Beyond new neurons in the adult hippocampus: imipramine acts as a pro-astrogliogenic factor and rescues cognitive impairments induced by stress exposure

  Citation: Machado-Santos, A.R.; Loureiro-Campos, E.; Patrício, P.; Araújo, B.; Alves, N.D.; Mateus-Pinheiro, A.; Correia, J.S.; Morais, M.; Bessa, J.M.; Sousa, N.; et al. Beyond New Neurons in the Adult Hippocampus: Imipramine Acts as a Pro-Astrogliogenic Factor and Rescues Cognitive Impairments Induced by Stress Exposure. Cells 2022,11, 390. https://doi.org/ 10.3390/cells11030390 Academic Editor: Dmitri Rusakov Received: 17 December 2021 Accepted: 21 January 2022 Published: 24 January 2022 Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. Copyright: © 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). cells Article Beyond New Neurons in the Adult Hippocampus: Imipramine Acts as a Pro-Astrogliogenic Factor and Rescues Cognitive Impairments Induced by Stress Exposure Ana R. Machado-Santos 1,2,†, Eduardo Loureiro-Campos 1,2,†, Patrícia Patrício 1,2, Bruna Araújo 1,2, Nuno Dinis Alves 1,2,‡ , António Mateus-Pinheiro 1,2, Joana Sofia Correia 1,2 , Mónica Morais 1,2, João M. Bessa 1,2, Nuno Sousa 1,2, Ana J. Rodrigues 1,2, João Filipe Oliveira 1,2,3,* and Luísa Pinto 1,2,* 1Life and Health Sciences Research Institute (ICVS), School of Medicine, University of Minho, 4710-057 Braga, Portugal; [email protected] (A.R.M.-S.); [email protected] (E.L.-C.); [email protected] (P.P.); [email protected] (B.A.); [email protected] (N.D.A.); [email protected] (A.M.-P.); [email protected] (J.S.C.); [email protected] (M.M.); [email protected] (J.M.B.); [email protected] (N.S.); [email protected] (A.J.R.) 2ICVS/3B’s—PT Government Associate Laboratory, Braga/Guimarães, Portugal 3IPCA-EST-2Ai, Polytechnic Institute of Cávado and Ave, Applied Artificial Intelligence Laboratory, Campus of IPCA, 4750-810 Barcelos, Portugal *Correspondence: [email protected] (J.F.O.); [email protected] (L.P.); Tel.: +351-253604929 (L.P.) † These authors contributed equally to the work and are joint first authors. ‡ Current affiliation: Department of Psychiatry, New York State Psychiatric Institute, Columbia University, New York, NY 10032, USA. Abstract: Depression is a prevalent, socially burdensome disease. Different studies have demonstrated the important role of astrocytes in the pathophysiology of depression as modulators of neurotransmission and neurovascular coupling. This is evidenced by astrocyte impairments observed in brains of depressed patients and the appearance of depressive-like behaviors upon astrocytic dysfunctions in animal models. However, little is known about the importance of de novo generated astrocytes in the mammalian brain and in particular its possible involvement in the precipitation of depression and in the therapeutic actions of current antidepressants (ADs). Therefore, we studied the modulation of astrocytes and adult astrogliogenesis in the hippocampal dentate gyrus (DG) of rats exposed to an unpredictable chronic mild stress (uCMS) protocol, untreated and treated for two weeks with antidepressants—fluoxetine and imipramine. Our results show that adult astrogliogenesis in the DG is modulated by stress and imipramine. This study reveals that distinct classes of ADs impact differently in the astrogliogenic process, showing different cellular mechanisms relevant to the recovery from behavioral deficits induced by chronic stress exposure. As such, in addition to those resident, the newborn astrocytes in the hippocampal DG might also be promising therapeutic targets for future therapies in the neuropsychiatric field. Keywords: astrocytes; hippocampus; dentate gyrus; astrogliogenesis; chronic stress; antidepressants 1. Introduction Major depressive disorder (MDD) is a prevalent neuropsychiatric disorder. Despite the effort to elucidate the neurobiology of MDD, its pathophysiology remains poorly understood, and the available therapeutic compounds are not effective in every patient. Therefore, it is crucial to fully unravel the mechanisms underlying this disorder and discover new therapeutic targets. Several hypotheses have been proposed to explain the neurobiological mechanisms underlying the onset, maintenance, and recovery of depression [ 1 – 4 ]. During the last Cells 2022,11, 390. https://doi.org/10.3390/cells11030390 https://www.mdpi.com/journal/cells Cells 2022,11, 390 2 of 18 decades, a significant number of studies revealed cell loss and neuronal atrophy, particularly in brain loci relevant for emotional behavior control—the hippocampus [ 5 – 11 ]. Multiple mechanisms were proposed to be responsible for this neuronal atrophy, namely glucocorticoid and glutamate toxicity for both astrocytes and neurons [ 12 ], decreased expression of neurotrophic factors [ 13 , 14 ], and decreased neuroplasticity [ 15 – 17 ]. However, most of the evidence gathered to date focuses on neuronal cells in disregard of glial cells, which has, for a long time, contributed to a neurocentric view of the disease. It is now well recognized that glial cells, namely astrocytes, are not only responsible for providing support to neuronal cells, but they also undergo several plastic alterations both in the healthy and depressed brain [ 8 , 18 – 23 ]. Astrocytes are the most common type of glial cells in the adult mammalian brain, playing a relevant role in neuronal activity and function modulation [ 24 – 27 ]. Astrocytes are being