Relation between CarS expression and activation of carotenogenesis by stress in Fusarium fujikuroi

Relation between CarS expression and activation of carotenogenesis by stress in Fusarium fujikuroi Macarena Ruger-Herreros, Steffen Nordzieke, Carmen Vega-Álvarez, Javier Avalos and M. Carmen Limón* Department of Genetics, Faculty of Biology, University of Seville, Seville, Spain Fusarium fujikuroi, a model organism for secondary metabolism in fungi, produces carotenoids, terpenoid pigments with antioxidant activity. Previous results indicate that carotenoid synthesis in F. fujikuroi is stimulated by light or by different stress conditions and downregulated by a RING finger protein encoded by carS gene. Here, we have analyzed the effects of three stressors, nitrogen scarcity, heat shock, and oxidative stress. We compared them with the effect of light in the wild type, a carS mutant that overproduces carotenoids, and its complemented strain. The assayed stressors increase the synthesis of carotenoids in the three strains, but mRNA levels of structural genes of carotenogenesis, carRA and carB, are only enhanced in the presence of a functional carS gene. In the wild-type strain, the four conditions affect in different manners the mRNA levels of carS: greater in the presence of light, without significant changes in nitrogen starvation, and with patent decreases after heat shock or oxidative stress, suggesting different activation mechanisms. The spores of the carS mutant are more resistant to H 2 O 2 than those of the wild type; however, the mutant shows a greater H 2 O 2 sensitivity at the growth level, which may be due to the participation of CarS in the regulation of genes with catalase domains, formerly described. A possible mechanism of regulation by heat stress has been found in the alternative splicing of the intron of the carS gene, located close to its 3′end, giving rise to the formation of a shorter protein. This action could explain the inducing effect of the heat shock, but not of the other inducing conditions, which may involve other mechanisms of action on the CarS regulator, either transcriptionally or posttranscriptionally. KEYWORDS light, CarS, photoinduction, oxidative stress, heat shock, nitrogen starvation, intron, alternative splicing Introduction The rice pathogen Fusarium fujikuroi is an ascomycete fungus well known for its capacity to produce gibberellins (Tudzynski, 2005), plant growth-promoting hormones with applications in agriculture. This species is also a model to produce other compounds, including bikaverin, fusarins, and carotenoids. The carotenoid biosynthetic pathway has OPEN ACCESS EDITED BY A. Pedro Gonçalves, National Cheng Kung University, Taiwan REVIEWED BY Fengjiao Xin, Institute of Food Science and Technology (CAAS), China Biplab Paul, Massachusetts General Hospital, Harvard Medical School, United States *CORRESPONDENCE M. Carmen Limón, [email protected] SPECIALTY SECTION This article was submitted to Synthetic Biology, a section of the journal Frontiers in Bioengineering and Biotechnology RECEIVED 21 July 2022 ACCEPTED 12 September 2022 PUBLISHED 05 October 2022 CITATION Ruger-Herreros M, Nordzieke S, Vega-Álvarez C, Avalos J and Limón MC (2022), Relation between CarS expression and activation of carotenogenesis by stress in Fusarium fujikuroi. Front. Bioeng. Biotechnol. 10:1000129. doi: 10.3389/fbioe.2022.1000129 COPYRIGHT © 2022 Ruger-Herreros, Nordzieke, Vega-Álvarez, Avalos and Limón. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Frontiers in Bioengineering and Biotechnology frontiersin.org01 TYPE Original Research PUBLISHED 05 October 2022 DOI 10.3389/fbioe.2022.1000129 received much attention in recent years in this fungus (Avalos et al., 2017), and all genes responsible for the production of its major carotenoid product, the acidic xanthophyll neurosporaxanthin (NX), have been elucidated. Two major genes in the pathway, carRA and carB, encode a bifunctional phytoene synthase and a desaturase, respectively, and are needed for the synthesis of β-carotene and the NX precursor torulene (Figure 1). The carRA and carB genes are linked to the carX gene, encoding a β-carotene-cleaving oxygenase (Prado-Cabrero et al., 2007b), and carO gene, encoding a proton-pumping rhodopsin (García-Martínez et al., 2015), forming a co-regulated cluster. The CarX oxygenase