholic fatty liver disease (NAFLD), is defined as steatotic liver disease (SLD) in the presence of one or more cardiometabolic risk factors and the absence of harmful alcohol intake (1). Beyond hepatic pathology, MASLD is associated with gut microbiota dysbiosis, visceral fat accumulation, insulin resistance, oxidative stress, and chronic inflammation, factors implicated in extrahepatic complications, including diabetes, cardiovascular disease, and kidney disease (2,3), underscoring that MASLD is a multisystem disease. Emerging evidence from recent years suggests that MASLD can substantially affect brain health, being associated with cognitive dysfunction, structural abnormalities, and an increased risk of neurodegenerative disorders. A metaanalysis has shown a 1.44fold higher risk of cognitive impairment in individuals with MASLD compared to healthy controls (4), and data from community cohorts suggest reductions in total and gray matter brain volumes in MASLD. Liver fibrosis, assessed via FibroScan, correlates with imaging markers of neurodegeneration, and MASLD severity is linked to memory deficits and hippocampal alterations (5). In preclinical rodent models, diets rich in saturated fats and simple sugars, known to induce MASLD, cause impaired cognitive function. Likewise, highenergy diets in mice disrupt memory and learning processes (6), provoke neuroinflammation, activate complementmediated synaptic degradation (7), and induce magnetic resonance imaging (MRI)–detectable brain changes consistent with inflammation (8). MASLD has also been associated with lowgrade brain hypoxia, glial activation, cerebrovascular dysfunction, and behavioral changes that may persist or worsen with disease progression, increasing the risk of Alzheimer’s disease and related conditions (9). These findings highlight the need to explore the liverbrain axis within the MASLD pathophysiology. While clinical and epidemiological data support the association between MASLD and impaired brain function, the causal role of MASLD in brain dysfunction and the underlying mechanisms remain 1liver Disease lab, Center for Cooperative Research in Biosciences (CiC bioGUne), Basque Research and technology Alliance (BRtA), 48160 Derio, Bizkaia, Spain. 2Metabolic liver Disease laboratory, Biobizkaia health Research institute, 48903 Barakaldo, Bizkaia, Spain. 3iKeRBASQUe, Basque Foundation for Science, Bilbao, Spain. 4Centro de investigación en enfermedades Raras (CiBeRer), 28029 Madrid, Spain. 5translational Psychiatry, instituto de Biomedicina de Sevilla (iBiS), hospital Universitario virgen del Rocío/CSiC/Universidad de Sevilla, 41013 Sevilla, Spain. 6Spanish network for Research in Mental health (CiBeRSAM, iSCiii), 28029 Madrid, Spain. 7Clinical and translational Research in liver and Digestive Diseases–Seliver Group, instituto de Biomedicina de Sevilla (iBiS), hospital Universitario virgen del Rocío/CSiC/Universidad de Sevilla, 41013 Sevilla, Spain. 8Centro de investigación Biomédica en Red de enfermedades hepáticas y Digestivas (CiBeRehd), Carlos iii national health institute, 28029 Madrid, Spain. 9Departamento de Fisiología, Facultad de Biología, Universidad de Sevilla, 41012 Sevilla, Spain. 10Cellular Oncology Group, 20014 Biogipuzkoa health Research institute, San Sebastian–Donostia, Spain. 11Department of Physiology, CiMUS, University of Santiago de Compostela, instituto de investigación Sanitaria, Santiago de Compostela, Spain; CiBeR Fisiopatologia de la Obesidad y nutrición (CiBeRobn), Madrid, Spain; Galician Agency of innovation (GAin), Xunta de Galicia, 15782 Santiago de Compostela, Spain. 12Proteomics Platform, Center for Cooperative Research in Biosciences (CiC bioGUne), Basque Research and technology Alliance (BRtA), 48160 Derio, Bizkaia, Spain. 13School of Medicine, University of Cantabria, Clinical and translational Research in Digestive Diseases, valdecilla Research institute (iDivAl), 39011 Santander. MedicineAi, 28028 Madrid, Spain. 14Centro de investigación Biomédica en Red Fragilidad y envejecimiento Saludable (CiBeRfes), 28029 Madrid, Spain. 15Department of Medicine and Psychiatry, University hospital virgen del Rocio, iBiS, 41013 Seville, Spain. *Corresponding author. email: tcardosodelgado@ gmail. com (t.C.D.); mlmartinez@ cicbiogune. es (M.l.M.- C.) †these authors contributed equally to this work. ‡these authors contributed equally to this work. Copyright © 2025 the Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. no claim to original U.S. Government Works. Distributed under a Creative Commons Attribution nonCommercial license 4.0 (CC BYnC). Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 2 of 18 under investigation. To date, chronic systemic inflammation, changes in cerebrovascular perfusion, brain aging, and incipient neurodegeneration have been highlighted as causes of cognitive dysfunction in patients with MASLD (10). Direct therapeutic strategies targeting MASLDrelated cognitive dysfunction are limited. However, the impact of MASLD reversal on neurobehavioral outcomes warrants investigation, particularly given the emergence of therapeutic options for MASLD originally developed for type 2 diabetes and obesity, such as pioglitazone, glucagonlike peptide–1 (GLP1) receptor agonists, multiagonists, and sodiumglucose transport protein 2 inhibitors (1), and, more recently, the approval of resmetirom, a thyroid hormone receptor β–selective agonist for patients with atrisk metabolic dysfunction–associated steatohepatitis (11,12). In this study, we conducted a comprehensive behavioral and cognitive assessment, along with brain cellular characterization, in two wellcharacterized mouse models of dietinduced MASLD: the cholinedeficient, lamino acid–defined (CDAA) diet and the CDAA highfat diet (CDAHFD), which have been previously well characterized for liver phenotype (13). A group of animals was treated with small interfering RNA (siRNA) targeting Cyclin and CystathioninebetaSynthase (CBS) domain divalent metal cation transport mediator 4 or Cyclin M4 (CNNM4). CNNM4 is a key magnesium transporter that regulates intracellular magnesium homeostasis, which is critical for maintaining mitochondrial function, adenosine 5′- triphosphate production, and redox balance (14–16). Previous results have shown that silencing Cnnm4 in mouse livers is an effective therapeutic strategy for ameliorating MASLD (14). Here, siRNACNNM4 is conjugated to Nacetylgalactosamine (GalNAc), a targeting ligand that binds highly selectively to asialoglycoprotein, which is abundantly expressed on hepatocytes surface, leading to rapid endocytosis and ensuring hepatocytespecific delivery of the siRNACNNM4. By silencing Cnnm4 specifically in hepatocytes, we aimed to modulate magnesium flux and hepatic metabolic stress and evaluate whether this intervention could ameliorate neurobehavioral impairments, thereby uncovering previously unknown mechanistic links in the liverbrain axis. RESULTS