recognized as a stress response hub, influencing cytogenesis, morphology, and synaptic plasticity in chronic stress contexts, and other diseases [ 28 – 33 ]. Studies either in animal models of depressive-like behavior [ 34 – 38 ] or in postmortem brain tissue of MDD patients [ 8 , 39 – 41 ] have reported a decreased number of astrocytes in different frontolimbic areas, including the medial prefrontal cortex (PFC), as well as in the dorsolateral and orbitofrontal cortex, the amygdala, and the hippocampus. Furthermore, the expression of S100 β , a selective marker of mature astrocytes, was also found to be altered in postmortem brain tissue of depressive patients [ 42 ]. Besides cell density alterations, astrocytic size and morphology are also changed in depressed individuals. Increased glial cell nuclei size [ 39 , 41 , 43 , 44 ] has been observed in depressed individuals and proposed to be compensatory response to the metabolic needs of the surrounding neurons [8,39,45,46]. Importantly, astrocytes were recently described to integrate neural circuits involved in MDD, suggesting a relevant role for several emotional behaviors [ 47 , 48 ]. Specifically, selective deletion of astrocytes in the medial PFC induce depressive-like behavior and triggers cognitive impairments in rodents [ 10 , 49 , 50 ]. However, there is still little research on the potential of newborn astrocytes both in the pathophysiology of depression and in the actions of current antidepressants (ADs). The generation of astrocytes—astrogliogenesis—in the adult brain has been repeatedly demonstrated [ 8 , 36 , 49 – 51 ]. Unlike neurons, glial cells retain their ability to proliferate in most areas of the brain, postnatally and even during adulthood [ 8 , 52 – 54 ]. Particularly, the generation of astrocytes is also detectable in the neocortex and hippocampus of the adult human brain [ 55 , 56 ]. Concomitantly, in adult rats, around 15% of newborn cells in the hippocampal dentate gyrus (DG) are positive for the astrocytic marker glial fibrillary acidic protein (GFAP) weeks post cell birth, using a tracing method [ 8 ]. Interestingly, glucocorticoid treatment—which mimics the elevation of blood glucocorticoids (GCs) that may occur under chronic stress exposure—decreases astrocytic proliferation in the adult rat hippocampus [ 57 , 58 ]. In line with this effect, in rats, exposure to chronic unpredictable stress decreases astrocyte proliferation in the prelimbic cortex [ 35 , 37 ]. Of relevance, this stress-induced decrease in newborn astrocytes is counteracted by the treatment with the AD fluoxetine [ 35 , 37 ]. Interestingly, fluoxetine treatment does not alter the neuron-to-glia ratio, suggesting it also increases the number of newborn astrocytes in the adult brain [ 8 ]. Therefore, it becomes necessary to clarify how newborn astrocytes are modulated by stress and ADs treatment, and which molecular changes are impairing adult astrogliogenesis in the context of MDD. To better understand the importance of astrogliogenic plasticity in the context of depression, we longitudinally assessed dynamic alterations of resident and newborn astrocytes in the hippocampal DG of rats under exposure to unpredictable chronic mild stress (uCMS) and AD treatment either with fluoxetine—a selective inhibitor of serotonin reuptake—or imipramine—a tricyclic agent and a potent inhibitor of serotonin and norepinephrine reuptake. We assessed shortand long-term astrocytic alterations immediately after stress exposure and AD treatment and after a four-weeks period, respectively. We show that imipramine increased the number of newborn astrocytes in the hippocampal DG Cells 2022,11, 390 3 of 18 4 weeks after stress exposure, while fluoxetine induced hypertrophy of both pre-existent and newborn astrocytes in the same region. Interestingly, only imipramine could significantly rescue the cognitive impairments transiently induced by stress exposure. Therefore, this study provides a better understanding of the role of glial cells in MDD paving the way to the comprehension of astrogliogenic factors as therapeutic targets for this disease. 2. Materials and Methods 2.1. Animals Male Wistar–Han rats 2 months of age (Charles River Laboratories, L’Arbresle, France) were used for all in vivo experiments. Those animals were housed in groups and kept under standard laboratory conditions, i.e., 22 ± 1 ◦ C, 12h light/dark cycle, 55% relative humidity, and ad libitum access to water and food. Rats from three independent cohorts were randomly divided into four groups (n= 14–16 per group were used for behavioral analysis, of which 6–8 were used for gene expression quantification, immunofluorescence, and morphologic studies. In detail, we used samples from three independent cohorts for a short-term analysis (immediately after stress exposure—tp1) and samples from two independent cohorts for a long-term analysis (4 weeks after stress exposure—tp2), for gene expression quantification, immunofluorescence, and morphologic purposes. All the procedures were conducted under the European Directive 2010/63/EU, and experiments were approved by the University of Minho Subcommittee of Ethics for the Life and Health Sciences (SECVS068/2017). 