S. epidermidis putative toxin-antitoxin module mazEF: the role in VBNC formation and impact on the immune system

Universidade do Minho Escola de Engenharia Vânia da Silva Gaio janeiro de 2022 Vânia da Silva Gaio UMinho|2022 S. epidermidis putative toxin-antitoxin module mazEF: the role in VBNC formation and impact on the immune system S. epidermidis putative toxin-antitoxin module mazEF: the role in VBNC formation and impact on the immune system janeiro de 2022 Doutoramento em Engenharia Biomédica Universidade do Minho Escola de Engenharia Vânia da Silva Gaio Trabalho realizado sob a orientação do Doutor Nuno Cerca da Doutora Ângela França e do Prof. Doutor Manuel Vilanova Tese de Doutoramento Universidade do Minho Escola de Engenharia S. epidermidis putative toxin-antitoxin module mazEF: the role in VBNC formation and impact on the immune system ii DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS Este é um trabalho académico que pode ser utilizado por terceiros desde que respeitadas as regras e boas práticas internacionalmente aceites, no que concerne aos direitos de autor e direitos conexos. Assim, o presente trabalho pode ser utilizado nos termos previstos na licença abaixo indicada. Caso o utilizador necessite de permissão para poder fazer um uso do trabalho em condições não previstas no licenciamento indicado, deverá contactar o autor, através do RepositóriUM da Universidade do Minho. Licença concedida aos utilizadores deste trabalho Atribuição-NãoComercial-SemDerivações CC BY-NC-ND https://creativecommons.org/licenses/by-nc-nd/4.0 iii Acknowledgments À medida que se aproxima o fim desta longa e muito desafiante etapa da minha vida, é inevitável o reconhecimento das várias pessoas que me ajudaram a superar os obstáculos e a festejar as conquistas, a quem endereço agora algumas sinceras palavras de apreço e gratidão. Em primeiro lugar agradeço à equipa de orientadores que possibilitou este trabalho e que me acompanhou de perto ao longo de toda a jornada. Ao Doutor Nuno Cerca agradeço a oportunidade e apoio na realização deste desafio, a partilha de conhecimentos e a exigência no trabalho, que me ajudou a crescer a nível pessoal e profissional. À Doutora Ângela França agradeço todos os ensinamentos, a paciência para explicar e debater ideias e, acima de tudo, a incansável ajuda na procura de resposta para os problemas que pareciam não ter solução. Ao Professor Manuel Vilanova agradeço a disponibilidade para me ter recebido na sua equipa e por todas as contribuições e partilha de conhecimento do vasto mundo que é a Imunologia. Aos membros da equipa “Cerca et al. ” com quem tive o privilégio de trabalhar, agradeço a boa disposição, o apoio, as risadas e a amizade. Um agradecimento especial à “companheira de luta” Nathalie, à Joana pelo carinho e voz da sabedoria e à Aliona pelos doces momentos que passamos juntas. Agradeço também à Tânia Lima do i3S pela partilha de conhecimentos e por toda a ajuda que permitiu a realização das tarefas de Imunologia. Aos colegas e amigos com quem me cruzei no CEB agradeço especialmente pelos momentos de convívio, mas também pelo vosso contributo, apoio e ensinamentos quando foi preciso. Especialmente à Daniela A., Daniela S., Graça, Luís, Paula, Andreia e Tânia: obrigada pela vossa amizade e companheirismo e por me fazerem sorrir e ajudarem a superar os momentos mais amargos. Um agradecimento muito especial à família e amigos de longa data, especialmente à Mónica, Maria, Beatriz, Henrique e Hugo, pelos momentos de lazer, almoços e jantares, passeios e aventuras, pelo amor e amizade e por estarem sempre por perto. Por fim, o agradecimento mais importante vai para a minha “Família Perfeita Feliz”, a quem devo quase tudo aquilo que sou hoje e estarei infinitamente grata: AMO-VOS. Pai e mãe, obrigada por serem o meu pilar e o meu maior exemplo, pelo vosso amor incondicional e por sempre me incentivarem a seguir os meus sonhos e a lutar pelos meus objetivos. Sónia e Daniela, obrigada pela amizade e partilha, pelo vosso apoio e amor sem fim. Crescer convosco foi a melhor aventura da minha vida e espero que partilhemos o resto das nossas vidas juntas como “amiguinhas do coração”. Ana Maria e Ricardo, obrigada por se terem juntado à família, isto tem muita mais piada convosco por perto. Ao meu amor pequenino Emma, obrigada por me relembrares a inocência das crianças, pelas brincadeiras e gargalhadas. És uma lufada de ar fresco nas nossas vidas! A ti, Tiago, agradeço-te principalmente todo o amor, amizade, apoio, paciência e compreensão ao longo de todos os anos juntos, em especial nos últimos anos. Obrigada por acreditares em mim, mais do que eu mesma e por me fazeres acreditar que consigo ser e fazer tudo aquilo que eu quiser. Quero continuar a partilhar toda a minha vida contigo. This study was supported by the Portuguese Foundation for Science and Technology (FCT) through an individual PhD scholarship (SFRH/BD/131452/2017), further extended by the fellowship COVID/BD/151934/2022, by the funded project PTDC/BIA-MOL/29553/2017, under the scope of COMPETE2020 (POCI-01-0145-FEDER-029553) and by the strategic funding of unit UIDB/04469/2020. iv STATEMENT OF INTEGRITY I hereby declare having conducted this academic work with integrity. I confirm that I have not used plagiarism or any form of undue use of information or falsification of results along the process leading to its elaboration. I further declare that I have fully acknowledged the Code of Ethical Conduct of the University of Minho. v mazEF, um potencial sistema toxina-antitoxina em S. epidermidis : papel na formação de células viáveis mas não-cultiváveis e impacto no sistema imunitário RESUMO Staphylococcus epidermidis é um microrganismo comensal que habita na pele e membranas mucosas dos seres humanos e outros mamíferos, mas que pode atuar como um agente patogénico oportunista, especialmente em pacientes imunocomprometidos e em bebés prematuros. Os principais fatores de virulência de S. epidermidis são a sua reduzida suscetibilidade a antibióticos e a sua capacidade de formação de biofilmes e de evasão à resposta do sistema imunitário. Os biofilmes estão também associados à recorrência de infeções, o que pode estar relacionado com a presença de células viáveis mas não-cultiváveis (CVNC) na sua composição. Um anterior estudo identificou o operão mazEF, descrito como um potencial sistema toxina-antitoxina (TA), como um possível regulador da ocorrência de CVNC em biofilmes de S. epidermidis. De forma a determinar o papel do mazEF na modulação do estado CVNC e o seu impacto noutros aspetos de virulência, construímos e caracterizamos duas estirpes mutantes sem o operão mazEF. Um modelo in vitro previamente desenvolvido para modular a indução do estado CVNC em biofilmes foi validado com as nossas estirpes e conseguimos também induzir a formação de células CVNC em culturas planctónicas, sendo este fenómeno de alguma forma regulado pela densidade celular. Surpreendentemente, ao compararmos a estirpe mutante de mazEF com a estirpe selvagem, não foram encontradas diferenças na indução do estado CVNC quer em biofilmes, quer em culturas planctónicas. Uma vez que homólogos do operão mazEF foram identificados como sistemas TA, os mutantes foram complementados com outro plasmídeo onde a expressão do mazEF foi regulada por um promotor induzível, permitindo assim determinar se a indução da toxina levaria à morte celular. Contudo, sob as condições experimentais utilizadas, a expressão destes genes não levou à morte celular, sugerindo, assim, que o homólogo de mazEF não funciona como um sistema TA nas estirpes testadas. Estudámos também o impacto do mazEF noutras características de virulência, incluindo a sobrevivência a antibióticos ou à ação bactericida do sangue e plasma humanos e a resposta de células dendríticas e macrófagos a infeções com as estirpes de S. epidermidis 1457. Dos fatores testados, apenas uma menor suscetibilidade à rifampicina e uma atividade metabólica distinta após tratamento com tetraciclina foram observados no mutante, levando-nos a concluir que o homólogo de mazEF tem um impacto pouco significativo no potencial de virulência das estirpes de S. epidermidis aqui usadas. Palavras-chave: Biofilmes, CVNC, fatores de virulência, manipulação genética, mazEF . vi S. epidermidis putative toxin-antitoxin module mazEF : role in VBNC formation and impact on the immune system ABSTRACT Staphylococcus epidermidis is a commensal microorganism that inhabits the skin and mucous membranes of humans and several mammals, but acts as an opportunistic pathogen, particularly in immunocompromised patients and neonates. The main virulent properties of S. epidermidis are its reduced antimicrobial susceptibility profile, associated with biofilm formation ability, which contribute to the evasion from the host immune response. Biofilms have also been associated with recurrent infections, and this might be due to the high proportion of viable but non-culturable (VBNC) cells within them. A previous RNA-Seq study identified the mazEF putative toxin-antitoxin (TA) system as a possible key player in the regulation of the occurrence of VBNC cells in S. epidermidis biofilms. In order to determine the role of mazEF in the modulation of the VBNC state and its impact on other virulence aspects of biofilms , we constructed and characterized two mutant strains lacking the mazEF operon. The previously characterized in vitro model used to modulate VBNC induction in biofilm cultures was further validated and we demonstrated that VBNC induction can also occur in planktonic cultures, being this phenomenon somewhat related to cellular densities. Surprisingly, when comparing the mazEF operon mutant to the wild-type strain, no significant differences were observed in VBNC induction in either biofilms or planktonic cultures. As mazEF homologues have also been identified as TA systems, the mutants were complemented with a different plasmid, wherein the mazEF expression was regulated by an inducible promoter, in order to determine if the induction of the toxin module would lead to bacterial death. However, under our experimental conditions, neither gene expression led to bacterial death, suggesting that the mazEF homologue was not acting as a TA system in our strains. We also assessed the impact of mazEF in other relevant virulence characteristics, including the ability to survive after antibiotic challenges or in human blood and plasma, and the response of dendritic cells and macrophages to infections with S. epidermidis 1457 strains. Of the tested traits, only a lower susceptibility to rifampicin and a distinct metabolic activity upon treatment with tetracycline was observed in the mutant strain, leading us to conclude that the mazEF homologue operon had a minor impact on virulence of the S. epidermidis strains considered herein. Keywords: Biofilms, gene manipulation, mazEF , VBNC, virulence factors. vii Table of contents CHAPTER 1 Introduction 1 1.1. Background 2 1.2. Research questions 3 1.3. Scope and aims 3 1.4. Thesis outline 4 1.5. Bibliography 6 CHAPTER 2 Literature review 8 2.1. State of the art 9 2.2. Microbial biofilms 10 2.2.1. S. epidermidis biofilms and infections 11 2.2.2. Antimicrobial susceptibility 14 2.2.3. Cell dormancy within biofilms 16 2.2.3.1. Induction of the VBNC state in S. epidermidis biofilms 18 2.3. Pathogenicity and immune response activation 20 2.3.1. Innate immunity 21 2.3.2. Cytokine production 22 2.3.3. Activation of the complement system 24 2.3.4. Evasion from the immune system 25 2.4. Toxin-antitoxin systems 26 2.4.1. Characterization of the mazEF module in E. coli 28 2.4.1.1 Programmed cell death in E. coli 30 2.4.2. mazEF and persister cells 31 2.4.3. The role of mazEF system in different species 32 2.4.4. Targeting TA systems to fight infections 33 2.5. Bibliography 36 xiv NaCl Sodium chloride NETs Neutrophil extracellular traps OD Optical density PAMPs Pathogen-associated molecular patterns PBMCs Peripheral blood mononuclear cells PBS Phosphate-buffered saline PCD Programmed cell death PCR Polymerase chain reaction PI Propidium iodide PIA/PNAG Polysaccharide intercellular adhesin / poly-N-acetylglucosamine PMNs Polymorphonuclear leukocytes PMS Phenazine methosulfate PRE Prevented VBNC state PRRs Pattern recognition receptors PSC Peak serum concentration PSMs Phenol-soluble modulins qPCR Quantitative PCR R Resistant RBS Ribosomal binding site RFU Relative fluorescence units RIF Rifampicin RNA Ribonucleic acid RNA-Seq RNA sequencing xv RPKM Reads Per Kilobase of transcript per Million reads mapped ROS Reactive oxygen species S Susceptible SEM Scanning electron microscopy sRPMI RPMI supplemented with 10% FBS, 2% L-glutamine, 1% HEPES and 50𝜇M 𝛽mercaptoethanol TA Toxin-antitoxin TET Tetracycline TGF- Transforming growth factor-beta TLRs Toll-like receptors TNF- Tumour necrosis factor-alpha TSA Tryptic soy agar TSAATC TSA supplemented with 1 g/mL anhydrotetracycline hydrochloride TSACM10 TSA supplemented with 10 g/mL chloramphenicol TSB Tryptic soy broth TSBCM10 TSB supplemented with 10 g/mL chloramphenicol UV Ultra-violet VAN Vancomycin VBNC Viable but non-culturable WGA Wheat germ agglutinin WT Wild-type XTT 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2 H -Tetrazolium-5-Carboxanilide xvi List of figures CHAPTER 2 Figure 2.1 – Scanning electron microscopy (SEM) of a S. epidermidis biofilm in early stages. 10 Figure 2.2 – Representation of S. epidermidis biofilm lifecycle and some of the molecules involved in the different phases of biofilm formation and disassembly. 11 Figure 2.3 – SEM image of a grape-like cluster of S. epidermidis , with evidence of biofilm matrix (purple). 13 Figure 2.4 – Some hypotheses that attempt to explain the decreased susceptibility of biofilm cells to antibiotics. 15 Figure 2.5 – Cytokine network. 23 Figure 2.6 – Hypothetical involvement of TA systems in cellular processes and main functions performed by these complexes in several bacterial species, most already confirmed for E. coli . 28 Figure 2.7 – Schematic representation of the E. coli mazEF -mediated cell death pathway. 29 Figure 2.8 – Schematization of the persistence mechanism due to persister cells. 31 CHAPTER 3 Figure 3.1 – Representative gating used for the analysis of live cells within S. epidermidis populations grown under VBNC modulating conditions. 57 Figure 3.2 – Ratio between the number of culturable (CFU) and live biofilm cells in prevented and induced VBNC conditions, grown with TSB from Liofilchem. 59 Figure 3.3 – Ratio between the number of culturable (CFU) or the total amount of cells (OD640nm) found on biofilms with induced (IND) or prevented (PRE) VBNC state of different strains, grown with TSB from Merck. 60 Figure 3.4 – Culturability (CFU) of S. epidermidis 1457 planktonic cells grown under induced (IND) or prevented (PRE) VBNC conditions using two different strategies. 62 xvii CHAPTER 4 Figure 4.1 – (A) Result of electrophoresis run upon PCR with plasmids cloned into S. epidermidis 1457  mazEF . (B) Normalized expression (to 16S rRNA ) of mazEF homologue and rsbU genes of S. epidermidis 1457 WT and constructs. 77 Figure 4.2 – Result of electrophoresis run upon PCR with plasmids cloned into S. epidermidis 1457  mazEF. 78 Figure 4.3 – Growth curve of S. epidermidis 1457  mazEF planktonic cells upon incubation with different concentrations of anhydrotetracycline (ATC) or tetracycline (TET). 78 Figure 4.4 – Fold-change expression of the mazEF homologue genes in the pRMC2 inducible plasmid cloned into S. epidermidis 1457  mazEF. 79 Figure 4.5 – Growth curve of S. epidermidis 1457  mazEF constructs upon induction of mazE / mazF / mazEF genes. 80 Figure 4.6 – Gene expression of mazEF , normalized to the expression of 16S rRNA in S. epidermidis 9142 WT and mutant ( mazEF ) strains. 81 Figure 4.7 – Fold-change expression of the mazEF homologue genes in the pRMC2 inducible plasmid cloned into S. epidermidis 9142  mazEF. 82 Figure 4.8 – Culturability of S. epidermidis 9142  mazEF constructs in the control and induced (0.64 g/mL ATC) conditions for up to 4 hours of growth. 82 Figure 4.9 – Alignment of mazE sequences of S. epidermidis 1457 and S. aureus Newman. 94 Figure 4.10 – Alignment of mazF sequences of S. epidermidis 1457 and S. aureus Newman. 95 Figure 4.11 – Prediction of MazEF protein structure of S. epidermidis and S. aureus strains. 96 Figure 4.12 – Growth curve of planktonic populations of S. epidermidis 1457 WT,  mazEF and  mazEF ::pRB473+ mazEF strains. 97 Figure 4.13 – Quantification of 48-hours biofilms of S. epidermidis 1457 WT,  mazEF and  mazEF ::pRB473+ mazEF and S. epidermidis 9142 WT,  mazEF and  mazEF ::pRMC2+ mazEF . 98 Figure 4.14 – Antimicrobial effect of rifampicin (RIF), tetracycline (TET) and vancomycin (VAN) on 24 hours-old planktonic cultures of S. epidermidis strains. 100 Figure 4.15 – Survival of S. epidermidis strains in human blood and plasma. 101 xviii CHAPTER 5 Figure 5.1 – Representative gating used for the analysis of activation makers expression upon incubation of MDDCs with S. epidermidis strains. 112 Figure 5.2 – Effect of mazEF deletion on the response of M1-type MDMs, assessed by the quantification of cytokines secreted upon 24 hours of infection with S. epidermidis 1457 strains at a MOI of 1MDM:5B and 1MDM:10B. 114 Figure 5.3 – Effect of mazEF deletion on the response of M2-type MDMs, assessed by the quantification of cytokines secreted upon 24 hours of infection with S. epidermidis 1457 strains at a MOI of 1MDM:5B and 1MDM:10B. 115 Figure 5.4 – Effect of mazEF deletion on the response of MDDCs, assessed by the quantification of secreted cytokines upon 24 hours of infection with S. epidermidis 1457 strains at a MOI of 1MDDC:5B and 1MDDC:10B. 117 Figure 5.5 – Effect of mazEF deletion on the activation and maturation of MDDCs, assessed by the quantification of the expression of activation markers upon 24 hours of infection with S. epidermidis 1457 strains at a MOI of 1MDDC:5B and 1MDDC:10B. 118 Figure 5 . 6 – Effect of mazEF deletion on the production of ROS by PMNs upon infection with S. epidermidis 1457 strains at a MOI of (A) 1PMN:5B and (B) 1PMN:10B. 119 CHAPTER 6 Figure 6.1 – Comparison of S. epidermidis 1457 biofilms grown under prevented or induced VBNC conditions. 127 Figure 6.2 – Quantification of biofilms of S. epidermidis 1457 strains grown under VBNC modulating conditions. 128 Figure 6.3 – Quantification of biofilms of S. epidermidis 9142 strains grown under VBNC modulating conditions. 129 Figure 6 . 4 – Comparison of planktonic cultures of S. epidermidis 1457 strains grown for 24 hours under prevented or induced VBNC conditions. 130 Figure 6.5 – Quantification of planktonic cultures of S. epidermidis 1457 strains under VBNC modulating conditions. 131 xix CHAPTER 6 – Continued Figure 6.6 – S. epidermidis 1457 biofilm structure analysis by CLSM. 132 Figure 6.7 – Antimicrobial effect of rifampicin (RIF) and tetracycline (TET) on 48 hours-old biofilms of S. epidermidis strains grown under VBNC modulating conditions. 133 Figure 6.8 – Log2 fold expression of clpP, codY, pdhA, icaA, psm and psm in S. epidermidis 1457 WT,  mazEF and  mazEF:: pRB473+ mazEF biofilms. 135 xx List of tables CHAPTER 3 Table 3.1 – List of primers used for qPCR analysis. 58 Table 3.2 – Analysis of mazE and mazF expression on S. epidermidis 48 hours-old biofilms and planktonic cells of strains 9142 and 1457 grown under induced or prevented VBNC conditions. 63 CHAPTER 4 Table 4.1 – List of primers used for the deletion and complementation processes. 72 Table 4.2 – List of primers used for qPCR analysis of gene expression. 74 Table 4.3 – Blast results for strains with high homology to S. epidermidis 1457 mazEF sequence. 84 Table 4.4 – Blast with S. epidermidis 1457 mazE or mazF sequence homologous with strains where sequences were described as part of TA systems. 91 Table 4.5 – Minimum inhibitory concentration (mg/L) of rifampicin, tetracycline and vancomycin against S. epidermidis 1457 WT and constructs. 99 CHAPTER 6 Table 6.1 – List of primers used for qPCR analysis. 126 xxi Scientific outputs Part of the work described in this thesis has been published in international peer-reviewed journals and presented in international scientific conferences. Articles published in peer-reviewed journals Gaio, V., Lopes, N, Cerca, N, França, A. codY and pdhA expression is induced in Staphylococcus epidermidis biofilm and planktonic populations with higher proportions of viable but non-culturable cells. Frontiers in Cellular and Infection Microbiology. 2021;11:771666. Gaio, V., Lima, T., Vilanova, M., Cerca, N., França, A. mazEF homologue has a minor role in Staphylococcus epidermidis 1457 virulence potential”. Frontiers in Cellular and Infection Microbiology. 2022, 11:803134. Poster communications at international scientific conferences Gaio, V., Cerca, N., França, A. “ Preliminary studies on the role of mazEF in S. epidermidis biofilm dormancy” in Microbiotec 2019 – Congress of microbiology and biotechnology, Coimbra, Portugal, December 5-7, 2019. Gaio, V., Cerca, N., França, A. “ The putative toxin-antitoxin mazEF gene cluster is not involved in cell death in S. epidermidis ” in Microbiotec 2021 – Congress of microbiology and biotechnology, Online congress, November 23-26, 2021. CHAPTER 1 Introduction SUMMARY This chapter presents the initial introduction to the thesis, research questions aimed to be answered and the main scope and aims of this work. Moreover, the thesis outline is herein presented. 2 1.1. Background Staphylococcus epidermidis is a common colonizer of humans due to its ubiquitous presence in the skin and mucous membranes [1], with a great ability to form biofilms [2]. Despite its general commensal lifestyle and benign relationship with the host [1], S. epidermidis can cause severe complications, such as bloodstream infections [3, 4], which are often hard to treat due to the decreased antimicrobial susceptibility of bacteria [5, 6]. Since bacteraemia is associated with increased morbidity and mortality among hospitalized patients [7], this species has become an important object of study in the past years [4]. Importantly, this species presents a high ability to form biofilms on the surface of indwelling medical devices, being acknowledged as one of the most frequent causes of nosocomial infections in the United States of America [8, 9]. Moreover, according to the 2014 Annual Epidemiological Report on Antimicrobial Resistance and Healthcare [10], S. epidermidis , together with other coagulase-negative staphylococci (CoNS), is one of the most frequent pathogens isolated from intensive care units-acquired bloodstream infections in European countries [10]. Interestingly, the last Annual Epidemiological Report published by the European Centre for Disease Prevention and Control (ECDC), in 2019, still outlines CoNS as prevalent microorganisms in surgical site infections [11]. In fact, also in Portugal, CoNS have been found to be among the main pathogens involved in bloodstream nosocomial infections and in infections associated with central venous catheters [12], being S. epidermidis one of the most frequent pathogens associated with hospital-acquired infections [13]. Several studies have shown that S. epidermidis biofilms are more tolerant to antimicrobial therapies [14] and to the host immune defences [15], which results in relapsing and recurrent infections [1]. Moreover, it was found that these bacteria can enter a special state of dormancy, where cells are viable but nonculturable (VBNC) during the biofilm lifecycle, turning them even more tolerant to antibiotics [16, 17] and to the immune response [18]. As a result, the treatment of such infections becomes more difficult and, consequently, affects the quality of life of thousands of persons every year [19, 20]. It was recently found that mazE was only expressed in S. epidermidis biofilms where the VBNC state was induced [17]. The mazE gene encodes a protein of the mazEF complex that has been described as a toxin-antitoxin (TA) system in several species, such as Escherichia coli [21], Pseudomonas aeruginosa [22] , Streptococcus mutans [23] and Staphylococcus aureus [24] and mentioned as a putative TA system in S. epidermidis as well, nonetheless this association was purely based in protein homology [25–27]. 