Acute Colon Inflammation Triggers Primary Motor Cortex Glial Activation, Neuroinflammation, Neuronal Hyperexcitability, and Motor Coordination Deficits
Abstract
Neuroinflammation underlies neurodegenerative diseases. Herein, we test whether acute colon inflammation activates microglia and astrocytes, induces neuroinflammation, disturbs neuron intrinsic electrical properties in the primary motor cortex, and alters motor behaviors. We used a rat model of acute colon inflammation induced by dextran sulfate sodium. Inflammatory mediators and microglial activation were assessed in the primary motor cortex by PCR and immunofluorescence assays. Electrophysiological properties of the motor cortex neurons were determined by whole-cell patch-clamp recordings. Motor behaviors were examined using open-field and rotarod tests. We show that the primary motor cortex of rats with acute colon inflammation exhibited microglial and astrocyte activation and increased mRNA abundance of interleukin-6, tumor necrosis factor-alpha, and both inducible and neuronal nitric oxide synthases. These changes were accompanied by a reduction in resting membrane potential and rheobase and increased input resistance and action potential frequency, indicating motor neuron hyperexcitability. In addition, locomotion and motor coordination were impaired. In conclusion, acute colon inflammation induces motor cortex microglial and astrocyte activation and inflammation, which led to neurons’ hyperexcitability and reduced motor coordination performance. The described disturbances resembled some of the early features found in amyotrophic lateral sclerosis patients and animal models, suggesting that colon inflammation might be a risk factor for developing this disease.
Full text
Citation: Carrascal, L.; Vázquez-Carretero, M.D.; García-Miranda, P.; Fontán-Lozano, Á.; Calonge, M.L.; Ilundáin, A.A.; Castro, C.; Nunez-Abades, P.; Peral, M.J. Acute Colon Inflammation Triggers Primary Motor Cortex Glial Activation, Neuroinflammation, Neuronal Hyperexcitability, and Motor Coordination Deficits. Int. J. Mol. Sci. 2022,23, 5347. https:// doi.org/10.3390/ijms23105347 Academic Editors: Rita Moretti and Mauro Giuffrè Received: 9 March 2022 Accepted: 7 May 2022 Published: 11 May 2022 Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. Copyright: © 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). International Journal of Molecular Sciences Article Acute Colon Inflammation Triggers Primary Motor Cortex Glial Activation, Neuroinflammation, Neuronal Hyperexcitability, and Motor Coordination Deficits Livia Carrascal 1,2,† , María D. Vázquez-Carretero 1,† , Pablo García-Miranda 1,*,† ,Ángela Fontán-Lozano 3, María L. Calonge 1, Anunciación A. Ilundáin 1, Carmen Castro 2,4 , Pedro Nunez-Abades 1,2 and María J. Peral 1,* 1Departamento de Fisiología, Facultad de Farmacia, Universidad de Sevilla, 41012 Sevilla, Spain; [email protected] (L.C.); [email protected] (M.D.V.-C.); [email protected] (M.L.C.); [email protected] (A.A.I.); [email protected] (P.N.-A.) 2Instituto de Biomedicina de Cádiz (INIBICA), 11009 Cádiz, Spain; [email protected] 3 Departamento de Fisiología, Facultad de Biología, Universidad de Sevilla, 41012 Sevilla, Spain; [email protected] 4Departamento de Fisiología, Facultad de Medicina, Universidad de Cádiz, 11003 Cádiz, Spain *Correspondence: [email protected] (P.G.-M.); [email protected] (M.J.P.); Tel.: +34-954-55-67-77 (P.G.-M.) † These authors contributed equally to this work. Abstract: Neuroinflammation underlies neurodegenerative diseases. Herein, we test whether acute colon inflammation activates microglia and astrocytes, induces neuroinflammation, disturbs neuron intrinsic electrical properties in the primary motor cortex, and alters motor behaviors. We used a rat model of acute colon inflammation induced by dextran sulfate sodium. Inflammatory mediators and microglial activation were assessed in the primary motor cortex by PCR and immunofluorescence assays. Electrophysiological properties of the motor cortex neurons were determined by whole-cell patch-clamp recordings. Motor behaviors were examined using open-field and rotarod tests. We show that the primary motor cortex of rats with acute colon inflammation exhibited microglial and astrocyte activation and increased mRNA abundance of interleukin-6, tumor necrosis factor-alpha, and both inducible and neuronal nitric oxide synthases. These changes were accompanied by a reduction in resting membrane potential and rheobase and increased input resistance and action potential frequency, indicating motor neuron hyperexcitability. In addition, locomotion and motor coordination were impaired. In conclusion, acute colon inflammation induces motor cortex microglial and astrocyte activation and inflammation, which led to neurons’ hyperexcitability and reduced motor coordination performance. The described disturbances resembled some of the early features found in amyotrophic lateral sclerosis patients and animal models, suggesting that colon inflammation might be a risk factor for developing this disease. Keywords: colon inflammation; motor neurons; microglial and astrocyte activation; neuroinflammation; neurodegeneration; hyperexcitability; motor coordination 1. Introduction Neuroinflammation is considered an important inducer for the development of neurodegenerative diseases, such as Parkinson’s, Alzheimer’s, and amyotrophic lateral sclerosis (ALS) [ 1 ]. Astrocytes and microglia, which exhibit either resting or activated states depending on the surrounding environment, play a key role in neuroinflammation. Reactive astrocytes exhibit increased size and release inflammatory mediators [ 1 ]. Activated microglia display increased body size and release pro-inflammatory cytokines, such as interleukin-1 beta (IL-1 β ), interleukin-6 (IL-6), and tumor necrosis factor-alpha (TNF- α ) [ 2 ]. Overactive microglia and astrocytes also release reactive oxygen species, such as nitric oxide (NO), that primarily results from increased expression of the inducible nitric oxide Int. J. Mol. Sci. 2022,23, 5347. https://doi.org/10.3390/ijms23105347 https://www.mdpi.com/journal/ijms
Int. J. Mol. Sci. 2022,23, 5347 2 of 21 synthase (iNOS) [ 2 ]. Another form of NOS is present exclusively in neurons (nNOS) [ 3 ]. The released pro-inflammatory cytokines and NO, in turn, activate surrounding glial cells, inducing a self-potentiating cycle that maintains a pro-inflammatory environment [2]. Central nervous system (CNS) inflammation can be elicited by peripheral inflammation [ 4 ]. Diseases that involve peripheral inflammation are the inflammatory bowel diseases (IBD), such as ulcerative colitis. Patients with these disorders exhibit intestinal symptoms such as diarrhea and rectal bleeding, but also often suffer from cognitive and neuropsychiatric disfunctions [ 5 , 6 ]. In fact, the intestinal inflammation has been considered a risk factor for suffering from Parkinson’s, Alzheimer’s, and ALS diseases [ 7 , 8 ], and the extent of the intestinal disorders observed in these patients are such that they are considered part of their clinical picture [ 9 ]. Animals with experimental colitis display behavior and morphological brain alterations similar to those of IBD patients, as well as inflammation in some brain regions [ 10 , 11 ]. In these animals, the neuroinflammation is accompanied by microglial activation in the hippocampus, cerebral cortex, and mesencephalon [ 11 – 16 ], increased excitability in the hippocampus and dorsal root ganglia [ 12 , 17 , 18 ], and reduced locomotor activity [ 11 , 19 , 20 ]. Together, these observations indicate that colitis animal models are suitable for studying the gut–brain interactions [10]. The gut–brain axis is a bidirectional link between the CNS and the gut, providing an explanation of how changes in the gut barrier affect brain homeostasis, and vice versa [ 8 , 10 ]. As far as we know, however, no study has addressed the effect of acute colon inflammation on the primary motor cortex. ALS disease is characterized by motor neurons’ degeneration, including pyramidal neurons of the primary motor cortex (layer V) that regulate voluntary motor output [ 21 ]. In most cases, ALS is a sporadic disease and the initial cause(s) remain(s) unknown, but besides activated microglia and astrocytes, and neuroinflammation [ 22 , 23 ], ALS patients and animal disease models exhibit motor cortical hyperexcitability that seems to precede the neurodegeneration associated with ALS [ 24 ]. What produces enhanced excitability and makes the pyramidal neurons of the primary motor cortex vulnerable to degeneration is not completely understood. Accumulating evidence suggests that one possible cause for the neuronal hyperexcitability may be the direct action of inflammatory and/or oxidative stress mediators (cytokines and NO) on both neuron membrane intrinsic properties and synapsis, which, in the long term, may contribute to neuronal injury and death [25–27]. The aim of the present study was to determine whether acute colon inflammation causes microglial and astrocyte activation and neuroinflammation in the primary motor cortex and alters motor neuron functions. To achieve this, we used a well-established rat model of acute colitis and evaluated both the intrinsic electrical properties of motor cortex neurons and the animal motor coordination. The study might contribute to understanding the role played by inflammation in the vulnerability of cortical motor neurons to degeneration and death, feature symptoms of the ALS pathology. 2. Results 2.1. DSS Treatment and Colon Inflammation The induction and progression of colon inflammation were evaluated by determining the disease activity index (DAI) and colon parameters, as described in the Methods Section. All the rats exposed to 3% DSS for 7 days developed acute colitis, as evidenced by the increase in the DAI, the shortening in the colon length, and the increase in the mRNA relative abundance of the pro-inflammatory cytokines IL-1 β , IL-6, and TNF- α ( Figure 1A–D ). The loss of crypt architecture and the massive infiltration of inflammatory cells in the mucosa and submucosa (Figure 1E,F) are also indicative of colon inflammation.