2.2. Unpredictable Chronic Mild Stress—uCMSand Drug Treatment Animals were exposed to a pre-validated 6-weeks uCMS protocol, as already described [ 15 , 16 ]. This protocol induced depressive-like behavior, anxious phenotype, as well as cognitive deficits in rats through an arbitrary and unpredictable exposure to various different mild stressors. Following previous studies [ 15 , 16 ], in the last 2 weeks of the uCMS protocol, animals were daily injected with saline (SAL, 0.9% NaCl, intraperitoneal injection) or with distinct Ads—fluoxetine (FLX; 10mg · kg −1 , Kemprotec, Middlesbrough, UK) or imipramine (IMIP; 10mg · kg −1 ; Kemprotec). Concomitantly, a group of animals was not exposed to uCMS but was injected with saline (CTRL). To track adult-born cells formed immediately after ADs treatment, all groups of animals received injections of bromodeoxyuridine (BrdU, 50 mgkg −1 ; intraperitoneal injections; Sigma-Aldrich, St. Louis, MO, USA) for 5 days (2 days during and 3 days next to the termination of the uCMS protocol). A subset of animals (n= 8–10) was not subjected to any stressor in the following 4 weeks after uCMS exposure (long-term time point of analysis). 2.3. Behavioral Analysis During the experimental protocol, we monitored rats’ behavior at different time-points. At week 6, which corresponds to the end of uCMS protocol and AD treatment, animals were submitted to the Sucrose Consumption test to assess anhedonic-like behavior [ 59 ], to the Forced Swimming test to measure stress-coping [ 59 ], and to the Open-field test to evaluate anxiety-like behavior. To assess memory performance in a longitudinal manner, rats were subjected to the Novel Object Recognition test immediately after uCMS and 4 weeks later. 2.3.1. Forced Swim Test (FST) FST trials were performed 24 h after a 5 min pre-test session. For this purpose, rats were placed in water filled glass cylinders (23 ◦ C; 50 cm deep) during 5 min. An increase in immobility time was related with an impaired performance to cope with an inescapable stress. Cells 2022,11, 390 4 of 18 2.3.2. Sucrose Consumption Test (SCT) Rats were exposed to a sucrose solution in the week before the start of the uCMS protocol with the aim of establishing the baseline preference levels. To assess sucrose preference, access to food and water was denied for 12 h, after which the animals were presented with two pre-weighed bottles—one containing 2% sucrose solution and the other tap water—for a period of 1 h (starting at the beginning of the dark period). Sucrose preference calculation was considered as previously described [15,59]. 2.3.3. Open Field Test Open-field test was performed in a room brightly illuminated by white light. Briefly, rats were placed in the center of an arena (43.2 × 43.2cm 2 , transparent acrylic walls and white floor, MedAssociates, St Albans, VT, USA), and their position was monitored over 5min through two 16-beam infrared arrays. The percentage of time spent in the center of the arena was used as a direct measure of anxiety-like behavior. 2.3.4. Novel Object Recognition (NOR) Short and long-term memory were assessed through the NOR test [ 60 ]. To first familiarize the rats with the testing arena that consisted of a black acrylic box (50 cm × 50 cm × 150 cm) with an open field space, they were placed inside it for 8 min without any objects. On the day after, rats were allowed to freely explore the arena with two identical objects, for 10 min. Then, 24 h later, the animals returned to the arena for 3 min, where one of the objects was replaced by a new one. Importantly, the familiar and new objects were different in color, shape, size, and texture. Between trials, the arena was always cleaned with 10% ethanol to avoid odor cues [ 61 ]. All sessions were videotaped and the time spent exploring each object was assessed manually (blind analysis). For repeated testing, different objects were used at each time point (tp1 and tp2). The percentage of time spent exploring the novel object was correlated with longand short-term memories performance. 2.4. Serum Corticosterone Levels Measurement Corticosterone levels were measured in the rat’s blood serum using a radioimmunoassay (RIA) kit (MP Biomedicals), according to the manufacturer’s instructions. Blood sampling (tail venipuncture) was performed at the beginning of the diurnal period (Nadir, N, 08:00–09:00) and of the nocturnal period (Zenith, N, 20:00–21:00) in the sixth week of the uCMS protocol [62]. 2.5. Hippocampal DG Primary Cultures Threeto five-day-old rats (Wistar Han) were rapidly decapitated and their brains collected. Then, we removed the meninges, separated the hemispheres, and macrodissected the hippocampi in ice-cold DMEM + 10% FBS. After mechanical trituration and several washes in DMEM + 10% FBS, cells were seeded in 12-well plates (NUNC) with neurospheres medium (3 mL; DMEM-F12-GlutaMAX ™ , B27 supplement 2%, Pen-Strep 1%, HEPES buffer 8 mM, bFGF, and EGF (10 ng/ µ L). We added Dexamethasone (DEX, Fortecortin, Merck; 1 µ M) to all plates besides the control ones. Viable progenitor hippocampal DG cells were counted by trypan blue exclusion assay in a hemocytometer and platted in PDL-coated 24-well plates at a density of 80,000 cells–100,000/well. Cells were kept at 37 ◦ C in 5% CO 2 and humid atmosphere. On the following day, the plates were carefully washed 3 times with differentiation medium (Neurobasal A, B27 supplement 2%, Pen-Strep 1%, HEPES buffer 8 mM), and 500 µ L of the medium was added to every plate. DEX was added every 2 days to the medium. In the last 4 days of culturing, Desipramine (10 µ M, Sigma-Aldrich, St. Louis, MO, USA) or