9 2.1. State of the art Indwelling medical devices have been increasingly used in modern medicine and have saved millions of lives worldwide. Unfortunately, they can also be a source of very serious infections [1]. Staphylococcus epidermidis , a commensal bacterium that colonizes healthy human skin and mucosa, has emerged as one of the most common causes of medical device-associated infections [2]. This is due to its ability to adhere to the surface of medical devices and form biofilms, complex tridimensional communities of microorganisms surrounded by an extracellular polymeric matrix, which are highly tolerant to antibiotics [3] and to the host immune system response [4]. Hence, S. epidermidis biofilms represent a common source of recurrent and relapsing infections that, due to the lack of effective treatments, are often only resolved via surgical removal of the colonized device, resulting in increased patients’ morbidity and an extra burden to healthcare systems [5]. The ability to form biofilms on medical devices is the most important virulence factor of S. epidermidis [5] . Moreover, the quantity of dormant bacteria in biofilms influences their ability to cause persistent and recurrent infections. It was previously shown that high amounts of dormant cells can turn biofilms less susceptible to both the host immune response [6] and antibiotic therapy [7]. Furthermore, cells in the dormant state have the particularity of not growing on standard culture media, and, consequently, are not detected in common infection’s detection tests [8]. This can result in misleading interpretations of the actual status of the infection, e.g., the bacterial load of a biofilm with dormant cells can be significantly higher than the one detected in usual culture tests [8], or might even lead to false-negative results [9]. The molecular mechanisms of biofilm formation in S. epidermidis have been extensively studied, however, despite their clinical relevance, little is known regarding the mechanisms involved in S. epidermidis dormancy. A selection of genes potentially involved in the dormancy state was made by performing RNA-sequencing (RNA-Seq) analysis of biofilms in conditions of prevented or induced dormancy [10]. Some of the genes that were differentially expressed in biofilms with induced or prevented dormancy were ranked based on homology analysis with other bacterial species, and it was found that mazE , an homolog gene putatively encoding the antitoxin of the mazEF complex, was only detected in biofilms with induced dormancy [10]. The role of this gene in S. epidermidis biofilms raised interest due to its involvement in bacterial stress response [11] and decreased susceptibility to antimicrobials [12]. So far, to our knowledge, no studies have been performed to 10 understand the role of mazEF in S. epidermidis and its effect on biofilm dormancy and pathogenicity. 2.2. Microbial biofilms Biofilms can be defined as an aggregation of microorganisms and their extracellular products, forming a well-structured population, generally attached to a surface [13], as represented in Figure 2.1. Human health can be deeply affected by the development of biofilms, not only because of the low susceptibility towards antimicrobial therapies, but also because biofilms can serve as a continuous reservoir of several opportunistic bacteria that are able to colonize different surfaces [14–16]. Formation of bacterial biofilms is accepted as a survival strategy, being accounted as responsible for several chronic and acute infections [15, 17], from which can be highlighted chronic bacterial wound infections [18], endocarditis [19] and respiratory tract infections [20]. The existence of a polymeric matrix surrounding bacteria has some benefits in protecting bacteria towards environmental changes [21, 22] and also protecting them from being removed from the surface where they are attached [23, 24]. Besides the contribution to the survival of the biofilm under diverse adverse conditions, such as the lack of nutrients, the biofilm matrix is also fundamental for the maintenance of the tridimensional structure of the biofilm [1, 25]. Figure 2.1– Scanning electron microscopy (SEM) of a S. epidermidis biofilm in early stages. Adapted from [26]. 11 2.2.1. S. epidermidis biofilms and infections Staphylococci are important pathogens of several animals and humans, and are responsible for a wide spectrum of infections, including a variety of life-threatening systemic diseases [24]. Skin and urinary tract infections, as well as infections of the soft tissues and bones, are common examples of injuries caused by several staphylococci, including by some opportunistic staphylococcal species [5, 27]. Colonization by S. epidermidis is frequent and can be very harmful in immunocompromised persons and neonates [5, 28]. On the other hand, this species is known to perform an important role in the maintenance of a healthy skin flora by competing with similar microorganisms which can be considerably more harmful, such as Staphylococcus aureus [28, 29] . Being a common inhabitant of the skin, S. epidermidis can easily invade this physical barrier through wounds and follicles. This happens mainly when the skin barrier is compromised, for example, due to medical practices as the insertion and removal of catheters and other medical devices, or upon fissures on the skin resulting from surgical procedures [30]. Figure 2.2 – Representation of S. epidermidis biofilm lifecycle and some of the molecules involved in the different phases of biofilm formation and disassembly. The process begins with initial attachment to the surface, followed by the adhesion of cells to each other, forming clusters. Maturation of the biofilm is achieved by the growth of bacterial clusters and the production of polymeric matrix by those aggregates, which will accumulate and surround bacteria. Lastly, a mature biofilm is obtained, and bacteria can detach and disperse from this biofilm and colonize other surfaces. Adapted from [5]. 12 S. epidermidis biofilm formation (Figure 2.2) is regulated by a system of cell-to-cell communication known as staphylococcal accessory gene regulator ( agr ) [31]. The first phase of biofilm development is generally termed initial adhesion or attachment and comprises bacterial adhesion to surfaces [28]. Non-specific interactions, as hydrophobic and electrostatic interactions, generally mediate this primary attachment to inert surfaces, in which bacteria can adhere directly to the surface of the implanted medical devices [32]. Conversely, specific interactions between the cell surface and host proteins can occur when the medical device is coated with host-derived matrix molecules [32–35]. The AtlE (major autolysin of S. epidermidis ) is among the bacterial proteins that mediate primary attachment, facilitating the adhesion of bacteria to surfaces or to previously attached host matrix proteins [32, 33]. Similarly, biofilm-associated protein ( bap ) may also be involved in the first stage of biofilm formation, by increasing the hydrophobicity of the cell surface to facilitate the initial adhesion process [36]. Some of the bacteria will detach from the surface, while only a part of those will enter the next phase and be able to form the biofilm, mainly due to intercellular adhesins and autolysins [37, 38]. As the biofilm grows and enters the maturation stage, specific interactions allow the growth of bacteria into clusters [32, 34] and the formation of the hydrated polymeric matrix that surrounds cells in biofilms [5, 34, 39, 40]. Moreover, some molecules, for instance adhesive and exopolysaccharide macromolecules, are produced to enhance cell-to-cell communication and aggregation [5, 34]. The icaADBC operon was the first and better studied molecular mechanism associated with biofilm formation by S. epidermidis . It is often present in invasive strains of S. epidermidis and accomplishes an important function in biofilm formation [40, 41]. Proteins from this operon produce a polymer of N-acetyl glucosamine (PNAG) [40], involved in aggregation of bacteria upon communication between adjacent polymers on the surface of bacteria [42]. As the first known function of PNAG was the intercellular adhesion, this polymer is also commonly known as a polysaccharide intercellular adhesin (PIA) [40, 43]. Furthermore, PNAG has a great influence on the structure of the biofilm [44] and has been shown to increase the survival rate of bacteria in the host [22]. On the other hand, it was also shown that PNAG promoted exacerbated liver inflammatory pathology in mice repeatedly challenged with S. epidermidis [45], and the secretion of PNAG acts as a decoy for the immune system [42]. 13 The development of the biofilm continues with the maturation of the cell agglomerates and the production of extracellular polymeric substances (EPS) that will be located between cells [24, 46], as illustrated in Figure 2.3. The major components of these polymeric substances are polysaccharides, proteins and nucleic acids that result from cellular metabolism and/or cell death processes, however, the composition of the matrix varies among different biofilms [38, 47]. Figure 2.3 – SEM image of a grape-like cluster of S. epidermidis , with evidence of biofilm matrix (purple). Adapted from [48]. The biofilm maturation stage proceeds with the formation of channels, which allow the flow of molecules within the biofilm, and the increasing number of bacteria and production of the polymeric matrix allow the expansion of the biofilm thickness [15, 49]. This phase depends on adhesive and disruptive forces and facilitates the communication of cells with the exterior, enabling the circulation of nutrients and oxygen into deeper layers of the biofilm [24, 50]. Later, the mature biofilm reaches a state that no longer tolerates significant growth, the stationary phase, where the division of bacteria occurs at a similar rate to bacterial death due to nutritional and physicochemical limitations [51]. Finally, S. epidermidis biofilms are characterized by entering a disassembly process that occurs in order to regulate the cell density of the biofilm [52, 53], being influenced by several environmental conditions [52, 54–56]. The availability of nutrients [57, 58] and oxygen [57, 59–61] and 14 environmental parameters, such as the pH [62, 63], temperature [64, 65] and nature of the surfaces to which bacteria are attached [49, 52], cause an active release of biofilm cells, known as dispersion, allowing the regulation of the biofilm cell density. Moreover, a passive release process may also occur when the biofilm is affected by shear forces that cause the detachment of cells from the biofilm structure [66, 67]. It is important to have into consideration that smaller active and passive events of cell release may also occur before the final disassembly phase. Although less significant than disassembly, the release of smaller amounts of cells should not be disregarded, as some clusters formed during biofilm maturation may detach and enter blood circulation and, ultimately, cause thromboembolisms [68]. The cells disassembled from the biofilm may be designated as biofilmreleased cells (Brc) [53] and have the ability to colonize other sites, contributing to the spreading of infections within the host and to the occurrence of inflammation processes [69, 70]. 2.2.2. Antimicrobial susceptibility An important issue associated with biofilm-related infections is the decrease in the susceptibility to antibiotics [33, 71]. This decreased susceptibility often leads to situations where it is unsuitable to treat infections with common antibiotic therapies, since the concentration of antibiotic needed to kill bacteria within biofilms is higher than the peak serum concentration (PSC) [3, 72, 73], which is the maximum concentration of an antibiotic that the human body can endure after administration. Importantly, the antimicrobial susceptibility of biofilms is mainly dependent on the species and antibiotics used [74, 75]. Additionally, biofilms are thought to present a lower susceptibility to antibiotics by a diversity of factors [76–79], as represented in Figure 2.4. Among those limitations, the diffusional barrier to antibiotics [80–82] and a slow growth rate of cells within the biofilm [83–85] are often highlighted as major causes of altered antimicrobial susceptibility. Moreover, the existence of a phenotype that is more tolerant to antimicrobials [78, 86, 87], such as dormant cells, including both viable but non-culturable (VBNC) and persisters cells, can also partially explain the inefficacy of antibiotic treatments in biofilms [10, 88–91]. Notwithstanding, it is known that neither of the above-mentioned hypotheses per se can fully explain the diminished susceptibility of biofilms towards antimicrobial treatment [74, 92]. For instance, some antibiotics can easily diffuse through the biofilm matrix of some species, as was already shown for rifampicin 15 in S. epidermidis biofilms [93, 94] and for amikacin and ciprofloxacin in S. epidermidis and S. aureus [95], among others. Figure 2.4 – Some hypotheses that attempt to explain the decreased susceptibility of biofilm cells to antibiotics. Adapted from [96]. The structure of the extracellular polymeric matrix can, occasionally, act as a physical diffusional barrier reducing and/or delaying the penetration of certain antibiotics into the biofilm, whereby some antibiotics can no longer reach a great number of bacterial cells [1, 73]. Furthermore, the negatively charged polymeric matrix may also behave as a chemical barrier to the positively charged antimicrobial agents, since these agents tend to bind to the matrix and, thus, the amount of antimicrobial drugs that successfully reach biofilm cells is limited [15, 97]. Moreover, some of the polysaccharides and proteins that constitute the matrix can specifically inactivate some antibiotics [1, 88, 98]. Among the modifications that bacteria experience upon growing as a biofilm, phenotypic changes are one of the most important, considering they may influence the susceptibility to antibiotics within the biofilm environment [1, 73]. It is now accepted that bacteria residing within the biofilm are phenotypically different from free-floating bacteria, whereby some bacteria may experience a differentiation process that leads to a particular dormant phenotype, which generally presents a lower susceptibility against antimicrobials [69–73]. Slow growing bacterial cells can be found in altered environment zones, since in the deeper layers of the biofilm the concentration of oxygen and nutrients is reduced, leading to distinct growth conditions [78, 88, 99]. The reduced bacterial growth rate, as well as the alteration of metabolic processes and reduced metabolic activity, present a limitation to the action of some classes of antibiotics in biofilm cells [78, 88, 99]. 16 The heterogeneity of cells within biofilms [100] also contributes to the decreased susceptibility to antimicrobials [73, 88]. Dormant cells are characterized by being in a physiological state that does not allow growth and present a decreased metabolic activity when compared with other cells [91, 101]. This population generally emerges upon stressful conditions, and presents an altered susceptibility to antibiotics, contributing to recalcitrant infections [102–104], as will be explored in the next section. As a consequence of the reduced susceptibility of biofilms to some common antibiotics, it is occasionally necessary to use a combination of different antibiotics to be able to treat biofilm infections [1, 99, 105]. When the difficulty is related to the diffusional barrier, the use of multiple antibiotics and other substances as adjuvants to promote diffusion through the matrix that envelops bacteria may be a solution. For instance, it was found previously that rifampicin used combined with vancomycin in S. epidermidis would provide a better result, as rifampicin improved the diffusion of vancomycin through the matrix [93]. In severe cases of antimicrobial therapy failure to treat medical device-related infections [104, 106], the removal of the colonized medical devices is often required, resulting in high costs and great inconvenience to patients [107, 108]. 2.2.3. Cell dormancy within biofilms There has long been some controversy regarding the definition and distinction between the terms: dormancy, persistence and VBNC [91, 109], but recent reviews have tried to clarify and standardize such definitions [89, 101, 110–112]. Nowadays, the concept of dormancy is widely applied to describe populations of cells that experienced a significant reduction in their metabolic activity, but not a complete loss [91], and, despite being alive, do not grow on laboratory cultures [89–91, 109, 110]. Dormant cells exist in a reversible non-replicative physiological state, i.e., these cells are in a temporary state where their reduced metabolic processes do not allow their replication, yet this state can be reverted with the appropriate growth conditions [103, 104]. In other words, dormancy may be viewed as a condition of extremely slow growth, which presents a decreased antimicrobial susceptibility [111, 113], but where cells maintain an intact membrane and membrane potential, contrasting with dead cells [114]. Several human pathogens have been shown to exist in a dormant state [115], which may impair the detection of the infections since traditional culture methods are unable to detect unculturable 17 cells [116]. On the other hand, most of these pathogens also present an ability to revert the unculturable physiological state of dormancy when in the presence of favourable microenvironmental conditions [91, 117], as happens in multiple staphylococcal species, including S. epidermidis, when grown in media without antibiotics and suitable concentrations of nutrients and oxygen [118–121]. Dormancy was previously defined as a state that occurs in response to unfavourable environmental conditions and did not contemplate the emergence of persisters, caused by stress related to antimicrobial therapies [122]. However, it is nowadays accepted that dormancy includes cells originated in both conditions, including VBNC and persister cells [89, 101, 110]. Altogether, the VBNC state is caused by environmental stresses [91, 116], such as nutritional starvation [123], oxygen limitations [124], oxidative stress [125] and substantial changes in the temperature, salinity and pH of the environment [65, 126, 127]. On the other hand, persister cells generally refer to a state in which cells can survive antimicrobial treatments [103, 128], entering the dormant state due to the interaction with antibiotics [129] or environmental stresses [89,91]. Persistence was first described in the early 40’s in Staphylococcus pyogenes, when it was observed that a small population of cells (named persisters) survived after exposure to penicillin, a mechanism found to be different from traditional mechanisms of antibiotics resistance [130, 131]. Persisters were, back then, defined as cells within a genetically homogeneous population with the ability to survive different types of stress, being considered phenotypic variations of the wild-type [132]. Importantly, chemical inhibition of protein synthesis may lead to the development of persister-like cells. Therefore, antibiotics acting on the protein synthesis machinery can trigger the formation of persisters and, consequently, decrease their susceptibility to antimicrobials [106]. Thus, persisters are typically a sub-population of cells that entered a dormant state in which they do not proliferate and present a reduced susceptibility to antibiotics [133]. A particularity of persisters is that they are able to resist upon exposure and treatment with high doses of antibiotics, being able to revert the transient dormant phenotype when the antibiotic stimulus ceases [73, 87], which leads to the problem of relapsing infections [86, 103, 134]. As both VBNC and persisters cannot be detected by means of classical laboratory detection methods, standard tests may lead to a misleading interpretation of the status of infections [8]. To overcome the detectability problem of non-culturable cells by counting colony-forming units (CFUs), it is necessary to use methods and/or techniques able to detect viable bacteria, such as the use 18 of LIVE/DEAD staining together with microscopy or flow cytometry techniques [6], which are often not used for this purpose in healthcare units. 2.2.3.1. Induction of the VBNC state in S. epidermidis biofilms Previous in vitro studies confirmed that biofilm dormant cells present a reduced susceptibility towards antimicrobials [7], as well as an increased ability to escape the host immune system response [71, 83], rendering biofilms more difficult to be treated. Moreover, using in vitro and in vivo models, it was possible to confirm that dormancy may impact the virulence of S. epidermidis biofilms under certain conditions [6, 79]. For those reasons, the interest in studying dormancy has increased over the last years, in an attempt to better understand the mechanisms and implications of dormancy in biofilm-associated infections. An in vitro model to study the effect of dormancy in S. epidermidis biofilms was previously developed [6]. This model was developed to induce or prevent dormancy in biofilms with the main aim of analysing how dormancy influenced biofilm physiology [6]. In this model, dormancy was assessed by the quantification of VBNC cells and induced by growing biofilms in a glucose-enriched medium and prevented by adding divalent ions such as Calcium (Ca2+) and Magnesium (Mg2+) [6]. Induced dormancy was achieved by incubating biofilms in TSB supplemented with 1% glucose, that, due to the glucose metabolism, leads to the acidification of media [6, 135], resulting in the inhibition of bacterial growth [136]. On the other hand, high levels of extracellular divalent calcium and magnesium ions (Ca2+ and Mg2+) [137–141] were used to reduce the number of bacteria entering the dormant state, being this a pH-independent phenomenon, as no changes in the pH were detected with our without calcium and magnesium supplementation [6]. Importantly, it was later found that supplementation with magnesium alone was able to prevent dormancy induced by glucose, without using calcium [79], and this model was used herein. While the exact mechanism behind the prevention of VBNC cells formation by Mg2+ was not elucidated [6, 140], recent studies showed that bacteria can control the membrane potential to withstand the effect of antibiotics targeting ribosomes or against starvation-induced persisters, and this ion flux modulation can be achieved with magnesium [142, 143]. Additionally, it was demonstrated that deprivation of magnesium in the extracellular media would lead to a reduction in the cytoplasmic ATP [143]. Since ATP levels and the formation of persister 25 Although the activation of the complement system by S. epidermidis invasions is not completely understood, previous studies have reported that the classical and lectin pathways seem to be the way of triggering the complement system by this bacterium [175]. Importantly, S. epidermidis has some particularities that allow it to avoid recognition and activation of the complement system, as will be further explored. 