Int. J. Mol. Sci. 2022,23, 5347 3 of 21 Int.J.Mol.Sci.2022,23,xFORPEERREVIEW3of22 Figure1.EvaluationoftheDSS‐inducedacutecolitisinrats.Control(untreated)andDSS‐treated ratsreceivedeitherwaterorwatercontaining3%dextransulphatesodium(DSS)for7days,respectively.(A)Diseaseactivityindex(DAI)assesseddaily.(B)Representativemacroscopicappearance ofcecumandcolon.(C)Colonlength.(D)mRNArelativeexpressionofpro‐inflammatorycytokines inthedistalcolon.(E)Representativehematoxylin/eosin‐stainedsectionsofhistologicalanalysis. (F)Scoreofdistalcolondamage.M:mucosa,SM:submucosa,ME:muscularisexterna.Scalebar Figure 1. Evaluation of the DSS-induced acute colitis in rats. Control (untreated) and DSS-treated rats received either water or water containing 3% dextran sulphate sodium (DSS) for 7 days, respectively. ( A ) Disease activity index (DAI) assessed daily. ( B ) Representative macroscopic appearance of cecum and colon. ( C ) Colon length. ( D ) mRNA relative expression of pro-inflammatory cytokines in the distal colon. ( E ) Representative hematoxylin/eosin-stained sections of histological analysis. ( F ) Score of distal colon damage. M: mucosa, SM: submucosa, ME: muscularis externa. Scale bar represents 200 µm . Data are means ± SEM (n= 8–15 animals per group). Student’s t-test: * p< 0.05 and ** p< 0.01, DSS-treated rats vs. controls. 2.2. Colon Inflammation Induces Neuroinflammation in Primary Motor Cortex Once we established that 7 days of DSS treatment induces acute colonic inflammation in rats (Figure 1A–F), we tested whether these rats developed neuroinflammation by measuring the mRNA relative abundance of the pro-inflammatory mediators IL-1 β , IL-6,
Int. J. Mol. Sci. 2022,23, 5347 4 of 21 TNF- α , iNOS, and nNOS. Total RNA was obtained from homogenates of the primary motor cortex of control (untreated) and DSS-treated rats. Figure 2A shows that, as compared with control rats, 7 days of DSS treatment significantly increased both IL-6 and TNF- α mRNA relative abundance by about 3- and 2-fold, respectively, with no change in that of IL-1 β . An almost 4-fold increase in both iNOS and nNOS mRNAs was found in DSS-treated rats as compared with controls (Figure 2B). Int.J.Mol.Sci.2022,23,xFORPEERREVIEW4of22 represents200μm.Dataaremeans±SEM(n=8–15animalspergroup).Student’st‐test:*p<0.05 and**p<0.01,DSS‐treatedratsvs.controls. 2.2.ColonInflammationInducesNeuroinflammationinPrimaryMotorCortex Onceweestablishedthat7daysofDSStreatmentinducesacutecolonicinflammation inrats(Figure1A–F),wetestedwhethertheseratsdevelopedneuroinflammationby measuringthemRNArelativeabundanceofthepro‐inflammatorymediatorsIL‐1β,IL‐6, TNF‐α,iNOS,andnNOS.TotalRNAwasobtainedfromhomogenatesoftheprimarymotorcortexofcontrol(untreated)andDSS‐treatedrats. Figure2Ashowsthat,ascomparedwithcontrolrats,7daysofDSStreatmentsignificantlyincreasedbothIL‐6andTNF‐αmRNArelativeabundancebyabout3‐and2‐fold, respectively,withnochangeinthatofIL‐1β.Analmost4‐foldincreaseinbothiNOSand nNOSmRNAswasfoundinDSS‐treatedratsascomparedwithcontrols(Figure2B). TheseobservationsdemonstratethatDSStreatmentinducedneuroinflammationin theprimarymotorcortex. Figure 2. Neuroinflammation and microglial activation in the motor cortex of control and DSS-treated rats. mRNA relative expression of ( A ) pro-inflammatory cytokines and ( B ) iNOS and nNOS in the primary motor cortex (n= 6–8 animals per group). Immunolocalization of ( C ) Iba1 (red) and ( D ) iNOS (green) performed in brain sections containing the primary motor cortex. Nuclei were visualized with Hoechst (blue). ( E ) Colocalization of Iba1-iNOS (yellow-orange color). The cells pointed to by arrows are shown in higher magnification. Scale bar represents 20 µ m. ( F ) Quantification of microglia cell body size (pixels) expressed as the cell body to cell size ratio (percentage) in the primary motor cortex. ( G ) Quantification of the number of either Iba1, iNOS, or Iba1-iNOS positive cells. For ( F , G ), the number of animals was 5 for each group and the number of cells analyzed in each animal was 200 (n= 5 animals per group). Data are means ± SEM. Student’s t-test: * p< 0.05 and ** p< 0.01, DSS-treated rats vs. controls.