produces retinal, the rhodopsin chromophore, that gives sense to the coregulation of the cluster as a gene set involved in the production of photoactive CarO rhodopsin. Two other genes, carT and carD, are unlinked to this cluster and are specifically involved in NX production: CarT as a torulene-cleaving dioxygenase (Prado-Cabrero et al., 2007a) and CarD as an aldehyde dehydrogenase responsible for the formation of the carboxylic group of NX (Díaz-Sánchez et al., 2011). The synthesis of carotenoids in Fusarium is modulated by environmental cues, with light as a major stimulatory signal (Avalos and Estrada, 2010). Illumination of dark-grown mycelia of F. fujikuroi results in the acquisition of an orange pigmentation due to an accumulation of carotenoids. This photoresponse is achieved at transcription level, with a rapid but transient increase in the mRNA amounts of the genes of the car cluster following illumination, reaching maximal levels at about 1 hour after illumination (Prado et al., 2004). At least three photoreceptors, the White-Collar protein WcoA, the DASH cryptochrome CryD, and the VIVID-like protein VvdA, participate in the control by light of carotenogenesis in F. fujikuroi (Castrillo and Avalos, 2015). The mutants of the genes for these photoreceptors exhibit different regulatory alterations, but still retain the ability to accumulate carotenoids in response to light. Carotenogenesis in F. fujikuroi is down-regulated by a RING- finger protein, called CarS. This is evidenced by the outstanding deep-pigmented phenotype in the dark of different mutants of the carS gene, and the recovery of the albino appearance by reintroduction of the wild-type carS allele (Rodríguez-Ortiz et al., 2013). A similar phenotype is exhibited by equivalent mutants in Fusarium oxysporum, where this gene was initially identified (Rodríguez-Ortiz et al., 2012). The increased carotenoid content of the carS mutants is due to the enhanced mRNA levels of the structural genes of the pathway either in the dark or under FIGURE 1 Carotenoid biosynthesis in Fusarium. Chemical modifications in each step are highlighted in color. The dashed arrow summarizes three sequential desaturations. The car genes encoding the enzymes in charge of each reaction are indicated. The orange area indicates the steps in charge of the genes of the car cluster. In the top on the right, it is depicted a simplified model for the effects of the four inducing conditions mentioned in the text (White arrows indicate positive effects on transcription of the car genes and grey bars indicate negative effects on carS transcription). Frontiers in Bioengineering and Biotechnology frontiersin.org02 Ruger-Herreros et al. 10.3389/fbioe.2022.1000129 illumination (Prado et al., 2004;Thewes et al., 2005;Prado- Cabrero et al., 2007a;Díaz-Sánchez et al., 2011). The carS mutants are reminiscent of crgA gene mutants of Mucor circinelloides with a deep-pigmented phenotype, due to overexpression of the car genes and overaccumulation of βcarotene (Navarro et al., 2000). CarS and CrgA are orthologous proteins, containing two RING finger domains and a LON protease domain. Despite the high phylogenetic divergence between both fungi, belonging to the Ascomycotina and Mucormycotina taxa, the coincidences in protein domains and mutant phenotypes suggest similar mechanisms of action. The data available on CrgA points to an ubiquitinating protein that can modulate the function of specific protein targets (Silva et al., 2008). The connection between CarS and the regulations by light has been recently analyzed at the global transcriptome level. RNA-seq analyses carried out on the wild type, a carS mutant, and a carS-complemented strain, grown in the dark or exposed to light for 1 hour, revealed that light and CarS alter the expression of a large battery of genes (Ruger-Herreros et al., 2019). Interestingly, it was found an outstanding overlap between the genes induced by light and by the carS mutation, including those of the car cluster, suggesting regulatory connections between CarS and the light-regulating machinery. The regulation of carotenogenesis in Fusarium is also connected to different stress conditions. Thus, nitrogen starvation has been described as a stimulatory factor, as inferred from the increased carotenoid content when the fungus was grown under nitrogen-limiting