2.3.4. Evasion from the immune system Several studies argue that S. epidermidis has the capacity to escape immune defences, mainly due to the misrecognition as a commensal species rather than a pathogenic invader. Moreover, the fact that S. epidermidis is frequently found living as biofilms also contributes to the decrease of the efficacy of the immune system in eradicating S. epidermidis, since biofilms are known to employ particular mechanisms to evade the host response. For instance, a previous study showed that the biofilm confers protection of S. epidermidis against opsonization by complement proteins and against neutrophil-mediated killing [190]. On the other hand, the biofilm structure per se can help in the evasion by hindering the diffusion of antibodies, opsonophagocytic molecules, phagocytic cells and ROS through the matrix [191–193], interfering with the process of opsonization and, more importantly, with the success of phagocytosis [4, 194, 195], as demonstrated for several species, including S. aureus [191, 196] and S. epidermidis [4, 190, 194, 195]. S. epidermidis has been shown to produce molecules that confer tolerance to AMPs, such as the SepA protease [197], and it was previously reported that this species’ biofilms were able to inactivate AMPs and also the proteins of the complement system, avoiding the death of the constituting cells [190]. Moreover, S. epidermidis is also recognized by its ability to produce phenolsoluble modulins (PSMs), which were suggested to present cytolytic activity against human neutrophils [198, 199] and by the production of PNAG [4], important for biofilm formation, and formation of a polysaccharide capsule [200, 201] that prevents bacteria from opsonization and protects them from phagocytosis by neutrophils and macrophages [190, 202–205]. Finally, a recent review focused on how Staphylococci evade the host innate response emphasized that biofilm formation is the most common strategy used by S. epidermidis and S. aureus to avoid opsonization and further phagocytosis through the production of proteins that target opsonization by blocking chemoattractant molecules [206]. 26 Taken together, it is evident that S. epidermidis bacteria are often able to evade or delay the action of the host immune system, contributing to the spreading of the infection, especially biofilmassociated infections. 2.4. Toxin-antitoxin systems Among the genes differentially expressed in VBNC induced conditions, mazE , a gene that belongs to the mazEF operon , has triggered special interest since it was only detected in biofilms with a higher proportion of dormant cells [10]. Homologues of mazEF operons have been previously characterized as toxin-antitoxin (TA) systems in several species, such as S. aureus where it was found to be involved both in bacterial stress response [11] and diminished susceptibility to antibiotics [12]. Moreover, the involvement of TA complexes in biofilm dormancy and persistence have previously been reported in other species, where, for instance, it was found that mazEF increased the number of persister cells in Streptococcus mutans [207] and that the overexpression of the toxin mazF was related to the formation of persister cells in E. coli [208]. Several factors are known to facilitate the persistence of nosocomial infections, such as the formation of persister cells [209], decreased susceptibility to antimicrobials [210], inducement of a dormant state [210] and increased biofilm formation [209], mechanisms in which TA systems were suggested to play a role [211]. TA systems are genetic modules that consist, in general, of a set of two closely related genes organized in an operon, encoding a stable toxin and a labile antitoxin [212]. TA systems are located on plasmids and chromosomes of many bacteria and work as a “poison and antidote” system, since the two modules present antagonistic roles [11, 213]. Usually, the toxin targets an essential cell process and the antitoxin is capable of neutralizing or suppressing the effect of the toxin [212, 214]. Most studies addressing TA systems, including the mazEF system, have been performed with E. coli [215–217]. In this species, TA systems contribute to the bacterial epigenetic machinery that regulates and control bacterial survival, meaning that the overexpression of these genes can regulate the inhibition of cell growth and, in some cases, trigger cell death [210, 218]. An interesting feature of these systems is that, when they are contained in plasmids, only the daughter cells containing the plasmid and, consequently, the TA system, survive after cell division, a process known as post-segregational killing [219]. In the case of plasmid-encoded TA modules, when a daughter cell is replicated with no plasmid inside, the labile antitoxin, which is already present 27 inside the cell, will be readily degraded due to its instability upon TA activation, resulting in the free action of the stable toxin, which was also inherited during cell division, inducing cell death, what explains why cells only survive in the presence of the replicating plasmid [219, 220]. It has also been found that the inducement of low levels of toxin expression in E. coli systems may result in the growth arrest of a subpopulation of cells, or, when inducing the toxin at high levels, to a state of induced dormancy, which supports the involvement of TA systems in biofilms dormancy [221– 224]. This presents a challenge to antimicrobial therapies and compromises the efficiency of antibiotics and, consequently, has been pointed out as one of the main causes of persistent infections [223]. Several studies, conducted especially with E. coli , allowed to understand that the homeostasis of bacteria can be disrupted by a series of events, as exposure to antibiotics [209, 210], phage infection [211, 225], and other stressful conditions, for instance nutrient starvation and temperature and pH alterations) [207, 210, 226]. These factors were shown to interfere with several cellular processes in which TA systems are proposed to have a role [227, 228], as represented in Figure 2.6. As a result, TA systems were shown to be involved in biofilm formation [209], cellular stasis [211], antibiotic-mediated programmed cell death [210], formation of persister cells [227] and antiphage defence [229]. Bacterial toxins of TA systems can be released into the host cells, threatening the host immune response by inducing death of the host innate immunity cells, increasing bacterial virulence, as discovered with the toxins ChpK and MazF in Leptospira interrogans [230] . Currently, there are 6 categories of TA systems, according to their nature and mode of action [231]. In types I and III, the antitoxins are RNA molecules that regulate the activity of the corresponding toxin by inhibiting the translation of the toxin mRNA, as antisense RNA (Type I) or by directly inhibiting the action of the toxin protein (Type III) [212, 231]. TA systems type II and IV are characterized by the fact that both toxin and antitoxin are proteins [209, 231]. While in type II systems the antitoxin binds directly to the toxin to inhibit its effect and toxicity [212, 232], in type IV systems, the proteins counteract without direct interaction, with the antitoxin reversing the effect of the toxin by acting on its target [220, 233]. Interestingly, the latest TA system types to be discovered present different regulatory principles compared to types I to IV [220, 231]. Type V are characterized by a protein antitoxin that has a sequence-specific activity of endoribonuclease that acts on the cleavage of the toxin mRNA, preventing its translation [234]. On the other hand, type 28 VI are known to have the toxin degraded by cleavage through a specific protease in a complex together with the antitoxin, rather than a direct actuation of the antitoxin itself [235]. Figure 2.6 – Hypothetical involvement of TA systems in cellular processes and main functions performed by these complexes in several bacterial species, most already confirmed for E. coli . Stressful conditions can act as TA inducers, such as antibiotic stress, nutrient starvation, phage infection and environmental alterations, as changes in temperature and pH. TA systems can perform a diversity of functions, as regulation of: 1. DNA replication; 2. tRNA synthesis; 3. macromolecular synthesis; 4. phage infection; 5. cytoskeletal polymerization; 6. plasmid maintenance; and 7. cell wall disruption. Adapted from [227]. 2.4.1. Characterization of the mazEF module in E. coli The mazEF system was first described in E. coli as a stress-induced TA located on the chromosome, in which mazF codes for the stable toxin MazF and mazE for the labile antitoxin MazE [217]. mazEF is negatively autoregulated by the combined action of the toxin (MazF) and antitoxin (MazE) proteins, which are co-expressed and interact directly at the transcriptional level on the mazEF promoter P2, being characterized as a type II system [212, 228]. Stressful conditions can affect the continuous expression of mazE by preventing its transcription and/or translation, thereby, mazEF is defined as a stress-induced suicide module [236]. On the other hand, the toxin MazF is a sequence-specific mRNA endoribonuclease that can initiate the 29 programmed cell death (PCD) pathway in response to various stresses [210, 212, 228], as described in Figure 2.7. Figure 2.7 – Schematic representation of the E. coli mazEF -mediated cell death pathway. The combined action of MazE and MazF proteins on the mazEF promoter P2 leads to the negative autoregulation of mazEF at the transcription level. MazE antitoxin and MazF toxin act in a coordinate matter, with the MazE antitoxin inhibiting the action of the toxin MazF. Besides being labile, MazE protein can also be degraded by ClpPA, leaving the toxin to act freely and induce apoptosis. MazF toxin can inhibit protein synthesis through cleavage of mRNAs and act on the synthesis of cell death proteins that induce programmed cell death. Adapted from [210]. Although MazF is a stable long-lived toxin, the labile protein antitoxin, MazE, can be degraded by ClpPA serine protease [228]. Stressful conditions, such as antibiotics targeting the inhibition of translation and/or transcription or antibiotics able to cause DNA damage, can prevent the expression of the mazEF module and, consequently, cause a reduction in the concentration of MazE, allowing MazF toxin to act uncontrollably [218]. Such stress conditions, known to cause bacterial cell death, have been found to act through the mazEF module [236–238]. Recent studies have shown that MazE could “resuscitate” E. coli cells within six hours of MazF overproduction, 30 however, exceeded that time threshold, MazE was unable to reverse the bactericidal effect of the overexpressed MazF [218, 226]. Proteins from the TA complexes are known to lead to cell growth inhibition, which, in turn, may interfere with DNA replication and translation, cell division and ATP synthesis [227]. As so, by inhibiting important cellular processes, TA modules may decrease E. coli biofilm formation and hinder its maintenance [220, 227]. Previous studies have suggested that some TA modules may play an important role in infections, especially during host colonization, implying that TA systems may be considered new virulence factors [224]. Moreover, a differential effect of TA systems on cell death and biofilm formation was previously shown with E. coli , where a significant defect on biofilm formation was caused by the deletion of the toxin mazF , emphasizing the idea that biofilm formation may, indeed, be affected by mazEF. TA mechanisms [239]. As previously explained, a continuous expression of MazE is required to prevent cell death, and this served as a basis for the development of a model to study mazEF as an inducer of programmed cell death in response to severe nutrient starvation, such as a specific lack of amino acids, heat shock or exposure to antibiotics [217, 230, 240]. Furthermore, mazEF acts as a regulator by inhibiting translation through cleavage of mRNAs at specific sites, recognizing specific amino acid sequences to induce a reversible state of bacteriostasis [228]. Nonetheless, as a result of the involvement of TA systems in PCD, it is suggested that mutations on the mazEF complex may result in a prominent decrease of biofilm formation, as previously reported in several studies [214, 239, 241]. 2.4.1.1. Programmed cell death in E. coli PCD is an active process that leads to cell death. This mechanism is essential to several microorganisms, since it is required for the elimination of harmful and/or damaged cells and regulation of the cellular population [242, 243]. The most well-known PCD processes in bacteria are related to TA systems [228]. The relation between TA and PCD has already been proven, for instance, with the activation of mazEF -mediated PCD as a response to DNA repair systems failure to detect damaged chromosomes, causing cells carrying genomic mutations or defects to enter the PCD pathway, thereby contributing to genomic stability within populations [210]. Although the involvement of mazEF in PCD may be controversial in other species [244], with some authors reporting that MazF induces a reversible stasis phenomenon instead of leading to cell 31 death [245, 246], mazEF was first described as a TA system linked to PCD in E. coli , being responsible for post-segregational killing [217, 228]. The expression of mazEF has been associated with a state of bacteriostasis in response to cellular damage [247], however, when reaching a certain threshold, for instance due to exhaustive DNA damage, the TA system may guide cells to enter the PCD pathway instead [248]. This mechanism is also associated with severe nutritional stress, during which the death of part of the population provides nutrients to the remaining surviving cells [217]. It has been shown that mazEFmediated death can be triggered by thymine starvation [236, 249], mitomycin C [237], nalidixic acid [237], UV irradiation [237], antibiotics [210, 238], oxidative (H2O2) stresses [237, 250] and high temperatures (50 °C) [251, 252]. 2.4.2. mazEF and persister cells Despite some debate regarding the involvement of TA systems in the control of biofilm formation, as previously mentioned, recent studies reported that the autoregulation of these systems interferes with the formation of persister cells in E. coli [129, 253], either by a spontaneous [254] or stochastic [221, 255] process. Moreover, further studies explained how the redundancy of type II TA systems in bacteria is associated with an increased frequency in the formation of persister cells [256]. Figure 2.8 – Schematization of the persistence mechanism due to persister cells. Although antimicrobial therapies can eradicate part of the biofilm cells, some persistent variants are not affected by the antimicrobial drugs and can persist, ensuring biofilm survival. After antimicrobial therapy discontinuation, the cells within the persistent fraction are able to continue to grow and lead to a mature biofilm again. Adapted from [257]. 32 Although a small number of cells enter the persistent state (Figure 2.8), this phenomenon is remarkably influenced by the decrease in the synthesis of some proteins, as a result of environmental and stress stimuli, such as nutritional depletion, antibiotic stress and host immune system pressure [209], known to influence the regulation of the expression of TA modules [106]. 2.4.3. The role of mazEF system in different species It is known that TA systems may present different sequences, mechanisms and physiological functions in gram-positive and gram-negative bacteria [258, 259]. Thereby, not all the findings reported in E. coli can be extrapolated for other species, especially gram-positive. Although the TA function of mazEF was experimentally confirmed in distinct species, such as S. aureus [260] , S. mutans [261] and Staphylococcus equorum [262], this operon has been described as a TA system in other species based on protein homology, as, for instance, in S. epidermidis [263] , P. aeruginosa [264] and Mycobacterium tuberculosis [265] . In fact, a recent study showed that the S. aureus mazEF sequence has a homologous sequence in all the 36 species of the Staphylococcus genus that were assessed [266]. Interestingly, it was previously found that MazE-like proteins in grampositive species form a cluster and are more closely related than the MazE-like proteins in gramnegative bacteria [11]. Accordingly, also MazF proteins in gram-positive strains presented a significant similarity and identity between them [262]. Notwithstanding, some similarities were found between mazEF functions in several species, regardless of their gram staining. Earlier studies reported that TA systems did not play a role in biofilm formation in either S. mutans [267] or E. coli [268]. However, recent studies showed the involvement of TA in biofilm formation [209, 269], with diverse scientific publications linking mazEF regulation and biofilm formation on distinct pathogenic species, such as E. coli [214, 241], P. aeruginosa [264, 270], and S. aureus [270, 271]. Interestingly, it was previously reported that mazEF systems may be involved in the persistence of S. mutans bacteria [207] , where overexpression of genes associated with the toxin and antitoxin modules was found in persister cells, similarly to what was described in E. coli [208, 253]. More similarities with E.coli have been described in M. tuberculosis , a bacteria that can be either gram-positive or -negative, as it was found that mazEF play a role in antimicrobial susceptibility and in stress response in this species [265, 272]. 33 Similarly to what happens in E. coli (gram-negative) with the specific mRNA sequence ACA [273], in Bacillus subtilis (gram-positive) the mRNA interferase MazF is specific for the UACAU sequence. Moreover, in S. aureus (gram-positive) it was also found that mazF is a sequence-specific mRNA interferase that cleaves mRNA UACAU sequences [260]. Regarding mazEF TA complex in Staphylococcus spp. , previous studies with S. aureus [274] reported an increased transcription of mazEF upon exposure to antibiotics, such as tetracycline and erythromycin [275, 276], which corroborates the hypothesis that TA systems may affect antimicrobial susceptibility. It was also found that S. aureus mazF is able to induce bacteriostasis by targeting selective mRNAs for cleavage, which may be related to the dormant physiological state of bacteria [277, 278], and that the interaction with antibiotics triggers an increase in the expression of other TA systems contributing to its virulence [275, 276]. A recent study targeting novel TA systems in S. aureus confirmed that the mazF endogenous sequence may induce stasis rather than cell death and that the deletion of the mazEF operon resulted in increased sensitivity to -lactam antibiotics [279]. Moreover, previous experiments conducted with S. equorum led to the suggestion that mazEF is involved in processes beyond pathogenicity in staphylococci [262]. However, to date, the function of mazEF on S. epidermidis is yet to be determined. Notwithstanding, it is already known that S. epidermidis mazEF sequence is homologous to the sequence in other species, previously described as a TA system [263, 266, 280], as outlined above. Moreover, recent studies have observed an increase in the expression of mazF upon biofilm formation in S. epidermidis, suggesting that the mazEF operon may be involved in the regulation of the initial phase of the biofilm lifecycle in this species [281], as also reported for other species mentioned above. As discussed earlier, in S. epidermidis, mazE was only expressed in biofilms with induced dormancy [10], suggesting that mazEF may have a role in the occurrence and persistence of biofilm-associated infections. Hence, a better study of the molecular mechanisms underlying biofilm dormancy, focusing on the role of mazEF as a hypothetical TA system in S. epidermidis , as well as in other important and concerning species, would help overcome the great number of nosocomial infections registered each year in hospitals around the world. 34 2.4.4. Targeting TA systems to fight infections As discussed above, TA can regulate some virulence factors, such as the control of biofilm infections and antimicrobial susceptibility, as well as the emergence of persisters and dormant cells. This triggered interest in using them as targets for antimicrobial therapies [282]. For instance, Williams et al. suggested that the use of TA systems to fight bacterial infections should focus on the artificial activation of the toxin module [282]. Since TA genes have no homologues in the human genome and are ubiquitously present in several important bacterial species, the interest in exploiting these systems as potential antimicrobial targets has significantly increased over the last decade [282]. TA toxins generally interfere with biological processes that are the target of antimicrobial agents, which led to the suggestion of a new strategy, based on TA systems, for treating infections and overcoming reduced antimicrobial susceptibility. More specifically, the activation of latent toxin proteins of TA systems was proposed as an alternative or adjuvant strategy to antimicrobial therapy [270, 282–284]. For instance, the interference with the equilibrium between the toxin and antitoxin may trigger the mechanism of PCD and, consequently, TA systems may be used to control infections by inducing the death of the pathogens [285]. Although the antitoxin module of type II TA systems normally acts as a transcriptional repressor of its own operon, it can occasionally act as a repressor on the expression of other genes involved in general stress response, being suggested that the artificial induction of the antitoxin can be used to control the expression of some virulence factors and metabolic pathways involved in the infection process [209, 286, 287]. Regarding mazEF , it is suggested that drugs could be used to directly target the mazEF complex and induce PCD, resorting to the activation of the toxin either by allosteric activation of MazF or by restricting the function of the antitoxin, MazE [240, 288]. On the other hand, proteolytic degradation of the antitoxin module is another suggestion to release the toxin and, consequently, induce cell death [282, 289]. Moreover, it is possible to inhibit the transcription of the TA locus using a molecule that binds to the promoter, resulting in the obstruction of the production of both the toxin and antitoxin. Since the antitoxin has a shorter cellular half-life, it would ultimately enable the toxin to act freely inducing toxin-mediated killing of bacteria [290, 291]. A former study with S. aureus showed that the ectopic 41 88. Stewart PS. Mechanisms of antibiotic resistance in bacterial biofilms. Int J Med Microbiol. 