Int. J. Mol. Sci. 2022,23, 5347 5 of 21 These observations demonstrate that DSS treatment induced neuroinflammation in the primary motor cortex. 2.3. Colon Inflammation and Microglial and Astrocyte Activation in Primary Motor Cortex Activated microglial cells produce nitric oxide and undergo morphological changes characterized by an increase in their body size and retraction of their processes. To determine whether DSS-induced colon inflammation activates the primary motor cortex microglia, we quantified the microglial cell body size/cell size ratio by Iba1-immunostaining, as described in the Methods Section. The number of either Iba1, iNOS, or iNOS-Iba1 positive cells was also evaluated. DSS treatment significantly increased the microglial cell body/total cell size ratio, the number of iNOS + cells (about 4-fold), and that of Iba1 + cells colocalizing with iNOS (about 7-fold), without modifying the number of Iba1 + cells (Figure 2C–G). The number of iNOS + cells was greater than that of Iba1 + -iNOS + cells, indicating that non-microglial cells expressed iNOS and that both microglial and non-microglial cells responded to colon inflammation with iNOS induction. Then, we examined whether DSS-induced colon inflammation also activates astrocytes in the primary motor cortex. For that, we performed a quantitative GFAP immunofluorescence assay, as described in the Methods Section. The results revealed a significant upregulation of GFAP expression in DSS-treated rats as compared with controls (Figure 3A,B). Int.J.Mol.Sci.2022,23,xFORPEERREVIEW5of22 Figure2.NeuroinflammationandmicroglialactivationinthemotorcortexofcontrolandDSS‐ treatedrats.mRNArelativeexpressionof(A)pro‐inflammatorycytokinesand(B)iNOSandnNOS intheprimarymotorcortex(n=6–8animalspergroup).Immunolocalizationof(C)Iba1(red)and (D)iNOS(green)performedinbrainsectionscontainingtheprimarymotorcortex.Nucleiwere visualizedwithHoechst(blue).(E)ColocalizationofIba1‐iNOS(yellow‐orangecolor).Thecells pointedtobyarrowsareshowninhighermagnification.Scalebarrepresents20μm.(F)Quantificationofmicrogliacellbodysize(pixels)expressedasthecellbodytocellsizeratio(percentage)in theprimarymotorcortex.(G)QuantificationofthenumberofeitherIba1,iNOS,orIba1‐iNOSpositivecells.For(F,G),thenumberofanimalswas5foreachgroupandthenumberofcellsanalyzed ineachanimalwas200(n=5animalspergroup).Dataaremeans±SEM.Student’st‐test:*p<0.05 and**p<0.01,DSS‐treatedratsvs.controls. 2.3.ColonInflammationandMicroglialandAstrocyteActivationinPrimaryMotorCortex Activatedmicroglialcellsproducenitricoxideandundergomorphologicalchanges characterizedbyanincreaseintheirbodysizeandretractionoftheirprocesses.TodeterminewhetherDSS‐inducedcoloninflammationactivatestheprimarymotorcortexmicroglia,wequantifiedthemicroglialcellbodysize/cellsizeratiobyIba1‐immunostaining, asdescribedintheMethodsSection.ThenumberofeitherIba1,iNOS,oriNOS‐Iba1positivecellswasalsoevaluated. DSStreatmentsignificantlyincreasedthemicroglialcellbody/totalcellsizeratio,the numberofiNOS+cells(about4‐fold),andthatofIba1+cellscolocalizingwithiNOS(about 7‐fold),withoutmodifyingthenumberofIba1+cells(Figure2C–G).ThenumberofiNOS+ cellswasgreaterthanthatofIba1+‐iNOS+cells,indicatingthatnon‐microglialcellsexpressediNOSandthatbothmicroglialandnon‐microglialcellsrespondedtocoloninflammationwithiNOSinduction. Then,weexaminedwhetherDSS‐inducedcoloninflammationalsoactivatesastrocytesintheprimarymotorcortex.Forthat,weperformedaquantitativeGFAPimmunofluorescenceassay,asdescribedintheMethodsSection.Theresultsrevealedasignificant upregulationofGFAPexpressioninDSS‐treatedratsascomparedwithcontrols(Figure 3A,B). Thesefindings,togetherwiththeobservationssummarizedinFigure2A,B,demonstratethattheDSS‐inducedacutecoloninflammationtriggersbothneuroinflammation andactivationofmicrogliaandastrocytesintheprimarymotorcortex. Figure 3. Astrocyte activation in the motor cortex of control and DSS-treated rats. ( A ) Immunofluorescence of GFAP was performed in brain sections containing primary motor cortex. The cells pointed to by arrows are shown in higher magnification. Scale bar represents 20 µ m. ( B ) Quantification of GFAP immunostaining area expressed as percentage of the analyzed area in the primary motor cortex. The number of animals was 5 for each group and the number of measurements in each animal was 30–50 (n= 5 animals per group). Data are means ± SEM. Student’s t-test: *** p< 0.001, DSS-treated rats vs. controls. These findings, together with the observations summarized in Figure 2A,B, demonstrate that the DSS-induced acute colon inflammation triggers both neuroinflammation and activation of microglia and astrocytes in the primary motor cortex.
Int. J. Mol. Sci. 2022,23, 5347 6 of 21 2.4. Colon Inflammation Depolarizes Membrane Potential and Increases Membrane Resistance of Motor Neurons We next determined whether DSS-induced colon inflammation affected the intrinsic electrical properties of the pyramidal neurons of the motor cortex. The whole-cell patchclamp technique was applied. Recordings in current clamp mode were made in the pyramidal neurons of control (untreated) and DSS-treated rats, as described in the Methods Section. Figure 4A exemplifies a pyramidal neuron with a patch pipette on it. Int.J.Mol.Sci.2022,23,xFORPEERREVIEW7of22 Figure4.Membraneinputresistanceandrestingmembranepotentialofpyramidalneuronsfrom themotorcortexofcontrolandDSS‐treatedrats.(A)Representativepyramidalneuronfromthe motorcortex,patch‐clamped.Scalebarrepresents20μm.(B)Membranevoltageresponsestodepolarizingandhyperpolarizingcurrentsteps(500ms,10pA)inarepresentativepyramidalneuronof controlandDSS‐treatedrats.(C)Restingmembranepotential(mV).(D)Relationshipbetweenvaluesofcurrentandvoltagerepresentedin(B).(E)Membraneinputresistance(MΩ).Dataaremeans ±SEM.Thenumberofanimalswas4foreachexperimentalconditionandthenumberofneurons recordedfromeachanimalwas2–4(n=12cellsrecordedintotalforeachgroup).Student’st‐test:* p<0.05and***p<0.001,DSS‐treatedratsvs.controls. 2.5.ColonInflammationInducesHyperexcitabilityinMotorNeurons Next,welookedattheactivemembranepropertiesofthepyramidalneuronsfrom theprimarymotorcortex.Intheseexperiments,weusedwhole‐cellpatch‐clamprecordingsincurrentclampmodeandmeasured,incontrol(untreated)andDSS‐treatedrats, rheobase,voltagethreshold,depolarizationvoltage,actionpotentialamplitudeandduration,frequencygain,maximumfrequencyofdischarge,andcancellationcurrent.ObservationsmadeinDSS‐treatedratswerecomparedtothoseincontrol(untreated)rats. Figure 4. Membrane input resistance and resting membrane potential of pyramidal neurons from the motor cortex of control and DSS-treated rats. ( A ) Representative pyramidal neuron from the motor cortex, patch-clamped. Scale bar represents 20 µ m. ( B ) Membrane voltage responses to depolarizing and hyperpolarizing current steps (500 ms, 10 pA) in a representative pyramidal neuron of control and DSS-treated rats. ( C ) Resting membrane potential (mV). ( D ) Relationship between values of current and voltage represented in ( B ). ( E ) Membrane input resistance (M Ω ). Data are means ± SEM. The number of animals was 4 for each experimental condition and the number of neurons recorded from each animal was 2–4 (n= 12 cells recorded in total for each group). Student’s t-test: * p< 0.05 and *** p< 0.001, DSS-treated rats vs. controls.