Behavioral, neurocognitive, and sensorimotor alterations in a nonobese preclinical model of dietinduced MASLD Mice fed a CDAA diet for 6 weeks develop pronounced macrovesicular steatosis, inflammation, and liver fibrosis (Fig.1A), as previously described (13). Notably, these animals are not insulin resistant (13) and are not obese (Fig.1B), which enables the assessment of liverspecific pathology without the confounding effects of obesity and diabetes. After 6 weeks on the CDAA diet, mice exhibit hypertransaminasemia (Fig.1, C and D), along with a trend toward increased serum ammonia levels—an established liverderived neurotoxin implicated in the pathogenesis of hepatic encephalopathy (Fig.1E) (17). To understand the association between the liverbrain axis in MASLD, we carried out a preliminary battery for behavioral screening in the CDAA diet–induced MASLD mouse model. These assessments include basic sensory and motor function tests, neurophysiological status, and sociability. In the openfield test, CDAAfed rodents present normal activity, indicating that animals on the CDAA diet for 6 weeks are not weak and do not exhibit motor impairment (fig.S1A). Moreover, no significant difference was found between the CDAA and controlfed rodents in the elevated plus maze test, a wellestablished task for assessing anxietylike conflict behavior in rodents (fig.S1B). In the threechamber sociality test, sociability is defined as the subject mouse spending more time interacting with the novel target mouse than with the inanimate novel object. The second phase measures the preference for a novel mouse compared to the familiar mouse when the latter is presented in the previously empty chamber, a measurement of the social memory index. Under these conditions, CDAAfed rodents show decreased social novelty preference index (Fig.1F). Social behavior of a tested subject may be affected by other confounding variables, such as social rank and aggressiveness (18). To address this, we carried out a tube test, a simple and robust behavioral assay used to measure social hierarchy in mice. No differences were observed in the tube test between CDAAfed rodents and standard chow–fed healthy animals (fig.S1C). Last, the hotplate test is a test of the pain response in animals, and the CDAAfed rodents show equal sensitivity to heat as control animals (fig.S1D). Next, we aimed to examine multiple aspects of cognition that cover different domains of functioning, including preattention and attention, and various aspects of learning and memory. No significant differences were found in the Ymaze experiment used to test the spatial working memory between the control group and the mice model of CDAA diet–induced MASLD (fig.S1E). Last, the rodent acoustic startle response (ASR) test is commonly used to study fundamental properties of the central nervous system, including habituation, sensitization, classical conditioning, fear and anxiety, sensorimotor gating, and drug effects. Of relevance, mice on a CDAA diet for 6 weeks presented decreased ASR processes without alteration in the prepulse inhibition (PPI) response relative to their control group (Fig.1G and fig.S1F), highlighting that altered sensorimotor processes characterize these MASLD mice. In summary, animals for 6 weeks on a CDAA diet, a nonobese animal model of dietinduced MASLD, are characterized by impaired alterations in sociability and sensorimotor processing. Neurocognitive and sensorimotor processing function in experimental models of dietinduced MASLD after livertargeted therapy The neurocognitive and sensorimotor processing responses to livertargeted therapy were assessed in CDAA diet–induced MASLD mice. A single subcutaneous injection was administered at week 3, consisting of a validated liverspecific therapeutic: GalNAcconjugated siRNA targeting Cnnm4. In CDAAfed mice, this hepatocytetargeted Cnnm4GalNAc siRNA lowered hepatic Cnnm4 levels and ameliorated steatosis, inflammation, and fibrosis, without altering body weight compared to vehicletreated controls (Fig.2, A and B), in line with our previous findings (14). Notably, liverspecific Cnnm4 knockdown also translated into neurological benefits. Treated animals displayed an improvement in social memory performance (Fig.2C) and restoration to control healthy animal levels of the ASR (Fig.2D). Overall, our results demonstrate that in the CDAA diet–induced animal model of MASLD, liver-targeted therapy restores neurobehavioral domains related to sociability and sensorimotor processing, underscoring the functional relevance of the liverbrain axis in this metabolic context. Restoration of hippocampal dendritic spine density following livertargeted therapy in experimental models of dietinduced MASLD Previous studies in the clinical setting and experimental mouse models suggested that the presence and severity of MASLD were associated Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 3 of 18 Fig. 1. Behavior, neurocognitive aspects, and sensorimotor processing/gating in a nonobese preclinical animal model of dietinduced MASLD. (A) hepatic hematoxylin and eosin (h&e), Oil Red staining of lipids, Sirius Red staining of collagen fibers, and immunohistochemical (ihC) analysis of F4/80, a membrane macrophage marker. Scale bars, 20 μm. (B) Weight of animals. Serum transaminases, (C) aspartate aminotransferase (ASt) and (D) alanine aminotransferase (Alt) serum levels. (E) Serum ammonia levels. (F) threechamber sociality test (social preference and social novelty) and (G) acoustic startle response (ASR) test in C57Bl/6J 3monthold male mice randomly separated into two groups: animals on a CDAA diet for 6 weeks or rodents on a standard chow diet (control). Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 4 of 18 Fig. 2. Neurocognitive and sensorimotor processing in experimental models of dietinduced MASLD after livertargeted therapy. (A) Weight alterations. (B) hepatic h&e, Sirius Red staining of collagen fibers, and ihC analysis of F4/80, a membrane macrophage marker, and Cyclin and CBS domain divalent metal cation transport mediator 4 (Cnnm4). (C) threechamber sociality test (social preference and social novelty) and (D) acoustic startle response (ASR) test in C57Bl/6J 3monthold male mice randomly separated into three groups: animals on a standard chow diet, animals on a CDAA diet for 6 weeks, or animals on CDAA for 6 weeks where livertargeted therapy with GalnAcsiRnA for Cnnm4 conjugates was given at week 3 of dietary intervention at a dose of 3 mg/kg by subcutaneous administration. Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 5 of 18 with increased risk of memory impairment and hippocampal structural and functional abnormalities (19,20). Thus, we decided to evaluate the impact of the CDAA diet and livertargeted therapy on the hippocampus. We completed a detailed characterization of glial and neural cells to understand the lineages affected by the liver disease. There are no significant differences in the immunolabeling of glial fibrillary acidic protein (an astrocyte marker), oligodendrocyte [expressing sexdetermining region Ybox10 (Sox10)], and ionized calcium– binding adapter molecule 1– and CD68labeled microglia in the dentate gyrus (DG) of animals with dietinduced MASLD, which are also unaltered after treatment (fig.S2, A to C). Next, we studied parvalbuminpositive (PV+) inhibitory interneurons. PV+ interneurons present particular morphological and functional properties that precisely control local circuitry, brain networks, and memory processing (21). Here, we detected a decrease in the immunolabeling of PV interneurons in the hippocampus (subfields CA1, CA2, CA3, and CA4) of animals maintained on a CDAA diet for 6 weeks. The number of these PV+ neurons is restored in animals with ongoing livertargeted therapy (Fig.3A). The loss of PV+ neurons in the hippocampal region of CDAA diet–fed mice is not accompanied by colocalization with cleaved caspase3, as staining was negative across all experimental conditions. This suggests that the reduction in PV immunoreactivity is not due to apoptosis or neurodegeneration but rather reflects a downregulation of PV expression, indicating functional plasticity of these neurons (fig.S3A). Hippocampal PV+ interneurons form numerous dendritic spines with highly variable densities and inputselective organization. Dendritic spines are small, thin, specialized protrusions from neuronal dendrites and are important structures in the control of the synaptic input of the hippocampal neuron family. To test whether MASLD may induce structural plasticity, we quantified dendritic spine density in the hippocampal regions (CA1 and CA3) and the prefrontal cortex of animals fed a CDAA diet for 6 weeks. The density of dendritic spines in the CA3 and CA1 hippocampus areas is reduced in animals fed for 6 weeks on a CDAA diet relative to healthy rodents on a standard chow diet. However, when we treated these animals with the livertargeted siRNACnnm4 GalNAc conjugate, the dendritic spine density was restored to control levels (Fig.3, B and C). In contrast, no significant changes were detected regarding dendritic spine density in the prefrontal cortex (Fig.3D). In summary, livertargeted therapy in MASLD preclinical mouse models improves the brain’s neurocognitive and sensorimotor processing responses in association with remodeling of hippocampal PV+ interneurons and dendritic spine density. Hippocampal neural stem and neurogenesis indicators in experimental models of dietinduced MASLD after livertargeted therapy Structural plasticity of the hippocampus involves the reorganization of synapses and changes in dendritic arborization in the CA3 and CA1 areas, while cellular plasticity involves stem cell activity and neuronal differentiation in the DG. The DG of the hippocampus is a critical neurogenic region in the brain that continuously generates new neurons throughout adulthood. Approximately onethird of DG neurons lost during adulthood are replaced by adultborn neurons (22). Here, we evaluated the differences in Sox2 (marker of neural stem and progenitor cells), doublecortin (Dcx; an immature neuroblast marker), and Ki67 (a proliferating cell marker) immunolabelling in the DG. Sox2 immunolabeling costaining with Ki67 is reduced in the DG of animals on 6 weeks on a CDAA diet and increased upon livertargeted therapy for MASLD (Fig.4A). Both Dcx and Ki67 immunolabeling in the DG are decreased in CDAA diet–fed rodents. Otherwise, livertargeted siRNACnnm4 GalNAc conjugate treatment restores control levels of the Ki67 and Dcx (Fig.4, B and C). Moreover, the hippocampal expressions of CXC chemokine 1 and 2 ligands (Cxcl1 and Cxcl2), important for neurogenesis (23), are diminished in the hippocampus of rodents on a 6week CDAA, and upon MASLD livertargeted therapy, their expression is tendentially restored to control levels (fig.S4A). Transcription factors are crucial in orchestrating the correct cellspecific and temporal expression of all factors involved in neurogenesis. The transcription factor adenosine 3′,5′- monophosphate response element–binding protein (CREB) is critical for efficient neurogenesis and is involved in the differentiation process (24). To further characterize the processes of neurogenesis and neuronal differentiation, we studied CREB phosphorylation (pCreb) alone or in combination with DCX and costaining of DCX and Ki67. In addition, we also performed immunostaining for markers of mature neurons [β, tubulinIII (Tuj1), and calbindin]. The pCreb is reduced after 6 weeks on a CDAA diet and restored upon livertargeted therapy of MASLD, as it is also the Dcx immunolabeling costaining with pCreb (Fig.4D). In contrast, Dcx immunolabeling costaining with Ki67 is not significantly altered after dietary intervention or treatment (fig.S5A), with Dcx immunostaining with pCREB being significantly reduced after 6 weeks of CDAA and its expression restored upon livertargeted treatment in MASLD. Last, we also observed that the CDAA diet for 6 weeks reduced the immunolabeling in the DG of markers of mature neurons (Tuj1 and calbindin), being its expression restored to healthy control levels after livertargeted therapy (fig.S5B). In summary, our data show that livertargeted therapy in MASLD increases the expression of DG neural stem/progenitor, neurogenesis, and neuronal differentiation markers. Behavioral and cellular alterations in an experimental model of advanced diet–induced MASLD after livertargeted therapy Next, we completed a similar battery of experiments in a mouse model with more severe MASLD, putting animals on a CDAHFD for 6 weeks. These nonobese, noninsulinresistant animals (13) are characterized by overt macrosteatosis, inflammation, and significant liver fibrosis (Fig.5, A and B). In this group of animals, we performed magnetic resonance spectroscopy (MRS) of liver intrahepatic lipids and observed that after 6 weeks on a CDAHFD, there is a higher enrichment in unsaturated triglycerides than the saturated component of triglycerides (fig.S6A). These animals are characterized by augmented serum transaminases already at week 3 of dietary intervention and significantly augmented serum ammonia after 6 weeks of diet (Fig.5, C to E). This model of dietinduced MASLD is characterized by altered social memory index (Fig.5F) and reduced ASR (Fig.5G). No alterations were observed in the open field, object recognition, Ymaze (working memory), Ymaze (spatial memory), PPI acoustic startle response tests between CDAHFDfed rodents and control animals (fig.S7, A to D). In agreement, MRS of the hippocampus region at 6 weeks of CDAHFD shows decreased abundance of metabolites such as creatinine, glycerophosphocholine, and inositol. These changes were specific to the hippocampus, as these were not observed in the prefrontal cortex of animals for 6 weeks on CDAHFD (fig.S6, B and C). Notably, the choline derivative Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 6 of 18 Fig. 3. Parvalbumin (PV) interneurons and hippocampal dendritic spine density in experimental models of dietinduced MASLD after livertargeted therapy. (A) immunofluorescence staining of Pv in neurons of the hippocampus region and dendritic spine density in (B) hippocampus CA1 region, (C) hippocampus CA3 region, and (D) the prefrontal cortex region in C57Bl/6J 3monthold male mice randomly separated into three groups: animals on a standard chow diet, animals on a CDAA diet for 6 weeks, or animals on CDAA for 6 weeks where livertargeted therapy with GalnAcsiRnA for Cnnm4 conjugates was given at week 3 of dietary intervention. Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 7 of 18 Fig. 4. Hippocampal neurogenesis in experimental models of dietinduced MASLD after livertargeted therapy. immunofluorescence staining and quantifications of (A) Sox2 and Ki67, (B) Dcx, (C) Ki67, and (D) Dcx and phosphorylated Creb (pCreb) in the DG region in C57Bl/6J 3monthold male mice randomly separated into three groups: animals on a standard chow diet, animals on a CDAA diet for 6 weeks, or animals on CDAA for 6 weeks where livertargeted therapy with GalnAcsiRnA for Cnnm4 (Cyclin and CBS domain divalent metal cation transport mediator 4) conjugates was given at week 3 of dietary intervention. Ct, control. Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 8 of 18 Fig. 5. Neurocognitive and sensorimotor processing in experimental models of advanced diet–induced MASLD. (A) hepatic h&e, Oil Red staining of lipids, Sirius Red staining of collagen fibers, and ihC analysis of F4/80, a membrane macrophage marker. Scale bars, 20 μm. (B) Weight of animals. Serum transaminases, (C) ASt and (D) Alt serum levels. (E) Serum ammonia levels. (F) threechamber sociality test (social preference and social novelty) and (G) acoustic startle response (ASR) test in C57Bl/6J 3monthold male mice randomly separated into two groups: animals on a diet devoid of choline with 0.1% methionine and high fat–enriched (CDAhFD) for 6 weeks or rodents on a standard chow diet (control). Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 9 of 18 glycerophosphocholine is an important precursor of the neurotransmitter acetylcholine and plays important roles in brain and nervous system function. Moreover, animals on a CDAHFD already present reduced immunolabeling staining for hippocampal PV+ interneurons and a nonsignificant reduction of hippocampal neurogenesis indicators, Ki67 and Dcx, at 3 weeks of CDAHFD, which worsens and are statistically significant at 6 weeks of CDAHFD (fig.S8, A and B). At 3 weeks of diet, CDAHFDfed rodents were treated with a single subcutaneous injection of the GalNAcsiRNA for Cnnm4 livertargeted therapy. As previously reported (14), treatment with siRNACnnm4GalNAc to CDAHFD-fed rodents reduced liver Cnnm4 expression while decreasing liver steatosis and inflammation, without significant changes in weight relative to vehicletreated CDAAfed mice (Fig.6, A and B). Treatment with siRNACnnm4GalNAc to CDAHFDfed rodents results in a nonsignificant increase in the immunolabeling staining for PV neurons (Fig.6C) and a significant augmentation of Dcx, while Ki67 is increased, although not statistically significant (Fig.6, D and E). Overall, livertargeted siRNA therapy partially restores social memory, sensorimotor processing, and hippocampal alterations in advanced diet–induced MASLD mice, recapitulating findings from the early CDAA diet model. Hippocampal proteomic changes in experimental models of advanced diet–induced MASLD after livertargeted therapy The indepth identification of hippocampal protein expression changes is critical for understanding the mechanisms underlying MASLDinduced alterations and MASLD recovery. We identified 122 differentially expressed proteins in the hippocampus of animals fed a CDAHFD diet compared to control animals, with 13 significantly upregulated and 108 downregulated proteins (Fig.7A). Functional enrichment using Ingenuity Pathway Analysis (IPA) revealed strong inhibition (zscore<−2) of the synaptogenesis signaling pathway and oxidative phosphorylation (synaptogenesis signaling pathway zscore=−2.646 and oxidative phosphorylation zscore= −2.236), along with activation (zscore>2) of the mitochondrial dysfunction canonical pathway (mitochondrial dysfunction zscore=2.646). In addition, we analyzed the hippocampal proteome following livertargeted reversal of MASLD using siRNACnnm4GalNAc conjugates in CDAAfed animals. Volcano plots displaying the differentially regulated proteins are shown inFig.7B. IPA analysis of canonical pathways based on differentially expressed proteins in both the hippocampus and prefrontal cortex, comparing animals fed a CDAHFD diet for 6 weeks with those receiving Cnnm4GalNAc therapy, is presented in tablesS1 and S2, respectively. In the hippocampus, proteins whose expression was downregulated by the CDAHFD diet and restored upon treatment include SRP54 (signal recognition particle subunit SRP54), PLCB1 (1phosphatidylinositol 4,5bisphosphate phosphodiesterase β1), CAMSAP3 (calmodulinregulated spectrinassociated protein 3), TRAPPC11 (trafficking protein particle complex subunit 11), and CPNE2 (copine II) (Fig.7C). These proteins are involved in calcium signaling, membrane trafficking, and processes related to endoplasmic reticulum–to–Golgi transport. Upstream regulator analyses by IPA of hippocampal proteins regulated in livertargeted treated rodents suggest that KLF3 (Krüppellike factor 3) is a transcription regulator predicted to be activated (Fig.7D). KLF3 is a transcription factor highly expressed in the adult hippocampus, particularly in the DG (www.proteinatlas.org). Immunolabeling analysis of Klf3 staining does not show significant differences between the control group, animals on CDAHFD diet, or livertargeted treated MASLD animals (fig.S9A). Previous results showed that KLF3 is a fundamental suppressor that operates as a feedback inhibitor of RELA/p65 and may be important in facilitating the resolution of inflammation (25). Other results showed that KLF3 activates the WNT signaling pathway in gastric cancer (26) and WNT is highly relevant in neurogenesis activity (27). Here, we confirmed by chromatin immunoprecipitation (ChIP) assay that in MASLD mouse biopsies of the hippocampus of livertargeted treated animals, Klf3 binding to the promoter region is augmented in several genes involved in neurogenesis, such as proliferating cell nuclear antigen (Pcna) and Wnt1. In agreement, Pcna and Wnt1 mRNA levels are augmented upon livertargeted therapy in MASLD mice (Fig.7, E and F). In summary, livertargeted therapy in MASLD is associated with increased transcriptional activity of hippocampal KLF3 that plays a role in regulating several genes involved in DG neurogenesis. DISCUSSION MASLD is now understood as a systemic condition, extending beyond hepatic manifestations to increase the risk of cardiometabolic