2002;292:107–13. 89. Ayrapetyan M, Williams T, Oliver JD. Relationship between the viable but nonculturable state and antibiotic persister cells. J Bacteriol. 2018;200:e00249. 90. Li L, Mendis N, Trigui H, Oliver JD, Faucher SP. The importance of the viable but non-culturable state in human bacterial pathogens. Front Microbiol. 2014;5:258. 91. Ayrapetyan M, Williams TC, Oliver JD. Bridging the gap between viable but non-culturable and antibiotic persistent bacteria. Trends Microbiol. 2015;23:7–13. 92. Singh S, Singh SK, Chowdhury I, Singh R. Understanding the mechanism of bacterial biofilms resistance to antimicrobial agents. Open Microbiol J. 2017;28:53–62. 93. Dunne WM, Mason EO, Kaplan SL. Diffusion of rifampin and vancomycin through a Staphylococcus epidermidis biofilm. Antimicrob Agents Chemother. 1993;37:2522–6. 94. Zheng Z, Stewart PS. Penetration of rifampin through Staphylococcus epidermidis biofilms. Antimicrob Agents Chemother. 2002;46:900–3. 95. Singh R, Ray P, Das A, Sharma M. Penetration of antibiotics through Staphylococcus aureus and Staphylococcus epidermidis biofilms. J Antimicrob Chemother. 2010;65:1955–8. 96. Keller D, Costerton JW. Oral biofilm: entry and immune system response. Compend Contin Educ Dent. 2009;30:24–32; quiz 34, 36. 97. Suci PA, Mittelman MW, Yu FP, Geesey GG. Investigation of ciprofloxacin penetration into Pseudomonas aeruginosa biofilms. Antimicrob Agents Chemother. 1994;38:2125–33. 98. Zhou G, Shi Q, Huang X, Xie X. The three bacterial lines of defense against antimicrobial agents. Int J Mol Sci. 2015;16:21711–33. 99. Mah TFC, O’Toole GA. Mechanisms of biofilm resistance to antimicrobial agents. Trends Microbiol. 2001;9:34–9. 100. Hall-Stoodley L, Costerton J. W, Stoodley P. Bacterial biofilms: from the natural environment to infectious diseases. Nat Rev Microbiol. 2004;2:95–108. 101. Balaban NQ, Helaine S, Lewis K, Ackermann M, Aldridge B, Andersson DI, et al. Definitions and guidelines for research on antibiotic persistence. Nat Rev Microbiol. 2019;17:441–8. 102. Stewart PS, Franklin MJ. Physiological heterogeneity in biofilms. Nat Rev Microbiol. 2008;6:199–210. 103. Lewis K. Persister cells, dormancy and infectious disease. Nat Rev Microbiol. 2007;5:48–56. 104. Lewis K. Persister cells. Annu Rev Microbiol. 2010;64:357–72. 105. Francolini I, Donelli G. Prevention and control of biofilm-based medical-device-related infections. FEMS Immunol Med Microbiol. 2010;59:227–38. 106. Kwan BW, Valenta JA, Benedik MJ, Wood TK. Arrested protein synthesis increases persisterlike cell formation. Antimicrob Agents Chemother. 2013;57:1468–73. 107. Jansen B, Kristinsson KG, Jansen S, Peters G, Pulverer G. In-vitro efficacy of a central venous catheter complexed with iodine to prevent bacterial colonization. J Antimicrob Chemother. 1992;30:135–9. 42 108. Uçkay I, Pittet D, Vaudaux P, Sax H, Lew D, Waldvogel F. Foreign body infections due to Staphylococcus epidermidis . Ann Med. 2009;41 July 2008:109–19. 109. Pinto D, Santos MA, Chambel L. Thirty years of viable but nonculturable state research: Unsolved molecular mechanisms. Crit Rev Microbiol. 2015;41:61–76. 110. Kim JS, Chowdhury N, Yamasaki R, Wood TK. Viable but non-culturable and persistence describe the same bacterial stress state. Environ Microbiol. 2018;20:2038–48. 111. Brauner A, Fridman O, Gefen O, Balaban NQ. Distinguishing between resistance, tolerance and persistence to antibiotic treatment. Nat Rev Microbiol. 2016;14:320–30. 112. Dewachter L, Fauvart M, Michiels J. Bacterial heterogeneity and antibiotic survival: Understanding and combatting persistence and heteroresistance. Mol Cell. 2019;76:255–67. 113. McDermott W. Microbial persistence. Harvey Lect. 1969;63:1–31. 114. Oliver JD. Recent findings on the viable but nonculturable state in pathogenic bacteria. FEMS Microbiol Rev. 2010;34:415–25. 115. Robben C, Fister S, Witte AK, Schoder D, Rossmanith P, Mester P. Induction of the viable but non-culturable state in bacterial pathogens by household cleaners and inorganic salts. Sci Rep. 2018;8:15132. 116. Kumar SS, Ghosh AR. Assessment of bacterial viability: A comprehensive review on recent advances and challenges. Microbiology. 2019;165:593–610. 117. Morishige Y, Fujimori K, Amano F. Differential resuscitative effects of pyruvate and its analogs on VBNC (Viable But Nonculturable) Salmonella . Stress Environ Regul Gene Expr Adapt Bact. 2016;28:180–6. 118. Pascoe B, Dams L, Wilkinson TS, Harris LG, Bodger O, Mack D, et al. Dormant cells of Staphylococcus aureus are resuscitated by spent culture supernatant. PLoS One. 2014;9:e85998. 119. Pasquaroli S, Zandri G, Vignaroli C, Vuotto C, Donelli G, Biavasco F. Antibiotic pressure can induce the viable but non-culturable state in Staphylococcus aureus growing in biofilms. J Antimicrob Chemother. 2013;68:1812–7. 120. Luo Y, Javed MA, Deneer H. Comparative study on nutrient depletion-induced lipidome adaptations in Staphylococcus haemolyticus and Staphylococcus epidermidis . Sci Rep. 2018;8:2356. 121. Onyango LA, Alreshidi MM. Adaptive metabolism in Staphylococci: Survival and persistence in environmental and clinical settings. J Pathog. 2018;20:1092632. 122. Orman MA, Brynildsen MP. Dormancy is not necessary or sufficient for bacterial persistence. Antimicrob Agents Chemother. 2013;57:3230–9. 123. Dietersdorfer E, Kirschner A, Schrammel B, Ohradanova-Repic A, Stockinger H, Sommer R, et al. Starved viable but non-culturable (VBNC) Legionella strains can infect and replicate in amoebae and human macrophages. Water Res. 2018;141:428–38. 124. Wu B, Liang W, Kan B. Growth phase, oxygen, temperature, and starvation affect the development of viable but non-culturable state of Vibrio cholerae . Front Microbiol. 2016;7:404. 125. Oh E, McMullen L, Jeon B. Impact of oxidative stress defense on bacterial survival and morphological change in Campylobacter jejuni under aerobic conditions. Front Microbiol. 2015;6:295. 43 126. Zhao X, Zhong J, Wei C, Lin CW, Ding T. Current perspectives on viable but non-culturable state in foodborne pathogens. Front Microbiol. 2017;8:580. 127. Nowakowska J, Oliver JD. Resistance to environmental stresses by Vibrio vulnificus in the viable but nonculturable state. FEMS Microbiol Ecol. 2013;84:213–22. 128. Allison KR, Brynildsen MP, Collins JJ. Heterogeneous bacterial persisters and engineering approaches to eliminate them. Curr Opin Microbiol. 2011;14:593–8. 129. Jayaraman R. Bacterial persistence: Some new insights into an old phenomenon. J Biosci. 2008;33:795–805. 130. Hobby GL, Meyer K, Chaffee E. Observations on the mechanism of action of penicillin. Exp Biol Med. 1942;50:281–5. 131. Bigger JW. Treatment of staphylococcal infections with penicillin by intermitent sterilization. Lancet. 1944;244:497–500. 132. Scherrer R, Moyed HS. Conditional impairment of cell division and altered lethality in hipA mutants of Escherichia coli K-12. J Bacteriol. 1988;170:3321–6. 133. van den Bergh B, Fauvart M, Michiels J. Formation, physiology, ecology, evolution and clinical importance of bacterial persisters. FEMS Microbiol Rev. 2017;41:219–51. 134. Fauvart M, de Groote VN, Michiels J. Role of persister cells in chronic infections: Clinical relevance and perspectives on anti-persister therapies. J Med Microbiol. 2011;60:699–709. 135. Cerca F, Trigo G, Correia A, Cerca N, Azeredo J, Vilanova M. SYBR green as a fluorescent probe to evaluate the biofilm physiological state of Staphylococcus epidermidis , using flow cytometry. CanJMicrobiol. 2011;57:850–6. 136. Wijtzes T, De Wit JC, In H, Van’t Riet K, Zwietering MH. Modelling bacterial growth of Lactobacillus curvatus as a function of acidity and temperature. Appl Environ Microbiol. 1995;61:2533–9. 137. Rice KC, Nelson JB, Patton TG, Yang SJ, Bayles KW. Acetic acid induces expression of the Staphylococcus aureus cidABC and lrgAB murein hydrolase regulator operons. J Bacteriol. 2005;187:813–21. 138. Cotter PD, Hill C. Surviving the acid test: Responses of gram-positive bacteria to low pH. Microbiol Mol Biol Rev. 2003;67:429–53. 139. Piddington DL, Kashkouli A, Buchmeier NA. Growth of Mycobacterium tuberculosis in a defined medium is very restricted by acid pH and Mg2+ levels. Infect Immun. 2000;68:4518–22. 140. Delavechia C, Hampp E, Fabra A, Castro S. Influence of pH and calcium on the growth, polysaccharide production and symbiotic association of Sinorhizobium meliloti SEMIA 116 with alfalfa roots. Biol Fertil Soils. 2003;38:110–4. 141. Macció D, Fabra A, Castro S. Acidity and calcium interaction affect the growth of Bradyrhizobium sp. and the attachment to peanut roots. Soil Biol Biochem. 2002;34:201–8. 142. Lee D yeon D, Galera-Laporta L, Bialecka-Fornal M, Moon EC, Shen Z, Briggs SP, et al. Magnesium flux modulates ribosomes to increase bacterial survival. Cell. 2019;177:352-360.e13. 143. Xu T, Wang X, Meng L, Zhu M, Wu J, Xu Y, et al. Magnesium links starvation-mediated antibiotic persistence to ATP. mSphere. 2020;5:1–7. 44 144. Shan Y, Gandt AB, Rowe SE, Deisinger JP, Conlon BP, Lewis K. ATP-dependent persister formation in Escherichia coli . MBio. 2017;8:e02267. 145. Conlon BP, Rowe SE, Gandt AB, Nuxoll AS, Donegan NP, Zalis EA, et al. Persister formation in Staphylococcus aureus is associated with ATP depletion. Nat Microbiol. 2016;1:16051. 146. Unoson C, Wagner EGH. A small SOS-induced toxin is targeted against the inner membrane in Escherichia coli . Mol Microbiol. 2008;70:258–70. 147. Wang Y, Bojer MS, George SE, Wang Z, Jensen PR, Wolz C, et al. Inactivation of TCA cycle enhances Staphylococcus aureus persister cell formation in stationary phase. Sci Rep. 2018;8:10849. 148. Carvalhais V, Pérez-Cabezas B, Oliveira C, Vitorino R, Vilanova M, Cerca N. Tetracycline and rifampicin induced a viable but nonculturable state in Staphylococcus epidermidis biofilms. Future Microbiol. 2018;13:27–36. 149. Carvalhais V, Cerveira F, Vilanova M, Cerca N, Vitorino R. An immunoproteomic approach for characterization of dormancy within Staphylococcus epidermidis biofilms. Mol Immunol. 2015;65:429–35. 150. Carvalhais V, Cerca N, Vilanova M, Vitorino R. Proteomic profile of dormancy within Staphylococcus epidermidis biofilms using iTRAQ and label-free strategies. Appl Microbiol Biotechnol. 2015;99:2751–62. 151. Carvalhais V, França A, Pier GB, Vilanova M, Cerca N, Vitorino R. Comparative proteomic and transcriptomic profile of Staphylococcus epidermidis biofilms grown in glucose-enriched medium. Talanta. 2015;132:705–12. 152. Nguyen TH, Park MD, Otto M. Host response to Staphylococcus epidermidis colonization and infections. Front Cell Infect Microbiol. 2017;7:90. 153. Cheung GYC, Otto M. Understanding the significance of Staphylococcus epidermidis bacteremia in babies and children. Current Opinion in Infectious Diseases. 2010;23:208–16. 154. Brown MM, Horswill AR. Staphylococcus epidermidis - Skin friend or foe? PLoS Pathog. 2020;16:e1009026. 155. Pastar I, O’Neill K, Padula L, Head CR, Burgess JL, Chen V, et al. Staphylococcus epidermidis boosts innate immune response by activation of gamma delta T cells and induction of perforin-2 in human skin. Front Immunol. 2020;11:550946. 156. Bookshelf N, Sonny Eli Zaluchu, Plaf, Janeway CA, Travers P, Walport M, et al. Principles of innate and adaptive immunity. In: Immunobiology: The Immune System in Health and Disease. 5th Edition. 2001. p. 1. 157. Chaplin DD. Overview of the immune response. J Allergy Clin Immunol. 2010;125:S3-23. 158. Linehan JL, Harrison OJ, Han SJ, Byrd AL, Vujkovic-Cvijin I, Villarino A V., et al. Non-classical immunity controls microbiota impact on skin immunity and tissue repair. Cell. 2018;172:784–96. 159. Gasteiger G, D’osualdo A, Schubert DA, Weber A, Bruscia EM, Hartl D. Cellular innate immunity: An old game with new players. Journal of Innate Immunity. 2017;9:111–25. 160. Medzhitov R, Janeway CA. Decoding the patterns of self and nonself by the innate immune system. Science. 2002;296:298–300. 45 161. DeLeo FR, Quinn MT. Phagocytes (innate immunity). In: Encyclopedia of Microbiology. 2019. p. 496–505. 162. Takeda K, Akira S. TLR signaling pathways. Semin Immunol. 2004;16:3–9. 163. Akira S, Hemmi H. Recognition of pathogen-associated molecular patterns by TLR family. Immunology Letters. 2003;85:85–95. 164. Stevens NT, Sadovskaya I, Jabbouri S, Sattar T, O’gara JP, Humphreys H, et al. Staphylococcus epidermidis polysaccharide intercellular adhesin induces IL-8 expression in human astrocytes via a mechanism involving TLR2. Cell Microbiol. 2009;11:421–32. 165. Fournier B. The function of TLR2 during staphylococcal diseases. Frontiers in Cellular and Infection Microbiology. 2013;2:167. 166. Dong Y, Glaser K, Schlegel N, Claus H, Speer CP. An underestimated pathogen: Staphylococcus epidermidis induces pro-inflammatory responses in human alveolar epithelial cells. Cytokine. 2019;123 March:154761. 167. Strunk T, Coombs MRP, Currie AJ, Richmond P, Golenbock DT, Stoler-Barak L, et al. TLR2 mediates recognition of live Staphylococcus epidermidis and clearance of bacteremia. PLoS One. 2010;5:e10111. 168. Rautenberg M, Joo H, Otto M, Peschel A. Neutrophil responses to staphylococcal pathogens and commensals via the formyl peptide receptor 2 relates to phenol‐soluble modulin release and virulence. FASEB J. 2011;25:1254–63. 169. Fairn GD, Grinstein S. How nascent phagosomes mature to become phagolysosomes. Trends in Immunology. 2012;33:397–405. 170. Riool M, De Boer L, Jaspers V, Van Der Loos CM, Van Wamel WJB, Wu G, et al. Staphylococcus epidermidis originating from titanium implants infects surrounding tissue and immune cells. Acta Biomater. 2014;10:5202–12. 171. Nauseef WM. How human neutrophils kill and degrade microbes: An integrated view. Immunological Reviews. 2007;219:88–102. 172. Faurschou M, Borregaard N. Neutrophil granules and secretory vesicles in inflammation. Microbes and Infection. 2003;5:1317–27. 173. Yipp BG, Kubes P. NETosis: How vital is it? Blood. 2013;122:2784–94. 174. Pilsczek FH, Salina D, Poon KKH, Fahey C, Yipp BG, Sibley CD, et al. A novel mechanism of rapid nuclear neutrophil extracellular trap formation in response to Staphylococcus aureus . J Immunol. 2010;185:7413–25. 175. Davis MM, Boniface JJ, Reich Z, Lyons D, Hampl J, Arden B, et al. Ligand recognition by alpha beta T cell receptors. Annu Rev Immunol. 1998;16:523–44. 176. Jakubzick C V., Randolph GJ, Henson PM. Monocyte differentiation and antigen-presenting functions. Nature Reviews Immunology. 2017;17:349–62. 177. Duque GA, Descoteaux A. Macrophage cytokines: Involvement in immunity and infectious diseases. Frontiers in Immunology. 2014;5:491. 178. Zhang JM, An J. Cytokines, inflammation, and pain. International Anesthesiology Clinics. 2007;45:27–37. 46 179. Cavaillon JM. Proversus anti-inflammatory cytokines: myth or reality. Cell Mol Biol. 2001;47:695–702. 180. O’Shea JJ, Gadina M, Siegel RM. Cytokines and Cytokine Receptors. In: Clinical Immunology. 2019. p. 108–35. 181. Spiliopoulou AI, Kolonitsiou F, Krevvata MI, Leontsinidis M, Wilkinson TS, Mack D, et al. Bacterial adhesion, intracellular survival and cytokine induction upon stimulation of mononuclear cells with planktonic or biofilm phase Staphylococcus epidermidis . FEMS Microbiol Lett. 2012;330:56–65. 182. Laborel-Préneron E, Bianchi P, Boralevi F, Lehours P, Fraysse F, Morice-Picard F, et al. Effects of the Staphylococcus aureus and Staphylococcus epidermidis secretomes isolated from the skin microbiota of atopic children on CD4+ T cell activation. PLoS One. 2015;10:e0141067. 183. Aarag Fredheim EG, Granslo HN, Flægstad T, Figenschau Y, Rohde H, Sadovskaya I, et al. Staphylococcus epidermidis polysaccharide intercellular adhesin activates complement. FEMS Immunol Med Microbiol. 2011;63:269–80. 184. Megyeri K, Mándi Y, Degré M, Rosztóczy I. Induction of cytokine production by different staphylococcal strains. Cytokine. 2002;19:206–12. 185. Rus H, Cudrici C, Niculescu F. The role of the complement system in innate immunity. Immunologic Research. 2005;33:103–12. 186. de Boer JP, Wolbink GJ, Thijs LG, Baars JW, Wagstaff J, Hack CE. Interplay of complement and cytokines in the pathogenesis of septic shock. Immunopharmacology. 1992;24:135–48. 187. Gullstrand B, Mårtensson U, Sturfelt G, Bengtsson AA, Truedsson L. Complement classical pathway components are all important in clearance of apoptotic and secondary necrotic cells. Clin Exp Immunol. 2009;156:303–11. 188. Harboe M, Mollnes TE. The alternative complement pathway revisited. Journal of Cellular and Molecular Medicine. 2008;12:1074–84. 189. Bajic G, Degn SE, Thiel S, Andersen GR. Complement activation, regulation, and molecular basis for complement‐related diseases. EMBO J. 2015;34:2735–57. 190. Kristian SA, Birkenstock TA, Sauder U, Mack D, Götz F, Landmann R. Biofilm formation induces C3a release and protects Staphylococcus epidermidis from IgG and complement deposition and from neutrophil-dependent killing. J Infect Dis. 2008;197:1028–35. 191. Thurlow LR, Hanke ML, Fritz T, Angle A, Aldrich A, Williams SH, et al. Staphylococcus aureus biofilms prevent macrophage phagocytosis and attenuate inflammation in vivo . J Immunol. 2011;186:6585–96. 192. Hay ID, Wang Y, Moradali MF, Rehman ZU, Rehm BHA. Genetics and regulation of bacterial alginate production. Environmental Microbiology. 2014;16:2997–3011. 193. Ryder VJ, Chopra I, O’Neill AJ. Increased mutability of Staphylococci in biofilms as a consequence of oxidative stress. PLoS One. 2012;7:e47695. 194. Johnson GM, Lee DA, Regelmann WE, Gray ED, Peters G, Quie PG. Interference with granulocyte function by Staphylococcus epidermidis slime. Infect Immun. 1986;54:13–20. 195. Gray ED, Verstegen M, Peters G, Regelmann WE. Effect of extracellular slime substance from Staphylococcus epidermidis on the human cellular immune response. Lancet. 1984;1:365–7. 47 196. Gil C, Solano C, Burgui S, Latasa C, García B, Toledo-Arana A, et al. Biofilm matrix exoproteins induce a protective immune response against Staphylococcus aureus biofilm infection. Infect Immun. 2014;82:1017–29. 197. Lai Y, Villaruz AE, Li M, Cha DJ, Sturdevant DE, Otto M. The human anionic antimicrobial peptide dermcidin induces proteolytic defence mechanisms in staphylococci. Mol Microbiol. 2007;63:497–506. 198. Periasamy S, Chatterjee S, Cheung G, Otto M. Phenol-soluble modulins in staphylococci: What are they originally for? Commun Integr Biol. 2012;5:275–7. 199. Vadyvaloo V, Otto M. Molecular genetics of Staphylococcus epidermidis biofilms on indwelling medical devices. Int J Artif Organs. 2005;28:1069–78. 200. Kocianova S, Vuong C, Yao Y, Voyich JM, Fischer ER, DeLeo FR, et al. Key role of poly-γ-dlglutamic acid in immune evasion and virulence of Staphylococcus epidermidis . J Clin Invest. 2005;115:688–94. 201. Peterson PK, Wilkinson BJ, Kim Y, Schmeling D, Quie PG. Influence of encapsulation on staphylococcal opsonization and phagocytosis by human polymorphonuclear leukocytes. Infect Immun. 1978;19:943–9. 202. Vuong C, Voyich JM, Fischer ER, Braughton KR, Whitney AR, DeLeo FR, et al. Polysaccharide intercellular adhesin (PIA) protects Staphylococcus epidermidis against major components of the human innate immune system. Cell Microbiol. 2004;6:269–75. 203. Cheung GYC, Rigby K, Wang R, Queck SY, Braughton KR, Whitney AR, et al. Staphylococcus epidermidis strategies to avoid killing by human neutrophils. PLoS Pathog. 2010;6:e1001133. 204. Schommer NN, Christner M, Hentschke M, Ruckdeschel K, Aepfelbacher M, Rohde H. Staphylococcus epidermidis uses distinct mechanisms of biofilm formation to interfere with phagocytosis and activation of mouse macrophage-like cells 774A.1. Infect Immun. 2011;79:2267–76. 205. Guenther F, Stroh P, Wagner C, Obst U, Hänch GM. Phagocytosis of staphylococci biofilms by polymorphonuclear neutrophils: S. aureus and S. epidermidis differ with regard to their susceptibility towards the host defense. Int J Artif Organs. 2009;32:565–7. 206. de Vor L, Rooijakkers SHM, van Strijp JAG. Staphylococci evade the innate immune response by disarming neutrophils and forming biofilms. FEBS Letters. 2020;594:2556–69. 207. Leung V, Lévesque CM. A stress-inducible quorum-sensing peptide mediates the formation of persister cells with noninherited multidrug tolerance. J Bacteriol. 2012;194:2265–74. 208. Vázquez-Laslop N, Lee H, Neyfakh AA. Increased persistence in Escherichia coli caused by controlled expression of toxins or other unrelated proteins. J Bacteriol. 2006;188:3494–7. 209. Wang X, Wood TK. Toxin-antitoxin systems influence biofilm and persister cell formation and the general stress response. Appl Environ Microbiol. 2011;77:5577–83. 210. Engelberg-Kulka H, Amitai S, Kolodkin-Gal I, Hazan R. Bacterial programmed cell death and multicellular behavior in bacteria. PLoS Genet. 2006;2:1518–26. 211. Magnuson RD. Hypothetical functions of toxin-antitoxin systems. J Bacteriol. 2007;189:6089–92. 48 212. Van Melderen L. Toxin-antitoxin systems: why so many, what for? Curr Opin Microbiol. 2010;13:781–5. 213. Hayes F. Toxins-antitoxins: Plasmid maintenance, programmed cell death, and cell cycle arrest. Science. 2003;301:1496–9. 214. Karimi S, Ghafourian S, Kalani MT, Jalilian FA, Hemati S, Sadeghifard N. Association between toxin-antitoxin systems and biofilm formation. Jundishapur J Microbiol. 2015;8:1–6. 215. Metzger S, Dror IB, Aizenman E, Schreiber G, Toone M, Friesen JD, et al. The nucleotide sequence and characterization of the relA gene of Escherichia coli . J Biol Chem. 1988;263:15699– 704. 216. Masuda Y, Miyakawa K, Nishimura Y, Ohtsubo E. chpA and chpB, Escherichia coli chromosomal homologs of the pem locus responsible for stable maintenance of plasmid R100. J Bacteriol. 1993;175:6850–6. 217. Aizenman E, Engelberg-Kulka H, Glaser G. An Escherichia coli chromosomal “addiction module” regulated by guanosine 3’,5’-bispyrophosphate: a model for programmed bacterial cell death. Proc Natl Acad Sci. 1996;93:6059–63. 218. Amitai S, Yassin Y, Engelberg-kulka H. mazF -mediated cell death in Escherichia coli : a point of no return. J Bacteriol. 2004;186:8295–300. 219. Gerdes K, Rasmussen PB, Molin S. Unique type of plasmid maintenance function: postsegregational killing of plasmid-free cells. Proc Natl Acad Sci. 1986;83:3116–20. 