Int. J. Mol. Sci. 2022,23, 5347 7 of 21 Initially, we measured resting membrane potential and membrane input resistance (passive membrane properties). Figure 4B,C shows that at rest, the pyramidal neurons of both experimental groups did not discharge action potentials spontaneously, exhibiting a stable resting membrane potential that in DSS-treated rats was significantly more depolarized (Table 1). Figure 4B also illustrates the responses of representative pyramidal neurons to hyperpolarizing and depolarizing current pulses. The recordings revealed that the magnitudes of the membrane potential changes, induced by the current pulses, were higher in the DSS-treated rats, as compared with untreated rats. In addition, depolarizing currents of either 40 or 50 pA generated action potentials only in DSS-treated rats ( Figure 4B ). Figure 4D shows the voltage–current relationship of the neurons illustrated in Figure 3B. The input membrane resistance, obtained from the slope of this relationship, was significantly increased in DSS-treated rats as compared to control rats (Figure 4E; Table 1). Table 1. Effects of DSS-induced acute colon inflammation on electrophysiological properties of pyramidal neurons from the primary motor cortex. Membrane Properties Control DSS Membrane resting potential (mV) −73.66 ±1.06 −62.65 ±1.52 *** Input resistance (MΩ) 158.49 ±14.35 212.6 ±27.14 * Rheobase (pA) 222.5 ±4.94 97.08 ±16.19 ** Voltage depolarization (mV) 31.16 ±2.50 20.60 ±2.22 ** Voltage threshold (mV) −39.42 ±2.54 −39.71 ±1.48 Action potential amplitude (mV) 120.38 ±4.34 112.95 ±3.21 Action potential duration (ms) 1.69 ±0.07 1.57 ±0.08 Frequency gain (AP·s−1/nA) 30.21 ±7.89 57.93 ±7.89 ** Maximum frequency (AP·s−1)29.08 ±3.17 29.10 ±2.56 Cancellation current (pA) 902.16 ±48.5 640. 00 ±50.57 ** Data are presented as mean ± standard error of the mean. The number of animals was 4 for each experimental condition and the number of neurons recorded from each animal was 2–4 (n= 12 cells recorded in total for each group). Student’s t-test: *** p< 0.001, ** p< 0.01, * p< 0.05, DSS-treated vs. control rats. 2.5. Colon Inflammation Induces Hyperexcitability in Motor Neurons Next, we looked at the active membrane properties of the pyramidal neurons from the primary motor cortex. In these experiments, we used whole-cell patch-clamp recordings in current clamp mode and measured, in control (untreated) and DSS-treated rats, rheobase, voltage threshold, depolarization voltage, action potential amplitude and duration, frequency gain, maximum frequency of discharge, and cancellation current. Observations made in DSS-treated rats were compared to those in control (untreated) rats. As seen in a representative pyramidal neuron (Figure 5A) and in the whole neuron population studied in each experimental group (Figure 5B,C; Table 1), the rheobase was reduced by 50% and the depolarization voltage was reduced by 35% in DSS-treated rats compared to control rats. The voltage threshold value was similar in the two experimental groups (Figure 5D). As DSS treatment depolarized the resting membrane potential and did not affect the voltage threshold, the depolarization voltage value was decreased (Figure 5C; Table 1). Compared to controls, DSS-treated rats did not show significant differences neither in the duration nor in the amplitude of the action potential, despite a tendency to decrease (Table 1). DSS-induced acute colon inflammation also modified the firing properties of pyramidal neurons from the primary motor cortex. Figure 6A shows that the motor neurons, from both experimental groups, responded to a depolarization current of 1 s duration by discharging repetitive action potentials, but with higher fire frequency in DSS-treated rats. The current–frequency relationship (Figure 6B) reveals that DSS treatment increased the frequency gain of the neurons by about 2-fold for the whole cell population (Figure 6C; Table 1). The maximum frequency achieved by the motor neurons, regardless of the current intensity, was not modified by DSS treatment (Figure 6D; Table 1), and the cancellation current in the neurons of DSS-treated rats was lower than in control rats (Figure 6E; Table 1).
Int. J. Mol. Sci. 2022,23, 5347 8 of 21 Int.J.Mol.Sci.2022,23,xFORPEERREVIEW8of22 Asseeninarepresentativepyramidalneuron(Figure5A)andinthewholeneuron populationstudiedineachexperimentalgroup(Figure5B,C;Table1),therheobasewas reducedby50%andthedepolarizationvoltagewasreducedby35%inDSS‐treatedrats comparedtocontrolrats.Thevoltagethresholdvaluewassimilarinthetwoexperimental groups(Figure5D).AsDSStreatmentdepolarizedtherestingmembranepotentialand didnotaffectthevoltagethreshold,thedepolarizationvoltagevaluewasdecreased(Figure5C;Table1). Comparedtocontrols,DSS‐treatedratsdidnotshowsignificantdifferencesneither inthedurationnorintheamplitudeoftheactionpotential,despiteatendencytodecrease (Table1).DSS‐inducedacutecoloninflammationalsomodifiedthefiringpropertiesof pyramidalneuronsfromtheprimarymotorcortex.Figure6Ashowsthatthemotorneurons,frombothexperimentalgroups,respondedtoadepolarizationcurrentof1sdurationbydischargingrepetitiveactionpotentials,butwithhigherfirefrequencyinDSS‐ treatedrats.Thecurrent–frequencyrelationship(Figure6B)revealsthatDSStreatment increasedthefrequencygainoftheneuronsbyabout2‐foldforthewholecellpopulation (Figure6C;Table1).Themaximumfrequencyachievedbythemotorneurons,regardless ofthecurrentintensity,wasnotmodifiedbyDSStreatment(Figure6D;Table1),andthe cancellationcurrentintheneuronsofDSS‐treatedratswaslowerthanincontrolrats(Figure6E;Table1). Thesealterations,alongwiththoseobservedinthepassiveproperties,indicatethat theDSS‐inducedacutecolitisneuroinflammationresultsinhyperexcitabilityofprimary motorcortexneurons. Figure 5. Rheobase and depolarization voltage of pyramidal neurons from the motor cortex of control and DSS-treated rats. ( A ) Membrane voltage responses to rheobase (minimum current required to evoke action potential) in a representative pyramidal neuron of control and DSS-treated rats. Vdp: Depolarization voltage. ( B ) Rheobase (pA). ( C ) Depolarization voltage (mV). ( D ) Voltage threshold (mV). Data are means ± SEM. The number of animals was 4 for each experimental condition and the number of neurons recorded from each animal was 2–4 (n= 12 cells recorded in total for each group). Student’s t-test: ** p< 0.01, DSS-treated rats vs. controls. These alterations, along with those observed in the passive properties, indicate that the DSS-induced acute colitis neuroinflammation results in hyperexcitability of primary motor cortex neurons.