diseases (27), chronic kidney disease (28), and intrahepatic and extrahepatic cancers (1–3,28). To isolate liverspecific effects, we used two nonobese, nondiabetic dietary mouse models of MASLD (CDAA and CDAHFD) and observed altered social behavior and impaired sensorimotor gating after 6 weeks of feeding. These effects were reversed by a single administration of a livertargeted siRNA therapy (GalNAcsiRNA against Cnnm4), previously shown to ameliorate hepatic inflammation and fibrosis without affecting body weight (14). These findings point to a liveroriginated mechanism contributing to MASLDassociated alterations of specific neurocognitive behavioral dysfunction, independent of systemic metabolic derangements. As a limitation of this study, only male animals were used. Although earlier results have demonstrated that young adult female mice exhibit protection against MASLD (29) and, in humans, MASLD more often affects men while premenopausal women are protected from developing MASLD (30), future studies in female mice will broaden our observations on the brainliver axis in MASLD. While methionineand cholinedeficient diets are established tools for inducing MASLD in mice (13), they may also affect brain function directly, given the roles of methionine and choline in neurotransmitter synthesis and neuronal signaling (31,32). Low choline intake has been linked to increased risk of dementia, Alzheimer’s disease, and Parkinson’s disease (33), as well as higher anxiety and depression levels (34,35). However, the cognitive improvements we observed following hepatocytespecific therapy, despite continued dietary restriction, support a direct contribution of the liver to the observed brain alterations. A recent MRIbased study showed hippocampal atrophy in patients with MASLD, particularly in subregions linked to memory such as the subiculum and presubiculum (19). The hippocampus is a key integrative hub for memory, emotional regulation, and sensorimotor processing (36,37). In our study, we have found that MASLD mice present altered social behavior and impaired sensorimotor gating. To date, evidence on the role of the hippocampus in regulating these behavioral domains is limited. The hippocampus is not a primary regulator of spontaneous social exploration, being more linked to social memory, especially of familiar conspecifics (38). Otherwise, social exploration/sociability is more directly regulated by other brain areas, such as the amygdala, medial prefrontal cortex, Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 16 of 18 (pH 8), and 500 mM NaCl], LiCl wash buffer [0.25 M LiCl, 1% NP40, 1% sodium deoxycholate, 1 mM EDTA, and 10 mM trisHCl (pH 8.1)], and TE buffer [10 mM trisHCl (pH 8.0) and 1 mM EDTA]. After the washes, DNAprotein complexes were eluted using elution buffer (1% SDS, 0.1 M NaHCO3, and 200 μl per condition) with agitation for 15min, followed by centrifugation at 2000g for 1min. The elution step was repeated once, and both eluates were combined in a single tube. To reverse DNAprotein crosslinks and release DNA, samples were incubated for 4 hours at 65°C in 200 mM NaCl. At this stage, the input DNA samples were also processed. To remove residual proteins, samples were incubated for 1 hour at 45°C in a solution containing 10 mM EDTA, 40 mM trisHCl (pH 6.5), and Proteinase K (40 μg/ml; Roche). Last, the immunoprecipitated DNA was purified using ChIP DNA clean and concentrator columns (Zymo Research), specifically designed for samples containing SDS. DNAprotein binding was quantified by realtime PCR using a StepOne instrument (Applied Biosystems) and regionspecific primers targeting each analyzed promoter region. Results are expressed as a percentage relative to input DNA, subtracting the signal obtained under the noantibody control condition. Sequence chip is as follows: Wnt1 promoter, 5′- TTTGCTCAGCCTACCCCTAC (forward) and 5′- CCTACGCTGTGGTCTCTTCT (reverse); Pcna promoter, 5′-ACCAACAACCTCCCAGAACA (forward) and 5′-GCAGGTATGAGTGAGCATGC (reverse). Statistical analysis Statistical significance was determined using Prism 10 (GraphPad Software, RRID:SCR_000306). Different statistical analysis was performed to interrogate statistical significance. In case that two groups were compared, an unpaired t test with Welch’s correction was applied to examine the statistical difference. When three groups were compared, an ordinary oneway analysis of variance (ANOVA) was used, and in case that significance was found, a post hoc Tukey test was used to detect differences between groups. Last, for the analysis of the ASR at different decibels, a twoway factorial ANOVA was used to find statistical differences, followed by multiple comparisons to compare column means. A P<0.05 was considered statistically different. P values are represented in each graph where data are represented as means±SEM, and each animal is represented as an individual point. At least five animals were used for each comparison. Supplementary Materials This PDF file includes: Figs.S1 to S9 tablesS1 to S3 REFERENCES AND NOTES 1. european Association for the Study of the liver (eASl), european Association for the Study of Diabetes (eASD), european Association for the Study of Obesity (eASO), eASleASDeASO clinical practice guidelines on the management of metabolic dysfunctionassociated steatotic liver disease (MASlD). Obes. Facts 17, 374–444 (2024). 2. e. Kaya, Y. Yilmaz, Metabolicassociated fatty liver disease (MAFlD): A multisystemic disease beyond the liver. J. Clin. Transl. Hepatol. 10, 329–338 (2022). 3. G. targher, A. lonardo, C. D. Byrne, nonalcoholic fatty liver disease and chronic vascular complications of diabetes mellitus. Nat. Rev. Endocrinol. 14, 99–114 (2018). 4. l. Wang, B. Sang, Z. Zheng, Risk of dementia or cognitive impairment in nonalcoholic fatty liver disease: A systematic review and metaanalysis. Front. Aging Neurosci. 14, 985109 (2022). 5. G. Weinstein, A. O’Donnell, S. Frenzel, t. Xiao, A. Yaqub, P. Yilmaz, R. J. de Knegt, G. e. Maestre, D. Melo van lent, M. long, M. GireudGoss, t. ittermann, F. Frost, R. Bulow, R. S. vasan, h. J. Grabe, M. A. ikram, A. S. Beiser, S. Seshadri, nonalcoholic fatty liver disease, liver fibrosis, and structural brain imaging: the CrossCohort Collaboration. Eur. J. Neurol. 31, e16048 (2024). 6. S. e. Kanoski, t. l. Davidson, Different patterns of memory impairments accompany shortand longerterm maintenance on a highenergy diet. J. Exp. Psychol. Anim. Behav. Process. 36, 313–319 (2010). 7. S. e. MackeyAlfonso, M. J. Butler, A. M. taylor, A. R. WilliamsMedina, S. M. Muscat, h. Fu, R. M. Barrientos, Shortterm high fat diet impairs memory, exacerbates the neuroimmune response, and evokes synaptic degradation via a complementdependent mechanism in a mouse model of Alzheimer’s disease. Brain Behav. Immun. 121, 56–69 (2024). 