220. Unterholzner SJ, Poppenberger B, Rozhon W. Toxin-antitoxin systems. Bioengineered. 2014;5:1–13. 221. Rotem E, Loinger A, Ronin I, Levin-Reisman I, Gabay C, Shoresh N, et al. Regulation of phenotypic variability by a threshold-based mechanism underlies bacterial persistence. Proc Natl Acad Sci. 2010;107:12541–6. 222. Korch SB, Hill TM. Ectopic overexpression of wild-type and mutant hipA genes in Escherichia coli : Effects on macromolecular synthesis and persister formation. J Bacteriol. 2006;188:3826– 36. 223. Brown MR, Collier PJ, Gilbert P. Influence of growth rate on susceptibility to antimicrobial agents: modification of the cell envelop and batch and continuous culture studies. Antimicrob Agents Chemother. 1990;34:1623–8. 224. Lobato-Marquez D, Diaz-Orejas R, Garcia-del Portillo F. Toxin-antitoxins and bacterial virulence. FEMS Microbiol Rev. 2016;40:592–609. 225. Hazan R, Engelberg-Kulka H. Escherichia coli mazEF -mediated cell death as a defense mechanism that inhibits the spread of phage P1. Mol Genet Genomics. 2004;272:227–34. 226. Kolodkin-gal I, Engelberg-kulka H. Induction of Escherichia coli chromosomal mazEF by stressful conditions causes an irreversible loss of viability. Microbiology. 2006;188:3420–3. 227. Wen Y, Behiels E, Devreese B. Toxin-antitoxin systems: Their role in persistence, biofilm formation, and pathogenicity. Pathog Dis. 2014;70:240–9. 228. Engelberg-Kulka H. mazEF : a chromosomal toxin-antitoxin module that triggers programmed cell death in bacteria. J Cell Sci. 2005;118:4327–32. 49 229. Pecota DC, Wood TK. Exclusion of T4 phage by the hok/sok killer locus from plasmid R1. J Bacteriol. 1996;178:2044–50. 230. Komi KK, Ge YM, Xin XY, Ojcius DM, Sun D, Hu WL, et al. ChpK and MazF of the toxinantitoxin modules are involved in the virulence of Leptospira interrogans during infection. Microbes Infect. 2015;17:34–47. 231. Harms A, Brodersen DE, Mitarai N, Gerdes K. Toxins, targets, and triggers: An overview of toxin-antitoxin biology. Mol Cell. 2018;7:768–84. 232. Jaffé A, Ogura T, Hiraga S. Effects of the ccd function of the F plasmid on bacterial growth. J Bacteriol. 1985;163:841–9. 233. Page R, Peti W. Toxin-antitoxin systems in bacterial growth arrest and persistence. Nat Chem Biol. 2016;12:208–14. 234. Wang X, Lord DM, Cheng HY, Osbourne DO, Hong SH, Sanchez-Torres V, et al. A new type V toxin-antitoxin system where mRNA for toxin GhoT is cleaved by antitoxin GhoS. Nat Chem Biol. 2012;8:855–61. 235. Aakre CD, Phung TN, Huang D, Laub MT. A bacterial toxin inhibits DNA replication elongation through a direct interaction with the β sliding clamp. Mol Cell. 2013;52:617–28. 236. Sat B, Reches M, Engelberg-Kulka H. The Escherichia coli mazEF suicide module mediates thymineless death. J Bacteriol. 2003;185:1803–7. 237. Hazan R, Sat B, Engelberg-kulka H. Escherichia coli mazEF -Mediated cell death is triggered by various stressful conditions. Microbiology. 2004;186:3663–9. 238. Sat B, Hazan R, Fisher T, Khaner H, Engelberg-kulka H, Glaser GAD. Programmed cell death Escherichia coli : some antibiotics can trigger mazEF lethality. J Bacteriol. 2001;183:2041–5. 239. Kolodkin-Gal I, Verdinger R, Shlosberg-Fedida A, Engelberg-Kulka H. A differential effect of E. coli toxin-antitoxin systems on cell death in liquid media and biofilm formation. PLoS One. 2009;4:1–8. 240. Belitsky M, Avshalom H, Erental A, Yelin I, Kumar S, London N, et al. The Escherichia coli extracellular death factor EDF induces the endoribonucleolytic activities of the toxins MazF and ChpBK. Mol Cell. 2011;41:625–35. 241. Kim Y, Wang X, Ma Q, Zhang XS, Wood TK. Toxin-antitoxin systems in Escherichia coli influence biofilm formation through YjgK (TabA) and fimbriae. J Bacteriol. 2009;191:1258–67. 242. Nagata S. Apoptosis by death factor. Cell. 1997;88:355–65. 243. Gray KM. Intercellular communication and group behavior in bacteria. Trends Microbiol. 1997;5:184–8. 244. Tripathi A, Dewan PC, Siddique SA, Varadarajan R. MazF-induced growth inhibition and persister generation in Escherichia coli . J Biol Chem. 2014;289:4191–205. 245. Buts L, Lah J, Dao-Thi MH, Wyns L, Loris R. Toxin-antitoxin modules as bacterial metabolic stress managers. Trends in Biochemical Sciences. 2005;30:672–9. 246. Gerdes K, Christensen SK, Løbner-Olesen A. Prokaryotic toxin-antitoxin stress response loci. Nature Reviews Microbiology. 2005;3:371–82. 247. Bayles KW. Bacterial programmed cell death: Making sense of a paradox. Nature Reviews Microbiology. 2014;12:63–9. 50 248. Rice KC, Mann EE, Endres JL, Weiss EC, Cassat JE, Smeltzer MS, et al. The cidA murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus . Proc Natl Acad Sci. 2007;104:8113–8. 249. Nakayama K, Kusano K, Irino N, Nakayama H. Thymine starvation-induced structural changes in Escherichia coli DNA. Detection by pulsed field gel electrophoresis and evidence for involvement of homologous recombination. J Mol Biol. 1994;243:611–20. 250. Storz G, Imlay J a. Oxidative stress. Curr Opin Microbiol. 1999;2:188–94. 251. Raina S, Missiakas D, Georgopoulos C. The rpoE gene encoding the sigmaE(sigma24) heat shock sigma factor of Escherichia coli . Embo J. 1995;14:1043–55. 252. Rouvière PE, De Las Peñas A, Mecsas J, Lu CZ, Rudd KE, Gross CA. rpoE , the gene encoding the second heat-shock sigma factor, sigma E, in Escherichia coli . EMBO J. 2018;14:1032–42. 253. Keren I, Shah D, Spoering A, Kaldalu N, Lewis K. Specialized persister cells and the mechanism of multidrug tolerance in Escherichia coli . J Bacteriol. 2004;186:8172–80. 254. Cataudella I, Trusina A, Sneppen K, Gerdes K, Mitarai N. Conditional cooperativity in toxinantitoxin regulation prevents random toxin activation and promotes fast translational recovery. Nucleic Acids Res. 2012;40:6424–34. 255. Gelens L, Hill L, Vandervelde A, Danckaert J, Loris R. A general model for toxin-antitoxin module dynamics can explain persister cell formation in E. coli . PLoS Comput Biol. 2013;9:e1003190. 256. Fasani RA, Savageau MA. Molecular mechanisms of multiple toxin-antitoxin systems are coordinated to govern the persister phenotype. Proc Natl Acad Sci. 2013;110:E2528–37. 257. Drenkard E. Antimicrobial resistance of Pseudomonas aeruginosa biofilms. Microbes Infect. 2003;5:1213–9. 258. Yang QE, Walsh TR. Toxin-antitoxin systems and their role in disseminating and maintaining antimicrobial resistance. FEMS Microbiol Rev. 2017;41:343–53. 259. Yamaguchi Y, Inouye M. Toxin-antitoxin systems in bacteria and archaea. Stress Environ Regul Gene Expr Adapt Bact. 2016;1:97–107. 260. Zhu L, Inoue K, Yoshizumi S, Kobayashi H, Zhang Y, Ouyang M, et al. Staphylococcus aureus MazF specifically cleaves a pentad sequence, UACAU, which is unusually abundant in the mRNA for pathogenic adhesive factor SraP. J Bacteriol. 2009;191:3248–55. 261. Syed MA, Koyanagi S, Sharma E, Jobin MC, Yakunin AF, Lévesque CM. The chromosomal mazEF locus of Streptococcus mutans encodes a functional type II toxin-antitoxin addiction system. J Bacteriol. 2011;193:1122–30. 262. Schuster CF, Park JH, Prax M, Herbig A, Nieselt K, Rosenstein R, et al. Characterization of a MazEF toxin-antitoxin homologue from Staphylococcus equorum . J Bacteriol. 2013;195:115–25. 263. Behrooz SK, Lida L, Ali S, Mehdi M, Rasoul M, Elnaz O, et al. Study of mazEF, sam , and phdDoc putative toxin-antitoxin systems in Staphylococcus epidermidis . Acta Microbiol Immunol Hung. 2018;65:1–11. 264. Valadbeigi H, Sadeghifard N, Salehi MB. Assessment of biofilm formation in Pseudomonas aeruginosa by antisense mazE -PNA. Microb Pathog. 2017;104:28–31. 57 Figure 3.1 – Representative gating used for the analysis of live cells within S. epidermidis populations grown under VBNC modulating conditions. Forward (FS) and side (SS) scatter signals were initially used to discriminate S. epidermidis cells (Bacteria gate) from background and debris. Then, the bacteria population was represented in a dot plot of SYBR green vs PI fluorescence and the number of live cells determined using both SYBR+/PIand SYBR+/PI+ populations, corresponding to live and potentially live cells, respectively. Dead cells (SYBR-/PI+) and negligible debris (not stained, SYBR-/PI-) were discarded. 3.2.5. Gene expression analysis Biofilms and planktonic cells were grown under VBNC modulating conditions, as described in Sections 3.2.2 and 3.2.3. Then, 48-hours biofilms were recovered from the plates and resuspended in 1 mL of 0.9% NaCl. To extract RNA from biofilm cells, a pool of at least three independent biofilms was used to reduce biological variability [11] and 1 mL of that mix was centrifuged (10 minutes, 16000 g , 4 °C) and used as template. For planktonic populations, 1 mL of the 48-hours cultures was centrifuged (10 minutes, 16000 g , 4 °C) and further used as template. The RNA extraction protocol was performed using the kit ExtractMe RNA Bacteria & Yeast (Blirt S.A., Poland), following the manufacturer’s instructions with a few optimizations, as previously described [12]. Then, RNA samples were treated with DNase I enzyme (Thermo Fisher Scientific Inc, Massachusetts, USA) and NanoDrop One (Thermo Fisher Scientific Inc) was used to quantify the concentration and assess the purity of RNA samples. Next, RNA was reverse transcribed into complementary DNA (cDNA) using 250 ng of RNA in a 10 µL reaction volume (RevertAid H minus M-Mulv RT, Thermo Fisher Scientific, Inc.) and using random primers (Bioron, Römerberg, Germany). Finally, gene expression was analysed by qPCR using Xpert Fast SYBR Mastermix (GRiSP, Lda., Porto, Portugal), following the manufacturer’s instructions and using a CFX96 (BioRad) thermal cycler with a previously optimized protocol (10 L reaction volume, run at 95 °C for 2 minutes, and 40 cycles of 95 °C for 5 seconds, 60 °C for 30 seconds). The primers used CD11c 58 for the quantification of gene expression were designed with Primer3 software [13] using S. epidermidis 1457 genome (Accession number CP020463.1) as a template and are described in Table 3.1. Table 3.1 – List of primers used for qPCR analysis. Target gene Forward sequence (5’-3’) Reverse sequence (3’-5’) Amplicon size (bp) Efficiency (%) 16S rRNA GGGCTACACACGTGCTACAA GTACAAGACCCGGGAACGTA 176 100.0 gyrB GCATTTGGTACGGGTATTGG CATCAACATCGGCATCAGTC 88 93.0 mazE CAAAATAGAAACCACAGTCTT GAAC AGATATTAAATGTGATTCATT GCAATC 138 91.8 mazF GAAGAGGAGATGTTTATTTAG CGG CCCAAACTAATATCTAAGGCA TTATC 325 95.5 3.2.6. Statistical analysis Statistical analysis was performed using GraphPad Prism version 7 (Trial version, CA, USA) through all the chapters of this thesis. One-way ANOVA with Tukey’s multiple comparisons test was used for the analysis of most data, except for gene expression analysis in which the unpaired T-test was used. A p -value below 0.05 was considered significant. 3.3. Results and discussion 3.3.1. Induction of VBNC cells in biofilms of S. epidermidis is dependent of variations of the growth media The VBNC model should be able to decrease the culturability of a population, by preventing cells from growing on regular media, without impacting their viability [1]. Thereby the assessment of culturable cells (CFU), viable cells (flow cytometry) or the total amount of cells (OD640nm quantification) allows the estimation of the proportion of VBNC cells. This model was first demonstrated using biofilms formed by strain 9142 and later confirmed in several strains, although not all strains were able to form VBNC cells under this experimental model [3]. Herein, in our first attempts to assess VBNC induction in S. epidermidis 1457, we were not able to replicate the established model, which pointed out the fact that the induction of the VBNC state in strain 1457 would not be mediated by glucose/magnesium chloride. However, when we decided to include the 59 original strain 9142, we observed that VBNC induction was also not occurring (Figure 3.2), as evaluated by the ratios between the number of culturable and live cells, assessed by CFU counting and flow cytometry, respectively. Figure 3.2 – Ratio between the number of culturable (CFU) and live biofilm cells in prevented and induced VBNC conditions, with TSB from Liofilchem. Results are displayed as the mean + standard deviation of four independent experiments. Statistical analysis was performed between the prevented and induced VBNC conditions for each strain. Based on the previously available literature [3, 9], strain 9142 was expected to have approximately 1 log culturability reduction in induced VBNC conditions. A careful review of the published papers revealed that the growth media used (TSB) was from the brand Merck, while the experiments represented in Figure 3.2 were performed in TSB from a different brand (Liofilchem). Since TSB is a complex medium, the exact composition between brands varies, and this can impact functional microbiology results [14]. As such, we repeated the same experiment using TSB from Merck, and we decided to increase the number of strains tested, to assess the validity of the model. For this initial screening, the total amount of cells from the biofilm was assessed by OD640nm quantification and the culturable cells were assessed by CFU quantification. The ratio between the amount of cells in the induced and prevented VBNC conditions (Ratio IND/PRE) was calculated for both culturable (CFU) and total cells (OD640nm). Contrary to what was observed in Figure 3.2, when using TSB from Merck we were able to confirm that this experimental model was indeed able to induce the VBNC state in strain 1457 (Figure 3.3). As described before [3], some variability was observed, but in 5 out of the 6 strains assessed, the 60 reduction of culturability was statistically significant, with only S. epidermidis PT13003 showing a smaller decrease. Moreover, the OD640nm ratios were close to 100% for all S. epidermidis isolates, meaning that the total amount of cells in biofilms under VBNC state induced conditions was not affected, suggesting a similar proportion of cells of biofilms in the prevented condition. Interestingly, strain 1457 showed an intermediate response to the VBNC induction model with an IND/PRE CFU ratio of circa 40%, meaning that the culturability suffered a decrease of about 60%, while strains COM040A and PT11004, previously studied by Carvalhais et al. [3], were the ones where the model was more effective (around 85-90% culturability decrease). Despite their higher susceptibility to VBNC induction, the fact that these strains have not been widely characterized yet, turns them into unlike candidates for genetic manipulation. Figure 3.3 – Ratio between the number of culturable (CFU) or the total amount of cells (OD640nm) found in biofilms formed by different S. epidermidis strains in TSB from Merck. Biofilms were grown under induced (IND) or prevented (PRE) VBNC conditions. The results are represented as the mean + standard deviation of at least three independent experiments. Statistical analysis was performed between the number of cells (CFU or total cells) on the prevented and induced VBNC state for each strain. * p < 0.05; ** p < 0.01; *** p < 0.005. Despite TSB not being a chemically defined medium and its exact composition cannot be assured in distinct brands or lots, both brands (Liofilchem and Merck) have the same composition in terms of glucose (2.5 mg/L) and were supplemented with the same additional concentration of glucose (1%). However, there was an evident difference in the proportion of culturable cells in the induced VBNC state when growing biofilms of strains 1457 and 9142 with TSB from Liofilchem (Figure 61 3.2), or with TSB from Merck brand (Figure 3.3), suggesting the presence of a yet unidentified component that is fundamental for VBNC induction besides glucose. Altogether, we were able to successfully implement the VBNC induction model using TSB from Merck in strain 1457, regardless of the VBNC model being slightly less effective than in some of the other strains assessed. However, S. epidermidis 1457 is a well-characterized strain, which genome has already been sequenced, and is more amenable to genetic manipulations, therefore, further studies were mainly conducted with this strain, using specifically TSB from Merck. 3.3.2. VBNC induction can be modulated in planktonic cells using a pre-established model for biofilms After establishing that the previously developed model was able to induce the VBNC state in S. epidermidis 1457 biofilms cells, we became interested in assessing if this model could also be applied to induce VBNC cells in planktonic cultures. We first assessed the model applicability using planktonic populations grown in similar conditions as the biofilms, wherein cells were adjusted to a concentration of around 2  106 CFU/mL and grown for 24 hours with 0.4% glucose or 0.4% glucose + 20 mM MgCl2 and, after medium replacement, grown for additional 24 hours with 1% glucose or 1% glucose + 20 mM MgCl2. In these experimental conditions, over 75% decrease in the culturability of cells was observed in the induced VBNC state (Figure 3.4). This finding led to the question if this model could be applied, with some alterations, to planktonic populations grown for 24 hours, which are more frequently used in scientific experiments. Thus, a second experimental setup was established, and planktonic populations were adjusted to a concentration of circa 2  107 CFU/mL and directly grown in TSB supplemented with 1% glucose (IND) or 1% glucose + 20 mM MgCl2 (PRE) and induced for up to 24 hours. Interestingly, the percentage of VBNC cells formed in both planktonic experimental designs was significantly different, as shown in Figure 3.4, wherein VBNC cells proportions was more pronounced on the 48-hours culture. A hypothesis for the lower induction of VBNC cells on 24-hour cultures is related to the lower cellular density, since the model was applied to a cellular concentration of about 107 CFU/mL, while in 48-hour assays the induction started in cultures with approximately 100 times more cells (109 CFU/mL). 62 Figure 3.4 – Culturability (CFU) of S. epidermidis 1457 planktonic cells grown under induced (IND) or prevented (PRE) VBNC conditions using two different strategies: (i) planktonic cells were grown for 24 hours in 0.4% glucose + 24 hours in 1% glucose and (ii) planktonic cells were grown for 24 hours in 1% glucose. Results are represented as the mean + standard deviation of five independent assays. Statistical analysis was performed between the two modes of growth. ** p < 0.01. Glu, glucose. It was previously shown, in E. coli , that RelE-induced dormancy was dependent on cellular concentration, with greater proportions of dormant cells being reached when starting the experiments with a higher concentration of cells [15]. This led to the hypothesis that nutrient consumption and further starvation is faster with higher densities of cells, which stimulates the entrance of cells into the VBNC state [15]. Another study, conducted with P. aeruginosa, showed that persister cells emerged in stationary planktonic cultures, but not in exponential cultures, where cell density is lower [16]. This was further confirmed in the same species in which persister cells increased in response to quorum-sensing signalling molecules, which are dependent on cell density [17]. We suggest that the same might be happening with glucose-mediated dormancy and believe a further assessment of the influence of nutrient starvation and of the release of quorum-sensing signalling molecules in the emergence of the VBNC state in S. epidermidis could help figure out the mechanisms behind this phenomenon. Overall, although both models tested in planktonic populations were able to generate VBNC cells, the 48-hours model was more effective and reached similar levels of VBNC induction as in biofilm cells, suggesting that induction of the VBNC state is not dependent on the cells’ phenotype. 63 3.3.3. mazEF expression is upregulated in VBNC induced condition in planktonic populations but not in biofilms of S. epidermidis 1457 Previous studies on the transcriptome of S. epidermidis 9142 biofilms grown under VBNC modulating conditions suggested a possible involvement of the mazEF genes in the VBNC emergence process, since it did not detect mazE expression in cells where the VBNC state was prevented [9]. However, on that study, RNA-Seq data was validated with a set of randomly selected genes that did not include mazEF . Herein, the expression of the mazE and mazF genes was determined with a different approach, analysing the genetic expression by quantitative PCR (qPCR) with the same strain of the RNA-Seq study (strain 9142). Moreover, gene expression of S. epidermidis 1457 was also assessed, both in biofilm and planktonic cultures. Table 3.2 – Analysis of mazE and mazF expression on S. epidermidis 48 hours-old biofilms and planktonic cells of strains 9142 and 1457 grown under induced or prevented VBNC conditions. Previously obtained RNA-Seq data of strain 9142 are also presented. Results are represented as the mean  standard deviation of at least three independent assays. mazE mazF RNA-Seq1 9142 biofilms Induced 34.60  10.91 122.87  77.90 Prevented ND 115.13  16.28 Fold-change3 N/A 1.05  0.58 qPCR2 Induced 8.43E-03  7.77E-03 9.50E-03  8.93E-03 Prevented 2.91E-03  7.48E-04 3.74E-03  1.74E-04 Fold-change3 2.79  2.59 3.19  2.90 1457 biofilms Induced 4.35E-03  2.89E-03 3.80E-03  2.73E-03 Prevented 3.79E-03  1.82E-03 3.64E-03  1.98E-03 Fold-change3 1.15  0.60 1.05  0.54 1457 planktonic Induced 4.44E-03  2.53E-03 7.89E-03  9.96E-04 Prevented 1.17E-03  6.45E-04 2.57E-03  1.40E-03 Fold-change3 4.05  2.64 2.58  1.79 1 RPKM (Reads Per Kilobase of transcript per Million reads mapped) values obtained by RNA-Seq 2 Normalized gene expression by qPCR (normalization to the geometric mean of 16S rRNA and gyrB ) 3 Induced/prevented genetic expression fold-change 64 As shown in Table 3.2, we observed that RNA-Seq results were not corroborated by qPCR, wherein mazE was indeed expressed in VBNC prevented conditions, with an overall 3-fold upregulation in the induced condition. Because several steps are required to construct RNA-Seq libraries and the limit of detection depends on several technical aspects, some bias can occur, and, for that reason, either performing multiple RNA-Seq runs or validating the expression of target genes by qPCR are often recommended [18, 19] An important issue when considering genetic expression is strain-to-strain variability [20] and, looking at the previous results, it is possible to observe that the expression of both mazE and mazF genes was, indeed, different between biofilms from strains 9142 and 1457. While the results obtained for the control strain (9142) suggest that the mazEF is affected by the modulation of VBNC cells, this was not true for strain 1457. However, when analysing the expression of mazEF in planktonic cultures of strain 1457, both genes were significantly upregulated in the induced condition. 