Heterologous expression of mammalian phospholipase D1 and D2 in the yeast model

dezembro de 2021 UMinho | 2021 Universidade do Minho Escola de Ciências Inês Paula Ribeiro Heterologous expression of mammalian phospholipase D1 and D2 in the yeast model Heterologous expression of mammalian phospholipase D1 and D2 in the yeast model Inês Paula Ribeiro dezembro de 2021 Universidade do Minho Escola de Ciências Inês Paula Ribeiro Heterologous expression of mammalian phospholipase D1 and D2 in the yeast model Dissertação de Mestrado Mestrado em Genética Molecular Trabalho efetuado sob a orientação de Doutora Sandra Cristina Almeida Paiva e de Doutor Tiago Gil Rodrigues Oliveira i DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS Este é um trabalho académico que pode ser utilizado por terceiros desde que respeitadas as regras e boas práticas internacionalmente aceites, no que concerne aos direitos de autor e direitos conexos. Assim, o presente trabalho pode ser utilizado nos termos previstos na licença abaixo indicada. Caso o utilizador necessite de permissão para poder fazer um uso do trabalho em condições não previstas no licenciamento indicado, deverá contactar o autor, através do RepositóriUM da Universidade do Minho. Licença concedida aos utilizadores deste trabalho Atribuição-NãoComercial-SemDerivações CC BY-NC-ND https://creativecommons.org/licenses/by-nc-nd/4.0/ ii STATEMENT OF INTEGRITY I hereby declare having conducted this academic work with integrity. I confirm that I have not used plagiarism or any form of undue use of information or falsification of results along the process leading to its elaboration. I further declare that I have fully acknowledged the Code of Ethical Conduct of the University of Minho. iii AGRADECIMENTOS Aqueles que passam por nós, não vão sós, não nos deixam sós. Deixam um pouco de si, levam um pouco de nós. - Antoine de Saint-Exupéry Em primeiro lugar, um enorme obrigada à Professora Sandra Paiva e ao Professor Tiago Gil, meus orientadores, que me proporcionaram com todo o apoio, condições e meios necessários para realizar esta dissertação. Pela sabedoria, pelas sugestões, pelas oportunidades, pela constante valorização do trabalho desenvolvido. Pela calma que sempre me trasmitiram, e pelo exemplo de compreensão e espírito positivo. À Rosana, minha mentora, por ser responsável por grande parte de tudo o que eu sei sobre investigação e trabalho laboratorial. Pela paciência, pela disponibilidade, pelas palavras de incentivo e motivação. Acima de tudo, por ser um exemplo de trabalho e dedicação. À Cidália e ao Félix, meus amigos e colegas de mestrado, e à Adília, à Sónia e à Natacha, minhas amigas, pelo carinho, pela ajuda, pelas gargalhadas, pelas conversas sobre ciência e pelas que nada têm a ver com ciência, pelas cartadas, por me manterem com os pés no chão. Aos meus colegas de laboratório, à Cláudia, à Tatiana, à Alexandra, ao Paulo e ao Humberto, um agradecimento especial por todos os conselhos, esclarecimentos e ajuda. Por criarem, no LGM um ambiente acolhedor e de entreajuda. À Rafaela, pela disponibilidade constante, por todo o tempo e ajuda na aquisição de fotos de microscopia confocal. Ao Professor Rui Oliveira, por toda a ajuda e conhecimento no cruzamento de leveduras e separação de tétradas. Por último, o maior agradecimento à minha família, os meus alicerces. Pelo apoio e carinho constantes. Ao meu pai, e à minha mãe que sempre fizeram tudo para que eu tivesse as ferramentas e condições para estar aqui hoje e cujo orgulho é a minha maior motivação. À Gabi, minha irmã, pelo companheirismo, pela cumplicidade e pelas gargalhadas. iv RESUMO Lipídos são moléculas com funções biológicas extremamente diversas, desde fontes de energia armazenada, a cofatores de enzimas e mensageiros intracelulares. Os glicerofosfolipídos, ou simplesmente fosfolipídos, são uma categoria de lipídos tipicamente conhecida como sendo componentes maioritários das membranas celulares. Quando fosfolipídos são hidrolisados por fosfolipases, os compostos resultantes podem atuar como mensageiros secundários ou mediadores, apresentando um papel importante no metabolismo e estrutura celular e em vias de transdução de sinal. A fosfolipase D (PLD), uma das principais classes de fosfolipases, hidrolisa a ligação fosfodiéster na fosfatidilcolina, produzindo ácido fosfatídico e colina. A sua ação está descrita em diversos organismos, incluido leveduras, mamíferos, bactérias e plantas. Em mamíferos, duas isoformas de PLD foram identificadas: a PLD1 e a PLD2, e a sua atividade tem sido associada a um grande número de condições patofisiológicas, nomeadamente doenças cardíacas, cancro e doenças neurodegenerativas. Especificamente, a PLD1 e a PLD2 têm sido identificadas como tendo um papel extremamente importante na doença de Alzheimer (AD). SPO14 é o ortólogo da PLD em levedura, codificando para a atividade PLD em S. cerevisiae , onde este gene é essencial para a meiose e a formação dos esporos. Apesar da sua semelhança no que toca à atividade catalítica e estrutura global, a PLD1 e PLD2 estão diferencialmente implicadas em diversas condições biológicas e vários aspetos da sua função distinta nas células estão ainda por desvendar. Com um conjunto robusto de vantagens manipulativas e sendo SPO14 , provavelmente, a única fonte canónica de atividade PLD em S. cerevisiae , esta espécie apresenta-se como um modelo relevante e ideal para o estudo dos papéis diferenciais da PLD1 e PLD2 mamíferas. O objetivo desta tese foi, então, estudar as enzimas mamíferas PLD1 e PLD2 usando o modelo de levedura, desenvolvendo mutantes para o SPO14, onde foram heterologamente expressas versões otimizadas do PLD1 e PLD2 de mamíferos. Foi desenvolvido um conjunto de ferramentas moleculares valiosas, que permitirão a exploração de vários aspetos relevantes da relação genótipo-para-fenótipo da PLD1 e PLD2 no contexto da AD. Globalmente, estas ferramentas possibilitam investigação adicional sobre potenciais diferenças biológicas entre estas isoenzimas mamíferas, usando S. cerevisiae como modelo v ABSTRACT Lipids are ubiquitous molecules with extremely diverse biological functions, from being stored energy sources, to acting as enzyme cofactors and intercellular messengers. Glycerophospholipids, also commonly called phospholipids, are a category of lipids mainly known for being major constituents of cell membranes and, when hydrolyzed by phospholipases, the resulting compounds can act as second messengers or mediators, playing important metabolic and structural roles as well as being involved in an array of signal transduction pathways. Phospholipase D (PLD), one of the major phospholipase classes, hydrolyzes the phosphodiester bond on phosphatidylcholine, producing phosphatidic acid and choline. Its action has been reported in several organisms including yeast, mammals, bacteria and plants. In mammals, two isoforms of PLD have been identified: PLD1 and PLD2, and their activity has been strongly associated with a number of pathophysiological conditions, namely heart disease, cancer and neurodegenerative diseases. Specifically, the PLD1 and PLD2 have been strongly implicated in Azlheimer’s disease (AD). SPO14 is the yeast ortholog of PLD, encoding the major phospholipase D activity in S. cerevisiae , where this gene is essential for meiosis and spore formation. Despite their similarity in catalytic function and overall structure, PLD1 and PLD2 are differentially implicated in various biological conditions and several aspects of PLD1’s and PLD2’s distinct function in cells are yet to be unveiled. With a robust set of manipulative advantages and with SPO14 likely being the only source of canonical PLD activity in this species, S. cerevisiae presents itself as an ideal and relevant model to study the differential roles of mammalian PLD1 and PLD2 in the cell. The aim of this thesis was to study mammalian PLD1 and PLD2 using the yeast model, by developing SPO14 yeast mutants which were used to heterologously expressing codon optimized versions of mammalian PLD1 and PLD2 . A set of valuable molecular tools was generated, which will allow for the exploration of several relevant aspects of the genotype-to-phenotype relationship of PLD1 and PLD2 in the context of AD. Overall, these tools permit further investigation of the potential biological differences between these mammalian isoenzymes using the S. cerevisiae model. vi HETEROLOGOUS EXPRESSION OF PHOSPHOLIPASE D1 AND D2 IN THE YEAST MODEL SCIENTIFIC OUTPUT Poster Communications 1. Inês P. Ribeiro, Rosana Alves, Rafaela Ribeiro, Sandra Paiva and Tiago Gil Oliveira “ Heterologous expression of mammalian PLD1 and PLD2 in Saccharomyces cerevisiae ” (2021) 13th iMED Conference, 6 - 10 Outubro, Lisboa, Portugal. xiii LIST OF FIGURES Figure 1. Four major lipid categories in mammals and examples of important members of each category. ....................................................................................................................................... 4 Figure 2. Phosphatidic acid biosynthesis by four different pathways. .................................................. 8 Figure 3. Action site of the four main phospholipases on the phospholipid molecule. ........................ 10 Figure 4. Reaction catalyzed by phospholipase D. .......................................................................... 11 Figure 5. Structure of mammalian PLD1 and PLD2 ........................................................................ 14 Figure 6. Structure of S. cerevisiae Spo14. .................................................................................... 20 Figure 7. DNA agarose gel of the PCR amplification of KanMX cassette from strain IR04. .................. 39 Figure 8. DNA agarose gel of the colony PCR for KanMX cassette integration in the SPO14 locus....... 40 Figure 9. DNA agarose gel of the PCR amplification of HygMX cassette from pAG32. ........................ 41 Figure 10. DNA agarose gel of the colony PCR for HygMX cassette integration in the SPO14 locus. .... 42 Figure 11. DNA agarose gel of the PCR amplification of codon-optimized PLD1 and PLD2 from hPLD1_pUC57 and mPLD2_PCCI-4K, respectively. ....................................................................... 43 Figure 12. DNA agarose gel of the digestion of p461_GPD-JEN1-GFP with BamHI and SalI. .............. 43 Figure 13. DNA agarose gel of the colony PCR for p416-coPLD1-GFP and p416-coPLD2-GFP. ........... 44 Figure 14. DNA agarose gel of the DNA fragments obtained by digestion of plasmids p461_GPDcoPLD1-GFP and p416_GPD-coPLD2-GFP with XbaI and EcoRV restriction enzymes. ........................ 45 Figure 15. Analysis of PLD1-GFP (A) and PLD2-GFP (B) expression and localization by fluorescence microscopy. ................................................................................................................................ 46 Figure 16. DNA agarose gel of the PCR amplification of the pRCC-K plasmid in three fragments. ....... 48 Figure 17. DNA agarose gel of the PCR amplification of codon optimized PLD1 and PLD2 from hPLD1_pUC57 and mPLD2_PCCI-4K, respectively. ....................................................................... 49 Figure 18. DNA agarose gel of the colony PCR for genomic integration of PLD1 and PLD2 in the yeast genome. ..................................................................................................................................... 50 Figure 19. Analysis of PLD activity by confocal microscopy. ............................................................. 51 Figure 20. Growth phenotypes of serial dilutions to 10-4 of wild-type, wild-type + vector, ∆spo14 and ∆spo14 cells carrying p416_GPD-coPLD1-GFP or p416_GPD-coPLD2-GFP. ..................................... 53 Figure 21. Distribution of codon usage frequency along the length of PLD1 and PLD2 to be expressed in S. cerevisiae ................................................................................................................................ 71 xiv Figure 22. Plasmid maps for (A) hPLD1_pUC57 (5935 bp) and (B) mPLD2_PCCI-4K (7096 bp) containing the codon optmized mammalian PLD1 and PLD2 , respectively........................................ 72 Figure 23. Plasmid maps for (A) p416_GPD-coPLD1-GFP (9714 bp) and (B) p416_GPD-coPLD2-GFP (9324 bp). .................................................................................................................................. 75 Figure 24. DNA Alignment of the p416_GPD-coPLD1-GFP predicted sequence with results obtained by sequencing the p416_GPD-coPLD1-GFP plasmid using primer pGPD-co-hPLD1-GFP-fw .................... 78 Figure 25. DNA Alignment of the p416_GPD-coPLD1-GFP predicted sequence with results obtained by sequencing the p416_GPD-coPLD1-GFP plasmid using primer 1114_GFP-R ................................... 79 Figure 26. DNA Alignment of the p416_GPD-coPLD2-GFP predicted sequence with results obtained by sequencing the p416_GPD-coPLD2-GFP plasmid using primer pGPD-co-mPLD2-GFP-fw ................... 82 Figure 27. DNA Alignment of the p416_GPD-coPLD2-GFP predicted sequence with results obtained by sequencing the p416_GPD-coPLD2-GFP plasmid using primer 1114_GFP-R ................................... 83 xv LIST OF TABLES Table 1. Most common head group substitutions and the resulting phospholipids. .............................. 6 Table 2. List of S. cerevisiae strains used in this work ..................................................................... 24 Table 3. List of oligonucleotides used in this work .......................................................................... 25 Table 4. List of plasmids used in this work..................................................................................... 26 Table 5. Cycling conditions for amplification of KanMX cassette from IR04 using PhusionTM High– Fidelity DNA Polymerase (Thermo Scientific) .................................................................................. 84 Table 6. Cycling conditions for colony PCR of integration of KanMX in the SPO14 locus .................... 84 Table 7. Cycling conditions for amplification of HygMX cassette from pAG32 using PhusionTM High– Fidelity DNA Polymerase (Thermo Scientific) .................................................................................. 85 Table 8. Cycling conditions for colony PCR of integration of HygMX in the SPO14 locus .................... 85 Table 9. Cycling conditions for amplification of PLD1 and PLD2 from hPLD1_pUC57 and mPLD2_PCCI-4K, respectively using PhusionTM High–Fidelity DNA Polymerase (Thermo Scientific). . 86 Table 10. Cycling conditions for colony PCR for correct assembly of p416_GDP-coPLD1-GFP and p416_GPD-coPLD2-GFP ............................................................................................................... 87 Table 11. Cycling conditions for amplification of fragment 1 from pRCC-K using PhusionTM High– Fidelity DNA Polymerase (Thermo Scientific) .................................................................................. 87 Table 12. Cycling conditions for amplification of fragment 2 from pRCC-K using PhusionTM High– Fidelity DNA Polymerase (Thermo Scientific) .................................................................................. 88 Table 13. Cycling conditions for amplification of fragment 3 from pRCC-K using PhusionTM High– Fidelity DNA Polymerase (Thermo Scientific) .................................................................................. 