Int. J. Mol. Sci. 2022,23, 5347 9 of 21 Int.J.Mol.Sci.2022,23,xFORPEERREVIEW9of22 Figure5.RheobaseanddepolarizationvoltageofpyramidalneuronsfromthemotorcortexofcontrolandDSS‐treatedrats.(A)Membranevoltageresponsestorheobase(minimumcurrentrequired toevokeactionpotential)inarepresentativepyramidalneuronofcontrolandDSS‐treatedrats. Vdp:Depolarizationvoltage.(B)Rheobase(pA).(C)Depolarizationvoltage(mV).(D)Voltage threshold(mV).Dataaremeans±SEM.Thenumberofanimalswas4foreachexperimentalconditionandthenumberofneuronsrecordedfromeachanimalwas2–4(n=12cellsrecordedintotal foreachgroup).Student’st‐test:**p<0.01,DSS‐treatedratsvs.controls. Figure6.FiringpropertiesofpyramidalneuronsfromthemotorcortexofcontrolandDSS‐treated rats.(A)Membranepotentialresponsestolong‐lastingdepolarizingcurrentpulses(200pA)ina representativeneuronfromcontrolandDSS‐treatedrats.(B)Relationshipbetweencurrentintensity andfrequencyofactionpotentials(AP)representedin(A).(C)Frequencygain(AP∙s⁻¹/nA).(D) Maximumfrequency(AP∙s⁻¹).(E)Cancellationcurrent(pA).Dataaremeans±SEM.Thenumberof animalswas4foreachexperimentalconditionandthenumberofneuronsrecordedfromeachanimalwas2–4(n=12cellsrecordedintotalforeachgroup).Student’st‐test:**p<0.01,DSS‐treated ratsvs.controls. Figure 6. Firing properties of pyramidal neurons from the motor cortex of control and DSS-treated rats. ( A ) Membrane potential responses to long-lasting depolarizing current pulses (200 pA) in a representative neuron from control and DSS-treated rats. ( B ) Relationship between current intensity and frequency of action potentials (AP) represented in (A). ( C ) Frequency gain (AP · s −1 /nA). (D) Maximum frequency (AP · s −1 ). ( E ) Cancellation current (pA). Data are means ± SEM. The number of animals was 4 for each experimental condition and the number of neurons recorded from each animal was 2–4 (n= 12 cells recorded in total for each group). Student’s t-test: ** p<0.01, DSS-treated rats vs. controls. 2.6. Colon Inflammation Causes Locomotion and Motor Coordination Deficits As DSS-induced acute colon inflammation results in hyperexcitability of primary motor cortex neurons, we next studied motor behavior by evaluating locomotor activity and motor coordination in control (untreated) and DSS-treated rats. Spontaneous locomotor activity was evaluated at the end of the DSS treatment using an activity cage, as described in the Methods Section. We first measured horizontal activity
Int. J. Mol. Sci. 2022,23, 5347 16 of 21 placed in low-calcium ACSF at 4 ◦ C. Primary motor cortex slices (300 µ m-thick) were obtained on a vibratome, kept at 33 ◦ C for 30 min in an ACSF-filled chamber, and then stored at 21 ◦ C in the same solution until use. For RNA extraction and PCR measurements, the primary motor cortex was dissected, frozen in liquid nitrogen, and stored at − 80 ◦ C until use. The primary motor cortex was identified as previously described [39]. 4.5. Relative Quantification of Real-Time PCR Real-time PCR was carried out as previously described [ 52 ]. Briefly, total RNA was extracted from both the distal colon and primary motor cortex of control and DSS-treated rats using the RNeasy ® kit (Qiagen, Madrid, Spain). cDNA was synthesized from 1 µ g of total RNA using the QuantiTect ® reverse transcription kit (Qiagen), as described by the manufacturer. The primers used are presented in Table 3. Real-time PCR was performed with SsoFast ™ EvaGreen ® Supermix (BioRad, Madrid, Spain). β -Actin served as a reference gene and was used for samples’ normalization. The comparative Ct method was applied to determine the mRNA relative expression and the value of each gene measured in control rats was set at 1. Table 3. Oligonucleotides sequences used for reverse transcription-polymerase chain reaction assays. Gene Symbol Accession No. Sense (50-30) Antisense (50-30) IL-1βNM_031512.2 CTTTCGACAGTGAGGAGAATGAC CCACAGCCACAATGAGTGAC IL-6 NM_012589.2 ACAAGTCGGAGGCTTAATTACA GAAAAGAGTTGTGCAATGGCAA iNOS NM_012611.3 GATGTTGAACTACGTCCTATCTCC GTCTTG GTG AAAGCGGTGTTC nNOS NM_052799.1 CCTTTGAATACCAGCCTGATCC TTGTGATTTGCCTGTCTCTGTG TNF-αNM_012675 CTCACACTCAGATCATCTTCTC TGGTATGAAATGGCAAATCGG β-actin NM_007393 ACCCACACTGTGCCCATCTA CGGAACCGCTCATTGCC Primers were chosen according to the cDNA sequences entered in GenBank and designed using PerlPrimer program v1.1.14 (Parkville, Victoria, Australia). IL-1 β , interleukin 1 β ;IL-6, interleukin 6; iNOS, inducible nitric oxide synthase; nNOS, neuronal nitric oxide synthase; TNF-α, tumor necrosis factor α. 4.6. Immunofluorescence Staining Immunofluorescence assays were performed on coronal brain cryosections including the primary motor cortex of control and DSS-treated rats. Briefly, 20 µ m-thick cryosections applied to adhesive-coated glass slides were washed with PBS, permeabilized with 1% Triton X-100 for 1 h, and blocked with 3% bovine serum albumin (BSA), 3% fetal calf serum (FCS), and 0.1% Triton X-100 in PBS for 1 h at room temperature. Sections were then incubated overnight at 4 ◦ C with the primary antibodies anti-Iba1 and anti-iNOS or anti-GFAP diluted in blocking solution. Primary antibody binding was visualized with the appropriate secondary antibodies: Alexa Fluor-546 or -488. Nuclei were stained with Hoechst 33258 (Invitrogen, Thermo Fisher, Madrid, Spain). Negative controls for primary antibodies were performed in parallel without the correspondent primary antibody. The brain slides were mounted (Vectashield, Vector, Burlingame, CA, USA) and photographed with an Olympus BX61 microscope equipped with a DP73 camera. Images were analyzed using the ImageJ program. Immunofluorescence images were obtained at the “Centro de Investigación Tecnología e Innovación de la Universidad de Sevilla” (CITIUS). 4.7. Microglial and Astrocyte Activation Markers for activated microglial cells (Iba1) and astrocytes (GFAP) were assessed by quantitative immunofluorescence. Increased expression of GFAP is used as a marker of astrocyte activation [ 53 ]. For activated microglia, we measured the Iba1 immunostaining area of both the microglia cell body and the whole cell to determine microglial morphological changes, following the method indicated by Hovens et al. [ 54 ], and the number of either Iba1- and/or iNOS-positive cells [ 55 ]. The analysis was performed by using the ImageJ program. The number of Iba1-positive cells (red color signal), iNOS-positive cells (green color signal), and Iba1-iNOS double staining positive cells (yellow-orange color signal)
Int. J. Mol. Sci. 2022,23, 5347 17 of 21 were counted choosing the same area in all sections (100,000 µ m 2 ). The results of morphological modifications are presented as microglial cell body size to total cell size ratio [ 54 ]. The number of immunofluorescent labelled cells referred to the analyzed area and was expressed as number of cells/mm 2 . For activated astrocytes, the GFAP immunostaining area was measured in a frame of known area (50,000 µ m 2 ) placed on the tissue section and expressed as the percentage of this area. We analyzed 2 immunolabelled sections/rat and in 5–8 fields/section covering a representative area of the primary motor cortex, and a mean of all measurements for each animal was calculated. Quantifications were performed by 3 independent observers blinded to the treatment. 