3.4. Conclusions In this study, we uncovered an unexpected phenomenon related to the previously developed VBNC induction model, wherein VBNC cells were only formed when a particular brand of TSB was used (in this case, Merck). Although we did not explore the implications of this discovery and did not assess the extension of the medium specificity (by testing a wider range of growth media), it was evident that VBNC induction is strongly affected by environmental conditions, as described in other species [21–23]. Moreover, when we attempted to validate the RNA-Seq data that suggested mazEF played a key role in VBNC induction, we observed that qPCR data was not in accordance with the previous data. Nevertheless, qPCR data did point out some influence of the mazEF operon in the modulation of the VBNC state in either strain 9142 biofilms or strain 1457 planktonic cultures. Taken together, we achieved the aim of characterizing the VBNC induction model in several S. epidermidis strains, focusing particularly on S. epidermidis 1457. Nonetheless, the unexpected differences in the expression of the mazEF operon in VBNC modulation found between biofilms of strains 1457 and 9142 and between the planktonic and biofilm cultures of strain 1457, warrant further exploring of the role of this operon, as will be described in Chapter 4. 65 3.5. Bibliography 1. Cerca F, Andrade F, França A, Andrade EB, Ribeiro A, Almeida AA, et al. Staphylococcus epidermidis biofilms with higher proportions of dormant bacteria induce a lower activation of murine macrophages. J Med Microbiol. 2011;60:1717–24. 2. França A, Gaio V, Lopes N, Melo DR. Virulence factors in coagulase-negative staphylococci. Pathogens. 2021;10:170. 3. Carvalhais V, Pérez-Cabezas B, Oliveira C, Vitorino R, Vilanova M, Cerca N. Tetracycline and rifampicin induced a viable but nonculturable state in Staphylococcus epidermidis biofilms. Future Microbiol. 2018;13:27–36. 4. Mack D, Bartscht K, Fischer C, Rohde H, De Grahl C, Dobinsky S, et al. Genetic and biochemical analysis of Staphylococcus epidermidis biofilm accumulation. Methods Enzymol. 2001;336:215– 39. 5. Galac MRR, Stam J, Maybank R, Hinkle M, Mack D, Rohde H, et al. Complete genome sequence of Staphylococcus epidermidis 1457. Am Soc Microbiol. 2017;5:15–7. 6. Mack D, Siemssen N, Laufs R. Parallel induction by glucose of adherence and a polysaccharide antigen specific for plastic-adherent Staphylococcus epidermidis : Evidence for functional relation to intercellular adhesion. Infect Immun. 1992;60:2048–57. 7. Cerca N, Pier GB, Oliveira R, Azeredo J. Comparative evaluation of coagulase-negative staphylococci (CoNS) adherence to acrylic by a static method and a parallel-plate flow dynamic method. Res Microbiol. 2004;155:755–60. 8. Freitas AI, Vasconcelos C, Vilanova M, Cerca N. Optimization of an automatic counting system for the quantification of Staphylococcus epidermidis cells in biofilms. J Basic Microbiol. 2014;54:750–7. 9. Carvalhais V, França A, Cerca F, Vitorino R, Pier GB, Vilanova M, et al. Dormancy within Staphylococcus epidermidis biofilms: a transcriptomic analysis by RNA-Seq. Applied Microbiology and Biotechnology. 2014;98:1–12. 10. Cerca F, Trigo G, Correia A, Cerca N, Azeredo J, Vilanova M. SYBR green as a fluorescent probe to evaluate the biofilm physiological state of Staphylococcus epidermidis , using flow cytometry. CanJMicrobiol. 2011;57:850–6. 11. Sousa C, França A, Cerca N. Assessing and reducing sources of gene expression variability in Staphylococcus epidermidis biofilms. Biotechniques. 2014;57:295–301. 12. França A, Freitas AI, Henriques AF, Cerca N. Optimizing a qPCR gene expression quantification assay for S. epidermidis biofilms: A comparison between commercial kits and a customized protocol. PLoS One. 2012;7:e37480. 13. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. Primer3 - new capabilities and interfaces. Nucleic Acids Res. 2012;40:e115. 14. Rohde H, Knobloch JKM, Horstkotte MA, Mack D. Correlation of biofilm expression types of Staphylococcus epidermidis with polysaccharide intercellular adhesin synthesis: Evidence for involvement of icaADBC genotype-independent factors. Med Microbiol Immunol. 2001;190. 15. Tashiro Y, Kawata K, Taniuchi A, Kakinuma K, May T, Okabe S. relE -mediated dormancy is enhanced at high cell density in Escherichia coli . J Bacteriol. 2012;194:1169–76. 66 16. Spoering AL, Lewis K. Biofilms and planktonic cells of Pseudomonas aeruginosa have similar resistance to killing by antimicrobials. J Bacteriol. 2001;183:6746–51. 17. Möker N, Dean CR, Tao J. Pseudomonas aeruginosa increases formation of multidrug-tolerant persister cells in response to quorum-sensing signaling molecules. J Bacteriol. 2010;192:1946– 55. 18. Wong ML, Medrano JF. Real-time PCR for mRNA quantitation. BioTechniques. 2005;39:75– 85. 19. Coenye T. Do results obtained with RNA-sequencing require independent verification? Biofilm. 2021;3:100043. 20. Freitas AI, Lopes N, Oliveira F, Brás S, França Â, Vasconcelos C, et al. Comparative analysis between biofilm formation and gene expression in commensal and clinical Staphylococcus epidermidis . Future Microbiol. 2017;13:415–27. 21. Darcan C, Özkanca R, Idil Ö, Flint KP. Viable but non-culturable state (VBNC) of Escherichia coli related to EnvZ under the effect of pH, starvation and osmotic stress in sea water. Polish J Microbiol. 2009;58:307–17. 22. Li Y, Huang TY, Mao Y, Chen Y, Shi F, Peng R, et al. Study on the viable but non-culturable (VBNC) state formation of Staphylococcus aureus and its control in food system. Front Microbiol. 2020;11:599739. 23. Li Y, Huang TY, Mao Y, Chen Y, Shi F, Peng R, et al. Effect of environmental conditions on the formation of the viable but nonculturable state of Pediococcus acidilactici BM-PA17927 and its control and detection in food system. Front Microbiol. 2020;11:586777. 73 Table 4.1 – Continued * Restriction enzymes recognition site (SmaI, KpnI and BglII) are in bold ¥ Shine-Dalgarno sequence was added to these primers (underlined oligonucleotides) Designation Forward sequence (5’-3’) * Product size (bp) Purpose pRMC2_F ATTCAGGCTGCGCAAC 437 Primers for screening of plasmid pRMC2 MCS [16] pRMC2_R TTGTTGACATTATATCATTG CPmazEF_F_KpnI ¥ GCTAGGTACCAAGGAGTGAAGTTATGGAGGTTCTTTTCATGTT mazE : 223 mazF : 423 mazEF : 600 Amplification of mazEF homologue genes for complementation with pRMC2 CPmazE-R_BglII GCTAAGATCTTAGATCATTCATTCTTTGAATTAGATATTAAAT CPmazF_F_Kpn ¥ GCTAGGTACCAAGGAGTGAAGTTATGGAATGATTAGAAGAGGA CPmazEF_R_BglII GCTAAGATCTTAGGTTTACTGCATATAATTATTTAAGATTT 74 4.2.6. Gene expression analysis To confirm the expression or absence of expression of the mazEF genes, a qPCR was performed. The expression of mazE , mazF and mazEF was assessed in planktonic suspensions constructs to validate the mutation and complementation procedures. Importantly, to quantify the expression of genes cloned into the inducible plasmid pRMC2, planktonic cultures were induced with 0.64 g/mL ATC for 4 hours. Moreover, the expression of the rsbU gene was also assessed, since previous reports stated that mazEF deletions could interfere with the expression of this neighbour gene [5, 20]. Briefly, 1 mL of planktonic suspensions was centrifuged (10 minutes, 16000 g , 4 °C) and the following RNA extraction, cDNA synthesis and qPCR run were performed as previously detailed in Chapter 3. The primers used for the quantification of gene expression are listed in Table 4.2 and were designed with Primer3 software [21], using S. epidermidis 1457 genome (Accession number CP020463.1) as a template. Table 4.2 – List of primers used for qPCR analysis of gene expression. Target gene Forward sequence (5’-3’) Reverse sequence (3’-5’) Amplicon size (bp) Efficiency (%) 16S rRNA GGGCTACACACGTGCTA CAA GTACAAGACCCGGGAACGTA 176 100.0 mazE CAAAATAGAAACCACAGT CTTGAAC AGATATTAAATGTGATTCATTG CAATC 138 91.8 mazEF GCAACAGAAGCTTTCCC GAT CCCCTTGTTCAGACCCTTGA 141 102.0 mazF GAAGAGGAGATGTTTATT TAGCGG CCCAAACTAATATCTAAGGCA TTATC 325 95.5 rsbU CTAAAGCTGCTGGAATAC CT ATAAGCTTCAAGTCCACGAT 222 109.2 4.2.7. Antimicrobial susceptibility A first experiment regarding antimicrobial susceptibility of S. epidermidis strains to rifampicin, tetracycline and vancomycin was performed to determine their minimum inhibitory concentration (MIC). In brief, overnight inocula of the strains were adjusted to a concentration of about 1 × 108 CFU/mL, followed by dilution of 2 L of each suspension in 200 L of TSB containing the antibiotics, in duplicates. Importantly, 2-fold dilutions of the antibiotics were performed, and the 75 bacterial populations were incubated in a gradient of concentrations defined for each specific antibiotic. Simultaneously, a positive control of growth was performed by adding the bacterial populations to TSB without antibiotics. The MIC was determined as the lowest concentration of antibiotic that inhibited the visual growth of the bacterial populations after 24 hours. The antimicrobial susceptibility of planktonic cultures was evaluated upon 6 and 24 hours of incubation with antibiotics, through CFU counting and by the reduction of tetrazolium salt XTT, which estimates cells metabolic activity, as described before [18]. Briefly, 2 mL of TSB supplemented with the peak serum concentrations (PSC) of rifampicin (10 g/mL), tetracycline (16 g/mL) and vancomycin (40 g/mL) (VWR) (all purchased from Sigma-Aldrich) were inoculated with 1 × 107 CFU/mL of bacteria in the stationary phase (24 hours growth) and incubated at 37 °C and 120 rpm for up to 24 hours. After 6 and 24 hours, a sample was taken to count CFUs, while at the same time points 200 L of the cultures were collected, centrifuged (5 minutes, 16000 g , 4 °C) and resuspended with 200 L of a XTT [250 mg/L] + PMS [25 mg/L] solution and incubated at 37 °C for 3 hours in the dark. After the incubation with the XTT+PMS solution, the cultures were centrifuged (5 minutes, 10000 g , 4 °C) and 100 L of the supernatant were used to read the OD at 490 nm (OD490nm). 4.2.8. Survival in human blood and plasma A human ex vivo model [22–25], well established in our research group [26, 27], was used for the survival assays in human blood and plasma. Briefly, human blood was drawn in lithium heparin spray-coated tubes (Vacuette, Greiner Bio-one, Kremsmunter, Austria) for each experiment and pooled together in a single tube. Plasma was separated by centrifugation of a portion of the whole blood for 20 minutes at 1440 g and 4 ºC. The co-incubation of bacteria with either whole blood, plasma or TSB supplemented with heparin (TSB+heparin, control) was performed as described before [28, 29]. Briefly, 50 µL of bacterial suspensions with 2 × 105 CFU/mL were mixed with 450 µL of whole blood, plasma or TSB+heparin and incubated at 37 ºC and 80 rpm for up to 4 hours. Cells culturability was assessed at the beginning of the assay (T=0 hours) and 1, 2 and 4 hours after incubation. Due to donor-todonor variability, the blood of at least 3 male and 3 female donors was used. 76 4.2.8.1. Ethics statement Human blood was collected from adult healthy volunteers under an active protocol approved by the Institutional Review Board of the University of Minho (SECVS 002/2014 (ADENDA)), which is in strict accordance with the Declaration of Helsinki and Oviedo Convention. All donors gave written informed consent to have blood taken. 4.2.9. Statistical analysis Statistical analysis was performed with one-way ANOVA with Tukey’s multiple comparisons test for all experiments. p -values below 0.05 were considered significant. At least three independent experiments were performed for each assay presented. 4.3. Results and discussion 4.3.1. Construction of S. epidermidis 1457 mutant and complemented strains Herein, we first constructed an S. epidermidis 1457 mazEF mutant and its respective complemented strain, by transforming them with engineered plasmids. Following the deletion of the mazEF operon, that was confirmed by qPCR, the next step was to perform the complementation of S. epidermidis 1457  mazEF . Herein, the plasmid pRB473 was used and genetically manipulated to incorporate the mazEF sequence including the natural promoter region of the operon. The plasmid backbone (control) and the plasmid with the mazEF sequence were successfully transformed into the mutant strain by electroporation. A positive selection of clones was made in TSACM10 plates and plasmids were isolated from both S. epidermidis 1457  mazEF ::pRB473 and S. epidermidis 1457  mazEF ::pRB473+ mazEF strains. Then, a confirmatory PCR (Figure 4.1A) was performed, confirming the correct size of the empty and mazEFligated pRB473 plasmids. Finally, a qPCR run was performed to analyse the expression of mazEF and rsbU genes in the WT,  mazEF and  mazEF ::pRB473+ mazEF strains. As expected, data from Figure 4.1B showed that no expression of the mazEF operon was found in the mutant strain, confirming the successful knock-out of the gene, while the complementation of the S. epidermidis mazEF mutant with the plasmid pRB473+ mazEF restored the expression of the operon. The expression of mazEF was significantly higher in the complemented strain, which can be explained by multiple copies of the plasmid inside the bacteria, leading to the expression of multiples copies of the mazEF genes simultaneously. Moreover, the analysis of rsbU expression 77 confirmed that the deletion of mazEF did not cause important alterations in this contiguous gene [5, 20]. Figure 4.1 – (A) Result of electrophoresis run upon PCR with plasmids cloned into S. epidermidis 1457  mazEF . 1. pRB473+ mazEF (screening with primers CPmazEF_F and CpmazEF_R, expected size: 869 bp); 2. 100 bp ladder; 3. pRB473+ mazEF (amplified with pRB473_Hind and pRB473_Eco screening primers, expected size: 1067 bp); 4. Empty pRB473 plasmid (amplified with pRB473_Hind and pRB473_Eco screening primers, expected size: 212 bp); (B) Normalized expression (to 16S rRNA ) of mazEF homologue and rsbU genes of S. epidermidis 1457 WT and constructs. The results (B) are displayed as the mean + standard deviation of three independent experiments. Statistical analysis was performed between the WT and other strains for each gene. *** p < 0.001. 4.3.1.1. Complementation with plasmid pRMC2 To understand the role of each gene separately and further explore the putative role of the mazEF operon as a TA system, the genes were individually cloned into the inducible plasmid pRMC2 and transformed into the mutant strain. The successful transformation of the plasmids was confirmed by PCR with pRMC2 screening primers. After the confirmation that the correct plasmids and inserts were transformed into the mutant strain (Figure 4.2), we needed to define the optimal concentration of antibiotic necessary to induce the pRMC2 plasmids without interfering with bacterial viability, since the use of this plasmid was only described in S. aureus [16]. For that reason, a pilot assay was performed with S. epidermidis 1457  mazEF with different concentrations of tetracycline (TET) and anhydrotetracycline (ATC) and the viability (measured by CFU) and growth (quantified by OD640nm) of the strains induced was compared with the control (CT, not induced). 78 Figure 4.2 – Result of electrophoresis run upon PCR with plasmids cloned into S. epidermidis 1457  mazEF . 1. pRMC2+ mazE insert (expected size: 491 bp); 2. 100bp ladder; 3. pRMC2+ mazF insert (expected size: 688 bp); 4. 100bp ladder; 5. pRMC2+ mazEF insert (expected size: 868 bp). Figure 4.3 – Growth curve of S. epidermidis 1457  mazEF planktonic cells upon incubation with different concentrations of anhydrotetracycline (ATC) or tetracycline (TET), assessed in terms of (A) culturability (CFU/mL) and (B) total amount of cells (OD640nm). The control (CT) data refers to the population without any induction; Results are represented as a single value for each time point (pilot assay). 79 As can be seen in Figure 4.3, while tetracycline caused a slight decrease in cells growth and culturability, 0.64 g/mL of anhydrotetracycline had a minor impact on the growth of S. epidermidis 1457  mazEF . Therefore, we selected 0.64 g/mL of ATC to induce the expression of the inserts cloned into pRMC2 in further assays. 4.3.2. Role of mazEF as a putative TA system in S. epidermidis 1457 Since mazEF operon has been described as a TA system in some staphylococcal species [7, 30], we aimed to experimentally determine if it has the same function in S. epidermidis . To ensure that mazE/F/EF genes were being expressed under the selected inducing conditions (0.64 g/mL of ATC), a qPCR analysis was performed. Figure 4.4 – Fold-change expression of the mazEF homologue genes in the pRMC2 inducible plasmid cloned into S. epidermidis 1457  mazEF , after 4 hours of induction with ATC 0.64 g/mL, compared with the uninduced cultures grown for the same period. Results are presented as the mean + standard deviation of at least three independent assays. As shown in Figure 4.4, our data allowed us to confirm that the mazEF homologous genes were being significantly expressed in S. epidermidis 1457 constructs upon induction of the plasmid. Although at different levels, all constructs were successfully expressed with at least 10-fold increased expression when compared with non-induced cells. To analyse the putative role of mazEF as a TA system in S. epidermidis , the total amount of cells, determined by OD640nm, and cell culturability, determined by CFU counting, were assessed in the mazE mazF mazEF 1 10 100 1000 Fold-change ATC/CT expression 80 mutant and complemented strains upon induction of mazE/mazF/mazEF expression. Curiously, no significant differences of growth or culturability ( p < 0.05) were found among S. epidermidis 1457 constructs, neither between the strains nor when comparing the induced strains with their respective controls (Figure 4.5). Figure 4.5 – Growth curve of S. epidermidis 1457  mazEF constructs upon induction of mazE / mazF / mazEF genes, assessed by OD640nm of the (A) control condition (no ATC) and (B) strains induced with 0.64 g/mL of ATC for up to 24 hours (24H); (C) culturability of the strains under control or inducing conditions, for up to 4 hours of growth (4H). Results are represented as the mean + standard deviation of at least three independent assays. Statistical analysis was performed between the control and induced condition for each strain and time point. Having into consideration that the production of the toxin, without the antitoxin to counteract its toxic effect, should lead to cells death, it would be expected that the strain containing the putative toxin ( mazF homologue) would lose culturability over time, while the mutant strains complemented both with the putative antitoxin ( mazE homologue) or the full operon ( mazEF homologue) would maintain its culturability. Altogether, these results suggest that the mazEF homologue operon is 81 not acting as a TA system in S. epidermidis strain 1457, as initially hypothesized. To exclude the possibility of this finding being a strain-dependent observation, we confirmed these results with strain 9142. 4.3.3. Construction of S. epidermidis 9142 mutant and complemented strains Herein we were able to construct a mutant strain in the S. epidermidis 9142 background and the deletion of the mazEF operon was confirmed by qPCR, as represented in Figure 4.6. Figure 4.6 – Gene expression of mazEF , normalized to the expression of 16S rRNA in S. epidermidis 9142 WT and mutant ( mazEF. ) strains. The results are displayed as the mean + standard deviation of three independent experiments. 4.3.4. Role of mazEF as a putative TA system in S. epidermidis 9142 S. epidermidis 9142 mazEF mutant strain was complemented with the inducible plasmid (pRMC2) cloned with the mazE, mazF and mazEF genes as performed in strain 1457. Herein, the expression of mazE/F/EF genes under the selected inducing conditions (0.64 g/mL of ATC) was confirmed by qPCR. Data represented in Figure 4.7 confirmed that the mazEF homologous genes were being significantly expressed upon induction with ATC when compared to the uninduced condition, although at lower induction levels than compared with strain 1457. To assess the role of mazEF as a putative TA system in strain 9142, cells culturability was analysed upon induction of the expression of the mazE/mazF/mazEF genes . 82 Figure 4.7 – Fold-change expression of the mazEF homologue genes in the pRMC2 inducible plasmid cloned into S. epidermidis 9142  mazEF , after 4 hours of induction with ATC 0.64 g/mL, compared with the uninduced cultures grown for the same period. Results are presented as the mean + standard deviation of at least three independent assays. As can be seen in Figure 4.8, very similar results were obtained among the different constructs, with the induction of the inserts resulting in similar culturability rates to the ones obtained in the uninduced condition, even when the putative mazF toxin was induced. These results imply that mazF and mazE are not acting as a toxin and antitoxin in S. epidermidis , respectively, as was previously found for strain 1457, suggesting that this finding is strain-independent. Figure 4.8 – Culturability of S. epidermidis 9142 mazEF constructs in the control and induced (0.64 g/mL ATC) conditions for up to 4 hours of growth (4H). Results are represented as the mean + standard deviation of at least three independent assays. Statistical analysis was performed between the control and induced condition for each strain and time point. mazE mazF mazEF 1 10 100 1000 Fold-change ATC/CT expression 89 Table 4.3 – Continued Staphylococcus, Gram-positive S. saprophyticus No Antitoxin MazE; Type II toxin-antitoxin system MazE; Programmed cell death antitoxin YdcD 77.30 - 77.91 71.43 – 73.21 Type II toxin-antitoxin system PemK/MazF family toxin; Toxin MazF 82.94 – 83.24 86.67 – 88.33 S. schleiferi No Antitoxin MazE; Hypothetical protein; 76.65 – 77.25 73.21 PemK family transcriptional regulator; PemK family protein; 80.40 - 80.75 89.83 S. schweitzeri No Antitoxin MazE 85.38 85.71 mRNA interferase MazF 83.19 90.83 S. sciuri No Antitoxin MazE; Programmed cell death antitoxin YdcD 73.24 – 74.65 70.59 – 72.55 Type II toxin-antitoxin system PemK/MazF family toxin; Programmed cell death toxin YdcE; PemK family transcriptional regulator; 80.13 – 81.49 84.68 S. simiae No Programmed cell death antitoxin YdcD 84.21 87.50 Programmed cell death toxin YdcE 86.03 92.44 S. simulans No Antitoxin MazE 78.95 82.00 Toxin MazF; PemK family transcriptional regulator. Type II toxin-antitoxin system PemK/MazF family toxin; 82.14 – 82.44 89.38 - 89.47 S. stepanovicii No Antitoxin MazE 70.59 70.59 Toxin MazF 82.41 80.53 90 Table 4.3 – Continued Staphylococcus, Gram-positive S. succinus No Nd 82.01 82.61 Nd 81.76 90.27 S. warner No Antitoxin MazE; Hypothetical protein 86.55 – 87.13 89.29 Type II toxin-antitoxin system PemK/MazF family toxin. PemK family transcriptional regulator; 82.34 – 82.6 91.67 S. xylosus No Antitoxin MazE 80.61 75 Type II toxin-antitoxin system PemK/MazF family toxin; mRNA interferase MazF; PemK transcriptional regulator 81.77 – 82.04 88.33 Sulfitobacter , Gramnegative S. donghicola No Antitoxin MazE 87.72 89.29 Type II toxin-antitoxin system PemK/MazF family toxin 82.62 91.67 91 Table 4.4 – Blast with S. epidermidis 1457 mazE or mazF sequence homologous with strains where sequences were described as part of TA systems Gram staining Species (Alphabetic order) + Reference description as TA system Blast with S. epidermidis 1457 mazE sequence Blast with S. epidermidis 1457 mazF sequence Gene description on GenBank -PUBMED Nucleotide homology (%) Amino acid homology (%) Gene description on GenBank -PUBMED Nucleotide homology (%) Amino acid homology (%) Gram-negative Escherichia coli [32] MazF-MazE toxinantitoxin system antitoxin MazE; AbrB/MazE/SpoVT family DNA-binding; Programmed cell death antitoxin MazE. 39.7 - 45.8 11.2 – 22.3 Endoribonuclease MazF; PemK-like cell growth regulatory protein ChpA; MazF family transcriptional regulator; Programmed cell death toxin MazF; 30.4 – 46.9 17.3 – 35.9 Leptospira interrogans [33] Transcriptional regulator/antitoxin, MazE; Addiction module antidote protein; AbrB/MazE/SpoVT family DNA-binding domain-containing protein 43.3 – 48.0 11.1 – 23.7 ppGpp-regulated growth inhibitor ChpA/MazF; endoribonuclease MazF; Type II toxinantitoxin system PemK/MazF family toxin 49.0 – 51.8 25.8 – 32.7 92 Table 4.4 – Continued Gram-variable Mycobacterium tuberculosis [34] Type II toxin-antitoxin system antitoxin MazE; Antitoxin MazE; AbrB/MazE/SpoVT family DNA-binding domain-containing protein; 31.8 – 44.0 36.9 – 44.4 Type II toxin-antitoxin system PemK/MazF family toxin; mRNA interferase MazF. 9.1 – 22.1 16.9 – 37.7 Gram-positive Bacillus anthracis [35] AbrB/MazE/SpoVT family DNA-binding domain-containing protein; Hypothetical protein; 28.7 – 42.5 14.8 – 25.5 PemK family transcriptional regulator; 45.0 – 67.5 68.6 – 71.6 Bacillus subtilis [36] Type II toxin-antitoxin system antitoxin EndoAI; Antitoxin EndoAI; CopG family ribbon-helix-helix protein; AbrB/MazE/SpoVT family DNA-binding domain-containing protein; 36.7 – 43.4 10.6 – 21.3 Type II toxin-antitoxin system endoribonuclease NdoA; mRNA interferase EndoA; PemK family transcriptional regulator; Toxin mazF; 63.6 – 66.2 67.2 93 Table 4.4 – Continued Gram-positive Listeria monocytogenes [37] AbrB/MazE/SpoVT family DNA-binding domain-containing protein; Transition state regulator Abh; AbrB family transcriptional regulator; Transition state regulatory protein. 