conditions or when a non-stressed culture was transferred to a nitrogen-free solution (Rodríguez-Ortiz et al., 2009). Moreover, experimental evidence from different fungi points to a protective role of carotenoids against oxidative stress (Avalos and Limón, 2015). In Fusarium aquaeductuum, carotenoid content increases in mycelia exposed under red light to methylene blue or toluidine blue which produce singlet molecular oxygen ( 1 O 2 ) at this wavelength (Lang-Feulner and Rau, 1975). In addition, exposure to hydrogen peroxide (H 2 O 2 ) increases carotenoid accumulation in different fungi (Avalos and Limón, 2015), including F. aquaeductuum (Bindl et al., 1970). The regulation by light may be related to the association between illumination and some stressing conditions, such as exposure to air (oxidative stress), desiccation (osmotic stress), and high temperature (heat stress). In the latter case, an increase in mRNA levels has been described for the carB gene after exposure of F. fujikuroi to 42°C during 1 or 2 hours (Prado et al., 2004). Noteworthy, global transcriptomic data revealed that among the genes more affected by light or by the carS mutation there are several genes putatively involved in stress (Ruger-Herreros et al., 2019). To increase our knowledge on the regulatory connection between carotenoid biosynthesis and environmental stress in F. fujikuroi and the possible participation of CarS in such relation, we investigated under equivalent culture conditions the effects of light, nitrogen starvation, heat shock, and hydrogen peroxide on carotenoid accumulation. To do this, we employed the wild type, acarS mutant, and its complemented strain formerly used in our global transcriptomic studies (Ruger-Herreros et al., 2019). The data were completed with the effect on expression of the key structural carRA and carB genes, as well as that of the carS gene. We found similar effects on carotenoid accumulation and carRA/ carB expression, but different effects on carS gene expression, suggesting that the CarS protein is not involved in the same manner in the four responses. Special attention has been paid to the effect of the carS mutation on hydrogen peroxide sensitivity. Finally, we found alternative splicing events in an intron in the 3′ region of the mRNA of the carS gene and verified its possible involvement in stress regulation. The results are consistent with a possible participation in the activation of carotenogenesis by heat shock, but not by other stressors. Materials and methods Strains and culture conditions The Fusarium fujikuroi strains were the wild type IMI58289, obtained from the Imperial Mycological Institute (Kew, Surrey, England), the SG39 carS mutant (Avalos and Cerdá-Olmedo, 1987), and the SG256 complemented strain, isolated from a sectoring complementing strain obtained by introduction of the wild-type carS allele in the SG39 mutant (Rodríguez-Ortiz et al., 2013;Ruger-Herreros et al., 2019). The strains were cultured in DG minimal medium, containing per liter 30 g glucose, 3 g NaNO 3 ,1gKH 2 PO 4 , 0.5 g KCl, 0.5 g MgSO 4 ·7H 2 O, and 2 ml of a microelement solution (Avalos et al., 1985). To obtain spores, the F. fujikuroi strains were grown for 8–10 days under illumination at 22°C on EG medium, containing 1 g glucose, 1 g yeast extract, 1gNO 3 NH 4 ,1gKH 2 PO 4 , 0.5 g MgSO 4 ·7H 2 O, and 16 g agar per liter. When indicated, mycelia were illuminated by exposure to a set of four fluorescent tubes (Philips TL-D 18W/840) at ca. 60 cm, providing a light intensity of 7 W m -2 . For RT-PCR analyses, 10 6 spores of each strain were inoculated into 100 ml of DG medium in 500 ml Erlenmeyer flasks and incubated in the dark for 3 days in an orbital shaker at 200 rpm at 30°C. Afterwards, 25-ml samples of the cultures were transferred to 8.9-cm diameter Petri dishes under red safelight and incubated without agitation for 1 hour in the dark, under white light or subjected to heat shock or to hydrogen peroxide. In the case of nitrogen starvation, incubations in DG medium in 500 ml Erlenmeyer flasks and subsequent transfers to Petri dishes were done with either 3 g L −1 NaNO 3 as high nitrogen condition or with 0.625 g L −1 NaNO 3 as low nitrogen condition. Mycelial samples were collected by filtration and frozen immediately at –80°C for future use. For analysis of carotenoid production, the