88 Table 14. Cycling conditions for amplification of PLD1 from hPLD1_pUC57 using Platinum™ II HotStart DNA Polymerase (Thermo Scientific) ..................................................................................... 89 Table 15. Cycling conditions for amplification of PLD2 from mPLD2_PCCI-4K using Platinum™ II HotStart DNA Polymerase (Thermo Scientific) ..................................................................................... 89 Table 16. Cycling conditions for colony PCR of integration of PLD1 or PLD2 in the SPO14 locus ........ 90 1 Chapter I - Introduction 2 I. Introduction I.1. Lipids Lipids are a heterogeneous and ubiquitous group of compounds that share the feature of being poorly soluble in water and are classically defined as being soluble in organic solvents [1]. These amphipathic molecules include fats and oils (triglycerides), phospholipids, waxes, and sterols, amongst others and their biological functions can be extremely diverse, however, four main functions can be highlighted [2]: - Energy storage: for instance, glycerol esters (monoacylglycerol, diacylglycerol, and triacylglycerol) or sterols in lipid droplets can be used for membrane biogenesis and as reserves of caloric energy. - Structural: amphiphilic lipids, such as phospholipids are responsible for the spontaneous formation of membranes due to their physical-chemical properties. These properties also allow for the compartmentalization of structures within cells, and therefore the formation of organelles. The main membrane lipids in eukaryotic cells are glycerophospholipids such as phosphatidylcholine (PC), phosphatidylinositol (PI), and phosphatidylserine (PS). - First and second messengers: given their structural function in cell membranes, lipids are situated at the frontier between the intracellular and extracellular portions and can therefore participate in signal transduction pathways. The metabolization of membrane lipids can result in a signalling event that can be transmitted within the membrane to the cytoplasm through the hydrophobic and hydrophilic portions of these molecules, respectively. Lipid-derived signalling molecules include phosphatidic acid (PA) and diacylglycerol (DAG). Additionally, membrane lipids can be used as domain identifiers within membranes, and work as recruiters for proteins that organize subsequent effector complexes or secondary signalling cascades. - Chemical tags: the compartmentalization achieved by lipid membranes allows for the segregation and isolation of specific biochemical reactions that result in higher efficiency and controlled spread of reaction products. For example, phosphoinositides can be interconverted by phosphatases and kinases to mark cellular membranes and recruit cytosolic proteins. Additionally, lipids can regulate the aggregation or dispersion of certain proteins. In eukaryotic cells, variations in aliphatic chains and headgroups enable the existence of thousands of different lipid species [3]. As far as nomenclature, lipids can be classified into eight categories: fatty acyls, glycerolipids, glycerophospholipids, sphingolipids, sterol lipids, prenol lipids, saccharolipids and 3 polyketides [4]. Inside each category, lipids can be further subdivided in classes. Organisms can vary in the biological importance and presence of different lipid classes. In mammals, glycerolipids, sterols, sphingolipids, and glycerophospholipids are the lipid classes of most importance [5] – Figure 1. 4 Figure 1. Four major lipid categories in mammals and examples of important members of each category. In mammals, the four major lipid categories are glycerolipids, sterols, sphingolipids, and glycerophospholipids. Glycerolipids contain a glycerol molecule and can be divided into three main categories acylglycerols, glyceroglycolipids, and glycerophospholipids. Acylglycerols, or glycerides, are glycerol molecules that can be mono-, di-, or tri-esterified with fatty acids to form mono-, di-, and triglycerides, respectively. Sterols are non-polar lipids composed of an alkyl group on a hydroxylated sterane ring, a molecule composed of three rings with six atoms and one ring with five atoms, that can be esterified to a fatty acid. Sphingolipids are a class of membrane lipids composed of a sphingoid base linked to an N-acyl chain and a head group through a phosphate group. Phospholipids are composed of a glycerol backbone, linked to a polar head group by a phosphate residue and to one or two fatty acids, that can be saturated or unsaturated. 5 I.1.1. Glycerolipids Glycerolipids comprise all lipids that contain a glycerol molecule. These can be divided into three classes: acylglycerols, glyceroglycolipids, and glycerophospholipids. Acylglycerols, or glycerides, are glycerol molecules that can be mono-, di-, or tri-esterified with fatty acids to form mono-, di-, and triglycerides, respectively [6]. Glyceroglycolipids are composed of an sn -1,2diacylglycerol and a carbohydrate moiety linked by a glycosidic bond at the sn -3 position and are found in some bacteria and plants, in the membrane of thylakoids [7]. Glycerophospholipids have a glycerol backbone linked to a polar head group and one or two fatty acids [1]. I.1.2. Sterols Sterols are one of the major components of cell membranes, with cholesterol being the predominant membrane sterol in mammals and ergosterol in yeast [2]. These are non-polar lipids composed of an alkyl group on a hydroxylated sterane ring – a molecule composed of three rings with six atoms and one ring with five atoms – that can be esterified to a fatty acid. In mammals, cholesterol is the major sterol playing a key role in membrane structure given its conic geometry, while in yeast and fungi ergosterol is the main sterol [8]. I.1.3. Sphingolipids Sphingolipids are a class of membrane lipids composed of a sphingoid base – usually sphingosine, a long chain amino-alcohol – linked to an N -acyl chain and a head group through a phosphate group. This phosphate group places sphingolipids inside the phospholipid category of lipids [9]. Several sphingolipids can be produced by the substitution of the amino and alcohol moieties of sphingosine, with ceramide being the simpler one [10]. Sphingolipids have a distinctive characteristic when it comes to their location on cellular membranes, they can be found almost exclusively in the outer leaflet of most membrane bilayers [11]. Chemical diversity in sphingolipids is attributed to the length and type of sphingoid base present, the head group substituent, and the type and hydroxylation of the Nacyl chain [9]. The major representative of this class of lipids is sphingomyelin, a major component of cells membranes. Produced by transfer of the phosphorylcholine group from phosphatidylcholine to ceramide, sphingomyelin is found in large 6 amounts in the central nervous system, specifically in the myelin sheaths that surround the axons of some neurons [12,13]. I.1.4. Glycerophospholipids Glycerophospholipids, commonly referred to as phospholipids, are often considered as a lipid class of their own, given their abundance and importance in membrane structure, metabolism, and molecular signalling. Phospholipids are amphiphilic species, composed of a glycerol backbone, linked to a polar head group by a phosphate residue and to one or two fatty acids, that can be saturated or unsaturated. The fatty acids are esterified to carbons sn-1 and sn-2 of the glycerol molecule whilst the phosphate group is esterified to carbon sn-3 . Different combinations of fatty acids at sn-1 , which tend to be saturated or monounsaturated, and at sn-2 , which tend to be monoor polyunsaturated, can confer chemical diversity to phospholipids [9]. Given their biophysical properties, these molecules can aggregate to spontaneously form lipid bilayers in water, with their hydrophobic carbon chains facing inwards and their hydrophilic head groups facing outwards. This phenomenon explains phospholipid’s vital role in membrane structural integrity. Different head groups will result in different glycerophospholipids – Table 1. Table 1. Most common head group substitutions and the resulting phospholipids. 7 These include phosphatidylcholine (PC), phosphatidylinositol (PI), and phosphatidylserine (PS) and are very abundant in cells, being present as membrane components and acting as signalling molecules [1,5]. The asymmetrical distribution of different species of phospholipids across the membrane leaflets, vertically and laterally, plays a pivotal role in cell dynamics, namely in cell division [14], oncogenesis [15], and apoptosis [16]. Phosphoinositides are generated by phosphorylation of the inositol hydroxyls of PI at positions 3, 4 or 5, resulting in monophosphorylated [PI(3)P, PI(4)P and PI(5)P], bisphosphorylated [PI(3,4)P2, PI(3,5)P2 and PI(4,5)P2] and trisphosphorylated [PI(3,4,5)P3] species, respectively. These seven derivatives are differentially enriched in the membrane of various organelles, and thus play a role in the specification of organelle and membrane identity [17]. Despite their relative low abundance, these membrane phospholipids have emerged as key regulators of several essential cellular processes in eukaryotic cells such as cytoskeletal function, membrane transport, and plasma membrane signaling [18,19]. PA is the simplest of phospholipids, having only a phosphomonoester as the head group. I.1.4.1. Phosphatidic acid Despite being the simplest phospholipid, PA is a key intermediate in various processes, from lipid storage to membrane lipid synthesis, and has been implicated as a regulator and mediator of multiple essential cellular pathways including signal transduction, cytoskeletal rearrangement, membrane trafficking, and secretion [20]. Structurally, this amphipathic lipid consists of a glycerol backbone esterified to two fatty acid chains and a phosphate, at positions sn-1 , sn-2, and sn-3 , respectively. Structural diversity is conferred by variations in fatty acid chain length and saturation. An alternative species, lysophosphatidic acid (LPA) can also be described, differing from PA by having only one fatty acid chain at the sn-1 position. PA synthesis can be carried out by multiple enzymes and pathways, resulting in differences in the location and timing of the resulting species. Four important pathways for PA biosynthesis can be described, which are carried out in different organelles and under different stimuli [21]: I. De novo synthesis, where PA is generated via sequential acylation of glycerol-3phosphate by acyltransferases. In mammals, this process exists in most tissues, with different acyltransferase isoforms being located in the membranes of different organelles and expressed at various levels in different organs yielding distinct contributions to various cellular processes; 14 Figure 5. Structure of mammalian PLD1 and PLD2 A) and B) Characteristic domains of PLD1 and PLD2, respectively. Both isozymes contain PX and PH domains, essential for their subcellular localization. Similarly, both contain four (I-IV) highly conserved domains and two HKD motifs, critical for the enzyme’s catalytic activity. A PI(4,5)P2 binding region can also be found in both isozymes. A loop region can be found only in PLD1. C) and D) Predicted 3D protein structure of human PLD1 and PLD2, respectively (AlphaFold Protein Structure Database). Alphafold produces a color coded, per residue confidence score between 0 and 100. Regions in dark blue and light blue present model confidence scores of “very high” and “confident”, respectively, whilst regions in yellow and orange present confidence scores of “low” and “very low”, respectively. For both PLD1 and PLD2, most of the residues in the predictions show a very high model confidence score E) and F) Resolved crystal structures of the catalytic domains of human PLD1 [55] and PLD2 [89], respectively (Retrieved from RCSB PDB using Mol* [58]. PLD1 ID: 6U8Z PLD2 ID: 6OHO.) The resolved catalytic domain of human PLD1 shows 18 -strands, 18  -helices and a series of loops that combine, forming an asymmetric globular structure. For PLD2, a core containing 7 -strands is found between 3  -helices, running parallel to the strands on one side, and 1 long -helices that runs perpendicular to the -strands on the opposite side. A B C D E F 15 Despite both enzymes being ubiquitously expressed in almost all tissues and cell types [60], their subcellular localization differs, with PLD1 localizing, in steady-state normal conditions, predominantly at intracellular compartments such as the Golgi complex, the endosome, the lysosome, the endoplasmic reticulum, the plasma membrane, and in exocytotic vesicles, and PLD2 localizing mainly in the vicinity of the plasma membrane [61] with some reports of its presence at the Golgi complex [62,63], as well as associated with endosomal structures [64]. Interestingly, PLD1 and PLD2 cellular localization appear to be dynamic, changing throughout the cell cycle [65]. As an example, PLD1 can be recruited to the plasma membrane through the endosomal route upon stimulation [66,67]. Accordingly, PLD1 is involved in vesicle budding associated with the trans-Golgi network [68], Epidermal Growth Factor Receptor (EGFR) endocytosis [69], transport from the Golgi to the plasma membrane [63], exocytosis [70–74], regulation of the cytoskeleton [29,37] and phagocytosis [75], while PLD2 seems to function in phagocytotic traffic events associated with the Golgi [75,76] and G-protein coupled receptor endocytosis at the plasma membrane [64,77]. Even though PLD1 and PLD2 catalyze the same reaction, given the differences in intracellular localization, structure and activity in basal conditions, a difference in biological roles for PLD1 and PLD2 can be hypothesized. I.2.2.2. PLD3, PLD4, PLD5, and PLD6 Additionally, PLD3, PLD4, PLD5, and mitochondrial PLD (MitoPLD/PLD6) have also been described and are known to share the same HxKxxxxD sequence signature [78–81]. Due to differences in structure and the presence or absence of certain domains, this enzyme superfamily can be divided into two groups that can be described as “classical” PLDs and “non-classical” PLDs. “Classical” PLDs comprise all PLD enzymes with a PX and PH domain, with two HKD motifs (or phosphodiesterase catalytic centres) and with canonical lipase activity, whilst “non-classical” PLDs comprise all PLD enzymes that lack one or both PX and PH domains, have one or two HKD motifs and do not have canonical lipase activity [82]. With no known phospholipase activity the “non-classical” PLD3 and PLD4 have recently been identified as 5’-ssDNA exonucleases that are needed to regulate endosomal nucleicacid sensing [83]. PLD3 is a type II transmembrane protein and has been shown to localize to the ER, the golgi complex and lysosomes [84–86] This enzyme appears to be associated AD through the processing of amyloid precursor protein (APP) – PLD3 gene expression was found to be lower in neurons of AD patients when compared to cognitively healthy individuals and this lower expression correlated with higher levels of APP and amyloid-beta. This same study also found a rare variant of the PLD3 gene that increases the risk for AD [87]. Even though PLD4 contains two catalytic HKD domains 16 at the C-terminal end it does not have any known lipase activity. This PLD family member has, however, been associated with important processes such as the phagocytosis of microglia in the central nervous system [88] and shown to be involved in the activation of M1 macrophages promoting and inhibitory effect in colon cancer cells, in vitro [89]. Similarly to PLD3 and PLD4, PLD5 does not display any lipase activity. A