Norfluoxetine hydrochloride (10 µ M, Sigma-Aldrich, St. Louis, MO, USA) were added to the culture. BrdU (10 µ M, Sigma-Aldrich, St. Louis, MO, USA) was also added in the last 4 days. Cells were fixed at day 8 for further immunostaining analysis. Cells 2022,11, 390 5 of 18 2.6. Immunostaining Procedures 2.6.1. In Vivo Rats (n= 6–8 per group) were deeply anesthetized with sodium pentobarbital (20%; 100 mg · kg −1 , Eutasil ® , Sanofi, Gentilly, France) and transcardially perfused with 0.9% saline followed by cold 4% paraformaldehyde (PFA). Animals’ brains were removed and fixed in 4% PFA, followed by a cryoprotection in 30% sucrose overnight, and finally embedded in Optimal Cutting Temperature compound (OCT, ThermoScientific, Waltham, MA, USA), snap-frozen and stored at − 20 ◦ C. Coronal sections (20 µ m) containing the dorsal pole of the hippocampal dentate gyrus (DG) were further stained to measure the number and assess the morphology of astrocytic populations. Sections were stained with anti-GFAP (#20334; 1:200; Dako, Glostrup, Denmark), anti-BrdU (#6226; 1:100; Abcam, Cambridge, UK), and anti-S100 β (#AMAB91038; 1:100; Dako, Glostrup, Denmark) antibodies. 4 0 ,6diamidino-2-phenylindole (DAPI, 1:200; Sigma Aldrich) was used for cell nuclei staining. The quantification of cells per DG was performed individually for each DG, and the density of each cell population was determined by the ratio between the total number of cells and the respective area. Double-stained (GFAP + BrdU + ) cells were analyzed the same way. Analysis and cell counting were performed with a confocal microscope (Olympus FluoViewTM FV1000, Hamburg, Germany) and each area was determined with an optical microscope (Olympus BX51). Importantly, GFAP + cells in DG subgranular layer that exhibited a radial morphology were not included in the analysis as these cells are typically classified as (type-1) neural stem cells. All the analyses were blind. Cell densities are conveyed as the number of cells per 100 µm2. 2.6.2. In Vitro All in vitro cultures were fixed in 4% PFA for 10 min at RT and then washed with PBS. PBS-T 0.5% was used to permeabilize cellular membranes for 10 min. Incubation with primary antibodies for GFAP (#20334; Dako; 1:200) or BrdU (#6226; 1:100; Abcam, 1:50) was executed during overnight at 4 ◦ C. Secondary antibodies (1:1000; #A28175; anti-mouse Alexa-fluor ® 488; #A21069 anti-rabbit Alexa-fluor ® 568; Life Technologies, Thermo Fisher Scientific) were incubated for 2 h at RT. DAPI (Invitrogen) incubation was performed during 10 min to allow cell nuclei labelling. Slides were further washed with PBS 1 × and mounted with PermaFluor mountant medium (Thermo Scientific, Waltham, MA, USA). Sections were analyzed using an Olympus BX-61 Fluorescence Microscope (Olympus, Tokyo, Japan). For specific astrocytic genesis analysis, BrdU/GFAP double-positive cells were counted. Three coverslips and ten randomly selected microscope fields per condition were analyzed. Results are shown as the average number of GFAP+or GFAP+BrdU+cells per DAPI. 2.7. Morphological Analyses To analyze astrocytic morphology, we applied the previously described open-source tool Simple Neurite Tracer of ImageJ [ 63 ], enables the tridimensional reconstruction of main astrocytic processes in GFAP-stained sections. This marker specifically stains main astrocyte processes, and its expression is tightly related to morphological alterations. After immunostaining, z-stacks of confocal images (magnification: 40 × ; numerical aperture: 0.65; z-interval: 0.5; image resolution: 2048 × 2048 pixels; n= 10–15 astrocytes per subregion/animal) were used to determine the total processes length (in µ m) of each astrocyte analyzed. This analysis was performed for different DG subregions including the granule cell layer (GCL), the subgranular zone (SGZ), defined as the three deepest rows of granule cells, the inner molecular layer (IML), and the hilus. Further, only astrocytes that revealed complete processes were considered for analysis. 2.8. RT-PCR Measurements For dorsal DG macrodissection, rats were firstly anesthetized with pentobarbital (20%; 100 mg·kg−1, Eutasil®, Sanofi) and transcardially perfused with 0.9% saline. Immediately after dissection, tissues were frozen and stored at −80 ◦C until analysis. Cells 2022,11, 390 6 of 18 Total RNA from the macrodissected DGs was isolated according to the manufactures’ instructions using the Direct-Zol ™ RNA Mini-Prep (Zymo Research, Irvine, CA, USA. The extracted total RNA (500 ng) was reverse-transcribed using qScript cDNA SuperMix (Quanta Biosciences, Gaithersburg, MD, USA). For real-time (RT)-PCR, oligonucleotide primers for S100 calcium-binding protein β (S100 β , sense CACCGACTGGGCAAAATACT, antisense TCCGAACTTCCATGTCC), Glial Fibrillary Acidic Protein (GFAP, sense GGACCAGCTTACTACCAACAGTGCC, antisense TGGTTTCATCTTGGAGCTTCTGCCT), Signal transducer and activator of transcription 3 (STAT3, sense TGGACCGTCTGGAAAACTGGATAAC, antisense CTCCACCACGAAGGCACTCTTCATTA), Bone morphogenetic protein 4 (BMP4, sense TCCATCACGAAGAACATCTGGAGAA, antisense GTCCACCTGCTCCCGAAATAGC) jmjd3 (sense CGGTTCTGCCCAGTCTGTGAAACCG, antisense ATGCTGGGTGTAGGAGGGTTG), and B2M (sense GTGCTTGCCATTCAGAAAACTCC, antisense AGGTGGGTGGAACTGAGACA) were designed using the Primer-BLAST software (NCBI). Reactions were performed in an Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using 5 × HOT FIREPol EvaGreen qPCR Mix Plus, ROX (Solis BioDyne, Tartu, Estonia). Target gene expression levels were normalized against the housekeeping gene Beta-2-Microglobulin (B2M). The relative expression was determined using the ddCt method, and the results are presented as fold-change of mRNA levels between the respective experimental groups after normalization to B2M levels. 