8. B. W. Campillo, D. Galguera, S. Cerdan, P. lópezlarrubia, B. lizarbe, Shortterm highfat diet alters the mouse brain magnetic resonance imaging parameters consistently with neuroinflammation on males and metabolic rearrangements on females. A preclinical study with an optimized selection of linear mixedeffects models. Front. Neurosci. 16, 1025108 (2022). 9. A. hadjihambi, C. Konstantinou, J. Klohs, K. Monsorno, A. le Guennec, C. Donnelly, i. J. Cox, A. Kusumbe, P. S. hosford, U. Soffientini, S. lecca, M. Mameli, R. Jalan, R. C. Paolicelli, l. Pellerin, Partial MCt1 invalidation protects against dietinduced nonalcoholic fatty liver disease and the associated brain dysfunction. J. Hepatol. 78, 180–190 (2023). 10. A. C. D. Mikkelsen, K. Kjaergaard, A. h. v. Schapira, R. P. Mookerjee, K. l. thomsen, the liverbrain axis in metabolic dysfunctionassociated steatotic liver disease. Lancet Gastroenterol. Hepatol. 10, 248–258 (2025). 11. S. A. harrison, R. taub, G. W. neff, K. J. lucas, D. labriola, S. e. Moussa, n. Alkhouri, M. R. Bashir, Resmetirom for nonalcoholic fatty liver disease: A randomized, doubleblind, placebocontrolled phase 3 trial. Nat. Med. 29, 2919–2928 (2023). 12. e. e. Powell, A new treatment and updated clinical practice guidelines for MASlD. Nat. Rev. Gastroenterol. Hepatol. 22, 88–89 (2025). 13. M. MercadoGómez, n. GoikoetxeaUsandizaga, A. J. C. Kerbert, l. U. Gracianteparaluceta, M. SerranoMaciá, S. lachiondoOrtega, R. RodriguezAgudo, C. GilPitarch, J. Simón, i. GonzálezRecio, M. F. Fondevila, P. SantamarinaOjeda, M. F. Fraga, R. nogueiras, J. de las heras, R. Jalan, M. l. MartínezChantar, t. C. Delgado, the lipopolysaccharidetlR4 axis regulates hepatic glutaminase 1 expression promoting liver ammonia buildup as steatotic liver disease progresses to steatohepatitis. Metabolism 158, 155952 (2024). 14. J. Simon, n. GoikoetxeaUsandizaga, M. SerranoMacia, D. FernandezRamos, D. Saenz de Urturi, J. J. Gruskos, P. Fernandeztussy, S. lachiondoOrtega, i. GonzalezRecio, R. RodriguezAgudo, v. GutierrezdeJuan, B. Rodrigueziruretagoyena, M. varelaRey, P. GimenezMascarell, M. MercadoGomez, B. GomezSantos, C. FernandezRodriguez, F. lopitzOtsoa, M. Bizkarguenaga, S. Dames, U. Schaeper, F. Martin, G. Sabio, P. iruzubieta, J. Crespo, P. Aspichueta, K. h. Chu, D. Buccella, C. Martin, t. C. Delgado, l. A. MartinezCruz, M. l. MartinezChantar, Magnesium accumulation upon cyclin M4 silencing activates microsomal triglyceride transfer protein improving nASh. J. Hepatol. 75, 34–45 (2021). 15. C. GilPitarch, M. SerranoMacia, J. Simon, l. Mosca, C. Conter, C. M. RejanoGordillo, l. e. ZapataPavas, P. PenaSanfelix, M. Azkargorta, R. RodriguezAgudo, S. lachiondoOrtega, M. MercadoGomez, t. C. Delgado, M. Porcelli, i. Aurrekoetxea, J. D. Sutherland, R. Barrio, D. Xirodimas, P. Aspichueta, F. elortza, l. A. MartinezCruz, R. nogueiras, P. iruzubieta, J. Crespo, S. Masson, M. v. McCain, h. l. Reeves, R. J. Andrade, M. i. lucena, U. Mayor, n. GoikoetxeaUsandizaga, i. GonzalezRecio, M. l. MartinezChantar, neddylation inhibition prevents acetaminopheninduced liver damage by enhancing the anabolic cardiolipin pathway. Cell Rep. Med. 5, 101653 (2024). 16. i. GonzalezRecio, n. GoikoetxeaUsandizaga, C. M. RejanoGordillo, C. Conter, R. Rodriguez Agudo, M. SerranoMacia, l. e. ZapataPavas, P. PenaSanfelix, M. Azkargorta, F. elortza, J. M. herranz, A. Guillamon thiery, A. R. GuerraRuiz, R. Jover, U. GaliciaGarcia, C. Martin, U. Schaeper, t. C. Delgado, i. DiazMoreno, A. Diaz Quintana, D. Buccella, R. nogueiras, J. Argemi, M. A. Avila, J. GratacosGines, P. iruzubieta, e. Pose, R. Bataller, J. Crespo, l. A. MartinezCruz, M. l. MartinezChantar, Modulatory effects of CnnM4 on proteinlisoaspartylOmethyltransferase repair function during alcoholinduced hepatic damage. Hepatology 82, 388–404 (2024). 17. J. J. Gallego, M. P. Ballester, A. Fiorillo, F. CasanovaFerrer, A. lopezGramaje, A. Urios, Y. M. Arenas, M. P. Rios, l. Durban, J. Megias, t. SanMiguel, S. Benlloch, P. lluch, R. Jalan, C. Montoliu, Ammonia and beyond - Biomarkers of hepatic encephalopathy. Metab. Brain Dis. 40, 100 (2025). 18. D. G. Kim, e. l. Gonzales, S. Kim, Y. Kim, K. J. Adil, S. J. Jeon, K. S. Cho, K. J. Kwon, C. Y. Shin, Social interaction test in home cage as a novel and ethological measure of social behavior in mice. Exp. Neurobiol. 28, 247–260 (2019). 19. Y. Miao, B. Zhang, X. Sun, X. Ma, D. Fang, W. Zhang, t. Wu, X. Xu, C. Yu, Y. hou, Q. Ding, S. Yang, l. Fu, Z. Zhang, Y. Bi, the presence and severity of nAFlD are associated with cognitive impairment and hippocampal damage. J. Clin. Endocrinol. Metab. 108, 3239–3249 (2023). 20. A. P. Ross, e. C. Bruggeman, A. W. Kasumu, J. G. Mielke, M. B. Parent, nonalcoholic fatty liver disease impairs hippocampaldependent memory in male rats. Physiol. Behav. 106, 133–141 (2012). Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 17 of 18 21. S. hijazi, A. B. Smit, R. e. van Kesteren, Fastspiking parvalbuminpositive interneurons in brain physiology and Alzheimer’s disease. Mol. Psychiatry 28, 4954–4967 (2023). 22. K. l. Spalding, O. Bergmann, K. Alkass, S. Bernard, M. Salehpour, h. B. huttner, e. Bostrom, i. Westerlund, C. vial, B. A. Buchholz, G. Possnert, D. C. Mash, h. Druid, J. Frisen, Dynamics of hippocampal neurogenesis in adult humans. Cell 153, 1219–1227 (2013). 23. A. t. Deftu, R. Ciorescu, R. O. Gheorghe, D. Mihailescu, v. Ristoiu, CXCl1 and CXCl2 inhibit the axon outgrowth in a timeand celltypedependent manner in adult rat dorsal root ganglia neurons. Neurochem. Res. 44, 2215–2229 (2019). 24. K. Merz, S. herold, D. C. lie, CReB in adult neurogenesis – Master and partner in the development of adultborn neurons? Eur. J. Neurosci. 33, 1078–1086 (2011). 25. A. J. Knights, l. Yang, M. Shah, l. J. norton, G. S. Green, e. S. Stout, e. J. vohralik, M. Crossley, K. G. R. Quinlan, Kruppellike factor 3 (KlF3) suppresses nFκBdriven inflammation in mice. J. Biol. Chem. 295, 6080–6091 (2020). 26. W. Shen, l. Yuan, B. hao, J. Xiang, F. Cheng, Z. Wu, X. li, KlF3 promotes colorectal cancer growth by activating Wnt1. Aging 16, 2475–2493 (2024). 27. D. C. lie, S. A. Colamarino, h. J. Song, l. Desire, h. Mira, A. Consiglio, e. S. lein, S. Jessberger, h. lansford, A. R. Dearie, F. h. Gage, Wnt signalling regulates adult hippocampal neurogenesis. Nature 437, 1370–1375 (2005). 28. Z. M. Younossi, M. Kalligeros, l. henry, epidemiology of metabolic dysfunctionassociated steatotic liver disease. Clin. Mol. Hepatol. 31, S32–S50 (2025). 29. M. A. islam, R. Khairnar, J. Fleishman, S. e. Reznik, l. Ragolia, S. Gobbooru, S. Kumar, Female C57Bl/6 mice exhibit protection against nonalcoholic fatty liver disease and diabesity accompanied by differential regulation of hepatic lipocalin prostaglandin D2 synthase. Mol. Cell. Endocrinol. 595, 112404 (2025). 30. S. Ballestri, F. nascimbeni, e. Baldelli, A. Marrazzo, D. Romagnoli, A. lonardo, nAFlD as a sexual dimorphic disease: Role of gender and reproductive status in the development and progression of nonalcoholic fatty liver disease and inherent cardiovascular risk. Adv. Ther. 34, 1291–1326 (2017). 