recent study has associated PLD5 deregulation with thyroid cancer: survival analysis of mRNA expression profiles from thyroid cancer patients showed that up-regulation of PLD5 accelerated patients’ death [90]. As the name suggests, MitoPLD or PLD6 is a mitochondrial protein responsible for hydrolyzing cardiolipin, a lipid molecule specific to the mitochondrion, forming PA in the mitochondrial surface and aiding in mitochondrial fusion [80]. This member exhibits only one HKD motif in its sequence, interestingly however it appears that PLD6 can dimerize to form an active enzyme by combining two HKD motifs in one catalytic pocket [91]. Recent studies have also highlighted the role of MitoPLD in the piRNA biogenesis pathway in the mouse germline [92]. I.2.3. Regulation of PLD1 and PLD2 activity The first evidence of modulation of PLD activity was described in 1956 when the enzyme was partially purified for the first time. Authors reported that phospholipase D from cottonseed and cabbage were both susceptible to activity stimulation by NaCl [93]. The recent crystal structure solving of the catalytic domains of human PLD1 and PLD2 has highlighted some of the molecular mechanisms underlying substrate recognition and activation or inhibition of PLD1 and PLD2 [53,58]. In mammals, PLD activity can be regulated by a number of small GTPases such as ADP Ribosylation Factor (ARF) [94] and Rho GTPases [95], protein kinase C (PKC), and phosphoinositides. Furthermore, PLD has been shown to respond to receptor tyrosine kinases (RTK) such as EGF (Epidermal Growth Factor) signals in a number of cell types [96–98] with one particular study reporting that overexpression of PLD1 and PLD2 resulted in increased internalization and degradation of EGFRs. ARF, or ADPRibosylation Factors, were initially identified as positive regulators of PLD activity in human (HL60) [99] and porcine cells [100]. There are six known ARF proteins (ARF1 – ARF6) and all of them have been reported as activators of PLD1 activity in vitro [101], with ARF1 and ARF6 as the major activators [102]. However, PLD2 does not display a strong response to ARF activation [51,57]. PLD activation by PKC can be achieved through phosphorylation-dependent or phosphorylation-independent mechanisms. In vitro , PKC regulates PLD1 activity but not PLD2 [51,103]. Furthermore, only PKC and PKC have been reported as PLD1 activators in vitro , and this interaction is achieved through a non- 17 phosphorylation mechanism and in the absence of ATP [103,104]. Several studies have reported that PLD possesses PKC binding sites in both the Nand Cterminus [54,104,105]. Interestingly, there seems to be a synergistic interaction between PKC and some of the other PLD activators, namely Rho and ARF [103]. When compared to activation by ARF and PKC, Rho GTPases appear as a less potent activator of PLD activity [103]. In PLD1, this regulation is achieved through the binding of the small GTPase RhoA to the C-terminal of the enzyme [106]. When RhoA binds to PLD1 the Michaelis constant, Km , of PC is reduced [53]. With this result in mind, it has been hypothesized that PLD1 activation by RhoA is a result of conformational changes carried out when RhoA binds to one of the -helices of PLD1’s catalytic domain, increasing the enzyme’s affinity for its substrate, PC. Other small GTPases of the Rho family, such as Cdc42 and Rac1, have been reported as regulators of PLD1 but not PLD2 [95,107,108]. As previously mentioned, the binding of the phosphoinositide PI(4,5)P2 regulates activation of PLD1 and PLD2 and it is essential for their catalytic activity [52]. In fact, PLD1 requires PI(4,5)P2 as a co-factor for basal activity and for activation by RhoA, Arf, and PKC [53]. PI(3,4,5)P3 has also been reported as an activator of PLD, although less efficient than PI(4,5)P2 [103,109]. A recent study has shown that binding of PI(4,5)P2 strongly activates the PLD1 catalytic domain by 73-fold whilst PI(3,4,5)P3 binding only resulted in an activation of 5-fold [53]. I.2.4. Phospholipase D1 and D2 in health and disease Atypical expression and regulation of PLD activity have been strongly associated with a number of pathophysiological conditions, namely heart disease, cancer, and neurodegenerative diseases. PLD activity was shown to be increased in breast cancer and gastric carcinomas [110], while PLD1/2 expression appears elevated in breast cancer [111,112], colorectal carcinomas [113], and renal cancers [114]. Additionally, PLD1 expression was reported to play an important role in angiogenesis and metastasis, such as shown in studies using PLD1 KO mice that were partially resistant to cancer growth [115]. Pertaining to heart disease, studies involving PLD1 ablation in mice were associated with a protective effect in thrombosis and ischemic brain infarction [116] while PLD2 appeared to be involved in high blood pressure associated pathologies [117] and has been identified as a risk factor for hypertensive disease [118]. 18 I.2.5. PLD1 and PLD2 in the brain and neurodegeneration The part that lipid-mediated signalling takes in neurodegenerative diseases, such as AD, has become more relevant in recent years [25]. Expression of PLD1 and PLD2 in the brain begins during the developmental phase and prolongs itself throughout postnatal life and in fact, appears to be regulated accordingly with the different developmental stages of the brain [119,120]. Several studies have associated PLDs with AD. A study from 2006 reported that PLD1 regulates APP trafficking, and it also corrects impaired neurite outgrowth/ branching capacity in familial Alzheimer’s disease (FAD) mutant neurons, likely due to promotion of APP axonal transport [121]. APP is a precursor of amyloidbeta, the primary component of the amyloid plaques found in the brains of patients with AD. One of the clearest links between PLD activity and AD was established in a 2010 study, where ablation of PLD2 resulted in a decrease in the synaptotoxic effect of Aβ42 oligomers (a highly cytotoxic amyloid-beta species). Moreover, PLD2 KO mice were protected from memory deficits when crossed with a transgenic mouse model of AD [122]. Similarly, in an AD C. elegans model that overexpresses Aβ, the ablation of the only nematode PLD gene was shown to also have a positive impact in several Aβdeleterious phenotypes [123]. PLD has also been implicated as a potential neuroprotective target, with reports that PLD activity plays a role in buffering the cytotoxic effects of C16:PAF, a platelet-activating factor reported being elevated in the brain of patients with AD [124]. PLD1 was recently associated with longitudinal hippocampal axis functioning and organization and the ablation of PLD1 in mice resulted in disruption of the dorsal hippocampus (DH) – ventral hippocampus (VH) structural differentiation with a predominant effect on DH [125]. Given the role that the hippocampus plays in memory and learning, these results seem to, once again, implicate the PLD pathway in neurological disorders. I.3. A yeast ortholog: Spo14 In Saccharomyces cerevisiae, PLD activity was first described in the mitochondrial membrane where it was shown to play a role in the hydrolysis of mitochondrial enzymes during glucose repression under anaerobic conditions [126,127]. The SPO14 gene codes for a 1638 amino acid and 195 kDa PCspecific PLD whose activity is critical for the regulation of prospore membrane formation during meiosis in starvation conditions [128] (Figure 4) highlighting the role of this gene in meiosis and spore formation [129]. Structurally, Spo14 is very similar to PLD1 and PLD2, containing PX [50] and PH [130] domains involved in protein and lipid interaction, four highly conserved domains (I-IV) two of 19 which contain HKD motifs as the catalytic centres’ [55,131], and a PI(4,5)P2 binding site [52]. In yeast, asexual reproduction or gemulation is the reproductive strategy carried out in favourable environmental conditions. However, oxygen deprivation or exposure to an unfermentable carbon source induces a switch in the reproduction system, resulting in the mating of yeast cells and sporulation. Sporulation allows for the formation of haploid nuclei after meiosis. These nuclei are surrounded by a prospore membrane whose formation and subsequent envelopment of the nuclei is dependent on Spo14. The defects in meiosis observed when SPO14 is deleted can be rescued with the expression of a catalytically active Spo14 however, a catalytically inactive Spo14 mutant is not capable of rescuing the meiotic phenotype [55]. PLD activity of Spo14 is essential but not sufficient for meiosis, as a catalytically active Spo14 with a truncated N-terminal does not rescue the sporulation defect [128]. Therefore, this N-terminal region seems to play an important role in Spo14 subcellular localization. Localization wise, Spo14 is present throughout the cytoplasm in vegetative cells [73], re-localizing to the prospore membrane as the yeast enters meiosis II [128,132], the interaction of the PH domain with PI(4,5)P2 induces this translocation of Spo14. Spo14 has also been reported to be required for vesicle fusion during sporulation in S. cerevisiae [133]. Together, these results reveal a possibility for a conserved role of PLD in membrane fusion. Spo14 is also involved in the metabolic pathways of crossbreeding between yeasts. The Ste20p kinase is responsible for the formation of the shmoo, a protuberance before the crossing between the yeasts. It triggers the formation of the protein complex called the polarisome which facilitates the polarization of cells and the rearrangement of the actin cytoskeleton. The production of PA by Spo14 results in the activation of Ste20p [134]. SEC14 encodes a PI/PC transport protein essential for vesicle transport from the Golgi to the membrane. This requirement can be bypassed through a number of mutations in genes involved in the PC biosynthesis pathway. This is known as the SEC14 bypass mechanism [135]. Spo14 activity is essential for the bypass phenotype as deletion of SPO14 results in the elimination of the PI/PC excretion phenotypes [136]. These studies highlight a link between Sec14 and Spo14. Similar to what has been reported for mammalian PLD, Spo14 PLD activity in vitro is strongly activated by PI(4,5)P2 binding [52,109] however, it is unresponsive to ARF [128]. In yeast, PIP levels can be regulated by Vps13, a sorting protein involved in prospore membrane morphogenesis [137]. Another regulator of Spo14 activity is Spo14 Regulatory Factor 1, or SRF1, regulating Spo14 catalytic activity in mitotic cells [124]. 20 I.4. Yeast as a model organism: Using S. cerevisiae to study PLD1 and PLD2 Comprising a robust set of manipulative advantages, S. cerevisiae has been extensively used in scientific research and it is a well-established model organism. Importantly, it has been successfully used to study a variety of human diseases linked to the brain, specifically neurodegenerative diseases such as AD [138–141]. In fact, this species combines a set of characteristics that set it as one of the top models for eukaryotic cell biology research [142–145]: I. Along with having a short generation time (around 90 minutes), its small size and straightforward growth conditions make it so that it can be easily cultured and very cost-effective. Additionally, it is a nonpathogenic species making manipulation in a laboratory more effortless. II. As a unicellular eukaryote, S. cerevisiae shares a common cell architecture with higher multicellular eukaryotes. III. A wide variety of yeast resources are readily available: a completely sequenced genome, specific and detailed databases, several sets of strains including deletion mutants and GFP-tagged strains. Figure 6. Structure of S. cerevisiae Spo14. A) Domains of Spo14. Similarly to mammalian PLD1 and PLD2, Spo14 also contains PX and PH domains, the four highly conserved regions, I-IV, of which two share the conserved HKD motif involved in catalysis, and a PI(4,5)P2 binding site. B) Predicted 3D protein structure of S.cerevisiae Spo14 (AlphaFold Protein Structure Database). Alphafold produces a color coded, per residue confidence score between 0 and 100. Regions in dark blue and light blue present model confidence scores of “very high” and “confident”, respectively, whilst regions in yellow and orange present confidence scores of “low” and “very low”, respectively. Given the high number of disordered regions in this enzyme, model confidence scores are mixed. A B 21 IV. Availability of well-established transformation protocols, allowing for easy genetic manipulation using different genetic techniques (over and under expression, gene knockout or knockdown experiments, study gainor loss-of-function phenotypes). V. It can be grown as a haploid or a diploid organism, allowing for easier manipulation and identification of mutations and associated phenotypic traits. VI. SPO14 disruption does not compromise viability, nor does it exhibit growth defects under vegetative growth in S. cerevisiae [146]. As such, the yeast model provides a powerful heterologous expression system for the study and characterization of mammalian proteins. In fact, several studies have described the use of S. cerevisiae as a heterologous expression host for multiple important proteins of mammalian origin, including the GLUT glucose transporters [147], Na/H antiporters [148], Caspase-3 [149], and membrane proteins [150]. As for the use of S. cerevisiae in the study of PLD, some advantageous criteria can be highlighted: (1) approximately 17 % of yeast genes are orthologous for gene families associated with human diseases [151], and for the majority of these genes, the mammalian homolog functions in yeast and complements the deletion mutant [143]; (2) a single PLD ortholog has been identified and sequenced in S. cerevisiae - SPO14 [73,129]. (3) yeast presents reduced complexity compared to the typically used mammalian models, which in certain biological conditions, can be useful for the study of essential mammals genes. Since Spo14 is likely the only source of canonical PLD activity in yeast, the study of SPO14 mutants presents itself as a relevant model to study the differential roles of mammalian PLD1 and PLD2. I.5. Outline and aims of the thesis Deregulation of the mechanisms underlying PLD1 and PLD2 activity plays a key role in a number of pathophysiological conditions, mainly neurodegenerative diseases such as AD. Despite their apparent similarity when it comes to catalytic function and overall structure, PLD1 and PLD2 are differentially implicated in various biological conditions. Therefore, understanding the basic cellular mechanisms by which both enzymes abide and are a part of, is of the utmost importance. Moreover, the eukaryotic model organism, S. cerevisiae , has proven to be a great model for studying mammalian proteins [147– 149] and neurodegenerative diseases [124,138–141]. Despite being a simple unicellular organism, yeast shares a high level of complexity and similar cellular mechanisms with higher eukaryotes. Easy genetic manipulation and fast growth in accessible and easily achievable conditions in combination with the currently available genetic design and manipulation techniques make this organism a great model 22 for studying the differential roles of mammalian enzymes such as PLD1 and PLD2. Taking all of this into account, the present work aimed at heterologously expressing codon-optimized versions of mammalian PLD1 and PLD2 genes in the yeast S. cerevisiae SPO14 deletion mutant as a way to explore potential biological differences between these mammalian isoenzymes. Importantly, a set of valuable molecular tools was generated in order to further investigate the localization and expression of PLD1 and PLD2 which is relevant for this thesis, but also contributes for other future projects that intend to study PLD biology using multimodal and multispecies approaches. 