2.9. Statistical Analysis Statistical analysis was completed using Prism 8.0 (GraphPad Software, Inc., La Jolla, CA, USA). The assignment of the animals to the experimental groups was performed randomly. All presented data fulfilled normal distribution in Kolmogorov–Smirnov testing and were subjected to the appropriate statistical tests (after confirmation of the homogeneity of group variances). Student’s t-test was used for statistical comparisons between experimental groups when appropriate. The comparison between stressed groups was assessed using one-way analysis of variance. Analysis of variance repeated measures was used to analyze the number of intersections from the soma. Descriptive statistical results are presented as mean ± standard error of the mean (SEM). Differences between groups were determined by Bonferroni’s post hoc multiple comparison tests, and statistical significance was set at p< 0.05. 3. Results 3.1. Imipramine Induces the Generation of New Astrocytes in the Hippocampal Dentate Gyrus First, we assessed in a longitudinal manner the impact of chronic stress and ADs treatment on the number of existing and de novo population astrocytes in the hippocampal DG. The density of pre-existent astrocytes was assessed by the density of GFAP + cells (that includes immature and mature astrocytes or S100 β+ cells). To quantify newborn astrocytes, animals were injected with BrdU [ 64 ] 2 days before and 3 days after cessation of the uCMS protocol and ADs administration (Figure 1a,b). Assessment of astrocytic number in the dorsal dentate gyrus (dDG) immediately after chronic stress exposure (tp1) revealed no major differences between control and uCMS exposed groups, either on GFAP + cells population (Figure 1c), on S100 β+ cells (Figure 1d), and on GFAP + BrdU + cells (Figure 1e,f). Cells 2022,11, 390 7 of 18 Cells 2022, 11, 390 7 of 19 cells population (Figure 1c), on S100β + cells (Figure 1d), and on GFAP + BrdU + cells (Figure 1e,f). Figure 1. In vivo longitudinal analysis of astrocytic markers in the dorsal hippocampal dentate gyrus (dDG) of an animal model of depression and in in vitro primary cultures. (a) Illustrative experimental timeline. (b) Hippocampal DG coronal section immunostained for bromodeoxyuridine (BrdU) (in red), glial fibrillary acidic protein (in green), and DAPI (in blue). Additionally, a hippocampal DG coronal section immunostained for BrdU (in red), GFAP (in green), S100β (in grey), and DAPI (in blue). Quantitative analysis of GFAP + cells in the dorsal dentate gyrus (dDG) at tp1 (c) and at tp2 (g), after a six-week uCMS protocol including antidepressants (ADs) treatment, fluoxetine, and imipramine. (d,h) Quantitative analysis of the number of S100β+ cells in the dDG, both at tp1 Figure 1. In vivo longitudinal analysis of astrocytic markers in the dorsal hippocampal dentate gyrus (dDG) of an animal model of depression and in in vitro primary cultures. ( a ) Illustrative experimental timeline. ( b ) Hippocampal DG coronal section immunostained for bromodeoxyuridine (BrdU) (in red), glial fibrillary acidic protein (in green), and DAPI (in blue). Additionally, a hippocampal DG coronal section immunostained for BrdU (in red), GFAP (in green), S100 β (in grey), and DAPI (in blue). Quantitative analysis of GFAP + cells in the dorsal dentate gyrus (dDG) at tp1 ( c ) and at tp2 ( g ), after a six-week uCMS protocol including antidepressants (ADs) treatment, fluoxetine, and imipramine. ( d , h ) Quantitative analysis of the number of S100 β + cells in the dDG, both at tp1 ( d ) and tp2 ( h ). ( e , i ) Quantitative analysis of GFAP+BrdU+ cells, both immediately after stress exposure, tp1, Cells 2022,11, 390 8 of 18 ( e ) and 4 weeks after stress exposure, tp2 ( i ). ( f , j ) Analysis of the number of GFAP + BrdU + cells per total number of BrdU+ cells, both at tp1 ( f ) and at tp2 ( j ). ( k , m ) Representative image of immunocytochemistry of hippocampal primary cells in a control plate ( k ), and incubated with BrdU (m), with neurons labelled with β3-tubulin, astrocytes with GFAP proliferating cells with BrdU and cell nucleus with DAPI. ( l , n ) In vitro analysis of hippocampal DG primary cultures of p3–5 animals, regarding the number of GFAP + astrocytic cells ( l ) and astrocytes differentiation—GFAP + BrdU + ( n ) after incubation of the primary cell cultures with dexamethasone (DEX), norfluoxetine (NORFLX), or desipramine (DESIP) and BrdU. * Represents uCMS effect analyzed by Student’s t-test. # Represents ADs effect, by comparison of treatment and SAL animals; δ represents differences between ADs, analyzed by one-way analysis of variance (ANOVA). Data are represented as mean ± s.e.m. Scale bars represent 50 µ m.