31. S. n. Young, M. Shalchi, the effect of methionine and Sadenosylmethionine on Sadenosylmethionine levels in the rat brain. J. Psychiatry Neurosci. 30, 44–48 (2005). 32. D. B. vučević, i. B. Cerović, D. R. Mladenović, M. n. vesković, i. Stevanović, B. Z. Jorgačević, R. J. vukićević, t. S. Radosavljević, Methioninecholine deprivation alters liver and brain acetylcholinesterase activity in C57Bl6 mice. Gen. Physiol. Biophys. 35, 363–370 (2016). 33. J. Yuan, X. liu, C. liu, A. F. Ang, J. Massaro, S. A. Devine, S. h. Auerbach, J. K. Blusztajn, R. Au, P. F. Jacques, is dietary choline intake related to dementia and Alzheimer’s disease risks? Results from the Framingham heart Study. Am. J. Clin. Nutr. 116, 1201–1207 (2022). 34. i. Bjelland, G. S. tell, S. e. vollset, S. Konstantinova, P. M. Ueland, Choline in anxiety and depression: the hordaland health Study. Am. J. Clin. Nutr. 90, 1056–1060 (2009). 35. J. li, X. Kang, l. Zhang, J. luo, D. Zhang, Dietary choline is inversely associated with depressive symptoms: A crosssectional study of the national health and nutrition examination Survey (nhAneS) 2011 to 2018. J. Affect. Disord. 301, 23–29 (2022). 36. e. Kong, K.- h. lee, J. Do, P. Kim, D. lee, Dynamic and stable hippocampal representations of social identity and reward expectation support associative social memory in male mice. Nat. Commun. 14, 2597 (2023). 37. Y. lee, M. Davis, Role of the hippocampus, the bed nucleus of the stria terminalis, and the amygdala in the excitatory effect of corticotropinreleasing hormone on the acoustic startle reflex. J. Neurosci. 17, 6434–6446 (1997). 38. t. Okuyama, Social memory engram in the hippocampus. Neurosci. Res. 129, 17–23 (2018). 39. J. Ko, neuroanatomical substrates of rodent social behavior: the medial prefrontal cortex and its projection patterns. Front. Neural Circuits 11, 41 (2017). 40. C. lieberwirth, Z. Wang, Social bonding: Regulation by neuropeptides. Front. Neurosci. 8, 171 (2014). 41. M. Fendt, M. Koch, Cholinergic modulation of the acoustic startle response in the caudal pontine reticular nucleus of the rat. Eur. J. Pharmacol. 370, 101–107 (1999). 42. M. Castle, e. Comoli, A. D. loewy, Autonomic brainstem nuclei are linked to the hippocampus. Neuroscience 134, 657–669 (2005). 43. A. Foggetti, G. Baccini, P. Arnold, t. Schiffelholz, P. Wulff, Spiny and nonspiny parvalbuminpositive hippocampal interneurons show different plastic properties. Cell Rep. 27, 3725–3732.e5 (2019). 44. Y. Z. Gao, K. liu, X. M. Wu, C. n. Shi, Q. l. he, h. P. Wu, J. J. Yang, h. Yao, M. h. Ji, Oxidative stressmediated loss of hippocampal parvalbumin interneurons contributes to memory precision decline after acute sleep deprivation. Mol. Neurobiol. 62, 5377–5394 (2025). 45. P. Steullet, h. C. neijt, M. Cuenod, K. Q. Do, Synaptic plasticity impairment and hypofunction of nMDA receptors induced by glutathione deficit: Relevance to schizophrenia. Neuroscience 137, 807–819 (2006). 46. Q. Zhou, K. J. homma, M. M. Poo, Shrinkage of dendritic spines associated with longterm depression of hippocampal synapses. Neuron 44, 749–757 (2004). 47. Z. Chen, Y.- Y. Xu, R. Wu, Y.- X. han, Y. Yu, J.- F. Ge, F.- h. Chen, impaired learning and memory in rats induced by a highfat diet: involvement with the imbalance of nesfatin1 abundance and copine 6 expression. J. Neuroendocrinol. 29, 10.1111/jne.12462 (2017). 48. K. Burk, B. Ramachandran, S. Ahmed, J. i. hurtadoZavala, A. Awasthi, e. Benito, R. Faram, h. Ahmad, A. Swaminathan, J. Mcilhinney, A. Fischer, P. Perestenko, C. Dean, Regulation of dendritic spine morphology in hippocampal neurons by copine6. Cereb. Cortex 28, 1087–1104 (2018). 49. A. Gorlach, K. Bertram, S. hudecova, O. Krizanova, Calcium and ROS: A mutual interplay. Redox Biol. 6, 260–271 (2015). 50. G. l. Ming, h. Song, Adult neurogenesis in the mammalian brain: Significant answers and significant questions. Neuron 70, 687–702 (2011). 51. M. Boldrini, C. A. Fulmore, A. n. tartt, l. R. Simeon, i. Pavlova, v. Poposka, G. B. Rosoklija, A. Stankov, v. Arango, A. J. Dwork, R. hen, J. J. Mann, human hippocampal neurogenesis persists throughout aging. Cell Stem Cell 22, 589–599.e5 (2018). 52. M. K. tobin, K. Musaraca, A. Disouky, A. Shetti, A. Bheri, W. G. honer, n. Kim, R. J. Dawe, D. A. Bennett, K. Arfanakis, O. lazarov, human hippocampal neurogenesis persists in aged adults and Alzheimer’s disease patients. Cell Stem Cell 24, 974–982.e3 (2019). 53. G. Kempermann, F. h. Gage, l. Aigner, h. Song, M. A. Curtis, S. thuret, h. G. Kuhn, S. Jessberger, P. W. Frankland, h. A. Cameron, e. Gould, R. hen, D. n. Abrous, n. toni, A. F. Schinder, X. Zhao, P. J. lucassen, J. Frisen, human adult neurogenesis: evidence and remaining questions. Cell Stem Cell 23, 25–30 (2018). 54. e. P. MorenoJimenez, M. FlorGarcia, J. terrerosRoncal, A. Rabano, F. Cafini, n. PallasBazarra, J. Avila, M. llorensMartin, Adult hippocampal neurogenesis is abundant in neurologically healthy subjects and drops sharply in patients with Alzheimer’s disease. Nat. Med. 25, 554–560 (2019). 55. A. n. tartt, C. A. Fulmore, Y. liu, G. B. Rosoklija, A. J. Dwork, v. Arango, R. hen, J. J. Mann, M. Boldrini, Considerations for assessing the extent of hippocampal neurogenesis in the adult and aging human brain. Cell Stem Cell 23, 782–783 (2018). 56. S. F. Sorrells, M. F. Paredes, A. CebrianSilla, K. Sandoval, D. Qi, K. W. Kelley, D. James, S. Mayer, J. Chang, K. i. Auguste, e. F. Chang, A. J. Gutierrez, A. R. Kriegstein, G. W. Mathern, M. C. Oldham, e. J. huang, J. M. Garciaverdugo, Z. Yang, A. AlvarezBuylla, human hippocampal neurogenesis drops sharply in children to undetectable levels in adults. Nature 555, 377–381 (2018). 57. J. W. Kim, K. R. hahn, D. Y. Yoo, h. Y. Jung, i. K. hwang, J. K. Seong, Y. S. Yoon, Methioninecholine deprivation impairs adult hippocampal neurogenesis in C57Bl/6 mice. J. Med. Food 22, 344–354 (2019). 58. C. l. Wang, R. Ohkubo, W. C. Mu, W. Chen, J. l. Fan, Z. Song, A. Maruichi, P. h. Sudmant, A. O. Pisco, D. B. Dubal, n. Ji, D. Chen, the mitochondrial unfolded protein response regulates hippocampal neural stem cell aging. Cell Metab. 35, 996–1008.e7 (2023). 59. h. Weina, n. Yuhu, h. Christian, l. Birong, S. Feiyu, W. le, liraglutide attenuates the depressiveand anxietylike behaviour in the corticosterone induced depression model via improving hippocampal neural plasticity. Brain Res. 1694, 55–62 (2018). 60. X. Wang, J. e. lee, R. i. Dorsky, identification of Wntresponsive cells in the zebrafish hypothalamus. Zebrafish 6, 49–58 (2009). 61. J. Kriska, l. Janeckova, D. Kirdajova, P. honsa, t. Knotek, D. Dzamba, D. Kolenicova, O. Butenko, M. vojtechova, M. Capek, Z. Kozmik, M. M. taketo, v. Korinek, M. Anderova, Wnt/βcatenin signaling promotes differentiation of ischemiaactivated adult neural stem/progenitor cells to neuronal precursors. Front. Neurosci. 15, 628983 (2021). 