4.8. Whole-Cell Patch-Clamp Recordings and Analysis Electrophysiological parameters were measured using the whole-cell patch-clamp technique and recordings in current- and voltage-clamp mode. The primary motor cortex slices were placed in the recording chamber, perfused with oxygenated ACSF with a pump (P-70, Harvard Apparatus, Cambridge, MA, USA) at 1 mL min −1 , and warmed to 33 ◦ C with a feedback-controlled heater (TC-324B, Warner Instruments Corporation, San Diego, CA, USA). Visual guidance to patch-clamp the neurons includes a Nikon Eclipse FN1 microscope with infrared-differential interference contrast (IR-DIC) optics, a 40 × water-immersion objective, and a WAT-902H2 Ultimate Camera. Pyramidal neurons were identified based on their location within the motor cortex and their remarkable morphology [ 56 ]. Patch pipettes were pulled from a borosilicate glass capillary (inner diameter 0.6, outer diameter 1 mm; World Precision Instruments) using a glass microelectrode puller (PC10, Narishige, London, U.K). Patch electrodes had 3–5 M Ω resistance. The intracellular solution pipette was a K + -gluconate solution containing (in mM): 120 K + -gluconate, 10 KCl, 10 phosphocreatine disodium salt, 2 MgATP, 0.3 NaGTP, 0.1 EGTA, and 10 HEPES (pH 7.3). An osmolarity of 285 mosmol/kg was maintained via adjustment with sucrose [57]. Whole-cell patch-clamp recordings were achieved using a micromanipulator (MP-225, Sutter, Novato, CA, USA) and an amplifier (Multiclamp 700B, Axon Instruments, Molecular Devices, Sunnyvale, CA, USA). Recordings were low-pass Bessel-filtered at 2–10 kHz, and the data were digitized at 2–20 KHz with a Digidata 1550 analog–digital converter and developed on a computer screen using the pCLAMP 10 software (Molecular Devices, San Jose, CA, USA). Data were analyzed using the Clampfit 10.4 software (Molecular Devices, San Jose, CA, USA). In current-clamp mode, the bridge was periodically balanced using the auto-adjust feature. Throughout voltage-clamp recordings, the whole-cell capacitance was measured, and recordings were discontinued if the series resistance increased by >50% or exceeded 20 MΩ. 4.9. Current- and Voltage-Clamp Recordings The following parameters were evaluated to assess the intrinsic electrical properties: resting membrane potential, input resistance, rheobase, voltage threshold, depolarization voltage, action potential amplitude and duration, frequency gain, maximum frequency of discharge, and cancellation current. The methods employed were as previously described [ 37 ]. The resting membrane potential was the difference between the intracellular and extracellular potentials after moving the electrode away. To calculate the input resistance, positive and negative current pulses were injected into the cell (500 ms, 1 Hz; 10 pA each step) and the slope of the current–voltage relationship affords the value of the resistance. Rheobase is the minimum current intensity (100 ms, 1 Hz; 5 pA each step) able to produce an action potential in 50% of cases. The voltage increment in membrane potential required to achieve the voltage threshold was the depolarization voltage. To determine the spike threshold, the action potential recording was differentiated, with the spike onset taken as the value of the membrane potential at which the first derivative exceeded 10 V s −1 . Single action potential amplitude was the difference between the voltage at a resting level and that at the spike peak, and its duration was determined as the width of the spike at its half amplitude. Repetitive discharge was evoked by depolarizing current steps (1 s, 0.5 Hz;
Int. J. Mol. Sci. 2022,23, 5347 18 of 21 10–50 pA increments). The firing frequency was taken as the number of spikes during the repetitive discharge in 1 s. The frequency gain was the slope of the firing frequency and current injected relationship. The maximum firing frequency was the highest frequency achieved by the neurons, regardless of the current intensity, and the cancellation current was the current at which the neuron firing ceases. 4.10. Locomotor Activity and Motor Coordination Assessment Motor behaviors were assessed in control and DSS-treated rats according to the established protocols [58,59]. The spontaneous locomotor activity was measured for 10 min in an active cage, consisting of a novel open-field arena (dimensions 45 × 45 cm) equipped with a photoelectric actimeter (LE8815-Panlab, Barcelona, Spain) with SEDACOM 2.0v software (Barcelona, Spain). The cage projects infrared light beams from one side of the cage to the other. Each time the rat moves around the cage, the beams are interrupted, and this is recorded as “beam break counts”. The arena and surrounding walls were cleaned with water and 70% of ethanol before each session. The different motor behavioral parameters were measured using ActiTrack v.2.7.13 software (PanLab, Barcelona, Spain) with the specific setup. The measurements included total and per minute horizontal motor activity (beam break counts), total distance traveled (in centimeters), locomotion in the center and in the periphery of the arena (beam break counts), percentage of time spent within the center and within the periphery of the arena, number of stereotypes (repetitive movements that is invariant and without a goal), number of grooming movements, total vertical motor activity (expressed in number of rearings), maximum speed (in centimeters/second), percentage of time spent resting, and slow locomotion and fast locomotion. Motor coordination was evaluated using a Rotarod apparatus (LE8505-Panlab, Barcelona, Spain). We performed a two-trial test, with a maximum time of 5 min in the rotarod per trial, and the trials were separated by 20 min. Both trials were performed with a constant acceleration protocol from 4 to 40 rotations per minute (rpm). Rats were placed on the rotating rod, facing away from the direction of rotation so they must walk forward to stay upright, and the rotarod was set with a start speed of 4 rpm, and an acceleration rate of 20 rpm/min . Latency to fall: the time, in seconds, that an animal was able to hold itself on the rod, with a maximum time of 300 s, and maximum speed, in rpm, before the animal falls were recorded. 4.11. Statistical Analysis Statistical analyses were conducted using GraphPad Prism v8.0 (San Diego, CA, USA) and IBM SPSS Statistics v26 programs (Armonk, NY, USA). Data are presented as mean ±standard error of the mean (SEM). To test normality, the Shapiro–Wilk test was applied. Comparisons between the two experimental groups (independent) were evaluated by the two-tailed Student’s t-test. When data were not normally distributed, the Mann–Whitney U-test was used. Comparisons between different measures in the same experimental group (dependent variables) were evaluated with a mixed ANOVA, considering the following assumptions: the dependent variable was measured on a continuous scale, it was normally distributed, and there was homogeneity of variances, and pairwise comparisons were corrected by the Bonferroni test. If the normality and/or the homogeneity of variances assumptions were violated, a Friedman test was used followed by a post hoc Wilcoxon signed-ranked test. Differences were set to be significant at p< 0.05, unless stated otherwise. 5. Conclusions This is the first report showing that DSS-induced acute colon inflammation produces microglial and astrocyte activation in the primary motor cortex. The microglial and astrocyte activation and the increased pro-inflammatory environment might trigger motor neuron hyperexcitability. This hyperexcitability is apparently mediated by a depolarized