*, # p< 0.05, ## p< 0.01, δδδδ p< 0.0001; Sample size: TP1: CTRL: 5–7; CMS: 5–7; FLX: 6–8; IMIP: 4–7; TP2: CTRL: 6–8; CMS: 6–9; FLX:6–8; IMIP: 6–8. Abbreviations: GFAP, Glial Fibrillary Acidic Protein; CTRL, non-stressed animals; SAL, animals exposed to uCMS and injected with saline; IMIP, animals exposed to uCMS and treated with imipramine; FLX, animals exposed to uCMS and treated with fluoxetine; dDG, dorsal dentate gyrus; DEX, dexamethasone; NORFLX, Norfluoxetine; DESIP, Desipramine; β 3tub, β 3-tubulin; DAPI, 4 0 ,6 0 -diamino-2-fenil-indol; BrdU, Bromodeoxyuridine; tp1, time point 1 (6 weeks; immediately after the stress protocol cessation); and tp2, time point 2 (10 weeks; 4 weeks after the stress protocol cessation). However, at 4 weeks after the end of the uCMS protocol—tp2—we observed a significant decrease in the number of GFAP + cells promoted by uCMS (p= 0.04, t(12) = 1.92; Figure 1g), as supported by previous studies [ 38 , 65 ]. Treatment with fluoxetine or imipramine did not reverse uCMS-induced changes (Figure 1g). Regarding mature astrocytes— labeled with S100 β [ 66 ]—chronic stress exposure induced a reduction in the number of S100 β+ cells in the hippocampal DG at tp2 (p= 0.04, t (11) = 3.04; Figure 1h). Imipramine, but not fluoxetine, treatment significantly increased the number of S100 β+ cells, to higher levels compared to those presented by the control group (p= 0.002, F(2,31) = 10.29; Figure 1h). Furthermore, when exploring the effect of stress and ADs on newborn astrocytes at tp2, a time-point at which newborn cells should have started differentiating and integrating into the circuitry [ 16 ], chronically stressed animals presented a significant reduction in newborn astrocytes (p= 0.02, t (11) = 2.96; Figure 1i). Interestingly, imipramine treatment elicited a strong pro-astrogliogenic response with an higher number of both GFAP + BrdU + cells (p= 0.02, F (2,29) = 6.16; Figure 1i) and GFAP + BrdU + /BrdU + (p= 0.003, F( 2,33 ) = 13.99; Figure 1j) in comparison to those presented by rats exposed to uCMS. Treatment with fluoxetine did not exert any alterations on the density of these cells, which is suggestive of a more pro-neurogenic response previously observed [ 16 ]. To verify if this effect was specific to newborn mature astrocytes and not to glial-like precursor cells, we analyzed the effect of stress and ADs on the number of GFAP + S100 β+ cells among all BrdU + cells (Figure S1). No differences were found between groups in the number of GFAP + S100B + /BrdU + cells at tp1 (Figure S1a). However, at tp2, stress exposure decreased the number of the newborn mature astrocytes (p= 0.02, t (4) = 3.31; Figure S1b) and, although not significantly different, imipramine treatment showed a tendency to increase the density of these cells (Figure S1b). Furthermore, we analyzed the in vitro differentiation of astrocytes using primary hippocampal cell cultures from p3–5 rats. We conditioned the cells with dexamethasone (DEX) and with the active metabolites of the ADs used in the in vivo experimental approach, norfluoxetine and desipramine. By labeling the cells with GFAP and β 3-tubulin antibodies (Figure 1k), after 8 days in vitro , we showed that DEX significantly decreases the number of astrocytes (GFAP + cells; p= 0.02, t (21) = 2.14; Figure 1l), which are restored to levels similar to the control group after desipramine conditioning, but not with norfluoxetine (p< 0.0001, F (2,33) = 14.30; Figure 1l). Moreover, analyses of the number of GFAP + /BrdU + cells, revealed that DEX reduces the number of newborn astrocytes (p= 0.0332, t (9) = 2.088; Figure 1n). Hippocampal cells treated with desipramine, but not with norfluoxetine, present a number of newborn astrocytes similar to the control untreated cells (p> 0.10, F(2,11) = 1.183; Figure 1n). Cells 2022,11, 390 9 of 18 3.2. Expression of Astrocytes’ Mediator Factors Next, we quantified the levels of several genes expressed by resident astrocytes, such as GFAP and S100 β , and other genes related to astrocytic differentiation, such as BMP4, STAT3, and JMJD3. We show that, at tp1, both GFAP and S100 β expression levels are not significantly changed by chronic stress exposure (GFAP: p= 0.2344, t (4) = 1.399; S100 β : p= 0.3673; F (2,11) = 1.764, p= 0.2166, Figure 2a,b). However, there was a significant decrease in GFAP expression after fluoxetine administration (p= 0.0397, F (2,7) = 6.220; Figure 2a). Analyses of the genes associated with astrocytic differentiation revealed that, despite no significant alterations induced by stress exposure (BMP4: p= 0.8308, t (4) = 0.228; Figure 2c; STAT3: p= 0.5799, t (4) = 0.618, Figure 2d; and jmjd3: p= 0.8955, t (4) = 0.1428 Figure 2e), treatment with imipramine treatment induces a tendency for increased expression levels of BMP4 and STAT3 (BMP4: p= 0.0501, F= 5.780, Figure 2c; STAT3: p= 0.076, F (2,5) = 4.063, Figure 2d) and significantly increases JMJD3 when compared to the stress-exposed group (p= 0.0095, F(2,5) = 13.60; Figure 2e). Cells 2022, 11, 390 9 of 19 3.2. Expression of Astrocytes’ Mediator Factors Next, we quantified the levels of several genes expressed by resident astrocytes, such as GFAP and S100β, and other genes related to astrocytic differentiation, such as BMP4, STAT3, and JMJD3. We show that, at tp1, both GFAP and S100β expression levels are not significantly changed by chronic stress exposure (GFAP: p = 0.2344, t (4) = 1.399; S100β: p = 0.3673; F (2,11) = 1.764, p = 0.2166, Figure 2a,b). However, there was a significant decrease in GFAP expression after fluoxetine administration (p = 0.0397, F (2,7) = 6.220; Figure 2a). Analyses of the genes associated with astrocytic differentiation revealed that, despite no significant alterations induced by stress exposure (BMP4: p = 