62. J. Simon, M. nunezGarcia, P. Fernandeztussy, l. Barbiertorres, D. FernandezRamos, B. GomezSantos, X. Buque, F. lopitzOtsoa, n. GoikoetxeaUsandizaga, M. SerranoMacia, R. RodriguezAgudo, M. Bizkarguenaga, i. ZubieteFranco, v. Gutierrezde Juan, D. Cabrera, C. Alonso, P. iruzubieta, M. RomeroGomez, S. van liempd, A. Castro, R. nogueiras, M. varelaRey, J. M. FalconPerez, e. villa, J. Crespo, S. C. lu, J. M. Mato, P. Aspichueta, t. C. Delgado, M. l. MartinezChantar, targeting hepatic glutaminase 1 ameliorates nonalcoholic steatohepatitis by restoring verylowdensity lipoprotein triglyceride assembly. Cell Metab. 31, 605–622.e10 (2020). 63. v. GutierrezdeJuan, S. lopez de Davalillo, D. FernandezRamos, l. Barbiertorres, i. ZubieteFranco, P. Fernandeztussy, J. Simon, F. lopitzOtsoa, J. de las heras, P. iruzubieta, M. t. Ariasloste, e. villa, J. Crespo, R. Andrade, M. i. lucena, M. varelaRey, S. C. lu, J. M. Mato, t. C. Delgado, M. l. MartinezChantar, A morphological method for ammonia detection in liver. PLOS ONE 12, e0173914 (2017). 64. F. De Chiara, K. l. thomsen, A. habtesion, h. Jones, n. Davies, J. GraciaSancho, n. Manicardi, A. hall, F. Andreola, h. l. Paish, l. h. Reed, A. A. Watson, J. leslie, F. Oakley, K. Rombouts, R. P. Mookerjee, J. Mann, R. Jalan, Ammonia scavenging prevents progression of fibrosis in experimental nonalcoholic fatty liver disease. Hepatology 71, 874–892 (2020). 65. F. De Chiara, S. heeboll, G. Marrone, C. Montoliu, S. hamiltonDutoit, A. Ferrandez, F. Andreola, K. Rombouts, h. Gronbaek, v. Felipo, J. GraciaSancho, R. P. Mookerjee, h. vilstrup, R. Jalan, K. l. thomsen, Urea cycle dysregulation in nonalcoholic fatty liver disease. J. Hepatol. 69, 905–915 (2018). 66. h. hagihara, K. toyama, n. Yamasaki, t. Miyakawa, Dissection of hippocampal dentate gyrus from adult mouse. J. Vis. Exp., 1543 (2009). 67. J. l. Silverman, M. Yang, C. lord, J. n. Crawley, Behavioural phenotyping assays for mouse models of autism. Nat. Rev. Neurosci. 11, 490–502 (2010). Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025
Cardoso Delgado et al., Sci. Adv. 11, eady9758 (2025) 22 October 2025 SCienCe ADvAnCeS | ReSeARCh ARtiCle 18 of 18 68. Q. li, C. Cheung, R. Wei, e. S. hui, J. Feldon, U. Meyer, S. Chung, S. e. Chua, P. C. Sham, e. X. Wu, G. M. McAlonan, Prenatal immune challenge is an environmental risk factor for brain and behavior change relevant to schizophrenia: evidence from MRi in a mouse model. PLOS ONE 4, e6354 (2009). 69. e. M. Glaser, h. van der loos, Analysis of thick brain sections by obversereverse computer microscopy: Application of a new, high clarity Golginissl stain. J. Neurosci. Methods 4, 117–125 (1981). 70. n. Ramamonjisoa, h. Ratiney, e. Mutel, h. Guillou, G. Mithieux, F. Pilleul, F. Rajas, O. Beuf, S. Cavassila, in vivo hepatic lipid quantification using MRS at 7 tesla in a mouse model of glycogen storage disease type 1a. J. Lipid Res. 54, 2010–2022 (2013). 71. M. Wilson, G. Reynolds, R. A. Kauppinen, t. n. Arvanitis, A. C. Peet, A constrained leastsquares approach to the automated quantitation of invivo 1h magnetic resonance spectroscopy data. Magn. Reson. Med. 65, 1–12 (2011). 72. J. R. Wisniewski, A. Zougman, n. nagaraj, M. Mann, Universal sample preparation method for proteome analysis. Nat. Methods 6, 359–362 (2009). Acknowledgments: We want to acknowledge the valuable technical support of B. R. iruretagoyena, laboratory technician at the liver Disease laboratory in CiC bioGUne. GalnAc siRnACnnm4 was provided from Silence therapeutics Gmbh, Berlin, Germany. Funding: this work was supported by grants from Ministerio de Ciencia, innovación y Universidades MiCinn: CeX2021001136S (to M.l.M.- C.) and MiCinn: PiD2022139395OB100 (to M.l.M.- C.); integrado en el Plan estatal de investigación Científica y técnica e innovación, cofinanciado con Fondos FeDeR; and Project funded by CiBeRehD; 2018 BBvA Foundation Grants for Scientific Research teamsUMBRellA (to M.l.M.- C., M.R.G., and B.C.- F.). t.C.D. is funded by “Ayuda RYC2020029316i financiada por MCin/Aei/10.13039/501100011033 y por el FSe invierte en tu futuro.” this work was supported by grants from Ministerio de Ciencia, innovación y Universidades MiCinn: PiD2020117116OBi00 (to t.C.D.). C.M.- C. was supported by CiBeRSAM (G26) and the instituto de Salud Carlos iii (AC23_2/00034). A.C.S.h. received funding from CiBeRSAM (G26) and the Consejería de Salud y Familias (Rh0063). v.D.R.h. was supported by the Agencia estatal de investigación (PiD2019109405R and Pi00142022). l.e.Z.- P. was supported by a PhD fellowship from the Provincial Section of Bizkaia from the Scientific Foundation of the Spanish Association Against Cancer PRDvZ233980ZAPA. C.M.R.G. was supported by Ayuda Juan de la Cierva JDC2023052761i from the MCin/Aei/10.13039/501100011033–Unión europea nextGenerationeU/PRtR. v.M.- A. was supported by the Miguel Servet contract (CP23/00111) from the iSCiii. this project has also received funding from the european horizon’s research and innovation program hORiZOnhlth2022StAYhlth02 (agreement no. 101095679), Spanish instituto de Salud Carlos iiiFeDeR Grant (FiSPi22/01853) and european UnionnextGenerationeU (PMP21/00112) (to J.C.). Competing interests: M.l.M.- C. advises for Mitotherapeutix llC and is a founder of Gibela therapeutics. All other authors declare that they have no competing interests. Author contributions: Conceptualization: t.C.D., C.G.- P., l.A.M.- C., v.M.- A., M.R.G., B.C.- F., and M.l.M.- C. Writing—original draft: t.C.D., R.n., B.C.- F., and M.l.M.- C. Writing—review and editing: t.C.D., J.l., l.e.Z.- P., R.n., J.C., v.M.- A., A.M.F., M.R.G., B.C.- F., and M.l.M.- C. investigation: t.C.D., C.M.- C., A.C.S.h., A.G.G., C.M.R.G., J.l., R.G.D., n.G.- U., i.G.- R., C.G.- P., l.e.Z.- P., J.A.B.- B., C.C., v.D.R.h., M.A., F.e., v.M.- A., J.C., M.R.G., B.C.- F., and M.l.M.- C. Methodology: t.C.D., A.C.S.h., A.G.G., C.M.R.G., R.G.D., n.G.- U., C.C., v.D.R.h., M.A., F.e., A.M.F., M.R.G., B.C.- F., and M.l.M.- C. Formal analysis: t.C.D., J.l., J.C., C.G.- P., J.A.B.- B., l.A.M.- C., v.M.- A., A.M.F., M.R.G., B.C.- F., and M.l.M.- C. Resources: t.C.D., C.G.- P., R.n., M.R.G., B.C.- F., and M.l.M.- C. validation: J.l., J.A.B.- B., J.C., v.M.- A., M.R.G., B.C.- F., and M.l.M.- C. visualization: t.C.D., J.l., J.C., v.M.- A., M.R.G., B.C.- F., and M.l.M.- C. Data curation: B.C.- F. Funding acquisition: t.C.D., J.A.B.- B., l.A.M.- C., A.M.F., M.R.G., B.C.- F., and M.l.M.- C. Supervision: t.C.D., M.R.G., B.C.- F., and M.l.M.- C. Project administration: t.C.D., B.C.- F., and M.l.M.- C. Data and materials availability: the mass spectrometry proteomics data have been deposited in the ProteomeXchange Consortium via the PRiDe [1] partner repository with the dataset identifier PXD063321 (www.ebi.ac.uk/pride/archive/ projects/PXD063321). All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Submitted 13 May 2025 Accepted 25 September 2025 Published 22 October 2025 10.1126/sciadv.ady9758 Downloaded from https://www.science.org at Universidad de Sevilla on November 03, 2025