23 Chapter II - Materials and methods 30 II.10. Agarose gel electrophoresis Agarose gel electrophoresis was performed for visualization of different DNA fragments throughout this work. All agarose gel electrophoresis experiences were performed using a 1 % agarose gel (1 % (w/v) agarose and 1X TAE (Tris-Acetate-EDTA) buffer). Agarose gels were pre-stained with Midori Green Advance nucleic acid stain (Nippon Genetics Europe) and all DNA samples were prepared with loading buffer (5 % (w/v) glycerol, 0.1 mM EDTA, 0.4 % (w/v) bromophenol blue) before being loaded into the gel. Gels were run at 200 V for 20 minutes and visualized in a UV transilluminator (VMR, Genosmart) II.11. Cloning strategy Two cloning strategies were performed in this work, to achieve different results. For subcellular localization studies, the codon-optimized mammalian PLD1 and PLD2 genes were cloned into a plasmid carrying the GFP reporter gene using traditional cloning. For studies involving sporulation and evaluation of PLD activity, the optimized genes were integrated into the genome of S. cerevisiae using the CRISPR-Cas9 editing tool. II.11.1. Construction of GFP tagged PLD1 and PLD2 by restriction enzymebased cloning In traditional cloning, restriction endonucleases are used to cleave both the DNA insert and the vector, generating complementary end sequences that can be joined together by a DNA ligase before the transformation into the desired species. By using two restriction enzymes whose resulting cut sites are not compatible, the insert will be cloned directionally and the occurrence of re-ligation of the vector after digestion will decrease significantly. In order to clone the codon-optimized versions of human PLD1 and mouse PLD2 into the p416-GPD-GFP plasmid, both genes were amplified by polymerase chain reaction with primers containing recognition sites for the BamHI (Thermo Scientific) and SalI (Thermo Scientific) restriction enzymes. PLD1 was amplified using primers pGPD-co-hPLD1-GFP-fw and pGPD-co-hPLD1-GFPrv (Table 3), while PLD2 was amplified using primers pGPD-co-mPLD2-GFP-fw and pGPD-comPLD2-GFP-rv (Table 3). PCR amplification was followed by digestion at of both genes with BamHI and SalI using the conditions recommended by Thermo Scientific’s DoubleDigest Calculator: 0,5 µl of BamHI; 1 µl of SalI; 1 µl BamHI buffer; 2 µl of DNA insert and 3,5 µl of ultra-pure water. The digestion was carried out at 37 ºC for 4 hours. Simultaneously, the 31 p416_GPD-JEN1-GFP vector [154] was digested using the same enzymes and reaction conditions (0,5 µl of BamHI; 1 µl of SalI; 1 µl BamHI buffer; 2 µl of plasmid vector and 3,5 µl of ultra-pure water). After digestion, the vector was loaded in an agarose gel and the empty vector (p416_GPD-GFP) was extracted from the gel and purified using the NZYGelpure kit (NZYTech). Briefly, the desired DNA fragment was excised from the gel with a scalpel and solubilized at 55 °C with 300 μL of Binding Buffer for each 100 mg of gel weight for 10 minutes, or until the gel slice was completely dissolved. The mixture was then loaded into an NZYTech spin column inside a collection tube and centrifuged for 1 minute at top speed (12000 rpm). The flow-through was discarded and the column was washed with 600 µL of Wash Buffer and centrifuged for 1 minute at top speed. After discarding the flow-through, the column was dried by centrifugation for 1 minute at top speed. Finally, 50 µL of DNA Elution Buffer was added and the column was incubated for 1 minute at room temperature. DNA was eluted by centrifugation for 1 minute at top speed and DNA was quantified using the NanoDrop® ND-1000 system. vector and DNA insert were ligated in vitro in a 1:1 molar ratio using T4 DNA ligase (Thermo Scientific™) (10 µl of digested insert; 5 µl of digested vector; 1 µl of T4 DNA ligase; 2 µl of 10X T4 DNA ligase buffer; 2 µl of ultra-pure water) and incubated at 22 ºC for 1 hour. After ligation, 10 µl of each reaction were transformed, individually, into XL1blue chemically competent E. coli cells. After transformation, single colonies were chosen from selection plates and plasmid DNA was extracted, digested with XbaI (Thermo Scientific) or EcoRV (Thermo Scientific), single and double-cut enzymes, respectively, to verify the size of the constructs (0,5 µl of XbaI or EcoRV; 1 µl of buffer Tango or buffer R; 1 µl of plasmid and 7,5 µl of ultra-pure water, incubated at 37 ºC for 1 hour). Several of the constructs showing the correct size were sent for sequencing (sequencing results and alignments are available in Chapter VI – Appendices). The constructs whose sequence was correct were transformed into the IR01 S. cerevisiae strain (Table 2). II.11.2. Genomic integration of mammalian PLD1 and PLD2 in the yeast genome using the CRISPR-Cas9 system The budding yeast S. cerevisiae can reproduce sexually or asexually, depending on environmental conditions. In favourable conditions, where nutrient sources are readily available, yeast reproduces asexually by budding, a daughter cell simply buds out from the parent cell. This generates daughter cells that are genetic clones of the parental cells since these cells are 32 only undergoing mitosis. When nutrient sources are scarce or unavailable, yeast switches to sexual reproduction, mating with other yeast cells of a different mating type and sporulating. In order to test phenotypes that are associated with sporulation and meiosis and to yield a strain that expresses PLD1 and PLD2 in levels that are similar to physiological conditions, the optimized phospholipase D genes were integrated into the yeast genome. The CRISPR-Cas9 genome editing technique was performed following the protocol developed by Generoso et al ., [153] where a single plasmid is used to carry the Cas9 nuclease and the gRNA recognition sequences. Firstly, the Cas9 bearing plasmid was amplified by PCR in three fragments, with primers containing the protospacer sequences (gRNA_HygMX4-FW and gRNA_HygMX4-RV – Table 3), and with primers for amplification of the remaining two fragments (196_pMEC_MX4_fwd, 253_kanC3, 473_MSW_rev, 576_pBR322_2 – Table 3) The protospacer containing primers were chosen according to the CRISPR gRNA Design tool provided by DNA 2.0. Afterwards, the plasmid was assembled using the Gibson Assembly® Master Mix (New England Biolabs) following the conditions provided by the manufacturer. Meanwhile, the PLD1 and PLD2 genes were amplified by PCR, in a total of four reactions per gene. The resulting DNA was then concentrated in order to allow for a higher concentration of donor DNA to be transformed into the yeast, increasing the efficiency of the transformation. The assembled plasmid and each donor gene were transformed into the IR10 yeast strain (Table 2) following the LiAc/ SS carrier DNA/PEG protocol and plated in selection plates containing geneticin (1 % yeast extract (w/v), 1 % peptone (w/v), 2 % glucose (w/v), 2 % agar (w/v) and 200 g/ml of geneticin), to allow for the selection of transformants carrying the pRCC-K_gRNAHygMX4 plasmid. Cells were grown at 30 C for 2-4 days. Afterwards, cells were replica plated into media containing hygromycin (1 % yeast extract (w/v), 1 % peptone (w/v), 2 % glucose (w/v), 2 % agar (w/v), and 300 g/ml of hygromycin), which allowed for the growth of colonies that did not have the PLD1 or PLD2 genome integration. Colonies that grew in media containing geneticin but did not grow in media containing hygromycin were selected for colony PCR. II.12. E. coli transformation E. coli transformation with the desired plasmids was performed following the heat shock transformation protocol adapted from Inoue et al., [156]. E. coli XL1-blue competent cells were defrosted on ice. Once completely defrosted, 50 µl of competent cells were aliquoted for each transformation, into as many tubes as needed and 1 µl of plasmid DNA was added (approximately 100 33 ng), and cells were incubated on ice for 20 minutes. After the incubation on ice, cells were heatshocked at 42 C for 45 seconds and immediately returned to the ice for an additional 10 minutes. Afterwards, 200 µl of SOC medium was added to the tubes, and cells were allowed to recover in a shaking incubator at 37 C for 1 hour. Cells were plated in LB-Amp selection plates (0,5 % yeast extract (w/v), 1 % peptone (w/v), 1 % sodium chloride (w/v), 2 % agar (w/v) and 100 µg/ml ampicillin) and allowed to grow overnight at 37 C. II.13. Plasmid DNA extraction Plasmid DNA extraction was performed using the NZYMiniprep Kit (NZYTech) by following the provided protocol. For plasmid extraction from E. coli , cells were grown in 5 ml of LB media with appropriate antibiotics (Geneticin or ampicillin) overnight at 37 C with agitation (200 rpm). The following morning, cells were collected by centrifugation at 13000 rpm for 1 minute. The supernatant was discarded, and cell lysis was performed by resuspending the pellet in 250 µl of A1 buffer and vigorously vortexed. Once the pellet was completely dissolved, 250 µl of buffer A2 were added and mixed by gently inverting the tube 6-8 times. Cells were incubated at room temperature for 4 minutes followed by the addition of 300 µl of A3 buffer. The tube was inverted 6-8 times and the lysate was clarified by centrifuging the tube for 10 minutes at 13000 rpm. The supernatant was loaded onto the spin columns provided by the kit and centrifuged for 1 minute at 13000 rpm to allow for the binding of DNA onto the silica column. The flow-through was discarded and the DNA was washed by adding 500 µl of AY buffer was loaded onto the column followed by another 1-minute centrifugation at 13000 rpm to dry. The flow-through was discarded and 600 µl of A4 buffer were added followed by 1-minute centrifugation at 13000 rpm. The silica membrane was dried by re-inserting the column into the tube and centrifuging for 2 minutes at 13000 rpm. The silica column was placed into a new 1,5 ml tube and 50 µl of AE buffer were carefully added to the center of the column and incubated for 1 minute at room temperature in order to elute DNA. The tube was centrifuged for 1 minute at 13000 rpm and the resulting flow-through was quantified using the NanoDrop® ND-1000 system and stored at -20 C for later use. II.14. Yeast transformation The transformation of yeast strains with the desired DNA sequences was performed following two transformation protocols. 34 II.14.1. Electroporation protocol For the expression of PLD1-GFP and PLD2-GFP in yeast, the corresponding plasmid constructs were transformed into the IR01 yeast strain (Table 2) using an electroporation transformation protocol. Transformation using electroporation uses an electrical pulse at an optimized voltage discharged through the cell. The voltage allows for the formation of temporary pores across the plasma membrane. Additionally, it helps increase the membrane potential across the cell. These two conditions allow the charged molecules in DNA to travel across the pores formed throughout the membrane which results in a large number of transfected cells. Firstly, a pre-culture was prepared by growing the IR01 strain (Table 2) in 5 ml of YPD medium overnight at 30 C with the agitation of 200 rpm. The following morning, cell culture was prepared by diluting the pre-culture in 50 ml of YPD medium to an optical density at 640 nm (OD640) of approximately 0.2 and grown until OD640 reached 1.5. Once the cell culture reached the desired optical density, cells were collected by centrifugation at 3500 rpm for 5 minutes at room temperature and washed two times, first with 50 ml of sterile distilled H2O followed by a wash with 25 ml of sterile distilled H2O. The cell pellet was resuspended in 8 ml of sterile distilled H2O, 1 ml of TE 10X (0.1 M Tris-CL and 0.01 M EDTA), and 1 ml of LiAc 1 M and incubated at 30 C for 30 min with the agitation of 200 rpm. After incubation, 250 µl of DTT 1 M was added to the cells and further incubated at 30 C for 1 hour with the agitation of 200 rpm. Following the incubation, 40 ml of ice-cold sterile distilled H2O was added, and cells were collected by centrifugation at 3500 rpm for 5 minutes at 4 C. From this step onwards, cells were always kept on ice. Cells were then washed twice, first with 25 ml of cold sterile distilled H2O and then with 5 ml of cold 1 M sorbitol. The pellet was resuspended in 500 µl of cold 1 M sorbitol. For each transformation, 45 µl of the now competent cells were transferred into as many tubes as needed and 1 µg of plasmid DNA was added into the corresponding tubes. The contents of each tube were transferred into the sterile electroporation cuvettes and electroporated at 1,5 kV, 200 , 25 µF. Immediately after electroporation, 1 ml of sterile distilled water was added to the cuvettes and the contents were transferred back into the tubes. Afterwards, cells were collected by centrifugation at 3500 rpm for 5 minutes and resuspended in 400 µl of sterile distilled water, plated into synthetic complete medium without uracil (SCura) plates (2 % glucose (w/v), 2 % agar (w/v), 1850 mg/L of Kaiser SC double dropout -His - 35 Ura (FORMEDIUM), 6,7 g/L of yeast nitrogen base w/o amino acids (BD Difco™) and 76 mg/L of histidine) and allowed to grow at 30 C for 2-4 days. II.14.2. Lithium acetate/single-stranded carrier DNA/PEG protocol For the integration of PLD1 and PLD2 in the yeast genome transformation was performed following the LiAc/ SS-DNA/PEG protocol, adapted from Gietz et al., [157]. This is a high-efficiency version of the yeast transformation method using the Lithium acetate /single-stranded carrier DNA/PEG method. Firstly, a pre-culture was prepared by growing the S. cerevisiae IR53 strain (Table 2) in 5 ml of YPD medium overnight at 30 C with the agitation of 200 rpm. The following morning, a cell culture was prepared by diluting the pre-culture in 50 ml of YPD medium to an optical density at 640 nm (OD640) of approximately 0.4 and grown until OD640 reached 1.5. Once the cell culture reached the desired optical density, cells were harvested by centrifugation at 3500 rpm for 3 minutes and washed two times in 25 ml of sterile distilled H2O. After washing, cells were resuspended in 1 ml of 100 mM LiAc, and the suspension was transferred into a 1,5 ml microcentrifuge tube. Cells were centrifuged at 13000 rpm for 15 seconds and LiAc was removed. The cell pellet was resuspended by adding 400 µl of 100 mM LiAc to a final volume of 500 µl and vortexed until the pellet was fully mixed. Afterwards, 50 µl of cell suspension was added into as many tubes as needed and centrifuged and the LiAc was removed. Following the thorough removal of remaining LiAc, the reagents for the transformation mix were added to each tube, in order: 240 µl of PEG 50 % (w/v); 36 µl of LiAc 1 M; 25 µl of previously boiled salmon sperm DNA 2 mg/ml; 40 µl of sterile distilled H2O and 10 µl of PCR product or 50 µl of sterile distilled H2O for the negative control. Tubes were vortexed until the cell pellet was completely dissolved and incubated at 30 C for 30 minutes followed by incubation at 42 C for 25 minutes. After incubation at 42 C, tubes were centrifuged at 8000 rpm for 30 seconds and the transformation mix was completely removed. Afterwards, 1 ml of sterile distilled H2O was added