0.8308, t (4) = 0.228; Figure 2c; STAT3: p = 0.5799, t (4) = 0.618, Figure 2d; and jmjd3: p = 0.8955, t (4) = 0.1428 Figure 2e), treatment with imipramine treatment induces a tendency for increased expression levels of BMP4 and STAT3 (BMP4: p = 0.0501, F = 5.780, Figure 2c; STAT3: p = 0.076, F (2,5) = 4.063, Figure 2d) and significantly increases JMJD3 when compared to the stress-exposed group (p = 0.0095, F (2,5) = 13.60; Figure 2e). At tp2, no differences were found on GFAP expression levels between control and stress groups (p= 0.2224; t (5) = 1.443 Figure 2f) and upon treatment with ADs (p = 0.7600, F (2,6) = 0.2874; Figure 2f). Interestingly, chronic stress exposure did not induce statistically significant changes in S100β expression, but imipramine treatment was able to increase S100β expression levels by comparison to the stress-exposed group (CTRL vs. CMS: p= 0.2535; ADs treatment: p = 0.0227, F(2,5) = 8.858; Figure 2g). Curiously, BMP4 and STAT3 expression levels are increased in the uCMS-exposed group, in comparison to the control group (BMP4: p= 0.0512, t (6) = 2.429, Figure 2h; STAT3: p= 0.0399, t (4) = 3.002, Figure 2i). Plus, we observed a decreased expression of these genes in the rats treated with imipramine, when comparing to the stress-exposed group (BMP4: p = 0.0089, F (2,9) = 8.353, Figure 2h; STAT3: p= 0.0169, F (2,6) = 8.697, Figure 2i). The expression levels of JMJD3 were not changed among groups at tp2, neither promoted by stress exposure (p = 0.3344, t (a) = 1.097; Figure 2j) nor treatment with ADs (p =0.9737, F (2,6) = 0.0268; Figure 2j). Figure 2. Relative mRNA expression levels of astrocytic and astrogliogenic related genes at tp1 and tp2 in the macrodissected DG. We analyzed the mRNA expression levels of GFAP (a,f), S100β (b,g), Figure 2. Relative mRNA expression levels of astrocytic and astrogliogenic related genes at tp1 and tp2 in the macrodissected DG. We analyzed the mRNA expression levels of GFAP ( a , f ), S100 β ( b , g ), BMP4 ( c , h ), STAT3 ( d , i ), and jmjd3 ( e , j ) in macrodissected dentate gyrus tissue from control animals and uCMS-exposed animals treated either with saline, fluoxetine, or imipramine at tp1 and tp2. * Represents uCMS effect analyzed by Student’s t-test; # Represents ADs effect, by comparison of treatment and SAL animals, analyzed by one-way analysis of variance (ANOVA); and δ represents differences between ADs, analyzed by one-way analysis of variance (ANOVA). Data are represented as mean ± s.e.m. *, #, δ p< 0.05; Sample size: TP1: CTRL: 3–4; CMS: 4–6; FLX: 3–5; IMIP: 3–5; TP2: CTRL: 3–4; CMS: 3–4; FLX: 3–4; and IMIP: 3–4. CTRL, non-stressed animals; IMIP, animals exposed to uCMS and treated with imipramine; FLX, animals exposed to uCMS and treated with fluoxetine; SAL, animals exposed to uCMS and injected with saline; GFAP, Glial Fibrillary Acidic Protein; S100 β , S100 calcium-binding protein β ; BMP4, Bone morphogenetic protein 4; STAT3, Signal transducer and activator of transcription 3; JMJD3, histone H3 Lys 27 (H3K27) demethylase; tp1, time point 1 (6 weeks; immediately after the stress protocol cessation); and tp2, time point 2 (10 weeks; 4 weeks after the stress protocol cessation). Cells 2022,11, 390 16 of 18 9. Liu, R.J.; Aghajanian, G.K. Stress Blunts Serotoninand Hypocretin-Evoked EPSCs in Prefrontal Cortex: Role of CorticosteroneMediated Apical Dendritic Atrophy. Proc. Natl. Acad. Sci. USA 2008,105, 359–364. [CrossRef] 10. Banasr, M.; Duman, R.S. Glial Loss in the Prefrontal Cortex Is Sufficient to Induce Depressive-like Behaviors. Biol. Psychiatry 2008 , 64, 863–870. [CrossRef] 11. Maciag, D.; Hughes, J.; O’Dwyer, G.; Pride, Y.; Stockmeier, C.A.; Sanacora, G.; Rajkowska, G. Reduced Density of Calbindin Immunoreactive GABAergic Neurons in the Occipital Cortex in Major Depression: Relevance to Neuroimaging Studies. Biol. Psychiatry 2010,67, 465–470. [CrossRef] 12. Abraham, I.; Juhasz, G.; Kekesi, K.A.; Kovacs, K.J. Corticosterone Peak Is Responsible for Stress-Induced Elevation of Glutamate in the Hippocampus. Stress 1998,2, 171–181. [CrossRef] [PubMed] 13. Lee, J.; Duan, W.; Mattson, M.P. Evidence That Brain-Derived Neurotrophic Factor Is Required for Basal Neurogenesis and Mediates, in Part, the Enhancement of Neurogenesis by Dietary Restriction in the Hippocampus of Adult Mice. J. Neurochem. 2002,82, 1367–1375. [CrossRef] 14. Sairanen, M.; Lucas, G.; Ernfors, P.; Castrén, M.; Castrén, E. Brain-Derived Neurotrophic Factor and AntidepressantDrugs Have Different but Coordinated Effects on Neuronal Turnover, Proliferation, and Survival in the Adult Dentate Gyrus. J. Neurosci. 2005 , 25, 1089–1094. [CrossRef] 15. Bessa, J.M.; Mesquita, A.R.; Oliveira, M.; Pêgo, J.M.; Cerqueira, J.J.; Palha, J.A.; Almeida, O.F.X.; Sousa, N. A Trans-Dimensional Approach to the Behavioral Aspects of Depression. Front. Behav. Neurosci. 2009,3. [CrossRef] 16. Mateus-Pinheiro, A.; Pinto, L.; Bessa, J.M.; Morais, M.; Alves, N.D.; Monteiro, S.; Patrício, P.; Almeida, O.F.X.; Sousa, N. Sustained Remission from Depressive-like Behavior Depends on Hippocampal Neurogenesis. Transl. Psychiatry 2013,3, e210. [CrossRef] 17. Mateus-Pinheiro, A.; Patrício, P.; Bessa, J.M.; Sousa, N.; Pinto, L. Cell Genesis and Dendritic Plasticity: A Neuroplastic Pas de Deux in the Onset and Remission from Depression. Mol. Psychiatry 2013,18, 748–750. [CrossRef] [PubMed] 18. Manji, H.K.; Moore, G.J.; Rajkowska, G.; Chen, G. Neuroplasticity and Cellular Resilience in Mood Disorders. Mol. Psychiatry 2000,5, 578–593. [CrossRef] 19. Bélair, E.L.; Vallée, J.; Robitaille, R. In Vivo Long-Term Synaptic Plasticity of Glial Cells. J. Physiol. 