Petri dishes with the 25 ml of cultures of each strain were Frontiers in Bioengineering and Biotechnology frontiersin.org03 Ruger-Herreros et al. 10.3389/fbioe.2022.1000129 incubated for 24 h under the indicated conditions. In all the cases, control plates were incubated in the dark or without stress. For studying the effect of temperature on intron splicing, the Petri dishes with the 25 ml samples were incubated for 1 hour at 16, 22, 30, 37 or 42°C in the dark to adapt to the new temperature. One of the dishes was incubated under illumination and the other in darkness for another hour at the indicated temperature. Carotenoid analysis Mycelial samples were filtered from liquid cultures and frozen in liquid nitrogen for lyophilization. Carotenoids from lyophilized mycelia were extracted with acetone following a standard protocol (Marente et al., 2020b), with two pulses of 6 m/s for 30sinaFAST-PREP24(MPBiomedicals,Irvin,CA,United States). Extracted carotenoids were concentrated and measured in a UV-1800 UV-VIS spectrophotometer (Shimadzu, Kyoto, Japan) as previously described (Marente et al., 2020b). RNA isolation Frozen samples of 2–3 mg of mycelium were ground with a FAST-PREP24 (Biomedicals, LLC Europe, France) using zirconia/silica beds with two pulses of 30 s at 4 m/s. Total RNA was extracted using RNeasy ® Plant Mini Kit (QIAGEN GmbH, Germany) following manufacturer instructions and specific indications for fungal samples. Retrotranscription Before retrotranscription, DNA contaminations were removed from total RNA samples by treatment with 2 units of rDNAse I RNAse-free (Affymetrix, Santa Clara, CA, United States) per 1 µg RNA for 15 min at room temperature. After inactivation at 65°C, RNA concentrations were estimated with a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE, United States). 2.5 μg of RNA were retrotranscribed to cDNA with the Transcriptor first-strand cDNA synthesis kit (Roche, Mannheim, Germany), following manufacturer instructions. Expression analysis Transcript levels of the investigated genes were analyzed by quantitative real time PCR (qRT-PCR). Final concentrations of cDNA were set to 25 ng μl −1 . RT-qPCR analyses were performed in a LightCycler 480 real-time instrument (Roche) with the LightCycler 480 SYBR green I Master (Roche), using the primers included in Table 1. Transcript levels for each gene were normalized against the β1-tubulin FFUJ_04397 gene mRNA levels under the same conditions. Intron analysis Alternative intron splicing was identified from junctions between exons in the single readings of RNA-seq analyses of the wild type in a former work (Ruger-Herreros et al., 2019), using Integrative Genomics Viewer application (IGV) version 2.13.1 (Robinson et al., 2011). Alternative splicing was checked by PCR using 50 ng of cDNA obtained from mRNA extracted from mycelia grown under different conditions. Standard PCR reactions were done in a TC-312 thermal cycler (Techne, Cole Parmer, Vernon Hills, IL, United States), using 50 mM Biotaq polymerase (Bioline, Meridian Bioscience, Cicinnati, OH, United States), 10 mM dNPTs, and 500 mM of primers that are described in Table 1. For carS gene, PCR program consisted in 94°C 2 min, 32 cycles of 94°C30s,54 °C30s,72 °C 30 s, and an extension at 72°C for 10 min. For amplification of longer bands with S1-carS-1F and carS-11R primers, annealing was done at 58°C for 1 min. For carB gene, primer annealing was done at 53°C. PCR products were visualized in 1.2% or 2.5% agarose gels depending on their sizes. To check the validity of the number of cycles, two samples withdifferencesinthepatternsofbandswereamplified using from 20 to 35 cycles. As a result, amplification signals began to be detected from 26 cycles. Despite increasing the intensity of the bands, the proportions between the bands corresponding to different splicing variants were maintained up to the maximum number of 35 cycles used (Supplementary Figure S1). The band pattern was especially visible at 32 cycles, so TABLE 1 Oligonucleotides used in this study. Oligonucleotide Sequence (5’->39) qRT-PCR analyses RTcarRA-1F CAGAAGCTGTTCCCGAAGACA RTcarRA-1R TGCGATGCCCATTTCTTGA RTcarB-1F TCGGTGTCGAGTACCGTCTCT RTcarB-1R TGCCTTGCCGGTTGCTT RTFfcarS-1F GATACCCGGCGGAAAGGTTA RTFfcarS-1R CTGACAGTCCATTTCAGCGC Tub-2F CCGGTGCTGGAAACAACTG Tub-2R CGAGGACCTGGTCGACAAGT Detection of