34.6 – 46.5 12.8 – 19.6 PemK family transcriptional regulator; Type II toxin-antitoxin system PemK/MazF family toxin. 58.8 – 65.1 56.5 – 65.2 Streptococcus mutans [38] MazE; Cell growth regulatory protein; AbrB/MazE/SpoVT family DNA-binding domain-containing protein; Antidote-toxin recognition MazE family protein; Cell division protein FtsW 43.2 – 52.4 11.0 – 23.0 PemK; ppGppregulated growth inhibitor; Type II toxinantitoxin system PemK/MazF family toxin 39.7 – 43.2 18.1 – 26.6 Not applicable (NA) Human Genome NA NA Not detected Not detected NA Not detected Not detected 94 Curiously, the similarity with S. aureus , where mazEF was also experimentally determined as a TA system, was significantly higher, with more than 85% homology of the mazE sequence (both nucleotide and amino acids) and from circa 80 to more than 90% of nucleotide and amino acids correspondence of the mazF sequence. Nonetheless, the homology between the S. epidermidis and S. aureus sequences triggered the interest in exploring the main similarities and differences and further exploring the impact in the translation into proteins. As such, an alignment of the S. epidermidis 1457 and S. aureus Newman sequences was performed. Figure 4.9 – Alignment of mazE sequences of S. epidermidis 1457 (upper row) and S. aureus Newman (lower row). (A) Alignment of mazE DNA sequences; (B) Alignment of mazE amino acid sequences. “–“ represents a gap between the sequences, “X” represents different nucleotides/amino acids and “+” represents an alteration of amino acid by a similar one. 95 Figure 4.10 – Alignment of mazF sequences of S. epidermidis 1457 (upper row) and S. aureus Newman (lower row). (A) Alignment of mazF DNA sequences; (B) Alignment of mazE amino acid sequences. “–“ represents a gap between the sequences, “X” represents different nucleotides/amino acids and “+” represents an alteration of amino acid by a similar one. 96 The analysis of Figure 4.9 confirmed the high homology between the mazE sequences of both strains assessed, with few differences being found: DNA sequences only showed 18 different nucleotides and 4 gaps, which resulted in an amino acid sequence with an identity of 48 out of 56 amino acids, but a similarity of 53/56 amino acids. On the other hand, data from Figure 4.10 showed that the mazF DNA sequences presented 56 distinct nucleotides and 6 gaps, resulting in an amino acid sequence with an identity of 110/120, in which a total of 112 amino acids were considered similar. Moreover, to explore the effect of the amino acid differences in the translation into a protein, a prediction of the protein structure of MazE and MazF was performed and represented in Figure 4.11. Although the main structure of the proteins in the S. epidermidis and S. aureus strains is similar, there are some “low” and “very low” confidence levels for some areas of the protein structure prediction, which may indicate structural differences that could affect the activity of these proteins, which should be further experimentally determined. Figure 4.11 – Prediction of MazEF protein structure of S. epidermidis and S. aureus strains. (A) S. epidermidis 1457 MazE structure prediction; (B) S. aureus Newman MazE structure prediction; (C) S. epidermidis 1457 MazF structure prediction and (D) S. aureus Newman MazF structure prediction. Structure prediction was obtained with “AlphaFold Protein Structure Database”[39, 40]. (D)(C) (A)(B) 3D viewer Model Confidence: Very high (pLDDT > 90) Confident (90 > pLDDT > 70) Low (70 > pLDDT > 50) Very low (pLDDT < 50) 97 Taken together, since no toxin and antitoxin outcome of the S. epidermidis mazF and mazE genes was found in strains 9142 or 1457, we suggest that the mazEF operon in the S. epidermidis species has a different role, despite the high homology found with S. aureus . 4.3.6. Effect of mazEF in bacterial growth and biofilm formation We further characterized the mazEF mutant in the physiology and virulence potential of S. epidermidis . Therefore, to understand if the mazEF mutation affected cell growth, planktonic populations growth kinetics of all S. epidermidis 1457 strains (WT,  mazEF and mazEF ::pRB473+ mazEF ) was assessed for up to 24 hours. Figure 4.12 – Growth curve of planktonic populations of S. epidermidis 1457 WT,  mazEF and  mazEF ::pRB473+ mazEF strains, determined by OD640nm; Results are presented as the mean + standard deviation of three independent assays. Statistical analysis was performed between the WT and the other strains for each time point. As assessed by the quantification of the total amount of cells represented in Figure 4.12, all strains presented a similar growth profile in the planktonic mode, either during the exponential or stationary phases, despite their different genetic makeover. Moreover, we aimed to understand if the mazEF deletion could affect biofilm formation. To do so, we grew 48-hours biofilms of both S. epidermidis 1457 and S. epidermidis 9142 and their respective constructs and evaluated the number of culturable biofilm cells. 98 Overall, the results from Figure 4.13 show that similar biofilms, in terms of bacterial culturability, were produced by the distinct WT and constructs of each strain. Figure 4.13 – Quantification of 48-hours biofilms formed by S. epidermidis 1457 WT,  mazEF and  mazEF ::pRB473+ mazEF and S. epidermidis 9142 WT,  mazEF and  mazEF ::pRMC2+ mazEF , assessed by the number of culturable cells (CFU/mL). Results are presented as the mean + standard deviation of three independent assays. Statistical analysis was performed between the WT and constructs for each strain. Altogether, these results suggest that mazEF does not present an important function in general planktonic growth or biofilm formation in S. epidermidis, at least under our experimental conditions. Nonetheless, the growth of planktonic and biofilm populations was also assessed in conditions where the VBNC state was either induced or prevented, since previous data suggested the involvement of mazEF in the modulation of this state and will be presented in Chapter 6. 4.3.7. Effect of mazEF in antimicrobial susceptibility We further assessed the role of mazEF in S. epidermidis virulence by performing an antimicrobial susceptibility study, using three antibiotics with distinct mechanisms of action, namely, rifampicin (RNA synthesis inhibitor), tetracycline (protein synthesis inhibitor) and vancomycin (cell wall synthesis inhibitor). First, the minimal inhibition concentration (MIC) of vancomycin, rifampicin and WT ΔmazEF ΔmazEF::pRB473+mazEF WT ΔmazEF ΔmazEF::pRMC2+mazEF 0.0 5.0×108 1.0×109 1.5×109 2.0×109 2.5×109 CFU/mL S. epidermidis 1457 S. epidermidis 9142 105 17. França A, Freitas AI, Henriques AF, Cerca N. Optimizing a qPCR gene expression quantification assay for S. epidermidis biofilms: A comparison between commercial kits and a customized protocol. PLoS One. 2012;7:e37480. 18. Cerca N, Martins S, Cerca F, Jefferson KK, Pier GB, Oliveira R, et al. Comparative assessment of antibiotic susceptibility of coagulase-negative staphylococci in biofilm versus planktonic culture as assessed by bacterial enumeration or rapid XTT colorimetry. J Antimicrob Chemother. 2005;56:331–6. 19. Brückner R. A series of shuttle vectors for Bacillus subtilis and Escherichia coli . Gene. 1992;122:187–92. 20. Schuster CF, Mechler L, Nolle N, Krismer B, Zelder ME, Götz F, et al. The mazEF toxin-antitoxin system alters the β-lactam susceptibility of Staphylococcus aureus . PLoS One. 2015;10:1–22. 21. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. Primer3 - new capabilities and interfaces. Nucleic Acids Res. 2012;40:e115. 22. Malachowa N, Whitney AR, Kobayashi SD, Sturdevant DE, Kennedy AD, Braughton KR, et al. Global changes in Staphylococcus aureus gene expression in human blood. PLoS One. 2011;6:e18617. 23. Fradin C, Kretschmar M, Nichterlein T, Gaillardin C, D’Enfert C, Hube B. Stage-specific gene expression of Candida albicans in human blood. Mol Microbiol. 2003;47:1523–43. 24. Mereghetti L, Sitkiewicz I, Green NM, Musser JM. Extensive adaptive changes occur in the transcriptome of Streptococcus agalactiae (Group B streptococcus) in response to incubation with human blood. PLoS One. 2008;3:1–10. 25. Vebø HC, Snipen L, Nes IF, Brede DA. The transcriptome of the nosocomial pathogen Enterococcus faecalis V583 reveals adaptive responses to growth in blood. PLoS One. 2009;4:15– 21. 26. França A, Carvalhais V, Maira-Litrán T, Vilanova M, Cerca N, Pier GB. Alterations in the Staphylococcus epidermidis biofilm transcriptome following interaction with whole human blood. Pathog Dis. 2014;70:444–8. 27. França A, Cerca N. Plasma is the main regulator of Staphylococcus epidermidis biofilms virulence genes transcription in human blood. Pathog Dis. 2016;74:ftv125. 28. Brás S, França A, Cerca N. Optimizing a reliable ex vivo human blood model to analyze expression of Staphylococcus epidermidis genes. PeerJ. 2020;8:e9295. 29. França A, Pier GB, Vilanova M, Cerca N. Transcriptomic analysis of Staphylococcus epidermidis biofilm-released cells upon interaction with human blood circulating immune cells and soluble factors. Front Microbiol. 2016;7:1–6. 30. Zhu L, Inoue K, Yoshizumi S, Kobayashi H, Zhang Y, Ouyang M, et al. Staphylococcus aureus MazF specifically cleaves a pentad sequence, UACAU, which is unusually abundant in the mRNA for pathogenic adhesive factor SraP. J Bacteriol. 2009;191:3248–55. 31. Fu Z, Tamber S, Memmi G, Donegan NP, Cheung AL. Overexpression of mazFSa in Staphylococcus aureus induces bacteriostasis by selectively targeting mRNAs for cleavage. J Bacteriol. 2009;191:2051–9. 106 32. Aizenman E, Engelberg-Kulka H, Glaser G. An Escherichia coli chromosomal “addiction module” regulated by guanosine 3’,5’-bispyrophosphate: a model for programmed bacterial cell death. Proc Natl Acad Sci. 1996;93:6059–63. 33. Komi KK, Ge YM, Xin XY, Ojcius DM, Sun D, Hu WL, et al. ChpK and MazF of the toxin-antitoxin modules are involved in the virulence of Leptospira interrogans during infection. Microbes Infect. 2015;17:34–47. 34. Ramirez M V., Dawson CC, Crew R, England K, Slayden RA. MazF6 toxin of Mycobacterium tuberculosis demonstrates antitoxin specificity and is coupled to regulation of cell growth by a Sojlike protein. BMC Microbiol. 2013;13:240. 35. Agarwal S, Mishra NK, Bhatnagar S, Bhatnagar R. PemK toxin of Bacillus anthracis is a ribonuclease: An insight into its active site, structure, and function. J Biol Chem. 2010;285:7254– 70. 36. Pellegrini O, Mathy N, Gogos A, Shapiro L, Condon C. The Bacillus subtilis ydcDE operon encodes an endoribonuclease of the MazF/PemK family and its inhibitor. Mol Microbiol. 2005;56:1139–48. 37. Curtis TD, Takeuchi I, Gram L, Knudsen GM. The influence of the toxin/antitoxin mazEF on growth and survival of Listeria monocytogenes under stress. Toxins (Basel). 2017;9:31. 38. Syed MA, Koyanagi S, Sharma E, Jobin MC, Yakunin AF, Lévesque CM. The chromosomal mazEF locus of Streptococcus mutans encodes a functional type II toxin-antitoxin addiction system. J Bacteriol. 2011;193:1122–30. 39. Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, et al. Highly accurate protein structure prediction with AlphaFold. Nature. 2021;596. 40. Varadi M, Anyango S, Deshpande M, Nair S, Natassia C, Yordanova G, et al. AlphaFold Protein Structure Database: massively expanding the structural coverage of protein-sequence space with high-accuracy models. Nucleic Acids Res. 2021. 41. Ma D, Mandell JB, Donegan NP, Cheung AL, Ma W, Rothenberger S, et al. The toxin-antitoxin mazEF drives Staphylococcus aureus biofilm formation, antibiotic tolerance, and chronic infection. MBio. 2019;10:e01658-19. 42. Coskun USS, Cicek AC, Kilinc C, Guckan R, Dagcioglu Y, Demir O, et al. Effect of MazEF, HigBA and RelBE toxin-antitoxin systems on antibiotic resistance in Pseudomonas aeruginosa and Staphylococcus isolates . Malawi Med J. 2018;30:67–72. 43. Dale DC, Boxer L, Conrad Liles W. The phagocytes: Neutrophils and monocytes. Blood. 2008;112:935–45. 44. Telser A. Molecular Biology of the Cell, 4th Edition. Shock. 2002;18:289. 45. Behrooz SK, Lida L, Ali S, Mehdi M, Rasoul M, Elnaz O, et al. Study of mazEF, sam , and phdDoc putative toxin-antitoxin systems in Staphylococcus epidermidis . Acta Microbiol Immunol Hung. 2018;65:1–11. 46. Shivaee A, Mohammadzadeh R, Shahbazi S, Pardakhtchi E, Ohadi E, Kalani BS. Time-variable expression levels of mazF, atlE, sdrH , and bap genes during biofilm formation in Staphylococcus epidermidis . Acta Microbiol Immunol Hung. 2019;66:499–508. 47. Cerca N, Brooks JL, Jefferson KK. Regulation of the intercellular adhesin locus regulator ( icaR ) by SarA, σB, and IcaR in Staphylococcus aureus . J Bacteriol. 2008;190:6530–3. CHAPTER 5 Importance of mazEF in the immune response SUMMARY The activation of the innate immune response upon pathogenic invasions has previously been described for a wide variety of species, including the commensal bacteria S. epidermidis, and extensively reported in the literature . mazEF homologue operons have formerly been shown to influence the host immune response to bacterial infections, raising the interest in the study of the impact of mazEF deletion on the activation of the host immune system. Herein we aimed to understand if the expression of the mazEF operon could modulate the response of the host by analysing the production of proand anti-inflammatory cytokines by human monocyte-derived macrophages (MDMs) and dendritic cells (MDDCs). The activation of MDDCs upon interaction with the distinct S. epidermidis strains was also evaluated. The study of the interaction of S. epidermidis with host immune cells was completed with the study of the production of reactive oxygen species (ROS) by polymorphonuclear leukocytes (PMNs). Overall, the analysis of the results obtained for the individual strains revealed a very similar response by the immune cells in all the parameters assessed, suggesting that the deletion of the mazEF operon from S. epidermidis 1457 genome did not have a significant impact on the activation of the innate immune response. Notwithstanding, our results confirm that the S. epidermidis 1457 strain induces the activation of the assessed immune cells and production of cytokines by humanderived M1and M2-type MDMs and MDDCs, both as the production of ROS by human-isolated neutrophils. 108 5.1. Brief introduction S. epidermidis cells have the ability to evade the host immune response, resorting to some immune evasion molecules [1, 2], hindering its elimination by the host. Importantly, this ability has been previously shown to be more evident in biofilms, where in vitro studies have reported enhanced tolerance of S. epidermidis biofilms to the host immune response [3, 4]. Being a commensal and opportunistic pathogen, usually accounting for increased morbidity rates rather than mortality [5, 6], may be one of the reasons why there has not been an extensive focus on the study of the immune response to this species. Thereby, the literature on the activation of the host innate immune system by S. epidermidis is rather scarce. Curiously, the mazEF operon has been associated with alterations in the response of the host to infections caused by Mycobacterium tuberculosis [7] and the modification of immune cells with the mazF endoribonuclease from E. coli has been shown to interfere with their immunogenicity [8]. Hence, we could not discard a possible modulatory role of mazEF in the host immune response induced by S. epidermidis bacteria and aimed to understand the effect of this operon on the bacterial interaction with innate immune cells. Herein, human monocyte-derived macrophages (MDMs) and dendritic cells (MDDCs) were differentiated from peripheral blood mononuclear cells (PBMCs), since these are professional phagocytic cells that have a fundamental role in the innate immune response [9]. Moreover, neutrophils were isolated from blood samples for the assessment of the production of reactive oxygen species (ROS), as this cell population is also a major player in the innate immune response, able to phagocytose and kill extracellular bacteria through the production of ROS and antimicrobial peptides (AMPs) [10]. 5.2. Materials and methods 5.2.1. Strains and growth conditions To understand the role of the homologous mazEF operon in the response of the immune system, S. epidermidis 1457 WT,  mazEF and  mazEF ::pRB473 were grown overnight in TSB at 37 C with 120 rpm agitation in an orbital shaker (10 mm orbit). The concentration of the overnight suspensions was then adjusted to approximately 2 × 108 CFU/mL by adjusting the OD640nm of the suspensions to 0.25 ± 0.05, for further incubation with immune cells. 109 5.2.2. Isolation of polymorphonuclear leukocytes (PMNs) and differentiation of MDMs and MDDCs Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats through density gradient centrifugation using the SepMateTM PBMC isolation tubes (Stemcell Technologies) and following the manufacturer’s protocol. To obtain monocyte-derived cells, Histopaque-1077 (SigmaAldrich) was used as the density gradient medium and the SepMateTM tube was centrifuged at 1200 g for 15 minutes. The cells obtained were magnetically labelled and sorted to be able to selectively collect monocytes (CD14+ cells), using anti-human CD14 MicroBeads (Miltenyi Biotec), according to the manufacturer’s instructions. The monocytes selected were resuspended in RPMI (RPMI 1640, Sigma-Aldrich) supplemented with 10% FBS (Biowest), 4 mM L-glutamine (Sigma-Aldrich), 10 mM HEPES (Sigma-Aldrich), 50𝜇M 𝛽-mercaptoethanol and 1% penicillin-streptomycin), from now on designated as complete RPMI (cRPMI). Then, cells were counted with trypan blue and seeded in 6-well culture plates at a final concentration of 1 × 106 cells/mL. Specific cytokines were added to the culture to promote the differentiation of the monocytes into MDMs and MDDCs. More specifically, GM-CSF (50 ng/mL) or M-CSF (50 ng/mL) were added to originate M1or M2-type MDMs, respectively, while GM-CSF (50 ng/mL) and IL-4 (50 ng/mL) were added as a mean to differentiate cells into MDDCs. Plates with the cell cultures were incubated at 37C with 5% CO2 for up to 7 days. Every 3 days, half of the cell culture medium was removed and replaced by fresh medium. The isolation of PMNs from buffy coats was completed by a double gradient technique using solutions with distinct densities, namely Histopaque-1077 (Sigma-Aldrich) and Histopaque1119 (SigmaAldrich), according to the SepMateTM protocol. The cells obtained upon this procedure were resuspended in cRPMI for further use. 5.2.2.1 Ethics statement Buffy coats (fraction of anticoagulated blood sample containing most the white blood cells and platelets) from healthy blood donors used for M1/M2 MDMs and MDDCs differentiation were acquired at the Immunohemotherapy Department of Centro Hospitalar So Joo from Porto, Portugal. All donors gave have given informed written consent for part of their blood samples to be used for scientific purposes, according to Protocol reference 260/11, under ethical approval of the service. The principles of the Declaration of Helsinki and Oviedo Convention were respected during 110 the procedures used to obtain peripheral blood mononuclear cells (PBMCs) from the buffy coats donated. 5.2.3. Infection of MDDCs and MDMs with S. epidermidis strains On day 7, the non-adherent and loosely adherent MDDCs were harvested from bottom the of the plate through gentle up and down pipetting movements, while both M1and M2-type MDMs were detached from the plate with 5 mM EDTA. Cells were then recovered from the 6-well plates and resuspended in supplemented RPMI (sRPMI, media supplemented with 10% FBS, 2% L-glutamine, 1% HEPES and 50𝜇M 𝛽mercaptoethanol), followed by counting with trypan blue to estimate the concentration of cells. Next, MDDCs were seeded in 96-well plates with a round bottom, while MDMs were seeded in flat-bottom plates. Both types of monocyte-derived cells were infected with the strains (WT,  mazEF and  mazEF ::pRB473+ mazEF ) at a multiplicity of infection (MOI) of 1MDDC/MDM:5Bacteria or 1MDDC/MDM:10B. Controls were added to a better estimation of the level of cytokine production, namely a negative control where cells were not stimulated and a positive control with stimulation of cells with 2 g/mL lipopolysaccharide (LPS) from E. coli (SigmaAldrich). Then, the plates were incubated at 37C and 5% CO2. After 2 hours, 50 g/mL gentamicin were added to each well to stop bacterial growth, and the plates were incubated back in the same conditions (37C and 5% CO2) for up to 24 hours. After the incubation period, the plates were centrifuged at 300 g for 10 minutes and the supernatants were collected and stored at -80C for further measurement of cytokine secretion by ELISA. Finally, cells were prepared and stained for flow cytometry detection and analysis of cell surface activation. 