to the cell pellet and vortexed to uniformly resuspend the pellet. Cells were plated into YPD medium and allowed to grow at 30 C for 2-4 days. For transformations that required antibiotic gene selection, cells were transferred into glass tubes with 1 ml of YPD and incubated for 3 hours at 30 C to allow for the good expression of the antibiotic resistance gene. 36 II.15. Growth assays Cells from strains IR23, IR71, IR74, IR78, IR77 (Table 2) were grown overnight in YPD or SC-ura medium at 30 C with the agitation of 200 rpm. The following morning, cells were harvested by centrifugation at 3000 rpm for 5 minutes and washed three times with sterile distilled water. After the final wash, cells were resuspended in 10 ml of sterile water and diluted to an OD640 = 1 in 1 ml of water, and serial dilutions to 10-4 were prepared for each strain. In a laminar flow chamber 3 µl drops of each dilution, for every strain, were plated in SC-URA, SC-ura supplemented with 0.4 % (v/v) of ethanol and SC-URA + 2.5 g/ml C16:PAF, SC-ura + 5 g/ml C16:PAF, and SC-ura + 7.5 g/ml C16:PAF. Cells were grown at 30 C for 2 days. II.16. Imaging of phospholipase D activity For evaluating PLD activity a newly developed method by the Baskin Lab at Cornell was followed. This method, named IMPACT (Imaging Phospholipase D Activity with Clickable Alcohols via Transphosphatidylation) allows us to image phospholipase D activity through a click chemistry reaction. The method is based on the promiscuity of PLD enzymes, which, in addition to using water for phospholipid hydrolysis, can also accept a variety of primary alcohols in a transphosphatidylation reaction. By tagging the resultant lipids with fluorescent reporters via click chemistry we end up with fluorescent lipids that act as reporters of PLD activity. Firstly, two pre-cultures were prepared by growing IR01, IR04, IR71 and IR74 S. cerevisiae strains (Table 2) in 5 ml of YPD medium overnight at 30 C with the agitation of 200 rpm. The following morning, cell cultures were prepared by diluting the precultures in 50 ml of YPD medium to an optical density at 640 nm (OD640) of approximately 0.2 and grown until OD640 reached 3. Once the cell culture reached the desired optical density, cells were harvested by centrifugation at 3500 rpm for 3 minutes and resuspended in 1 ml of YPD medium supplemented with 10 mM of 5-hexyn-1-ol (hexynol for short) and incubated for 1 hour at 30 C with the agitation of 200 rpm. After incubation with the primary alcohol, cells were collected by centrifugation at 10,000 x g for 1 minute and washed three times in 0.1 M potassium phosphate buffer pH 6.5 (0.1 M K2HPO4, 0.1 M KH2PO4). Afterwards, cells were fixed by resuspension of the pellet in 680 µl of potassium phosphate buffer containing 3.7 % paraformaldehyde (v/v) followed by an incubation of 45 minutes at room temperature with gentle shaking. Meanwhile, click master mix was prepared by combining, in the following order, 100 mM Tris pH 8.0, 1 mM CuSO4 (from a freshly prepared 20 mM stock), 40 µM AZDye 594 Azide (Click Chemistry Tools), and 50 mM of sodium ascorbate (from a 37 freshly prepared 500 mM stock). At the end of the incubation period, fixed cells were washed three times with 0.1 M potassium phosphate buffer and 1 ml of click master mix was added to each tube. Cells were incubated for 30 minutes at 30 C for fluorescent tagging. The labelled cells were then washed three times with 0.1 M potassium phosphate buffer and stored in 100 µl of 0.1 M potassium phosphate buffer at 4 C until imaging. II.17. Fluorescent and confocal microscopy of yeast cells For imaging of yeast cells expressing PLD1-GFP and PLD2-GFP , cells were grown in SC-ura plates at 30 C overnight. The following day, biomass was collected from the plates, cells were resuspended in 1 ml of sterile ultra-pure water and pelleted by centrifugation at 13,000 rpm for 30 seconds. Afterwards, 5 µl of cells were aspirated from the pellet, mounted onto a coverslip, and imaged immediately after using the Leica DM5000B epifluorescent microscope. Images were acquired with a Leica DFC 350FX R2 digital camera using the LAS AF V2.6.0 software. For imaging yeast cells after IMPACT, the labelled cells were pelleted by centrifugation and potassium phosphate buffer was removed. Cells were then stained with DAPI nuclear stain by incubating the cells for 60 seconds at room temperature with 0.5µg/ml of DAPI in PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4). Cells were washed with PBS and pelleted by centrifugation. Afterwards, 5 µl of cells were aspirated from the pellet, mounted onto a coverslip, and imaged immediately after using the Olympus LPS Confocal FV1000 microscope. 38 Chapter III – Results and discussion 39 Figure 7. DNA agarose gel of the PCR amplification of KanMX cassette from strain IR04. M represents the molecular weight marker (Thermo ScientificTM GeneRulerTM 1 kb DNA Ladder), Crepresents the negative control for this PCR reaction and KanMX shows the amplified KanMX cassette (2165 bp) with primers primerA-spo14-del and primerD-spo14-del. III. Results and discussion III.1. Construction of SPO14 deletion strains One of the aims of this work was to use the yeast model as a heterologous system to study the heterologous expression of the mammalian PLD1 and PLD2 genes. For this purpose, S. cerevisiae strains deleted in SPO14, the yeast ortholog of mammalian PLD1 and PLD2, were developed. In order to study phenotypes associated with the deletion of SPO14 and see if the expression of the mammalian genes could complement any of the phenotypes, construction of SPO14 deletion strains was carried out. Briefly, an antibiotic resistance cassette is amplified by PCR with primers that contain several base pairs of homology to the upstream and downstream regions of the ORF of the gene of interest. When transformed into the desired strain, the amplified cassette will be integrated by homologous recombination into the desired locus, replacing the desired gene. To delete the SPO14 gene from the IR07 yeast strain (Table 2), genomic DNA was extracted from strain IR04 (Table 2) and the KanMX antibiotic resistance cassette was amplified via PCR using primers primerA-spo14-del and primerDspo14-del (Table 3). The size of the amplified cassette was confirmed by DNA gel electrophoresis using a 1 % TAE agarose gel, and images were acquired using a UV transilluminator (Genosmart, VWR) - Figure 7. 46 A B Figure 15. Analysis of PLD1-GFP (A) and PLD2-GFP (B) expression and localization by fluorescence microscopy. Yeast ∆ spo14 cells carrying p416_GPD-coPLD1-GFP or p416_GPD-coPLD2-GFP plasmids were grown on selective SC-ura plates. Biomass was collected and diluted in water. A volume of 5 µL of cells was instantly visualized using Leica DM5000B epifluorescent microscope with appropriate filters. 47 In mammals, PLD1 and PLD2 expression can be found in different locations of the intracellular environment. PLD1 is usually found at intracellular compartments such as the Golgi complex, the endosome, the lysosome and the endoplasmic reticulum and at the plasma membrane, and exocytotic vesicles, whilst PLD2 localizes mainly in the vicinity of the plasma membrane [60] and in the Golgi complex [61,62]. In yeast, Spo14 is usually found throughout the cytoplasm and relocates to the prospore membrane when yeast cells undergo meiosis [128,132]. In this work, fluorescent microscopy of the yeast strains overexpressing the mammalian codon-optimized PLD1 or PLD2 seems to also reveal a difference in the intracellular localization of PLD1-GFP (Figure 15-A) and PLD2-GFP (Figure 15B). Both PLD1-GFP and PLD2-GFP show expression at the plasma membrane, replicating what has been reported to be their location in mammalian organisms [64,158]. PLD1-GFP shows strong fluorescence in the vacuole. Vacuoles, like lysosomes, are the cell primary organ for digestion and degradation of cell components such as proteins and lipids. Both organelles are similarly involved in autophagy, an important mechanism that maintains cell homeostasis by inducing clearing of damaged cell organelles and toxic products, as well as being an energy retrieval mechanism used when cells experience glucose starvation [159]. Importantly, PLD1 appears to have a regulatory role in autophagy, specifically in the clearance of protein aggregates [160] and in the promotion of cancer cell death [161]. Additionally, both PLD-GFP fusions seem to be strongly expressed in what appear to be vesicles throughout the cell, which could potentially be endosomes. This again appears to be mimicking the endosomal localization reported for PLD1 and PLD2 in mammals [61–64]. This is of course speculative and further co-localization studies with organelle-specific stains will be necessary for a clear description of the intracellular localization of overexpressed PLD1-GFP and PLD2-GFP . III.4. Genomic integration of codon-optimized PLD1 and PLD2 in the SPO14 locus of a mutant strain Heterologous expression of a gene of interest via a plasmid construct is a powerful tool for genetic engineering in yeast. However, despite its easy applicability and quick protocol, plasmid gene expression lacks stability as a plasmid can easily be lost if the antibiotic or auxotrophic selection is removed. A chromosomally integrated gene is not subject to this instability. Additionally, genomic integration allows for stable expression and long-term maintenance of the gene of interest in the transformed cells and their progeny. In order to integrate codon-optimized mammalian PLD1 and PLD2 in the yeast genome, the CRISPR Cas9 editing tool was used. For this, a technique developed by 48 Figure 16. DNA agarose gel of the PCR amplification of the pRCC-K plasmid in three fragments. M represents the molecular weight marker (Thermo ScientificTM GeneRulerTM 1 kb DNA Ladder), Crepresents the negative control for PCR amplification of each fragment. F3 shows the amplification of fragment 3 of the plasmid with primers 196_pMEC_MX4_fwd and gRNA_HygMX4-RV (2068 bp). F2 shows the amplification of fragment 2 of the plasmid with primers 473_MSW_rev and 576_pBR322_2 (3020 bp). F1 shows the amplification of fragment one of the plasmid with primers gRNA_HygMX4-FW and 253_KanC3 (5315 bp). Generoso et al ., [153] was used, whereby a single plasmid (pRCC-K) carries the Cas9 DNA endonuclease and the guide RNA (gRNA) sequence that guides the enzyme to its intended cutting site in the genome. The pRCC-K plasmid was amplified in three parts in order to insert the gRNA sequence needed to direct the Cas9 endonuclease to the HygMX cassette used to delete SPO14 : the first fragment was amplified with primers gRNA_HygMX4-FW and 253_KanC3 (Table 3), the second fragment was amplified with primers 473_MSW_rev and 576_pBR322_2 (Table 3), and the third fragment was amplified with primers 196_pMEC_MX4_fwd and gRNA_HygMX4-RV (Table 3) - Figure 16. Following amplification, all three fragments of the pRCC-K plasmid were subjected to enzymatic digestion with DpnI to get rid of any remaining template plasmid in the resulting PCR products. After digestion, the Gibson assembly technique was used to ligate all three fragments, generating pRCCK_gRNA-HygMX. Chemically competent E.coli cells were transformed with the newly developed plasmid. Cells were grown overnight at 37 C on selective media containing ampicillin (100 µg/ml). Subsequently, plasmid DNA was extracted via Miniprep. Additionally, PLD1 and PLD2 were amplified by PCR from hPLD1_pUC57 and mPLD2_pCCI-4K respectively, with primers Long-up-SPO14-hPLD1-FW and Long-down-SPO14-hPLD1-RV for PLD1 and Long-up-SPO14-mPLD2-FW and Long-down-SPO14- 49 mPLD2-RV (Table 3) for PLD2 - Figure 17. This amplification results in a DNA product containing PLD1 or PLD2 flanked on each side by a 50 base pair sequence homologous to the genomic regions before and after the SPO14 locus, allowing for the integration of the genes through homologous recombination after cleavage by the Cas9 enzyme. These products will henceforth be mentioned as donors. After amplification of PLD1 and PLD2 , both pRCC-K_gRNA-HygMX and donor PLD1 or PLD2 were transformed into the SPO14 deletion strain IR10 (Table 2). The resulting transformants were plated on selective media containing geneticin (200 g/ml) and allowed to grow at 30 C until isolated colonies were visible. Once isolated colonies were visible, cells were replica plated into selective plates containing hygromycin (300 g/ml) and geneticin (200 g/ml). Colonies that did not grow after replica plating were selected from the original plates containing only geneticin (200 g/ml) for colony PCR. The colony PCR reaction was carried out using primers screening-down-SPO14-rv and screening-hPLD1fw for PLD1 and screening-down-SPO14-rv and screening-mPLD2-fw for PLD2 . The resulting samples were loaded onto a 1 % TAE agarose gel and images were acquired using a UV transilluminator (Genosmart, VWR) – Figure 13. All tested colonies were confirmed to correctly harbour the respective construct by colony PCR. Figure 17. DNA agarose gel of the PCR amplification of codon optimized PLD1 and PLD2 from hPLD1_pUC57 and mPLD2_PCCI-4K, respectively. M represents the molecular weight marker (Thermo ScientificTM GeneRulerTM 1 kb DNA Ladder), Crepresents the negative control for PCR amplification of PLD1 and PLD2 respectively. PLD1 and PLD2 show the amplified PLD1 (3423 bp) and PLD2 (3033 bp) genes with primers Long-up-SPO14-hPLD1-FW plus Long-down-SPO14-hPLD1-RV and Long-up-SPO14-mPLD2-FW plus Long-down-SPO14-mPLD2-RV for PLD2, respectively. 