Int. J. Mol. Sci. 2022,23, 5347 19 of 21 resting membrane potential, decreased rheobase, and increased action potentials’ frequency gain, that could make the pyramidal neurons more vulnerable to injury. Locomotion and motor coordination impairments were also detected in DSS-treated rats. As these alterations are present at the early stages of the ALS pathology, it could be inferred that colon inflammation contributes to ALS development. Supplementary Materials: The following supporting information can be downloaded at: https: //www.mdpi.com/article/10.3390/ijms23105347/s1. Author Contributions: M.D.V.-C. and P.G.-M. performed the animal treatments, colon inflammation assessment, PCR, and immunohistochemistry experiments; L.C. performed electrophysiology experiments; Á.F.-L. performed the motor behavior tests; M.D.V.-C., P.G.-M., L.C., Á.F.-L. and M.L.C. analyzed data and contributed to figures’ preparation; A.A.I. carried out a critical revision of the manuscript; P.N.-A., C.C. and A.A.I. contributed to the analysis of the results; M.J.P. analyzed data, designed and supervised the work, and prepared the manuscript. All authors discussed the results and have read and approved the final version of the manuscript. Funding: This work was supported in part by Grant 18.06.07.3005 PID2019-105632RB-I00, funded by MCIN/AEI/10.13039/501100011033, granted to M.J.P., and by Grant RTI-2018.099908-B-C21, funded by MCIN/AEI, granted to C.C. Institutional Review Board Statement: Rats were humanely handled, and efforts were made to minimize the number of animals used and their suffering. The procedures concerning the protection of experimental animals were in accordance with the guidelines of the European Union Council (Directive 2010/63/UE) and the Spanish Royal Decree (BOE 34/11370, 2013). Experiments were approved by the Animal Ethics Committee of the University of Seville and Junta de Andalucía (15/01/2020/001, 23 January 2020). Informed Consent Statement: Not applicable. Data Availability Statement: The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. Acknowledgments: We thank AM. Pastor-Loro for providing the apparatus to conduct behavioral experiments and A. Ruiz-Calero and G. Sotelo for the technical support. Conflicts of Interest: The authors declare no conflict of interest. References 1. Glass, C.K.; Saijo, K.; Winner, B.; Marchetto, M.C.; Gage, F.H. Mechanisms Underlying Inflammation in Neurodegeneration. Cell 2010,140, 918–934. [CrossRef] [PubMed] 2. Butovsky, O.; Weiner, H.L. Microglial signatures and their role in health and disease. Nat. Rev. Neurosci. 2018 ,19, 622–635. [CrossRef] [PubMed] 3. Tricoire, L.; Vitalis, T. Neuronal nitric oxide synthase expressing neurons: A journey from birth to neuronal circuits. Front. Neural Circuits 2012,6, 82. [CrossRef] [PubMed] 4. Kempuraj, D.; Thangavel, R.; Selvakumar, G.P.; Zaheer, S.; Ahmed, M.E.; Raikwar, S.P.; Zahoor, H.; Saeed, D.; Natteru, P.A.; Iyer, S.; et al . Brain and peripheral atypical inflammatory mediators potentiate neuroinflammation and neurodegeneration. Front. Cell. Neurosci. 2017,11, 216. [CrossRef] [PubMed] 5. Neuendorf, R.; Harding, A.; Stello, N.; Hanes, D.; Wahbeh, H. Depression and anxiety in patients with Inflammatory Bowel Disease: A systematic review. J. Psychosom. Res. 2016,87, 70–80. [CrossRef] [PubMed] 6. Petruo, V.A.; Zeißig, S.; Schmelz, R.; Hampe, J.; Beste, C. Specific neurophysiological mechanisms underlie cognitive inflexibility in inflammatory bowel disease. Sci. Rep. 2017,7, 13943. [CrossRef] 7. Herrera, A.; Espinosa-Oliva, A.; Oliva-Martin, M.; Carrillo-Jimenez, A.; Venero, J.; de Pablos, R. Collateral Damage: Contribution of Peripheral Inflammation to Neurodegenerative Diseases. Curr. Top. Med. Chem. 2015,15, 2193–2210. [CrossRef] 8. Pellegrini, C.; Antonioli, L.; Colucci, R.; Blandizzi, C.; Fornai, M. Interplay among gut microbiota, intestinal mucosal barrier and enteric neuro-immune system: A common path to neurodegenerative diseases? Acta Neuropathol. 2018 ,136, 345–361. [CrossRef] 9. Rao, M.; Gershon, M.D. The bowel and beyond: The enteric nervous system in neurological disorders. Nat. Rev. Gastroenterol. Hepatol. 2016,13, 517–528. [CrossRef] 10. Abautret-Daly, Á.; Dempsey, E.; Parra-Blanco, A.; Medina, C.; Harkin, A. Gut-brain actions underlying comorbid anxiety and depression associated with inflammatory bowel disease. Acta Neuropsychiatr. 2018,30, 275–296. [CrossRef]
Int. J. Mol. Sci. 2022,23, 5347 20 of 21 11. Dempsey, E.; Abautret-Daly, Á.; Docherty, N.G.; Medina, C.; Harkin, A. Persistent central inflammation and region specific cellular activation accompany depression- and anxiety-like behaviours during the resolution phase of experimental colitis. Brain. Behav. Immun. 2019,80, 616–632. [CrossRef] [PubMed] 12. Riazi, K.; Galic, M.A.; Kuzmiski, J.B.; Ho, W.; Sharkey, K.A.; Pittman, Q.J. Microglial activation and TNF α production mediate altered CNS excitability following peripheral inflammation. Proc. Natl. Acad. Sci. USA 2008 ,105, 17151–17156. [CrossRef] [PubMed] 13. Zonis, S.; Pechnick, R.N.; Ljubimov, V.A.; Mahgerefteh, M.; Wawrowsky, K.; Michelsen, K.S.; Chesnokova, V. Chronic intestinal inflammation alters hippocampal neurogenesis. J. Neuroinflamm. 2015,12, 65. [CrossRef] [PubMed] 14. Han, Y.; Zhao, T.; Cheng, X.; Zhao, M.; Gong, S.-H.; Zhao, Y.-Q.; Wu, H.-T.; Fan, M.; Zhu, L.-L. Cortical Inflammation is Increased in a DSS-Induced Colitis Mouse Model. Neurosci. Bull. 2018,34, 1058–1066. [CrossRef] [PubMed] 15. Villarán, R.F.; Espinosa-Oliva, A.M.; Sarmiento, M.; De Pablos, R.M.; Argüelles, S.; Delgado-Cortés, M.J.; Sobrino, V.; Van Rooijen, N.; Venero, J.L.; Herrera, A.J.; et al. Ulcerative colitis exacerbates lipopolysaccharide-induced damage to the nigral dopaminergic system: Potential risk factor in Parkinson’s disease. J. Neurochem. 2010,114, 1687–1700. [CrossRef] 16. Espinosa-Oliva, A.M.; García-Miranda, P.; Alonso-Bellido, I.M.; Carvajal, A.E.; González-Rodríguez, M.; Carrillo-Jiménez, A.; Temblador, A.J.; Felices-Navarro, M.; García-Domínguez, I.; Roca-Ceballos, M.A.; et al. Galectin-3 Deletion Reduces LPS and Acute Colitis-Induced Pro-Inflammatory Microglial Activation in the Ventral Mesencephalon. Front. Pharmacol. 2021 ,12, 706439. [CrossRef] 17. Riazi, K.; Galic, M.A.; Kentner, A.C.; Reid, A.Y.; Sharkey, K.A.; Pittman, Q.J. Microglia-dependent alteration of glutamatergic synaptic transmission and plasticity in the hippocampus during peripheral inflammation. J. Neurosci. 2015 ,35, 4942–4952. [CrossRef] 18. Chen, J.; Winston, J.H.; Fu, Y.; Guptarak, J.; Jensen, K.L.; Shi, X.Z.; Green, T.A.; Sarna, S.K. Genesis of anxiety, depression, and ongoing abdominal discomfort in ulcerative colitis-like colon inflammation. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2015 ,308, R18–R27. [CrossRef] 19. Hassan, A.M.; Jain, P.; Reichmann, F.; Mayerhofer, R.; Farzi, A.; Schuligoi, R.; Holzer, P. Repeated predictable stress causes resilience against colitis-induced behavioral changes in mice. Front. Behav. Neurosci. 2014,8, 386. [CrossRef] 20. Nyuyki, K.D.; Cluny, N.L.; Swain, M.G.; Sharkey, K.A.; Pittman, Q.J. Altered brain excitability and increased anxiety in mice with experimental colitis: Consideration of hyperalgesia and sex differences. Front. Behav. Neurosci. 2018,12, 58. [CrossRef] 21. Mochizuki, Y.; Mizutani, T.; Shimizu, T.; Kawata, A. Proportional neuronal loss between the primary motor and sensory cortex in amyotrophic lateral sclerosis. Neurosci. Lett. 2011,503, 73–75. [CrossRef] [PubMed] 22. Brites, D.; Vaz, A.R. Microglia centered pathogenesis in ALS: Insights in cell interconnectivity. Front. Cell. Neurosci. 2014 ,8, 117. [CrossRef] [PubMed] 23. Yamanaka, K.; Komine, O. The multi-dimensional roles of astrocytes in ALS. Neurosci. Res. 2018 ,126, 31–38. [CrossRef] [PubMed] 24. Pradhan, J.; Bellingham, M.C. Neurophysiological mechanisms underlying cortical hyper-excitability in amyotrophic lateral sclerosis: A review. Brain Sci. 2021,11, 549. [CrossRef] [PubMed] 25. Ferraro, G.; Sardo, P. Nitric oxide and brain hyperexcitability. In Vivo 2004,18, 357–366. 26. Brown, G.C. Mechanisms of inflammatory neurodegeneration: INOS and NADPH oxidase. Biochem. Soc. Trans. 