5.2.4. Cytokine release evaluation by sandwich ELISA The secretion of specific pro-inflammatory (TNF-α, IL-6, IL-8 and IL-12p70) and anti-inflammatory (IL-10) cytokines by MDMs and MDDCs upon infection with S. epidermidis strains was quantified by sandwich ELISA. A commercial kit, specific for each cytokine, was used to analyse the cytokine level in cell culture supernatants (Human TNF-α DuoSet® ELISA Development System, Human IL6 DuoSet® ELISA Development System, Human IL-8 DuoSet® ELISA Development System, Human IL-1𝛽 DuoSet® ELISA Development System, Human IL-10 DuoSet® ELISA Development System and Human IL12p70 DuoSet® ELISA Development System from R&D systems) and the manufacturer’s protocol was followed. 111 5.2.5. Evaluation of MDDCs activation by fluorescence-activated cell sorting (FACS) The detection of cell surface activation markers from MDDCs relied on flow cytometry analysis. Briefly, the cells infected with the S. epidermidis strains were collected after 24 hours of incubation, washed, and stained with a fixable viability dye (eFluor 780) and with cell surface antibodies against the activation markers: anti-human CD11c APC-conjugated (clone BU15), anti-human HLA-DR PECy7-conjugated (clone L243), anti-human CD83 FITC-conjugated (clone HB15e), anti-human CD14 PE-conjugated (clone 61D3), anti-human CD80 BV510-conjugated (clone 2D10) and antihuman CD86 PECy5-conjugated (clone IT2.2), all from eBiosciences. Then, cells were fixed with paraformaldehyde and resuspended in FACS buffer (PBS 1× supplemented with 1% bovine serum albumin and 0.05% sodium azide). Finally, samples were analysed by flow cytometry, using a BD FACSCantoTM II and data was analysed with FlowJoTM 10.7.1 Software (BD Life Sciences), according to the gating strategy defined in Figure 5.1. 5.2.6. Evaluation of reactive oxygen species (ROS) production After adjusting the concentration of freshly isolated PMNs to 1 × 106 cells/mL, the human-derived cells were incubated with S. epidermidis with 2 distinct MOI, namely 1PMN:5B or 1PMN:10B in 96-well plates. To analyse the production of ROS, the samples were stained with 2’,7’ – dichlorofluorescin diacetate (DCFDA/H2DCFDACellular ROS Assay Kit, Sigma-Aldrich) according to the manufacturer’s instructions. A positive control of the reaction was done by incubating PMNs with 50 nM phorbol 12-myristate 13-acetate (PMA, Sigma-Aldrich). 5.2.7. Statistical analysis Data obtained from the results of this chapter were analysed with one-way ANOVA with Tukey’s multiple comparisons test. Differences between the WT and the other strains were regarded as statistically significant when a p -value lower than 0.05 was found. 112 Figure 5.1 – Representative gating used for the analysis of activation makers expression upon incubation of MDDCs with S. epidermidis strains. The samples were first filtered by size and complexity by representing them in a dot plot with forward (FSC-A) vs side (SSC-A) scatter. Then, using FSC-H (height) vs FSC-A (area) representation it was possible to select single cells and eliminate duplets for further analysis. Subsequently, the CD11+ population was selected at the same time that CD14+ cells (MDDC that did not differentiate) were excluded. Finally, dead cells that incorporated fixable viability dye (FVD) were also excluded from the analysis and the remaining CD11+ cells were used to measure the mean of intensity fluorescence (MIF) of the distinct surface markers. Black line: Medium (Negative control) Grey line: LPS (Positive control) HLA CD80 CD83 CD86 SSC-A FSC-A FSC-A FSC-H CD14 CD11c FVD CD11c 113 5.3. Results and discussion 5.3.1. Quantification of secreted cytokines by human MDMs and MDDCs Neutrophils, macrophages and dendritic cells are professional phagocytic cells. When the host senses a pathogenic invasion, it reacts via the innate immune response with the production of antimicrobial substances, activation of the complement system and production of other proinflammatory mediators, such as cytokines [9]. Both M1and M2-type MDMs were used in this study, since the “classically activated” macrophages (M1) are generally involved in proinflammatory and phagocytic processes, while the “alternatively activated” ones (M2) generally present an anti-inflammatory profile [11]. Herein, we assessed the production of cytokines by M1and M2-type MDMs and MDDCs, namely pro-inflammatory interleukins IL-12p70, IL-6, IL-8 and tumour necrosis factor (TNF-) and antiinflammatory IL-10. As shown in Figure 5.2, no differences were found in the production of any of the assessed cytokines induced by the distinct strains, suggesting that the action of mazEF operon on the stimulation of M1-type MDMs is not relevant. M1-type MDMs are generally considered proinflammatory. Therefore, they are expected to produce more pro-inflammatory cytokines upon contact with pathogens. Herein, we can see that the anti-inflammatory IL-10 cytokine (Figure 5.2 E) was slightly less produced than all the pro-inflammatory cytokines (Figure 5.2 A-D), especially with the lower multiplicity of infection (MOI 1:5), as compared with the control (LPS-induced cytokines). Overall, by analysing the levels of cytokines in the cell culture supernatants normalized to the positive control (LPS), it is evident that S. epidermidis 1457 strains induced the production of cytokines by the M1-type MDMs at a similar rate to the positive control (LPS), with the exception of IL-12, where the expression of cytokine in response to incubation with the strains was around 2fold higher than in the LPS control. Importantly, the higher multiplicity of infection (MOI 1:10) did not significantly impact the production of cytokines, with similar or slightly higher levels of production. On the other hand, M2-type MDMs are frequently viewed as anti-inflammatory and are expected to be more involved in the production of anti-inflammatory cytokines, such as IL-10. 114 Figure 5.2 – Effect of mazEF deletion on the response of M1-type MDMs, assessed by the quantification of cytokines secreted upon 24 hours of infection with S. epidermidis 1457 strains at a MOI of 1MDM:5B and 1MDM:10B. The levels of (A) IL-12p70, (B) IL-6, (C) IL-8, (D) TNF- and (E) IL-10 released into the supernatants were measured by ELISA and the results are presented as the mean plus standard deviation of the data normalized to the positive control samples (LPS). Three independent experiments were performed, in which each condition was performed in duplicate. Statistical analysis was performed between the WT and constructs for each condition. 121 5.5. Bibliography 1. Otto M. Staphylococcus epidermidis – the “accidental” pathogen. Nat Rev Microbiol. 2009;7:555–67. 2. Arrecubieta C, Toba FA, von Bayern M, Akashi H, Deng MC, Naka Y, et al. SdrF, a Staphylococcus epidermidis surface protein, contributes to the initiation of ventricular assist device driveline–related infections. PLoS Pathog. 2009;5:e1000411. 3. Cerca N, Jefferson KK, Oliveira R, Pier GB, Azeredo J. Comparative antibody-mediated phagocytosis of Staphylococcus epidermidis cells grown in a biofilm or in the planktonic state. Infect Immun. 2006;74:4849–55. 4. Cheung GYC, Rigby K, Wang R, Queck SY, Braughton KR, Whitney AR, et al. Staphylococcus epidermidis strategies to avoid killing by human neutrophils. PLoS Pathog. 2010;6:e1001133. 5. Cheung GYC, Otto M. Understanding the significance of Staphylococcus epidermidis bacteremia in babies and children. Current Opinion in Infectious Diseases. 2010;23:208–16. 6. Cherifi S, Byl B, Deplano A, Nonhoff C, Denis O, Hallin M. Comparative epidemiology of Staphylococcus epidermidis isolates from patients with catheter-related bacteremia and from healthy volunteers. J Clin Microbiol. 2013;51:1541–7. 7. Tiwari P, Arora G, Singh M, Kidwai S, Narayan OP, Singh R. MazF ribonucleases promote Mycobacterium tuberculosis drug tolerance and virulence in guinea pigs. Nat Commun. 2015;6:6059. 8. Saito N, Chono H, Shibata H, Ageyama N, Yasutomi Y, Mineno J. CD4+ T cells modified by the endoribonuclease MazF are safe and can persist in SHIV-infected rhesus macaques. Mol Ther - Nucleic Acids. 2014;3:e168. 9. Gasteiger G, D’osualdo A, Schubert DA, Weber A, Bruscia EM, Hartl D. Cellular innate immunity: An old game with new players. Journal of Innate Immunity. 2017;9:111–25. 10. Faurschou M, Borregaard N. Neutrophil granules and secretory vesicles in inflammation. Microbes and Infection. 2003;5:1317–27. 11. Jakubzick C V., Randolph GJ, Henson PM. Monocyte differentiation and antigen-presenting functions. Nature Reviews Immunology. 2017;17:349–62. 12. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nature Reviews Immunology. 2008;8:958–69. 13. Atri C, Guerfali FZ, Laouini D. Role of human macrophage polarization in inflammation during infectious diseases. International Journal of Molecular Sciences. 2018;19:1801. 14. Raggi F, Pelassa S, Pierobon D, Penco F, Gattorno M, Novelli F, et al. Regulation of human macrophage M1-M2 polarization balance by hypoxia and the triggering receptor expressed on myeloid cells-1. Front Immunol. 2017;8:1097. 15. Ambarus CA, Krausz S, van Eijk M, Hamann J, Radstake TRDJ, Reedquist KA, et al. Systematic validation of specific phenotypic markers for in vitro polarized human macrophages. J Immunol Methods. 2012;375:196–206. CHAPTER 6 The role of mazEF in modulating VBNC cells SUMMARY Herein, we studied the role of mazEF in the induction/prevention of VBNC cells in biofilms and planktonic populations, using wild-type (WT) S. epidermidis strain 1457, its mutant ( mazEF ) and complemented ( mazEF ::pRB473+ mazEF ) strains. Importantly, contrarily to what was previously proposed, no significant differences were found in the ability of the WT, mutant or complemented strains to form biofilms or to induce the VBNC state. Nonetheless, we could not discard a putative role of mazEF in the virulence potential of S. epidermidis . Therefore, we aimed to understand the impact of the mazEF deletion in the antimicrobial susceptibility and in the expression of some important genes associated with the virulence of S. epidermidis 1457, both when the VBNC state was induced or prevented. Altogether, it seems that mazEF may not be essential in the modulation of the VBNC condition in S. epidermidis 1457. 123 6.1. Brief introduction A previous RNA-Seq study suggested that mazEF operon could have been involved in VBNC modulation [1], which raised interest in the study of this operon in S. epidermidis . Despite the high homology of the S. epidermidis 1457 mazEF sequence with other mazEF homologues described as TA systems in S. aureus , we have shown in Chapter 4 that mazF and mazE expression are not involved in toxin and antitoxin functions in this strain. Nonetheless, we could not discard its potential role in the modulation of VBNC cells formation and, to test this hypothesis, the VBNC induction model previously validated for strain 1457 (Chapter 3) was used herein with the mazEF mutant and completed strains. 6.2. Materials and methods 6.2.1. Strains and growth conditions Most experiments of this study were conducted with the wild-type strain 1457 (WT), the genetically manipulated strain where the mazEF operon was deleted ( mazEF ) and the strain complemented with a plasmid (pRB473) cloned with the mazEF sequence ( mazEF ::pRB473+ mazEF. ) and including the gene natural promoter, as described in Chapter 4. S. epidermidis 9142 wild-type (9142 WT), mutant (9142 mazEF ) and complemented (9142 mazEF ::pRMC2+ mazEF ) strains were also used for the validation of the results regarding the role of mazEF in the modulation of VBNC cells, since this was the strain previously used in the studies that identified a potential involvement of the mazEF operon in the emergence of the VBNC state [1]. Similarly to the previous chapters, the experiments were started with a pre-inoculum of S. epidermidis strains grown from the 30% glycerol stocks in TSB (Merck, Darmstadt, Germany) and incubated overnight at 37 C with agitation at 120 rpm (orbital shaker with 10 mm orbit). Then, the concentration of the overnight suspensions was adjusted to approximately 2 × 108 CFU/mL by diluting the suspensions until an OD640nm of 0.25 ± 0.05 was reached, as previously optimized for S. epidermidis [2], to be used for further experiments. 6.2.2. Biofilm formation and planktonic growth Biofilms and planktonic cultures were prepared as described in Chapter 3, sections 3.2.2 and 3.2.3, respectively. Importantly, for the planktonic growth, the 48-hours model was followed to replicate the protocol used for biofilm growth. Of note, for confocal analysis (CLSM), biofilms were 124 formed on NuncTM thermanoxTM coverslips (Thermo Fisher Scientific) that were placed inside 24-well plates (Orange Scientific, Braine-l’Alleud, Belgium). Then, the spent media was discarded, and biofilms were washed twice with 500 µL of 0.9% NaCl to remove unattached cells and further staining for confocal analysis. Regarding antimicrobial assays, biofilms were formed in 96-well plates (Orange Scientific, Brainel’Alleud, Belgium), as previously optimized [3], by incubating 2 L of overnight suspensions into 200 L of TSB/ TSBCM10 supplemented with 0.4% glucose or 0.4% glucose + 20 mM MgCl2 and incubated at 37 °C and 120 rpm. After 24 hours, the supernatant was removed from all wells and 200 L of fresh TSBCM10 supplemented with 0.4% glucose or 0.4% glucose + 20 mM MgCl2 were added to the biofilms, to induce or prevent the VBNC state, respectively. After incubating the plate for 24 hours under the same conditions of temperature and agitation, spent media was removed, and biofilms were washed twice with 100 L of NaCl 0.9% for further incubation with antibiotics. 6.2.3. Quantification of cells The number of total cells in planktonic and biofilm cultures was quantified by OD640nm, live cells by flow cytometry and culturable cells by assessing CFU, as previously described in Chapter 3. 6.2.4. Confocal laser scanning microscopy (CLSM) analysis CLSM analysis used 4’,6-diamidine-2’phenylindole dihydrochloride (DAPI), which is a stain that binds to nucleic acids allowing the visualization of individual cells, and wheat germ agglutinin (WGA) staining that allows the detection of the biofilm matrix by binding to PNAG, as previously optimized [4]. Briefly, after forming biofilms in coverslips, as detailed in section 6.2.2., biofilms were stained using 10 g/mL WGA (Thermo Fisher Scientific) and 100 g/mL of DAPI (Sigma-Aldrich), according to the manufacturer’s instructions. Then, stained biofilms were observed with Olympus FluoView FV1000 (Olympus, Lisboa, Portugal), using a water-immersion objective (40/1.15 W) and different regions of the biofilms were analysed. Representative images of two independent experiments were obtained for further analysis with FluoView FV1000 Software (version 4.2). 125 6.2.5. Antimicrobial assays The antimicrobial susceptibility assays of biofilms were performed as described for planktonic cells (Chapter 4, section 4.2.7), with some modifications. Briefly, 200 L of TSB supplemented with the PSC of rifampicin (10 g/mL) and tetracycline (16 g/mL) were added to the 48-hours biofilms, in triplicates for both CFU and XTT analysis, and incubated at 37 °C and 120 rpm, for up to 24 hours. After 6 and 24 hours, the media was removed from the wells and biofilms washed once with 100 L of NaCl. Half of the biofilms were resuspended in 200 L NaCl for further CFU quantification, while 200 L of the XTT [250 mg/L] + PMS [25 mg/L] solution were added to the remaining biofilms and the plate was incubated at 37 °C for 3 hours in the dark. After the incubation with the XTT+PMS solution, the supernatants were recovered, centrifuged (5 minutes, 10000 g , 4 °C) and 100 L of the supernatant were used to read the OD490nm. 6.2.6. Gene expression analysis To understand the transcriptomic alterations of cells grown under VBNC inducing conditions, RNA was isolated from biofilm and from planktonic cells where the VBNC state was either induced or prevented, allowing the analysis of gene expression in these particular conditions. To do so, 1 mL of a pool of at least three independent resuspended-biofilm cells or 1 mL of planktonic suspensions were used to extract RNA, as detailed in Chapter 4 (Section 4.2.6). Importantly, further analysis with a wider range of genes was performed with biofilms formed by the WT,  mazEF and  mazEF ::pRB473+ mazEF strains. Primer3 software [6] was used to design the primers for quantification of gene expression described in Table 6.1, using S. epidermidis 1457 genome as the template (Accession number CP020463.1). 6.2.7. Statistical analysis Statistical analysis was performed using one-way ANOVA with Tukey’s multiple comparisons test for most the assays, except for the comparison between the WT and mutant strains regarding gene expression results, in which statistical differences were analysed using unpaired T-test. At least three independent assays were performed for each experiment and differences between analysed conditions were considered significant when a p -value lower than 0.05 was obtained. 126 Table 6.1 – List of primers used for qPCR analysis. Target gene Forward sequence (5’-3’) Reverse sequence (3’-5’) Amplicon size (bp) Efficiency (%) 16S rRNA GGGCTACACACGTGCTACA A GTACAAGACCCGGGAACGT A 176 100.0 clpP GTTGCTTGTCCTTGTGCACC CTGTATTGGTATGGCAGCGT C 129 105.7 codY TTCGCCACCACCTAAAATTG G AGAAGATCGACATATACCGC GTGA 166 98.3 gyrB GCATTTGGTACGGGTATTGG CATCAACATCGGCATCAGTC 88 93.0 icaA TGCACTCAATGAGGGAATCA TAACTGCGCCTAATTTTGGA TT 134 93.1 mazE CAAAATAGAAACCACAGTCT TGAAC AGATATTAAATGTGATTCATT GCAATC 138 91.8 mazEF GCAACAGAAGCTTTCCCGAT CCCCTTGTTCAGACCCTTGA 141 102.0 mazF GAAGAGGAGATGTTTATTTA GCGG CCCAAACTAATATCTAAGGC ATTATC 325 95.5 pdhA GCTTCTTGTCCTGCTGTTGG TG TTGGATGAAGACGGAAATGT CG 173 106.5 psm TTGCAAATACAGTAAAAGCA GCA TCCGAAGATTTTACCTAATA CGC 107 94.7 psm ATGGCAGCAGATATCATTTC TAC AACAAAGTTACAAAAGTTAC AATAGACTC 116 95.4 6.3. Results and discussion 6.3.1. mazEF does not alter biofilm formation and VBNC cells induction rates in S. epidermidis strains To evaluate mazEF potential role in VBNC state modulation in S. epidermidis biofilms grown under VBNC prevented and induced conditions [7], total, live and culturable cells of the biofilms were quantified by OD640nm measurement, flow cytometry and CFU counting, respectively. From the analysis of Figure 6.1 it is noticeable that no statistical differences ( p > 0.05) were observed among the strains, as assessed by the quantification of total and live cells, either in the prevented or induced VBNC state. Nevertheless, the mutant strain exhibited a slightly lower concentration of live cells in both VBNC modulating conditions compared to the WT strain. 127 Figure 6.1 – Comparison of S. epidermidis 1457 biofilms grown under prevented or induced VBNC conditions. (A) OD640nm and (B) concentration of live cells (cells/mL). Results are represented as the mean + standard deviation of at least four independent experiments. Statistical analysis was performed between the WT and constructs for each condition. Although some variability was found for the parameters assessed regarding the quantification of biofilms for all strains tested, this was not surprising since biofilm formation is known to be greatly variable and dependent on the exact conditions of growth, where a small difference in the temperature or aeration of the biofilms can deeply impact their structure [8]. Additionally, we aimed to study the effect of mazEF in the emergence of VBNC cells. Thus, the number of culturable cells was also assessed. 128 Figure 6.2 – Quantification of biofilms of S. epidermidis 1457 strains under VBNC modulating conditions, represented as the ratio (%) between the number of culturable cells in the induced (IND) and prevented (PRE) VBNC state; Results are represented as the mean + standard deviation of at least four independent experiments. Statistical analysis was performed between the WT and constructs. Not surprisingly, the analysis of data from Figure 6.2 revealed that the culturability of cells significantly decreased when the VBNC state was induced, as assessed by the CFU IND/PRE ratios being lower than 40%, finding that was consistent for all the strains. However, no significant differences were found between the mutant ( mazEF. ) or complemented ( mazEF ::pRB473+ mazEF ) strains when compared to the WT in any of the parameters assessed, strongly suggesting that mazEF does not have a pivotal role in the modulation of the VBNC state. Even though no significant differences were previously detected in mazEF role between strains 1457 and 9142, herein we included both strains to characterize under VBNC modulating conditions, since it was previously shown that VBNC induction is strain-dependent [9]. We conducted a brief characterization of strain 9142 and its respective constructs, using biofilms grown under VBNC-modulated conditions and assessing the extent of biofilm formation in terms of culturable cells (CFU). Data presented in Figure 6.3 shows that all strains had a similar decrease in the number of culturable cells in the VBNC induced condition, confirming the previous results found for S. epidermidis 1457 strains and, thus, suggesting that the model used herein to induce the VBNC 129 state in biofilms is, after all, independent on the mazEF operon, contrary to what was previously hypothesized. Figure 6.3 – Quantification of biofilms of S. epidermidis 9142 strains, assessed as the ratio (%) of culturable (CFU) cells in the induced (IND) and prevented (PRE) VBNC state. Results are represented as the mean + standard deviation of at least three independent experiments. Statistical analysis was performed between the WT and constructs . 6.3.2. mazEF does not alter planktonic growth and VBNC cells induction in S. epidermidis 1457 strains Despite no significant differences were found in the induction of the VBNC state in biofilms of S. epidermidis 1457 strains, we also decided to characterize the role of mazEF operon in VBNC state induction in planktonic cultures. To accomplish this goal, we quantified the amount of total (OD640nm), live (flow cytometry) and culturable cells (CFU) of cultures grown under the induced and prevented VBNC conditions. Our results show that planktonic cultures reached an equivalent proportion of cells after 24 hours of growth (Figure 6.4), with all strains showing similar levels of both total and live cells within the two conditions assessed, with no statistically significant differences observed ( p > 0.05). 130 Figure 6.4 – Comparison of planktonic cultures of S. epidermidis 1457 WT, mutant ( mazEF ) and complemented ( mazEF ::pRB473+ mazEF ) strains grown for 24 hours under prevented or induced VBNC conditions. (A) OD640nm and (B) concentration of live cells (cells/mL). Results are represented as the mean + standard deviation of at least three independent experiments. Statistical analysis was performed between the WT and constructs for each condition. While it seems evident that the deletion or further complementation of the mazEF operon in S. epidermidis did not affect the extent of planktonic growth under VBNC modulating conditions, we also assessed the ratio of culturable cells between the two conditions. Not surprisingly, the ratios of culturable cells between the induced and prevented VBNC state populations were similar to all tested strains (Figure 6.5), further ruling out the hypothesis that mazEF is the main regulator of VBNC state modulation in S. epidermidis.