50 Figure 18. DNA agarose gel of the colony PCR for genomic integration of PLD1 and PLD2 in the yeast genome. M represents the molecular weight marker (Thermo ScientificTM GeneRulerTM 1 kb DNA Ladder). PLD1 (lanes 1-2 and 6-7) shows the amplification of a part of the PLD1 gene from the yeast genome (2324 bp) from four different colonies. PLD2 (lanes 3-5) shows the amplification of a part of the PLD2 gene from the yeast genome from three different colonies. Crepresents the negative controls of the PCR reactions for the amplification of PLD1 or PLD2 , respectively. Two positive colonies were found for the correct integration of PLD1 in the SPO14 locus (Figure 18colonies 1 and 2), however, no positive transformants were found for the integration of PLD2 . Integration of PLD2 in the yeast genome will be attempted again and the sporulation and meiosis efficiency of these strains stably expression the mammalian genes will be evaluated. III.5. Imaging of mammalian PLD1 and PLD2 activity in S. cerevisiae The IMPACT (Imaging Phospholipase D Activity with Clickable Alcohols via Transphosphatidylation) protocol allows for imaging of phospholipase D activity with clickable alcohols via transphosphatydilation. This method is based on the promiscuity of PLD enzymes, which, in addition to using water for phospholipid hydrolysis, can also accept a variety of primary alcohols in a transphosphatidylation reaction. Tagging the resultant lipids with fluorescent reporters via click chemistry reactions results in fluorescent lipids that act as reporters of PLD activity. In order to image and compare phospholipase D activity in the different constructed strains, the IMPACT protocol was applied. Briefly, a wild type strain (IR17), a SPO14 deletion strain (IR01) and both strains expressing PLD1-GFP or PLD2-GFP (IR71 and IR74, respectively) (Table 2) were subject to IMPACT labelling and 51 stored. Immediately before imaging, labelled cells were treated with DAPI DNA stain and imaged by confocal microscopy - Figure 18. A B C D Figure 19. Analysis of PLD activity by confocal microscopy. Yeast wild type (A), ∆spo14 (B) and ∆spo14 cells carrying p416_GPD-coPLD1-GFP (C) or p416_GPD-coPLD2-GFP (D) plasmids were labelled by IMPACT protocol. Immediately prior to confocal microscopy, cells were stained with DAPI. A volume of 5 µL of cells for each strain was instantly visualized using Olympus LPS Confocal FV1000 microscope with appropriate filters. AZDye 594 Azide 52 The Alexa Fluor derived AZDYE 594 azide, a red fluorescent marker, was used to report on PLD activity whilst the blue stain DAPI was used to fluorescently tag the nucleus. In the wild type strain (Figure 19-A), basal levels of PLD activity in red can be observed. PLD activity related fluorescence can be seen throughout the cell, with some cells showing high IMPACT-derived fluorescence in certain regions of the intracellular space (Figure 19-A, marked by white arrows). This signal is likely to be ERassociated given its proximity to the nucleus and the previous results using IMPACT to study active PLD location inside the cell [162,163]. Overall, for this strain, the level of PLD-activity derived fluorescence is according to what would be expected for wild type cells. It would be interesting, however, to examine whether this activity could be altered by exposure to known PLD1 and PLD2 stimulants and inhibitors in mammal cells. In the SPO14 deletion strain (Figure19-B), little to no PLD-activity derived fluorescence can be observed. Given that SPO14 is the only reported source of canonical phospholipase D activity in yeast, this would be expected. Additionally, this result is a positive indicator of the correct construction of the SPO14 deletion strain used in this assay (IR01 - Table 2). As for the PLD1 (Figure 19-C) and PLD2 (Figure 19-D) expressing strains, functional expression of the mammalian PLDs through a plasmid vector results in higher PLD activity in yeast in both strains. This is expected, as increasing the copy number of a gene, in this case, compared to the wild type strain, yields higher expression and consequently activity of the said gene. This assay report directly on PLD-derived PA production. The fact that the IMPACT protocol resulted in such a clear difference in strains harbouring heterologous PLD1 and PLD2 reveals the correct performance of these enzymes when expressed in yeast. This is a good indicator of the validity of these tools for future projects. This experiment was performed with the constructed strains harbouring the PLD1 or PLD2 carrying plasmids, which result in overexpression of both genes due to the nature of the expression method used. Despite resulting in expression levels and consequently activity levels that are not necessarily similar to what is to be expected for the expression of these genes in basal conditions, the plasmid constructs harbouring the mammalian PLD1 and PLD2 worked well in this assay. Using these constructs, resulted in a clear difference in PLD activity related fluorescence between the wild type, the SPO14 deletion strain and the strains harbouring the constructs. This difference between strains, allows for clear separation of the phenotypes which not only proves the strength of the developed yeast-based tools, but also confirms the correct optimization and application of this assay. Ideally, this experiment should also be performed using the strains expressing PLD1 or PLD2 via genomic integration, to elucidate possible differences in expression levels at naturally occurring, basal conditions. 53 III.6. Growth assays: Evaluation of C16:PAF sensitivity A previous study by Kennedy et al ., [124] reported that the absence of the SPO14 gene renders yeast cells more sensitive to C16:PAF, a glycerolipid with a function in platelet aggregation during inflammation response. This lipid has previously been associated with AD in different molecular contexts, and its metabolism was found to be disrupted in the posterior/entorhinal cortex of the brains of patients with AD. In mice, a similar disruption was found following a pathogenic increase of the cortical ratio between Aß42 and Aß40. Acute elevation of C16:PAF was also reported to be a signal for tau hyperphosphorylation [164,165]. Given the previously mentioned importance of C16:PAF for AD and the study that reported a link between PLD1 and C16:PAF [124], we set to perform a growth assay to determine if the expression of the mammalian PLD1 or PLD2 could complement the growth phenotype of a SPO14 deletion mutant. Evaluation of growth phenotypes by growth assays is a quick, simple and easily scalable tool to study the sensitivity of desired strains to relevant molecules and compounds or to unravel possible gene interactions. A wild type yeast strain (IR78), a wild type yeast strain carrying the empty p416-GDP vector (IR77), a SPO14 deletion strain (IR23) and the SPO14 deletion strains carrying p416_GPD-coPLD1-GFP (IR71) or p416_GPD-coPLD2-GFP (IR74) (Table 2) were grown, in serial dilutions, on SC-ura media containing different concentrations of C16:PAF – Figure 19. Figure 20. Growth phenotypes of serial dilutions to 10-4 of wild type, wild type + vector, ∆spo14 and ∆spo14 cells carrying p416_GPD-coPLD1-GFP or p416_GPD-coPLD2-GFP. Cells are plated in SC-ura media containing different dilutions of C16:PAF (2.5 g/ml, 5 g/ml or 7.5  g/ml) and 0.4 % ethanol as a control for the C16:PAF vehicle. The different concentrations of the lipid were chosen as per the previously mentioned paper were the C16:PAF sensitivity phenotype was reported [124]. Experiments were performed in triplicate. 54 The growth phenotype of a wild type strain, the SPO14 deletion mutant and the SPO14 deletion strains expressing the plasmid constructs harbouring the codon-optimized PLD1 or PLD2 was evaluated when exposed to increasing concentrations (2.5 g/ml, 5 g/ml or 7.5 g/ml) of C16:PAF -Figure 19. Kennedy and co-workers [124] described that Δ spo14 cells were sensitive to C16:PAF in concentrations as low as 2.5 g/ml (in YPD media) and 5 g/ml (in SD-Leu media). We observed that cells lacking SPO14 do not display a significant difference in sensitivity to C16:PAF when compared with the wild type cells and the wild type cells harbouring the empty vector (Figure 19, first three rows of panels 2 through 4). This is in contrast with what has been described by Kennedy, et al ., [124]. However, it is important to note that the backgrounds of the SPO14 deletion strain used in the Kennedy et al ., and in this assay are different (SC288c and W303, respectively). This factor may influence the behaviour of the strains in the growth assay. All other relevant growth conditions were maintained, including the carbon source (2 % glucose) as well as the incubation time and temperature (2 days at 30 °C). Although we could not replicate this phenotype, a difference between the growth of the deletions strains harbouring p416_GPD-coPLD1-GFP or p416_GPD-coPLD2-GFP could be observed, with the first appearing more sensitive to the toxic lipid compound. The apparent higher resistance of cells overexpressing mammalian PLD2 is an interesting finding, given the relationship between C16:PAF and amyloid-beta toxicity [155,156], since PLD2 has also been strongly linked to amyloid-beta toxicity in the context of AD [122]. Ideally, this growth assay should be repeated with any other available SPO14 deletion strains given the discrepancy between these results and what has been published regarding the sensitivity of SPO14 deletion mutants to C16:PAF. Additionally, further controls should be included, such as the SPO14 deletion strain carrying the empty plasmid vector. Given the preferential affinity of PLD to primary alcohols, the dilution of the lipid molecule in different solvents should also be tested to exclude the possibility that any of the visible phenotypes could be due to a decrease in PLD-derived PA availability instead of the C16:PAF itself. Another aspect to consider is the mode of expression of the mammalian genes. In this case, despite the low copy number nature of the chosen vector (p416-GPD), overexpression of PLD1-GFP and PLD2-GFP will always occur. In yeast, plasmid burden has been characterized and shown to result in defects for the growth phenotype in most cases [166]. Therefore, and ideally, the C16:PAF sensitivity growth assay should be repeated using strains with genomic integration of PLD1 and PLD2 . 55 Chapter IV – Final remarks and future perspectives 62 isoenzymes. EMBO Journal . 18 (21), 5911–5921. [53] Bowling, F.Z., Salazar, C.M., Bell, J.A., Huq, T.S., Frohman, M.A., and Airola, M. V. (2020) Crystal structure of human PLD1 provides insight into activation by PI(4,5)P2 and RhoA. Nature Chemical Biology . 16 (4), 400–407. [54] Sung, T.C., Zhang, Y., Morris, A.J., and Frohman, M.A. (1999) Structural analysis of human phospholipase D1. Journal of Biological Chemistry . 274 (6), 3659–3666. [55] Sung, T.C., Roper, R.L., Zhang, Y., Rudge, S.A., Temel, R., Hammond, S.M., et al. (1997) Mutagenesis of phospholipase D defines a superfamily including a trans-Golgi viral protein required for poxvirus pathogenicity. EMBO Journal . 16 (15), 4519–4530. [56] Sugars, J.M., Cellek, S., Manifava, M., Coadwell, J., and Ktistakis, N.T. (2002) Hierarchy of membranetargeting signals of phospholipase D1 involving lipid modification of a pleckstrin homology domain. The Journal of Biological Chemistry . 277 (32), 29152–29161. [57] Sung, T.C., Altshuller, Y.M., Morris, A.J., and Frohman, M.A. (1999) Molecular analysis of mammalian phospholipase D2. Journal of Biological Chemistry . 274 (1), 494–502. [58] Metrick, C.M., Peterson, E.A., Santoro, J.C., Enyedy, I.J., Murugan, P., Chen, T.Y., et al. (2020) Human PLD structures enable drug design and characterization of isoenzyme selectivity. Nature Chemical Biology . 16 (4), 391–399. [59] Sehnal, D., Bittrich, S., Deshpande, M., Svobodová, R., Berka, K., Bazgier, V., et al. (2021) Mol∗Viewer: Modern web app for 3D visualization and analysis of large biomolecular structures. Nucleic Acids Research . 49 (W1), W431–W437. [60] Liscovitch, M., Czarny, M., Fiucci, G., and Tang, X. (2000) Phospholipase D: Molecular and cell biology of a novel gene family. Biochemical Journal . 345 (3), 401–415. [61] Jenkins, G.M. and Frohman, M.A. (2005) Phospholipase D: a lipid centric review. CMLS Cellular and Molecular Life Sciences . (62), 2305–2316. [62] Freyberg, Z., Bourgoin, S., and Shields, D. (2002) Phospholipase D2 is localized to the rims of the Golgi apparatus in mammalian cells. Molecular Biology of the Cell . 13 (11), 3930–3942. [63] Denmat-Ouisse, L.A., Phebidias, C., Honkavaara, P., Robin, P., Geny, B., Min, D.S., et al. (2001) Regulation of Constitutive Protein Transit by Phospholipase D in HT29-cl19A Cells. Journal of Biological Chemistry . 276 (52), 48840–48846. [64] Du, G., Huang, P., Liang, B.T., and Frohman, M.A. (2004) Phospholipase D2 Localizes to the Plasma Membrane and Regulates Angiotensin II Receptor Endocytosis. Molecular Biology of the Cell . 15 (3), 1024–1030. [65] Peng, X. and Frohman, M.A. (2012) Mammalian phospholipase D physiological and pathological roles. Acta Physiologica . 204 (2), 219–226. [66] Brown, F.D., Thompson, N., Saqib, K.M., Clark, J.M., Powner, D., Thompson, N.T., et al. (1998) Phospholipase D1 localises to secretory granules and lysosomes and is plasma-membrane translocated on cellular stimulation. Current Biology . 8 (14), 835–838. [67] Donaldson, J.G. (2009) Phospholipase D in endocytosis and endosomal recycling pathways. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids . 1791 (9), 845–849. [68] Chen, Y.G., Siddhanta, A., Austin, C.D., Hammond, S.M., Sung, T.C., Frohman, M.A., et al. (1997) 63 Phospholipase D stimulates release of nascent secretory vesicles from the trans-Golgi network. Journal of Cell Biology . 138 (3), 495–504. [69] Lee, C.S., Kim, I.S., Park, J.B., Lee, M.N., Lee, H.Y., Suh, P.G., et al. (2006) The phox homology domain of phospholipase D activates dynamin GTPase activity and accelerates EGFR endocytosis. Nature Cell Biology . 8 (5), 477–484. [70] Vitale, N., Caumont, A.S., Chasserot-Golaz, S., Du, G., Wu, S., Sciorra, V.A., et al. (2001) Phospholipase D1: A key factor for the exocytotic machinery in neuroendocrine cells. EMBO Journal . 20 (10), 2424–2434. [71] Vitale, N., Mawet, J., Camonis, J., Regazzi, R., Bader, M.F., and Chasserot-Golaz, S. (2005) The small GTPase RalA controls exocytosis of large dense core secretory granules by interacting with ARF6-dependent phospholipase D1. Journal of Biological Chemistry . 280 (33), 29921–29928. [72] Liu, L., Liao, H., Castle, A., Zhang, J., Casanova, J., Szabo, G., et al. (2005) SCAMP2 interacts with Arf6 and phospholipase D1 and links their function to exocytotic fusion pore formation in PC12 cells. Molecular Biology of the Cell . 16 (10), 4463–4472. [73] Rose, K., Rudge, S.A., Frohman, M.A., Morris, A.J., and Engebrecht, J. (1995) Phospholipase D signaling is essential for meiosis. Proceedings of the National Academy of Sciences of the United States of America . 92 (26), 12151–12155. [74] Choi, W.S., Kim, Y.M., Combs, C., Frohman, M.A., and Beaven, M.A. (2002) Phospholipases D1 and D2 Regulate Different Phases of Exocytosis in Mast Cells. The Journal of Immunology . 168 (11), 5682–5689. [75] Corrotte, M., Chasserot-Golaz, S., Huang, P., Du, G., Ktistakis, N.T., Frohman, M.A., et al. (2006) Dynamics and function of phospholipase D and phosphatidic acid during phagocytosis. Traffic . 7 (3), 365–377. [76] Iyer, S.S., Barton, J.A., Bourgoin, S., and Kusner, D.J. (2004) Phospholipases D1 and D2 Coordinately Regulate Macrophage Phagocytosis. The Journal of Immunology . 173 (4), 2615–2623. [77] Shen, Y., Xu, L., and Foster, D.A. (2001) Role for Phospholipase D in Receptor-Mediated Endocytosis. Molecular and Cellular Biology . 21 (2), 595–602. [78] Pedersen, K.M., Finsen, B., Celis, J.E., and Jensen, N.A. (1998) Expression of a novel murine phospholipase D homolog coincides with late neuronal development in the forebrain. Journal of Biological Chemistry . 273 (47), 31494–31504. [79] Yoshikawa, F., Banno, Y., Otani, Y., Yamaguchi, Y., Nagakura-Takagi, Y., Morita, N., et al. (2010) Phospholipase D family member 4, a transmembrane glycoprotein with no phospholipase D activity, expression in spleen and early postnatal microglia. PLoS ONE . 5 (11), e13932. [80] Choi, S.Y., Huang, P., Jenkins, G.M., Chan, D.C., Schiller, J., and Frohman, M.A. (2006) A common lipid links Mfn-mediated mitochondrial fusion and SNARE-regulated exocytosis. Nature Cell Biology . 8 (11), 1255– 1262. [81] Ota, T., Suzuki, Y., Nishikawa, T., Otsuki, T., Sugiyama, T., Irie, R., et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nature Genetics . 36 (1), 40–45. [82] Gomez-Cambronero, J. and Ganesan, R. (2018) Targeting phospholipase D genetically and pharmacologically for studying leukocyte function. in: Methods Mol. Biol., pp. 297–314. [83] Gavin, A.L., Huang, D., Huber, C., Mårtensson, A., Tardif, V., Skog, P.D., et al. (2018) PLD3 and PLD4 64 are single-stranded acid exonucleases that regulate endosomal nucleic-acid sensing. Nature Immunology . 19 (9), 942–953. [84] Munck, A., Böhm, C., Seibel, N.M., Hosseini, Z.H., and Hampe, W. (2005) Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum. FEBS Journal . 272 (7), 1718–1726. [85] Mukadam, A.S., Breusegem, S.Y., and Seaman, M.N.J. (2018) Analysis of novel endosome-to-Golgi retrieval genes reveals a role for PLD3 in regulating endosomal protein sorting and amyloid precursor protein processing. Cellular and Molecular Life Sciences . 