2007 ,35, 1119–1121. [CrossRef] [PubMed] 27. Vezzani, A.; Viviani, B. Neuromodulatory properties of inflammatory cytokines and their impact on neuronal excitability. Neuropharmacology 2015,96, 70–82. [CrossRef] 28. Kempuraj, D.; Thangavel, R.; Natteru, P.A.; Selvakumar, G.P.; Saeed, D.; Zahoor, H.; Zaheer, S.; Iyer, S.S.; Zaheer, A. Neuroinflammation Induces Neurodegeneration. J. Neurol. Neurosurg. Spine 2016,1, 1003. 29. Thonhoff, J.R.; Jordan, P.M.; Karam, J.R.; Bassett, B.L.; Wu, P. Identification of early disease progression in an ALS rat model. Neurosci. Lett. 2007,415, 264–268. [CrossRef] 30. Hayworth, C.R.; Gonzalez-Lima, F. Pre-symptomatic detection of chronic motor deficits and genotype prediction in congenic B6.SOD1G93A ALS mouse model. Neuroscience 2009,164, 975–985. [CrossRef] 31. Sahara Khademullah, C.; Aqrabawi, A.J.; Place, K.M.; Dargaei, Z.; Liang, X.; Pressey, J.C.; Bedard, S.; Yang, J.W.; Garand, D.; Keramidis, I.; et al. Cortical interneuron-mediated inhibition delays the onset of amyotrophic lateral sclerosis. Brain 2020 ,143, 800–810. [CrossRef] [PubMed] 32. Do, J.; Woo, J. From Gut to Brain: Alteration in Inflammation Markers in the Brain of Dextran Sodium Sulfate-induced Colitis Model Mice. Clin. Psychopharmacol. Neurosci. 2018,16, 422–433. [CrossRef] [PubMed] 33. Agostini, A.; Filippini, N.; Cevolani, D.; Agati, R.; Leoni, C.; Tambasco, R.; Calabrese, C.; Rizzello, F.; Gionchetti, P.; Ercolani, M.; et al. Brain functional changes in patients with ulcerative colitis: A functional magnetic resonance imaging study on emotional processing. Inflamm. Bowel Dis. 2011,17, 1769–1777. [CrossRef] 34. Fan, W.; Zhang, S.; Hu, J.; Liu, B.; Wen, L.; Gong, M.; Wang, G.; Yang, L.; Chen, Y.; Chen, H.; et al. Aberrant brain function in active-stage ulcerative colitis patients: A resting-state functional MRI study. Front. Hum. Neurosci. 2019 ,13, 107. [CrossRef] [PubMed] 35. Bao, C.H.; Liu, P.; Liu, H.R.; Wu, L.Y.; Shi, Y.; Chen, W.F.; Qin, W.; Lu, Y.; Zhang, J.Y.; Jin, X.M.; et al. Alterations in brain grey matter structures in patients with Crohn’s disease and their correlation with psychological distress. J. Crohn’s Colitis 2015 ,9, 532–540. [CrossRef] [PubMed]
Int. J. Mol. Sci. 2022,23, 5347 21 of 21 36. Pardillo-Díaz, R.; Carrascal, L.; Ayala, A.; Nunez-Abades, P. Oxidative stress induced by cumene hydroperoxide evokes changes in neuronal excitability of rat motor cortex neurons. Neuroscience 2015,289, 85–98. [CrossRef] 37. Carrascal, L.; Gorton, E.; Pardillo-Díaz, R.; Perez-García, P.; Gómez-Oliva, R.; Castro, C.; Nunez-Abades, P. Age-dependent vulnerability to oxidative stress of postnatal rat pyramidal motor cortex neurons. Antioxidants 2020,9, 1307. [CrossRef] 38. LoRusso, E.; Hickman, J.J.; Guo, X. Ion channel dysfunction and altered motoneuron excitability in ALS. Neurol. Disord. Epilepsy J. 2019,3, 124. 39. Pardillo-Diaz, R.; Carrascal, L.; Barrionuevo, G.; Nunez-Abades, P. Oxidative stress induced by cumene hydroperoxide produces synaptic depression and transient hyperexcitability in rat primary motor cortex neurons. Mol. Cell. Neurosci. 2017 ,82, 204–217. [CrossRef] 40. Torres-Torrelo, J.; Rodríguez-Rosell, D.; Nunez-Abades, P.; Carrascal, L.; Torres, B. Glutamate modulates the firing rate in oculomotor nucleus motoneurons as a function of the recruitment threshold current. J. Physiol. 2012 ,590, 3113–3127. [CrossRef] 41. Torres-Torrelo, J.; Torres, B.; Carrascal, L. Modulation of the input-output function by GABAA receptor-mediated currents in rat oculomotor nucleus motoneurons. J. Physiol. 2014,592, 5047–5064. [CrossRef] [PubMed] 42. King, A.E.; Woodhouse, A.; Kirkcaldie, M.T.K.; Vickers, J.C. Excitotoxicity in ALS: Overstimulation, or overreaction? Exp. Neurol. 2016,275, 162–171. [CrossRef] [PubMed] 43. Takeuchi, H.; Jin, S.; Wang, J.; Zhang, G.; Kawanokuchi, J.; Kuno, R.; Sonobe, Y.; Mizuno, T.; Suzumura, A. Tumor necrosis factorα induces neurotoxicity via glutamate release from hemichannels of activated microglia in an autocrine manner. J. Biol. Chem. 2006,281, 21362–21368. [CrossRef] [PubMed] 44. Garthwaite, J. Concepts of neural nitric oxide-mediated transmission. Eur. J. Neurosci. 2008 ,27, 2783–2802. [CrossRef] [PubMed] 45. Shimizu, S.; Takahashi, N.; Mori, Y. TRPs as chemosensors (ROS, RNS, RCS, gasotransmitters). Handb. Exp. Pharmacol. 2014 ,223, 767–794. [CrossRef] 46. Zaltman, C.; Braulio, V.B.; Outeiral, R.; Nunes, T.; de Castro, C.L.N. Lower extremity mobility limitation and impaired muscle function in women with ulcerative colitis. J. Crohn’s Colitis 2014,8, 529–535. [CrossRef] 47. Valentini, L.; Schaper, L.; Buning, C.; Hengstermann, S.; Koernicke, T.; Tillinger, W.; Guglielmi, F.W.; Norman, K.; Buhner, S.; Ockenga, J.; et al. Malnutrition and impaired muscle strength in patients with Crohn’s disease and ulcerative colitis in remission. Nutrition 2008,24, 694–702. [CrossRef] 48. Werkstetter, K.J.; Ullrich, J.; Schatz, S.B.; Prell, C.; Koletzko, B.; Koletzko, S. Lean body mass, physical activity and quality of life in paediatric patients with inflammatory bowel disease and in healthy controls. J. Crohn’s Colitis 2012,6, 665–673. [CrossRef] 49. Mohammadi, B.; Kollewe, K.; Cole, D.M.; Fellbrich, A.; Heldmann, M.; Samii, A.; Dengler, R.; Petri, S.; Münte, T.F.; Krämer, U.M. Amyotrophic lateral sclerosis affects cortical and subcortical activity underlying motor inhibition and action monitoring. Hum. Brain Mapp. 2015,36, 2878–2889. [CrossRef] 50. Eisen, A.; Braak, H.; Del Tredici, K.; Lemon, R.; Ludolph, A.C.; Kiernan, M.C. Cortical influences drive amyotrophic lateral sclerosis. J. Neurol. Neurosurg. Psychiatry 2017,88, 917–924. [CrossRef] 51. Menon, P.; Kiernan, M.C.; Vucic, S. Cortical hyperexcitability precedes lower motor neuron dysfunction in ALS. Clin. Neurophysiol. 2015,126, 803–809. [CrossRef] [PubMed] 52. Carvajal, A.E.; Vázquez-Carretero, M.D.; García-Miranda, P.; Peral, M.J.; Calonge, M.L.; Ilundain, A.A. Reelin expression is up-regulated in mice colon in response to acute colitis and provides resistance against colitis. Biochim. Biophys. Acta-Mol. Basis Dis. 2017,1863, 462–473. [CrossRef] [PubMed] 53. Sofroniew, M.V. Molecular dissection of reactive astrogliosis and glial scar formation. Trends Neurosci. 2009 ,32, 638–647. [CrossRef] [PubMed] 54. Hovens, I.; Nyakas, C.; Schoemaker, R. A novel method for evaluating microglial activation using ionized calcium-binding adaptor protein-1 staining: Cell body to cell size ratio. Neuroimmunol. Neuroinflamm. 2014,1, 82–88. [CrossRef] 55. Chhor, V.; Le Charpentier, T.; Lebon, S.; Oré, M.V.; Celador, I.L.; Josserand, J.; Degos, V.; Jacotot, E.; Hagberg, H.; Sävman, K.; et al. Characterization of phenotype markers and neuronotoxic potential of polarised primary microglia in vitro .Brain. Behav. Immun. 2013,32, 70–85. [CrossRef] 56. Pardillo-Díaz, R.; Carrascal, L.; Muñoz, M.F.; Ayala, A.; Nunez-Abades, P. Time and dose dependent effects of oxidative stress induced by cumene hydroperoxide in neuronal excitability of rat motor cortex neurons. Neurotoxicology 2016 ,53, 201–214. [CrossRef] 57. Segev, D.; Korngreen, A. Kinetics of two voltage-gated K + conductances in substantia nigra dopaminergic neurons. Brain Res. 2007,1173, 27–35. [CrossRef] 58. Belujon, P.; Bezard, E.; Taupignon, A.; Bioulac, B.; Benazzouz, A. Noradrenergic modulation of subthalamic nucleus activity: Behavioral and electrophysiological evidence in intact and 6-hydroxydopamine-lesioned rats. J. Neurosci. 2007 ,27, 9595–9606. [CrossRef] 59. Carter, R.J.; Morton, J.; Dunnett, S.B. Motor Coordination and Balance in Rodents. Curr. Protoc. Neurosci. 2001 ,15, 8.12.1–8.12.14. [CrossRef]