intron splicing by PCR carS-11F TGTTGACTATATACGGCGAG S1-carS-1F GCCAACTTTCATCAGCTAGG carS-11R CTACCGTCGAGTCGTAATCGTC carB2intr1F TGCTGGTGTCGGTGGTGT carB2intr1R CGCCCTCAGCAGTTAGAG Frontiers in Bioengineering and Biotechnology frontiersin.org04 Ruger-Herreros et al. 10.3389/fbioe.2022.1000129 these analysis conditions were used in subsequent experiments. Densitometry analysis was done online with the ImageJ software through the server https://ij.imjoy.io/. Germination assay Spore suspensions of each strain were prepared with approximately 10 7 spores in 1-ml of water. H 2 O 2 was added to a final concentration ranging from 25 to 150 mM and controls without H 2 O 2 were included. The spores were incubated in agitation at 30°Cindarknessandafterthetreatmenttheywere washed twice with sterile water by centrifugating at 3000 × gfor 5min,at4 °C. Different dilutions of the suspensions were streaked over DG agar medium. The number of the colonies on each plate was counted after 3 days of incubation at 30°C. Germination of spores was calculated as a percentage of the number of colonies appearing after incubation spores with H 2 O 2 respect to the nontreated ones. FIGURE 2 Effect of light and carS gene mutation on carotenoid production and expression of car genes. (A) Relative carotenoid content in the wild type (WT), carS mutant (SG39), and the complemented mutant (SG256). Absolute carotenoid contents are shown in Supplementary Table S1. Carotenoids were analyzed in mycelia incubated for 24 h after the 1-h illumination in the Petri dishes or without illumination. (B) Transcript levels of carRA, carB, and carS genes. The three strains were cultivated for 3 days in shake flasks with DG medium at 30°C in darkness, 25 ml of the cultures were transferred to Petri dishes and were illuminated with white light for 1 hour or incubated in darkness. Levels of mRNA were determined by RT-qPCR and referred to the levels in the wild type grown in the dark, taken as 1. FIGURE 3 Effect of nitrogen availability and carS mutation on carotenoid production and expression of car genes. (A) Relative carotenoid production or without treatment (control) in the wild type (WT), carS mutant (SG39), and the complemented mutant (SG256) under two different nitrogen concentrations. (B) Transcript levels of carRA, carB, and carS genes at two nitrogen concentrations. The three strains were grown in DG medium for 3 days at 30°C in darkness with 3 g/L −1 NaNO 3 (High N) or with 0.625 g/L −1 NaNO 3 (Low N). Levels of mRNA were determined by RT-qPCR and referred to the levels in the wild type grown in High N, taken as 1. The Petri dishes were incubated for 24 h more before extraction of carotenoids. Frontiers in Bioengineering and Biotechnology frontiersin.org05 Ruger-Herreros et al. 10.3389/fbioe.2022.1000129 Results Relation of light and nitrogen starvation with carS expression Light and nitrogen starvation have been described as stimulatory signals for carotenogenesis. To assess its possible connection with carS regulation, the effect of these signals was checked in the wild type, the carS mutant SG39, and the complemented strain SG256. There was a small increase in the carotenoid content of the three strains after exposition to light, while the carS mutant exhibited an approximately ten-fold increase compared to carS+ controls, both in the dark and after illumination (Figure 2A; absolute carotenoid content for all figures with carotenoid data shown in Supplementary Table S1). RT-qPCR assays showed that both carRA and carB transcripts strongly increased in the wild type and in the complemented strain 1 hour after the light exposure, while they were very high in the carS mutant irrespective of illumination (Figure 2B). The transcript levels of the carS gene were not affected by the carS mutation in the dark. As formerly reported, a modest photoinduction of such levels was observed in the wild type, but the increase was more pronounced in the carS mutant, suggesting a down-regulation of carS photoinduction by its own CarS protein. The photoinduction of the carS gene in the carS mutant contrasted with the lack of effect of light on the mRNA levels for the carRA and carB genes in the same strain. Formerly, the effect of nitrogen on carotenogenesis was investigated under different culture conditions (Rodríguez- Ortiz et al., 2009). For better comparison