75 (14), 2613–2625. [86] Gonzalez, A.C., Schweizer, M., Jagdmann, S., Bernreuther, C., Reinheckel, T., Saftig, P., et al. (2018) Unconventional Trafficking of Mammalian Phospholipase D3 to Lysosomes. Cell Reports . 22 (4), 1040– 1053. [87] Cruchaga, C., Karch, C.M., Jin, S.C., Benitez, B.A., Cai, Y., Guerreiro, R., et al. (2014) Rare coding variants in the phospholipase D3 gene confer risk for Alzheimer’s disease. Nature . 505 (7484), 550–554. [88] Otani, Y., Yamaguchi, Y., Sato, Y., Furuichi, T., Ikenaka, K., Kitani, H., et al. (2011) PLD4 is involved in phagocytosis of microglia: Expression and localization changes of PLD4 are correlated with activation state of microglia. PLoS ONE . 6 (11), e27544. [89] Gao, L., Zhou, Y., Zhou, S.X., Yu, X.J., Xu, J.M., Zuo, L., et al. (2017) PLD4 promotes M1 macrophages to perform antitumor effects in colon cancer cells. Oncology Reports . 37 (1), 408–416. [90] Han, Y. and Zhou, L. (2020) MiRNA-4665-3p Regulates Expression of PLD5 in Thyroid Cancer Patients and Predicts Death. Journal of Biomaterials and Tissue Engineering . 9 (7), 871–880. [91] Huang, H., Gao, Q., Peng, X., Choi, S.Y., Sarma, K., Ren, H., et al. (2011) PiRNA-Associated Germline Nuage Formation and Spermatogenesis Require MitoPLD Profusogenic Mitochondrial-Surface Lipid Signaling. Developmental Cell . 20 (3), 376–387. [92] Watanabe, T., Chuma, S., Yamamoto, Y., Kuramochi-Miyagawa, S., Totoki, Y., Toyoda, A., et al. (2011) MITOPLD Is a Mitochondrial Protein Essential for Nuage Formation and piRNA Biogenesis in the Mouse Germline. Developmental Cell . 20 (3), 364–375. [93] TOOKEY, H.L. and BALLS, A.K. (1956) Plant phospholipase D. I. Studies on cottonseed and cabbage phospholipase D. The Journal of Biological Chemistry . 218 (1), 213–224. [94] Cockcroft, S., Thomas, G.M.H., Fensome, A., Geny, B., Cunningham, E., Gout, I., et al. (1994) Phospholipase D: A downstream effector of ARF in granulocytes. Science . 263 (5146), 523–526. [95] Malcolm, K.C., Ross, A.H., Qiut, R.G., Symonst, M., and Exton, J.H. (1994) Activation of rat liver phospholipase D by the small GTP-binding protein RhoA. Journal of Biological Chemistry . 269 (42), 25951–25954. [96] Kaszkin, M., Seidler, L., Kast, R., and Kinzel, V. (1992) Epidermal-growth-factor-induced production of phosphatidylalcohols by HeLa cells and A431 cells through activation of phospholipase D. Biochemical Journal . 287 (1), 51–57. [97] Rydzewska, G. and Morisset, J. (1995) Activation of pancreatic acinar cell phospholipase d by epidermal, insulin-like, and basic fibroblast growth factors involves tyrosine kinase. Pancreas . 10 (1), 59–65. [98] Dean, N.M. and Boynton, A.L. (1995) EGF‐Induced increase in diacylglycerol, choline release, and DNA synthesis is extracellular calcium dependent. Journal of Cellular Physiology . 164 (3), 449–458. 65 [99] Brown, H.A., Gutowski, S., Moomaw, C.R., Slaughter, C., and Sternwels, P.C. (1993) ADP-ribosylation factor, a small GTP-dependent regulatory protein, stimulates phospholipase D activity. Cell . 75 (6), 1137–1144. [100] Brown, H.A., Gutowski, S., Kahn, R.A., and Sternweis, P.C. (1995) Partial purification and characterization of Arf-sensitive phospholipase D from porcine brain. Journal of Biological Chemistry . 270 (25), 14935–14943. [101] Cockcroft, S., Way, G., O’Luanaigh, N., Pardo, R., Sarri, E., and Fensome, A. (2002) Signalling role for ARF and phospholipase D in mast cell exocytosis stimulated by crosslinking of the high affinity FcεR1 receptor. Molecular Immunology . 38 (16–18), 1277–1282. [102] Rudge, S.A. and Wakelam, M.J.O. (2009) Inter-regulatory dynamics of phospholipase D and the actin cytoskeleton. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids . 1791 (9), 856–861. [103] Hammond, S.M., Jenco, J.M., Nakashima, S., Cadwallader, K., Gu, Q.M., Cook, S., et al. (1997) Characterization of two alternately spliced forms of phospholipase D1: Activation of the purified enzymes by phosphatidylinositol 4,5-bisphosphate, ADP-ribosylation factor, and RHO family monomeric GTP-binding proteins and protein kinase C-α. Journal of Biological Chemistry . 272 (6), 3860–3868. [104] Min, D.S., Park, S.K., and Exton, J.H. (1998) Characterization of a rat brain phospholipase D isozyme. Journal of Biological Chemistry . 273 (12), 7044–7051. [105] Park, S.K., Min, D.S., and Exton, J.H. (1998) Definition of the protein kinase C interaction site of phospholipase D. Biochemical and Biophysical Research Communications . 244 (2), 364–367. [106] Yamazaki, M., Zhang, Y., Watanabe, H., Yokozeki, T., Ohno, S., Kaibuchi, K., et al. (1999) Interaction of the small G protein RhoA with the C terminus of human phospholipase D1. Journal of Biological Chemistry . 274 (10), 6035–6038. [107] Exton, J.H. (2002) Regulation of phospholipase D. FEBS Letters . 531 (1), 58–61. [108] Bowman, E.P., Uhlinger, D.J., and Lambeth, J.D. (1993) Neutrophil phospholipase D is activated by a membrane-associated Rho family small molecular weight GTP-binding protein. Journal of Biological Chemistry . 268 (29), 21509–21512. [109] Sciorra, V.A., Rudge, S.A., Wang, J., McLaughlin, S., Engebrecht, J.A., and Morris, A.J. (2002) Dual role for phosphoinositides in regulation of yeast and mammalian phospholipase D enzymes. Journal of Cell Biology . 159 (6), 1039–1049. [110] Uchida, N., Okamura, S.I., and Kuwano, H. (1999) Phospholipase D activity in human gastric carcinoma. Anticancer Research . 19 (1 B), 671–675. [111] Uchida, N., Okamura, S.I., Nagamachi, Y., and Yamashita, S. (1997) Increased phospholipase D activity in human breast cancer. Journal of Cancer Research and Clinical Oncology . 123 (5), 280–285. [112] Noh, D.Y., Ahn, S.J., Lee, R.A., Park, I.A., Kim, J.H., Suh, P.G., et al. (2000) Overexpression of phospholipase D1 in human breast cancer tissues. Cancer Letters . 161 (2), 207–214. [113] Yamada, Y., Hamajima, N., Kato, T., Iwata, H., Yamamura, Y., Shinoda, M., et al. (2003) Association of a polymorphism of the phospholipase D2 gene with the prevalence of colorectal cancer. Journal of Molecular Medicine . 81 (2), 126–131. [114] Zhao, Y., Ehara, H., Akao, Y., Shamoto, M., Nakagawa, Y., Banno, Y., et al. (2000) Increased activity and intranuclear expression of phospholipase D2 in human renal cancer. Biochemical and Biophysical Research Communications . 278 (1), 140–143. 66 [115] Chen, Q., Hongu, T., Sato, T., Zhang, Y., Ali, W., Cavallo, J.A., et al. (2012) Key roles for the lipid signaling enzyme phospholipase D1 in the tumor microenvironment during tumor angiogenesis and metastasis. Science Signaling . 5 (249), ra79. [116] Huang, P. and Frohman, M.A. (2007) The potential for phospholipase D as a new therapeutic target. Expert Opinion on Therapeutic Targets . 11 (5), 707–716. [117] Tsukahara, T., Tsukahara, R., Fujiwara, Y., Yue, J., Cheng, Y., Guo, H., et al. (2010) Phospholipase D2dependent inhibition of the nuclear hormone receptor PPARγ by cyclic phosphatidic acid. Molecular Cell . 39 (3), 421–432. [118] Hong, K.W., Jin, H.S., Lim, J.E., Cho, Y.S., Go, M.J., Jung, J., et al. (2010) Non-synonymous singlenucleotide polymorphisms associated with blood pressure and hypertension. Journal of Human Hypertension . 24 (11), 763–774. [119] Peng, J.H.F. and Rhodes, P.G. (2000) Developmental expression of phospholipase D2 mRNA in rat brain. International Journal of Developmental Neuroscience . 18 (6), 585–589. [120] Zhao, D., Berse, B., Holler, T., Cermak, J.M., and Blusztajn, J.K. (1998) Developmental changes in phospholipase D activity and mRNA levels in rat brain. Developmental Brain Research . 109 (2), 121–127. [121] Cai, D., Zhong, M., Wang, R., Netzer, W.J., Shields, D., Zheng, H., et al. (2006) Phospholipase D1 corrects impaired βAPP trafficking and neurite outgrowth in familial Alzheimer’s disease-linked presenilin-1 mutant neurons. Proceedings of the National Academy of Sciences of the United States of America . 103 (6), 1936–1940. [122] Oliveira, T.G., Chan, R.B., Tian, H., Laredo, M., Shui, G., Staniszewski, A., et al. (2010) Phospholipase D2 ablation ameliorates Alzheimer’s disease-linked synaptic dysfunction and cognitive deficits. Journal of Neuroscience . 30 (49), 16419–16428. [123] Bravo, F.V., Da Silva, J., Chan, R.B., Di Paolo, G., Teixeira-Castro, A., and Oliveira, T.G. (2018) Phospholipase D functional ablation has a protective effect in an Alzheimer’s disease Caenorhabditis elegans model. Scientific Reports . 8 (1), 3540. [124] Kennedy, M.A., Kabbani, N., Lambert, J.P., Swayne, L.A., Ahmed, F., Figeys, D., et al. (2011) Srf1 is a novel regulator of phospholipase D activity and is essential to buffer the toxic effects of C16:0 platelet activating factor. PLoS Genetics . 7 (2), e1001299. [125] Santa-Marinha, L., Castanho, I., Silva, R.R., Bravo, F.V., Miranda, A.M., Meira, T., et al. (2020) Phospholipase D1 Ablation Disrupts Mouse Longitudinal Hippocampal Axis Organization and Functioning. Cell Reports . 30 (12), 4197-4208.e6. [126] Dharmalingam, K. and Jayaraman, J. (1971) Mechanism of glucose repression of mitochondriogenesis: Induction of phospholipases. Biochemical and Biophysical Research Communications . 45 (5), 1115–1118. [127] Grossman, S., Cobley, J., Hogue, P.K., Kearney, E.B., and Singer, T.P. (1973) Relation of phospholipase D activity to the decay of succinate dehydrogenase and of covalently bound flavin in yeast cells undergoing glucose repression. Archives of Biochemistry and Biophysics . 158 (2), 744–753. [128] Rudge, S.A., Morris, A.J., and Engebrecht, J.A. (1998) Relocalization of phospholipase D activity mediates membrane formation during meiosis. Journal of Cell Biology . 140 (1), 81–90. [129] Honigberg, S.M., Conicella, C., and Espositio, R.E. (1992) Commitment to meiosis in Saccharomyces cerevisiae: Involvement of the SP014 gene. Genetics . 130 (4), 703–716. 67 [130] Steed, P.M., Clark, K.L., Boyar, W.C., and Lasala, D.J. (1998) Characterization of human PLD2 and the analysis of PLD isoform splice variants. The FASEB Journal . 12 (13), 1309–1317. [131] Morris, A.J., Engebrecht, J.A., and Frohman, M.A. (1996) Structure and regulation of phospholipase D. Trends in Pharmacological Sciences . 17 (5), 182–185. [132] Rudge, S.A., Sciorra, V.A., Iwamoto, M., Zhou, C., Strahl, T., Morris, A.J., et al. (2004) Roles of Phosphoinositides and of Spo14p (phospholipase D)-generated Phosphatidic Acid during Yeast Sporulation. Molecular Biology of the Cell . 15 (1), 207–218. [133] Nakanishi, H., Morishita, M., Schwartz, C.L., Coluccio, A., Engebrecht, J.A., and Neiman, A.M. (2006) Phospholipase D and the SNARE Sso1p are necessary for vesicle fusion during sporulation in yeast. Journal of Cell Science . 119 (7), 1406–1415. [134] Harkins, A.L., London, S.D., and Dolan, J.W. (2008) An upstream regulator and downstream target of phospholipase D1 activity during pheromone response in Saccharomyces cerevisiae. FEMS Yeast Research . 8 (2), 237–244. [135] Cleves, A.E., McGee, T.P., Whitters, E.A., Champlon, K.M., Altken, J.R., Dowhan, W., et al. (1991) Mutations in the CDP-choline pathway for phospholipid biosynthesis bypass the requirement for an essential phospholipid transfer protein. Cell . 64 (4), 789–800. [136] Sreenivas, A., Patton-Vogt, J.L., Bruno, V., Griac, P., and Henry, S.A. (1998) A role for phospholipase D (Pld1p) in growth, secretion, and regulation of membrane lipid synthesis in yeast. Journal of Biological Chemistry . 273 (27), 16635–16638. [137] Park, J.S. and Neiman, A.M. (2012) VPS13 regulates membrane morphogenesis during sporulation in Saccharomyces cerevisiae. Journal of Cell Science . 125 (12), 3004–3011. [138] Zhang, W., Espinoza, D., Hines, V., Innis, M., Mehta, P., and Miller, D.L. (1997) Characterization of βamyloid peptide precursor processing by the yeast Yap3 and Mkc7 proteases. Biochimica et Biophysica Acta - Molecular Cell Research . 1359 (2), 110–122. [139] Feng, B.Y., Toyama, B.H., Wille, H., Colby, D.W., Collins, S.R., May, B.C.H., et al. (2008) Smallmolecule aggregates inhibit amyloid polymerization. Nature Chemical Biology . 4 (3), 197–199. [140] Outeiro, T.F. and Lindquist, S. (2003) Yeast Cells Provide Insight into Alpha-Synuclein Biology and Pathobiology. Science . 302 (5651), 1772–1775. [141] Narayan, P., Sienski, G., Bonner, J.M., Lin, Y.T., Seo, J., Baru, V., et al. (2020) PICALM Rescues Endocytic Defects Caused by the Alzheimer’s Disease Risk Factor APOE4. Cell Reports . 33 (1), 108224. [142] Mell, J.C. and Burgess, S.M. (2003) Yeast as a Model Genetic Organism. in: Encycl. Life Sci., pp. 1–8. [143] Botstein, D. and Fink, G.R. (2011) Yeast: An experimental organism for 21st century biology. Genetics . 189 (3), 695–704. [144] Mohammadi, S., Saberidokht, B., Subramaniam, S., and Grama, A. (2015) Scope and limitations of yeast as a model organism for studying human tissue-specific pathways. BMC Systems Biology . 9 (1), 1–21. [145] Hanson, P.K. (2018) Saccharomyces cerevisiae: A Unicellular Model Genetic Organism of Enduring Importance. Current Protocols in Essential Laboratory Techniques . 16 (1), e21. [146] Rudge, S.A., Pettitt, T.R., Zhou, C., Wakelam, M.J.O., and Engebrecht, J.A. (2001) SPO14 separation-offunction mutations define unique roles for phospholipase D in secretion and cellular differentiation in 68 Saccharomyces cerevisiae. Genetics . 158 (4), 1431–1444. [147] Wieczorke, R., Dlugai, S., Krampe, S., and Boles, E. (2003) Characterisation of mammalian GLUT glucose transporters in a heterologous yeast expression system. Cellular Physiology and Biochemistry . 13 (3), 123–134. [148] Flegelova, H., Haguenauer-Tsapis, R., and Sychrova, H. (2006) Heterologous expression of mammalian Na/H antiporters in Saccharomyces cerevisiae. Biochimica et Biophysica Acta - General Subjects . 1760 (3), 504– 516. [149] Wright, M.E., Han, D.K., and Hockenbery, D.M. (2000) Caspase-3 and inhibitor of apoptosis protein(s) interactions in Saccharomyces cerevisiae and mammalian cells. in: FEBS Lett., pp. 13–18. [150] Jidenko, M., Nielsen, R.C., Sørensen, T.L.M., Møller, J. V., Le Maire, M., Nissen, P., et al. (2005) Crystallization of a mammalian membrane protein overexpressed in Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America . 102 (33), 11687–11691. [151] Heinicke, S., Livstone, M.S., Lu, C., Oughtred, R., Kang, F., Angiuoli, S. V., et al. (2007) The Princeton Protein Orthology Database (P-POD): A comparative genomics analysis tool for biologists. PLoS ONE . 2 (8), e766. [152] Nijkamp, J.F., van den Broek, M., Datema, E., de Kok, S., Bosman, L., Luttik, M.A., et al. (2012) De novo sequencing, assembly and analysis of the genome of the laboratory strain Saccharomyces cerevisiae CEN.PK113-7D, a model for modern industrial biotechnology. Microbial Cell Factories . 11. [153] Generoso, W.C., Gottardi, M., Oreb, M., and Boles, E. (2016) Simplified CRISPR-Cas genome editing for Saccharomyces cerevisiae. Journal of Microbiological Methods . 127 203–205. [154] Soares-Silva, I., Paiva, S., Diallinas, G., and Casal, M. (2007) The conserved sequence NXX[S/T]HX[S/T]QDXXXT of the lactate/pyruvate:H+ symporter subfamily defines the function of the substrate translocation pathway. Molecular Membrane Biology . 24 (5–6), 464–474. [155] Goldstein, A.L. and McCusker, J.H. (1999) Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast . 15 (14), 1541–1553. [156] Inoue, H., Nojima, H., and Okayama, H. (1990) High efficiency transformation of Escherichia coli with plasmids. Gene . 96 (1), 23–28. [157] Gietz, R.D. and Schiestl, R.H. (2007) High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature Protocols . 