with the effect of light, growth conditions were as described above, but in this case the mycelia were grown for 3 days in minimal medium with high and low nitrogen concentration from the start of the experiment. The N-limiting concentration was inferred from the effect of nitrogen availability on the synthesis of gibberellins (Candau et al., 1992). The incubation of the three strains in the low nitrogen medium (Low N) resulted in a higher carotenoid content than in excess of nitrogen (High N) (Figure 3A). This correlated with an apparent increase in the mRNA levels of the carRA and carB genes in the wild type and the complemented strain, but not in those of the carS mutant, which exhibited the opposite pattern (Figure 3B). These results suggest that transcriptional activation of the carRA and carB genes by nitrogen shortage is at least partially dependent on the function of the CarS protein. However, regardless of the amount of nitrogen in the medium, only minor changes were appreciated in the carS mRNA levels. Effect of heat shock on carotenogenesis In F. fujikuroi,carB and carO genes have been reported to increase their transcript levels in the dark in response to a heat shock of 42°C(Prado et al., 2004;Estrada and Avalos, 2009). However, the expression of the rest of the genes of the cluster (e.g., carRA)orcarS gene, have not been investigated. To carry out this study, the three strains used in the former section were cultivated under the same conditions described for the regulation by light and nitrogen. In this case, after transfer to the Petri dishes, thecultureswereincubatedfor1hourat42 °C in the dark. The data showed a result similar to the effect caused by nitrogen starvation (Figure 3A), that is, a detectable increase in the carotenoid content in the three strains after the heat-shock (Figure 4A). FIGURE 4 Effect of heat shock on carotenoid production and expression of car genes. (A) Relative carotenoid production in the wild type (WT), carS mutant (SG39), and the complemented mutant (SG256) measured 1 day after 1 hour of heat shock. (B) Expression of carRA, carB and carS genes after 1-h heat shock. The three strains were grown in DG medium for 3 days at 30°C in darkness and incubated for 1 hour at 42°C. RNA was extracted from samples taken after the heat shock and carotenoids from samples incubated 24 h at 30°C after the heat shock. Controls for RNA were incubated 1 hour at 30°C. Controls for carotenoids were incubated 25 hours at 30°C. Levels of mRNA were determined by RT-qPCR and referred to the levels in the wild type grown without heat shock, taken as 1. Frontiers in Bioengineering and Biotechnology frontiersin.org06 Ruger-Herreros et al. 10.3389/fbioe.2022.1000129 In relation to the effect on gene expression, qRT-PCR analyses revealed an increase in carRA and carB mRNA levels in the wild type and complemented strains after heat shock (Figure 4B), which could explain the increased carotenoid content. However, this increase by heat shock did not occur in the carS mutant, indicating the mediation of CarS in this response. An opposite expression pattern was observed for the carS gene, with lower levels after the heat shock. However, the heat shock had hardly any effect on the transcript content of the three genes in the carS mutant, while it noticeably increased the amounts of carotenoids also in this strain. In addition, in this experiment it was particularly patent an increase in carS mRNA in the carS mutant, an effect already described (Ruger-Herreros et al., 2019), that can be attributed to a negative control of CarS proteinontranscriptionofitsowngene. Effect of H 2 O 2 on F. fujikuroi growth The effect of oxidative stress was studied using oxygen peroxide as oxidative agent. As preliminary information, the sensitivity of wild type F. fujikuroi to this reactive oxygen species was determined under the culture conditions described above. H 2 O 2 was added to the Petri dishes to different final concentrations and growth was determined after additional 24 h. Up to 8 mM H 2 O 2 ,thefungalbiomass waslikethatofthecontrol,butat16and32mMtherewasa visible drop (data not shown). The effect of hydrogen peroxide was also analyzed on agar cultures, by exposing the strains to H 2 O 2 throughout all the incubation time. Transplants of mycelium from each strain were transferred onto Petri dishes