2 (1), 31–34. [158] Freyberg, Z., Sweeney, D., Siddhanta, A., Bourgoin, S., Frohman, M., and Shields, D. (2001) Intracellular localization of phospholipase D1 in mammalian cells. Molecular Biology of the Cell . 12 (4), 943–955. [159] Lousa, C.D.M. and Denecke, J. (2016) Lysosomal and vacuolar sorting: Not so different after all! Biochemical Society Transactions . 44 (3), 891–897. [160] Dall’Armi, C., Hurtado-Lorenzo, A., Tian, H., Morel, E., Nezu, A., Chan, R.B., et al. (2010) The phospholipase D1 pathway modulates macroautophagy. Nature Communications . 1 (9), 1–11. [161] Cai, M., He, J., Xiong, J., Tay, L.W.R., Wang, Z., Rog, C., et al. (2016) Phospholipase D1-regulated autophagy supplies free fatty acids to counter nutrient stress in cancer cells. Cell Death and Disease . 7 (11), e2448-e2448. [162] Bumpus, T.W. and Baskin, J.M. (2017) Clickable Substrate Mimics Enable Imaging of Phospholipase D Activity. ACS Central Science . 3 (10), 1070–1077. [163] Liang, D., Wu, K., Tei, R., Bumpus, T.W., Ye, J., and Baskin, J.M. (2019) A real-time click chemistry 69 imaging approach reveals stimulus-specific subcellular locations of phospholipase D activity. Proceedings of the National Academy of Sciences of the United States of America . 116 (31), 15453–15462. [164] Chishti, M.A., Yang, D.S., Janus, C., Phinney, A.L., Horne, P., Pearson, J., et al. (2001) Early-onset Amyloid Deposition and Cognitive Deficits in Transgenic Mice Expressing a Double Mutant Form of Amyloid Precursor Protein 695. Journal of Biological Chemistry . 276 (24), 21562–21570. [165] Ryan, S.D., Whitehead, S.N., Swayne, L.A., Moffat, T.C., Hou, W., Ethier, M., et al. (2009) Amyloid-β42 signals tau hyperphosphorylation and compromises neuronal viability by disrupting alkylacylglycerophosphocholine metabolism. Proceedings of the National Academy of Sciences of the United States of America . 106 (49), 20936– 20941. [166] Karim, A.S., Curran, K.A., and Alper, H.S. (2013) Characterization of plasmid burden and copy number in Saccharomyces cerevisiae for optimization of metabolic engineering applications. FEMS Yeast Research . 13 (1), 107–116. [167] Haque, R.U. and Levey, A.I. (2019) Alzheimer’s disease: A clinical perspective and future nonhuman primate research opportunities. Proceedings of the National Academy of Sciences of the United States of America . 116 (52), 26224–26229. 70 Chapter VI – Appendices 71 VI. Appendices VI.1. Codon optimization of mammalian PLD1 and PLD2 VI.1.1. Codon Adaptation Index prediction and optimization To predict the levels of expression of a heterologous protein the Codon Adaptation Index (CAI) can be calculated. The ideal CAI is 1.0, although CAI values above 0.8 are considered sufficient for good expression levels in the host. The CAI for hPLD1 and mPLD2 for expression in S. cerevisiae were calculated using Genscript’s Rare Codon Analysis Tool. PLD1 showed a CAI of 0.66 and PLD2 a CAI of 0.57, both too low to ensure good heterologous expression in yeast. Therefore, to improve the heterologous expression of mammalian PLD1 and PLD2 in S. cerevisiae the codon usage frequency of both genes was optimized. The optimized genes were synthesized by Genscript and cloned into vectors pUC57 and pCCI-4K. After optimization, the CAI of both genes showed a significant improvement, with PLD1 showing a CAI of 0.91 and PLD2 showing a CAI of 0.93 – Figure 21. Figure 21. Distribution of codon usage frequency along the length of PLD1 and PLD2 to be expressed in S. cerevisiae The predicted CAI of human PLD1 was 0.66 before optimization and 0.91 after optimization.The predicted CAI of mouse PLD2 was 0.57 before optimization and 0.93 after optimization. The CAI index predictions were performed using the Rare Codon Analysis Tool from GenScript. 78 VI.2.3.1. p416_GPD-coPLD1-GFP + pGPD-co-hPLD1-GFP-fw Figure 24. DNA Alignment of the p416_GPD-coPLD1-GFP predicted sequence with results obtained by sequencing the p416_GPD-coPLD1-GFP plasmid using primer pGPD-co-hPLD1-GFP-fw Regions highlighted in red show the DNA sequence for coPLD1 and regions highlighted in blue show DNA sequence for the GPD promoter. The alignment was performed using the ApE program (v 2.0.60). 79 VI.2.3.2. p416_GPD-coPLD1-GFP + 1114_GFP-R Figure 25. DNA Alignment of the p416_GPD-coPLD1-GFP predicted sequence with results obtained by sequencing the p416_GPD-coPLD1-GFP plasmid using primer 1114_GFP-R Regions highlighted in red show the DNA sequence for coPLD1 and regions highlighted in green show DNA sequence for GFP . The alignment was performed using the ApE program (v 2.0.60). 80 VI.2.4. Predicted nucleotide sequence for PLD2-GFP in p416_GPD-coPLD2GFP ATGACTGTTACACAAAAGAATTTGTTTCCATACGGTGATTACTTAAATTCTTCACAATTGCACATGGAACCAGATGAAGTTGATACTT TGAGAGAAGGTGAAGATCCAGCAGATAGAATGCATCCATACTTGGCTATCTACGATTTGCAACCATTGAAAGCACATCCATTGGTTTTT GCTCCAGGTGTTCCAGTTATTGCTCAAGTTGTTGGTACTGAAAGATATACATCTGGTTCAAAAGTTGGTACTTGTACATTATACTCTGTT AGATTGACTCATGGTGATTTTACATGGACTACTAAGAAAAAATTCAGACATTTCCAAGAATTACATAGAGATTTGCAAAGACATAAGGTTT TGATGTCATTGTTACCATTGGCAAGATTTGCTGTTACTCATTCTCCAGCTAGAGAAGCTGCAGCTGAAGATATTCCATCATTACCAAGAG GTGGTTCTGAAGGTTCAGCAAGACATACAGCTTCTAAGCAAAAGTATTTAGAAAACTACTTGAATAGATTGTTAACTATGTCATTCTACA GAAACTACCATGCTATGACAGAATTTTTAGAAGTTTCTCAATTGTCATTTATCCCAGATTTAGGTTCAAAGGGTTTGGAAGGTGTTATTAG AAAAAGATCAGGTGGTCATAGAGTTCCAGGTTTTACTTTTTGTGGTAGAGATCAAGTTTGTTACAGATGGTCAAAGAGATGGTTAGTTGT TAAGGATTCATTTTTGTTGTACATGAGACCAGAAACAGGTGCTATTTCTTTTGTTCAATTGTTTGATCCAGGTTTTGAAGTTCAAGTTGGT AAAAGATCAACTGAAACAAGATACGGTGTTAGAATCGATACTTCTCATAGATCATTAATCTTGAAATGTTCTTCATACAGACAAGCAAGAT GGTGGGGTCAAGAAATTACAGAATTGGCTCAAGGTTCTGGTAGAGATTTCTTGCAATTGCATCAACATGATTCTTATGCTCCACCAAGA CCAGGTACTTTAGCAAGATGGTTTGTTAATGGTGCTGGTTACTTTGCAGCTGTTGCAGATGCTATCTTGAGAGCACAAGAAGAAATTTTT ATCACAGATTGGTGGTTGTCACCAGAAATTTATTTGAAGAGACCAGCACATTCTGATGATTGGAGATTAGATATTATGTTGAAGAGAAAA GCTGAAGAAGGTGTTAGAGTTTCTATCTTGTTGTTCAAAGAAGTTGAATTAGCATTGGGTATCAACTCTGGTTACTCAAAGAGAACTTTG ATGTTGTTGCATCCAAACATCAAGGTTATGAGACATCCAGATTTAGTTACATTGTGGGCTCATCATGAAAAATTGTTAGTTGTTGATCAAG TTGTTGCATTTTTGGGTGGTTTAGATTTGGCTTTTGGTAGATGGGATGATGTTCAATACAGATTGACTGATTTGGGTGATCCATCTGAAC CAGTTCATTTACAAACTCCAACATTGGGTTCAGATCCAGCAGCTACTCCAGATTTATCTCATAACCAATTTTTCTGGTTGGGCAAGGATT ACTCTAACTTGATCACAAAGGATTGGGTTCAATTGGATAGACCATTCGAAGATTTCATCGATAGAGAAACTACACCAAGAATGCCTTGGA GAGATGTTGGTGTTGTTGTTCATGGTGTTGCAGCTAGAGATTTAGCAAGACATTTCATCCAAAGATGGAACTTCACTAAGACTACAAAAG CTAGATACAAGACACCATTGTACCCATACTTGTTACCAAAATCTACTTCAACAGCAAACAACTTGCCATTCATGATTCCAGGTGGTCAAT GTGCTACTGTTCAAGTCTTAAGATCAGTTGATAGATGGTCAGCAGGTACTTTGGAAAATTCTATCTTGAACGCTTACTTGCATACAATCA GAGAATCACAACATTTCTTGTACATCGAAAACCAATTTTTCATCTCTTGTTCAGATGGTAGAACAGTTTTGAACAAGGTTGGTGATGAAAT CGTTGATAGAATTTTGAAAGCACATGAACAAGGTCAATGTTTCAGAGTTTATTTGTTATTGCCATTGTTGCCAGGTTTTGAAGGTGATATT TCTACTGGTGGTGGTAATTCTATCCAAGCTATCTTGCATTTCACATACTCATTGTGTTTGTTGCATCCATTTTTCTCTTTGAGAACTTTGT GTAGAGGTGAACATTCTATCTTGCATAGATTGAAGGCAGCTATGGGTACTGCTTGGAGAGATTACATGTCTATTTGTGGTTTGAGAACAC ATGGTGAATTGGGTGGTCATCCAATTTCTGAATTAATCTACATCCATTCAAAGATGTTGATCGCAGATGATAGAACTGTTATCATCGGTT CTGCTAACATCAACGATAGATCATTATTGGGCAAGAGAGATTCTGAATTAGCTATCTTGATCAAGGATACAGAAATGGAACCATCTTTAA TGGATGGTGTTGAATATCAAGCAGGTAGATTTGCTTTATCATTGAGAAAGCATTGTTTCTCTGTTATCTTGGGTGCTAACACTTGGCCAG ATTTAGATTTGAGAGATCCAGTTTGTGATGATTTCTTTCAATTGTGGCAAGAAACTGCAGAAAACAACGCTACAATCTACGAACAAATTTT TAGATGTTTGCCATCTAACGCAACTAGATCATTAAGAGCTTTGAGAGAATACGTTGCAGTTGAATCATTAGCTACAGTTTCTCCATCATT AGCACAATCTGAATTGGCTCATATTCAAGGTCATTTGGTTCATTTTCCATTGAAGTTTTTGGAAGATGAATCATTATTGCCACCATTAGGT TCTAAAGAAGGTATGATTCCATTGGAAGTTTGGACAGAATTCGATATCAAGCTTGTCGACATGAGTAAAGGAGAAGAACTTTTCACTGGA GTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGG AAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCACTTATGGTGTTCAATG CTTTTCAAGATACCCAGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTT CAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTT 81 TAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGG AATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGA TGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTC CTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAACACCATCACCATCACCATTAG VI.2.5. Sequencing results for PLD2-GFP in p416_GPD-coPLD2-GFP The p416_GPD-coPLD2-GFP construct was sequenced by Eurofins genomics using primers pGPD-co-mPLD2-GFP-fw and 1114_GFP-R. The plasmid was premixed with each primer individually according to Eurofins genomics directions 82 VI.2.5.1. p416_GPD-coPLD2-GFP + pGPD-co-mPLD2-GFP-fw Figure 26. DNA Alignment of the p416_GPD-coPLD2-GFP predicted sequence with results obtained by sequencing the p416_GPD-coPLD2-GFP plasmid using primer pGPD-co-mPLD2-GFP-fw Regions highlighted in yellow show the DNA sequence for coPLD2 and regions highlighted in blue show DNA sequence for the GPD promoter. The alignment was performed using the ApE program (v 2.0.60). 83 VI.2.5.1. p416_GPD-coPLD2-GFP + 1114_GFP-R Figure 27. DNA Alignment of the p416_GPD-coPLD2-GFP predicted sequence with results obtained by sequencing the p416_GPD-coPLD2-GFP plasmid using primer 1114_GFP-R Regions highlighted in yellow show the DNA sequence for coPLD2 and regions highlighted in green show DNA sequence for the GFP. The alignment was performed using the ApE program (v 2.0.60). 84 VI.3. PCR cycling conditions VI.3.1. Construction of SPO14 deletion The KanMX cassette was amplified by PCR from strain IR04 (see Table 2 in Chapter II-Materials and methods) using primers primerA-spo14-del and primerD-spo14-del (see Table 3 in Chapter II-Materials and methods). Reagents were prepared according to the manufacturers’ suggested protocol for PhusionTM High–Fidelity DNA Polymerase (Thermo Scientific). The cycling conditions were chosen according to the WebPCR online software (http://bjornfjohansson.pythonanywhere.com/pcr) and the enzyme manufacturers’ protocol - Table 5. Table 5. Cycling conditions for amplification of KanMX cassette from IR04 using PhusionTM High–Fidelity DNA Polymerase (Thermo Scientific) Initial denaturation 98 °C for 30 seconds 1 x Denaturation 98 °C for 10 seconds 30 x Annealing 60 °C for 30 seconds Extension 72 °C for 30 seconds Final extension 72 °C for 10 minutes 1 x For the colony PCR for integration of the KanMX in the SPO14 locus primers K3 and primerD-spo14del were used (see Table 3 in Chapter II-Materials and methods). Reagents were prepared according to the protocol described in Chapter II-Materials and methods (see II.5 Colony PCR). The cycling conditions were chosen according to the WebPCR online software (http://bjornfjohansson.pythonanywhere.com/pcr), with the exception of the initial denaturation step where a longer incubation period was used - Table 6. Table 6. Cycling conditions for colony PCR of integration of KanMX in the SPO14 locus Initial denaturation 94 °C for 10 minutes 1 x Denaturation 94 °C for 30 seconds 30 x Annealing 55 °C for 30 seconds Extension 72 °C for 2 minutes Final extension 72 °C for 10 minutes 1 x 85 The HygMX cassette was amplified by PCR from pAG32 (Table 4 in Chapter II-Material and methods) using 150_MX4fwd and 149_MX4rev (see Table 3 in Materials and methods). Reagents were prepared according to the manufacturers’ suggested protocol for PhusionTM High–Fidelity DNA Polymerase (Thermo Scientific). The cycling conditions were chosen according to the WebPCR online software (http://bjornfjohansson.pythonanywhere.com/pcr) and the enzyme manufacturers’ protocol - Table 7. Table 7. Cycling conditions for amplification of HygMX cassette from pAG32 using PhusionTM High–Fidelity DNA Polymerase (Thermo Scientific) Initial denaturation 98 °C for 30 seconds 1 x Denaturation 98 °C for 10 seconds 30 x Annealing 59 °C for 30 seconds Extension 72 °C for 30 seconds Final extension 72 °C for 10 minutes 1 x For the colony PCR for integration of the HygMX in the SPO14 locus primers 256_KanB and primerA-spo14-del were used (see Table 3 in Chapter II-Materials and methods). Reagents were prepared according to the protocol described in Chapter II-Materials and methods (see II.5 Colony PCR). The cycling conditions were chosen according to the WebPCR online software (http://bjornfjohansson.pythonanywhere.com/pcr), with the exception of the initial denaturation step where a longer incubation period was used - Table 8. Table 8. Cycling conditions for colony PCR of integration of HygMX in the SPO14 locus Initial denaturation 94 °C for 10 minutes 1 x Denaturation 94 °C for 30 seconds 30 x Annealing 50 °C for 30 seconds Extension 72 °C for 1 minutes Final extension 72 °C for 10 minutes 1 x 86 VI.3.2. Construction of p416_GPD-coPLD1-GFP and p416_GPD-coPLD2GFP The codon-optimized PLD1 and PLD2 genes were amplified by PCR from hPLD1_pUC57 and mPLD2_PCCI-4K, respectively. PLD1 was amplified using primers pGPD-co-hPLD1-GFP-fw plus pGPDco-hPLD1-GFP-rv (see Table 3 in Chapter II-Materials and methods) and PLD2 was amplified with primers pGPD-co-mPLD2-GFP-fw plus pGPD-co-mPLD2-GFP-rv (see Table 3 in Chapter II-Materials and methods). Reagents were prepared according to the manufacturers’ suggested protocol for PhusionTM High–Fidelity DNA Polymerase (Thermo Scientific). The cycling conditions were chosen according to the WebPCR online software (http://bjornfjohansson.pythonanywhere.com/pcr) and the enzyme manufacturers’ protocol - Table 9. Table 9. Cycling conditions for amplification of PLD1 and PLD2 from hPLD1_pUC57 and mPLD2_PCCI-4K, respectively using PhusionTM High–Fidelity DNA Polymerase (Thermo Scientific). Initial denaturation 98 °C for 30 seconds 1 x Denaturation 98 °C for 10 seconds 30 x Annealing 70.5 °C for 30 seconds Extension 72 °C for 48 seconds Final extension 72 °C for 10 minutes 1 x For the colony PCR for correct assembly of the desired genetic constructs primers pGPD-co-hPLD1GFP-fw and screening-hPLD1-rv for p416-coPLD1-GFP and pGPD-co-mPLD2-GFP-fw screening-mPLD2rv for p416-coPLD2-GFP (see Table 3 in Chapter II-Materials and methods). Reagents were prepared according to the protocol described in Chapter II-Materials and methods (see II.5 Colony PCR). The cycling conditions were chosen according to the WebPCR online software (http://bjornfjohansson.pythonanywhere.com/pcr), with the exception of the initial denaturation step where a longer incubation period was used - Table 10. 87 Table 10. Cycling conditions for colony PCR for correct assembly of p416_GDP-coPLD1-GFP and p416_GPD-coPLD2-GFP Initial denaturation 94 °C for 10 minutes 1 x Denaturation 94 °C for 30 seconds 30 x Annealing 54 °C for 30 seconds Extension 72 °C for 32 seconds Final extension 72 °C for 10 minutes 1 x VI.3.3. Genomic integration of codon-optimized PLD1 and PLD2 in the SPO14 locus of a mutant strain The pRCC-K plasmid was amplified in three parts: the first fragment was amplified with primers gRNA_HygMX4-FW and 253_KanC3 (see Table 3 in Chapter II-Materials and methods). The second fragment was amplified with primers 473_MSW_rev and 576_pBR322_2 (see Table 3 in Chapter IIMaterials and methods). The third fragment was amplified with primers 196_pMEC_MX4_fwd and gRNA_HygMX4-RV (see Table 3 in Chapter II-Materials and methods). Reagents were prepared according to the manufacturers’ suggested protocol for PhusionTM High–Fidelity DNA Polymerase (Thermo Scientific). The cycling conditions were chosen according to the WebPCR online software (http://bjornfjohansson.pythonanywhere.com/pcr) and the enzyme manufacturers’ protocol – Table 11, Table 12 and Table 13. Table 11. Cycling conditions for amplification of fragment 1 from pRCC-K using PhusionTM High–Fidelity DNA Polymerase (Thermo Scientific) Initial denaturation 98 °C for 30 seconds 1 x Denaturation 98 °C for 10 seconds 35 x Annealing 58.9 °C for 30 seconds Extension 72 °C for 2 minutes Final extension 72 °C for 10 minutes 1 x