with different H 2 O 2 concentrations and incubated for 3 days at 30°Cinthe dark. According to the diameter of the colonies, the carS mutant showed greater sensitivity to hydrogen peroxide than the wild type and the complemented strain, the difference being especially pronounced at a concentration of 16 mM, while at 32 mM the three strains were similarly affected (Figure 5A). Spore germination is a particularly sensitive stage in the life cycle of fungi. To see the effect of oxidative stress on germination, droplets with decreasing spore numbers, from 10 6 to 10 3 , were seeded on Petri dishes with minimal medium with different H 2 O 2 concentrations and incubated in the dark for 3 days at 30°C (Figure 5B). The results showed a greater sensitivity of the spores than that exhibited by mycelium in the former experiment. Thus, while in the presence of 8 mM H 2 O 2 there was no difference in mycelial growth of the strains compared to the control Petri dish without hydrogen peroxide, development from spores was almost non-existent at this concentration. Regarding the comparison between the three strains, the carS mutant also showed more sensitivity in these experimental conditions, with the difference especially evident at a concentration of 2mMH 2 O 2 . These results indicate that the mycelium of the SG39 carS mutant is less tolerant to hydrogen peroxide FIGURE 5 Effect of hydrogen peroxide on growth of the wild type (WT), carS mutant (SG39), and the complemented mutant (SG256). (A) Growth of surface colonies on media with different H 2 O 2 concentrations. Strains were grown for 4 days in DG agar medium and then 1-mm 2 pieces of mycelia were transferred to DG agar with the indicated H 2 O 2 concentrations. Pictures were taken after 3 days of cultivation at 30°C in darkness. (B) Growth from drops containing serial dilutions of spores of the three strains on DG agar with different H 2 O 2 concentrations, incubated for 3 days at 30°C in the dark. (C) Germination of spores exposed to hydrogen peroxide. Spores were incubated with different concentrations of H 2 O 2 for 30 min in agitation in darkness. Then the spores were washed twice and spread on DG plates to count number of colonies. Frontiers in Bioengineering and Biotechnology frontiersin.org07 Ruger-Herreros et al. 10.3389/fbioe.2022.1000129 than the wild-type strain. Thisdifferenceiscausedbythe mutation in the carS gene, as reveals the recovery of the tolerance in the complemented strain. To confirm this observation, the effect of hydrogen peroxide on the germination capacity of the spores was checked by incubating them for 30 min with different concentrations of H 2 O 2 . The number of colonies growing on DGagar medium indicated the ability of the spores to survive to this stress (Figure 5C). A higher survival rate was found in spores of the carS mutant at any of the tested H 2 O 2 concentrations than for the spores of the wild type or the complemented strains, while in the spore serial dilution experiments (Figure 5B)thegrowth of SG39 mutant was reduced in comparison to the growth of the carS+ strains. From both experiments, we conclude that the spores of the carS mutant are more tolerant to a temporary exposure to hydrogen peroxide than those of the wild type, but they are more sensitive to development in the presence of the oxidizing agent. Effect of H 2 O 2 on carotenogenesis To check the effect of hydrogen peroxide on carotenogenesis, H 2 O 2 was added to a final concentration of 16 mM to the Petri dishes with the 3-days mycelia of the carS mutant and the two control strains and checked for gene expression and carotenoid production. As formerly found for the effects of nitrogen starvation and heat shock, the three strains accumulated more carotenoids after 24 h in the presence of H 2 O 2 (Figure 6A). In thewildtypeandthecomplementedstrains,thiseffectmaybe attributed to enhanced expression of the car genes, as indicates the higher mRNA levels for the genes carRA and carB found 1 hour after the addition of hydrogen peroxide, whereas no significant changes were observed in these levels in the carS mutant (Figure 6B). Interestingly, mRNA amounts of the carS gene decreased after H 2 O 2 exposure in the three strains investigated. Effect of light and stress on alternative splicing of the carS mRNA intron Analysis of a global RNA-seq of F. fujikuroi (Ruger- Herreros et al., 2019) led us to identify two alternative splicing forms of an intron located in the 3′region of the carS gene (Supplementary Figure S2), which were not included in the F. fujikuroi genome annotation available in Fungi DB. Depending on the splicing pattern, two alternative small exons were mutually exclusive. Moreover, a detailed view of the RNA-seq data revealed that the intron was not always removed. Therefore, depending on the splicing event, three different mRNAs may be detected that correspond to intron retention or removal of a short or a large intron (Figure 7A). The removal of the 168-bp intron occurs when a proximal 3′splicing site (SS) is used while the 336-bp intron is spliced when the distal 3′SS is chosen. This predictably would lead to three CarS protein isoforms with changes in the carboxy-end sequence (Figure 7B). To check a possible regulation of CarS activity at mRNA splicing level, we analyzed the effect of light and the different stressing conditions on the generation of the different alternative carS transcripts. The occurrence of the three alternative mature mRNAs identified in the RNA-seq study was checked by PCR using cDNA obtained from samples of RNA of the wild type and appropriate primers. In the dark, the three alternatives were identified, with a predominance of the removal of the small intron (Figure 7C), corresponding to the use of the proximal 3’ SS. An additional band was detected above the 407-bp band FIGURE 6 Effect of oxidative stress and carS gene mutation on carotenoid production and expression of car genes. (A) Relative carotenoid accumulation after hydrogen peroxide treatment for 24 h in the wild type (WT), carS mutant (SG39), and the complemented mutant (SG256). (B) Expression levels of carRA, carB and carS genes after 1 hour incubation with H 2 O 2 . Control: samples without treatment. Culture conditions are as those for Figure 2. Levels of mRNA were determined by RT-qPCR and referred to the levels in the wild type grown without hydrogen peroxide, taken as 1. Frontiers in Bioengineering and Biotechnology frontiersin.org08 Ruger-Herreros et al. 10.3389/fbioe.2022.1000129 (Figure 7C) that was not observed with a different pair of primers. This amplification, which does not affect the conclusions, was probably due to non-specific binding of one of the two primers at a point close to the genuine one. The pattern of alternative splicing forms was very similar after 1-h illumination, under nitrogen starvation or exposure to H 2 O 2, (Figure 7C). However, after the heat-shock treatment an increased amount of unspliced mRNA was detected, which FIGURE 7 Effect of stressing conditions on splicing of carS mRNA. (A) Isoforms of carS mRNA according to RNA-seq reads. Red and blue bars indicate the mutually exclusive exons fused to the large pale blue exon depending on the splicing event. Arrows indicate primers used in the PCR assays. Stop codons resulting from each mRNA are indicated. Above: intron retention. Middle: splicing of a 168-bp intron. Below: splicing of a 336-bp intron. Only the relevant carS segment is displayed. (B) Three predicted isoforms of the CarS carboxy end according to the three intron maturation alternatives: intron retention (isoform A), 168-bp intron splicing (isoform B), and 336-bp intron splicing (isoform C). (C) PCR test of alternative splicing of carS gene in response to stress. Samples of 25 ml of 3-day-old cultures incubated at 30°C in the dark were transferred to Petri dishes and kept under the indicated stress for 1 h in the dark (D) or under illumination (L). Nitrogen starved mycelia (labelled as Nitrogen) were grown for 3 days in medium with 0.625 g/L −1 NaNO 3 before the transfer to Petri dishes. Oxidative stress was generated incubating mycelia with 16 mM H 2 O 2 for 1 h in the Petri dishes. M, Size markers; G, Genomic DNA; C, Control without cDNA. Molecular interpretation of the PCR products in the three mRNA alternatives is depicted on the schemes on the right. Densitometry analysis of the indicated bands is shown below. Intensity of each band is represented with a different color: green, 575-bp band (intron retention); red, 407-bp band (168-bp spliced intron); blue, 239-bp band (336-bp spliced intron). Frontiers in Bioengineering and Biotechnology frontiersin.org09 Ruger-Herreros et al. 10.3389/fbioe.2022.1000129