2010 ,588, 1039–1056. [CrossRef] [PubMed] 20. Ben Achour, S.; Pascual, O. Glia: The Many Ways to Modulate Synaptic Plasticity. Neurochem. Int. 2010,57, 440–445. [CrossRef] 21. Miguel-Hidalgo, J.J.; Waltzer, R.; Whittom, A.A.; Austin, M.C.; Rajkowska, G.; Stockmeier, C.A. Glial and Glutamatergic Markers in Depression, Alcoholism, and Their Comorbidity. J. Affect. Disord. 2010,127, 230–240. [CrossRef] [PubMed] 22. Verkhratsky, A.; Rodríguez, J.J.; Steardo, L. Astrogliopathology: A Central Element of Neuropsychiatric Diseases? Neuroscientist 2014,20, 576–588. [CrossRef] [PubMed] 23. Verkhratsky, A.; Rodríguez, J.J.; Parpura, V. Astroglia in Neurological Diseases. Future Neurol. 2013 ,8, 149–158. [CrossRef] [PubMed] 24. Kofuji, P.; Araque, A. Astrocytes and Behavior. Annu. Rev. Neurosci. 2021,44, 49–67. [CrossRef] 25. Kol, A.; Goshen, I. The Memory Orchestra: The Role of Astrocytes and Oligodendrocytes in Parallel to Neurons. Curr. Opin. Neurobiol. 2021,67, 131–137. [CrossRef] 26. Saavedra, L.M.; Hernández-Velázquez, M.G.; Madrigal, S.; Ochoa-Zarzosa, A.; Torner, L. Long-Term Activation of Hippocampal Glial Cells and Altered Emotional Behavior in Male and Female Adult Rats after Different Neonatal Stressors. Psychoneuroendocrinology 2021,126, 105164. [CrossRef] 27. Semyanov, A.; Verkhratsky, A. Astrocytic Processes: From Tripartite Synapses to the Active Milieu. Trends Neurosci. 2021 ,44, 781–792. [CrossRef] 28. Codeluppi, S.A.; Chatterjee, D.; Prevot, T.D.; Bansal, Y.; Misquitta, K.A.; Sibille, E.; Banasr, M. Chronic Stress Alters Astrocyte Morphology in Mouse Prefrontal Cortex. Int. J. Neuropsychopharmacol. 2021,24, 842–853. [CrossRef] 29. Luarte, A.; Cisternas, P.; Caviedes, A.; Batiz, L.F.; Lafourcade, C.; Wyneken, U.; Henzi, R. Astrocytes at the Hub of the Stress Response: Potential Modulation of Neurogenesis by MiRNAs in Astrocyte-Derived Exosomes. Stem Cells Int. 2017 ,2017, e1719050. [CrossRef] 30. Murphy-Royal, C.; Johnston, A.D.; Boyce, A.K.J.; Diaz-Castro, B.; Institoris, A.; Peringod, G.; Zhang, O.; Stout, R.F.; Spray, D.C.; Thompson, R.J.; et al. Stress Gates an Astrocytic Energy Reservoir to Impair Synaptic Plasticity. Nat. Commun. 2020 ,11, 2014. [CrossRef] 31. Naskar, S.; Chattarji, S. Stress Elicits Contrasting Effects on the Structure and Number of Astrocytes in the Amygdala versus Hippocampus. eNeuro 2019,6, ENEURO.0338-18.2019. [CrossRef] [PubMed] 32. Theis, M.; Jauch, R.; Zhuo, L.; Speidel, D.; Wallraff, A.; Döring, B.; Frisch, C.; Söhl, G.; Teubner, B.; Euwens, C.; et al. Accelerated Hippocampal Spreading Depression and Enhanced Locomotory Activity in Mice with Astrocyte-Directed Inactivation of Connexin43. J. Neurosci. 2003,23, 766–776. [CrossRef] [PubMed] 33. Escartin, C.; Galea, E.; Lakatos, A.; O’Callaghan, J.P.; Petzold, G.C.; Serrano-Pozo, A.; Steinhäuser, C.; Volterra, A.; Carmignoto, G.; Agarwal, A.; et al. Reactive Astrocyte Nomenclature, Definitions, and Future Directions. Nat. Neurosci. 2021 ,24, 312–325. [CrossRef] [PubMed] 34. Czéh, B.; Simon, M.; Schmelting, B.; Hiemke, C.; Fuchs, E. Astroglial Plasticity in the Hippocampus Is Affected by Chronic Psychosocial Stress and Concomitant Fluoxetine Treatment. Neuropsychopharmacology 2006 ,31, 1616–1626. [CrossRef] [PubMed] Cells 2022,11, 390 17 of 18 35. Czéh, B.; Müller-Keuker, J.I.H.; Rygula, R.; Abumaria, N.; Hiemke, C.; Domenici, E.; Fuchs, E. Chronic Social Stress Inhibits Cell Proliferation in the Adult Medial Prefrontal Cortex: Hemispheric Asymmetry and Reversal by Fluoxetine Treatment. Neuropsychopharmacology 2007,32, 1490–1503. [CrossRef] 36. Banasr, M.; Duman, R. Regulation of Neurogenesis and Gliogenesis by Stress and Antidepressant Treatment. CNS Neurol. Disord.—Drug Targets 2008,6, 311–320. [CrossRef] 37. Banasr, M.; Valentine, G.W.; Li, X.Y.; Gourley, S.L.; Taylor, J.R.; Duman, R.S. Chronic Unpredictable Stress Decreases Cell Proliferation in the Cerebral Cortex of the Adult Rat. Biol. Psychiatry 2007,62, 496–504. [CrossRef] 38. Gosselin, R.D.; Gibney, S.; O’Malley, D.; Dinan, T.G.; Cryan, J.F. Region Specific Decrease in Glial Fibrillary Acidic Protein Immunoreactivity in the Brain of a Rat Model of Depression. Neuroscience 2009,159, 915–925. [CrossRef] 39. Rajkowska, G.; Selemon, L.D.; Goldman-Rakic, P.S. Neuronal and Glial Somal Size in the Prefrontal Cortex: A Postmortem Morphometric Study of Schizophrenia and Huntington Disease. Arch. Gen. Psychiatry 1998,55, 215–224. [CrossRef] 40. Öngür, D.; Drevets, W.C.; Price, J.L. Glial Reduction in the Subgenual Prefrontal Cortex in Mood Disorders. Proc. Natl. Acad. Sci. USA 1998,95, 13290–13295. [CrossRef] 41. Rajkowska, G.; Miguel-Hidalgo, J.J.; Wei, J.; Dilley, G.; Pittman, S.D.; Meltzer, H.Y.; Overholser, J.C.; Roth, B.L.; Stockmeier, C.A. Morphometric Evidence for Neuronal and Glial Prefrontal Cell Pathology in Major Depression. Biol. Psychiatry 1999 ,45, 1085–1098. [CrossRef] 42. Gos, T.; Schroeter, M.L.; Lessel, W.; Bernstein, H.G.; Dobrowolny, H.; Schiltz, K.; Bogerts, B.; Steiner, J. S100B-Immunopositive Astrocytes and Oligodendrocytes in the Hippocampus Are Differentially Afflicted in Unipolar and Bipolar Depression: A Postmortem Study. J. Psychiatr. Res. 2013,47, 1694–1699. [CrossRef] [PubMed] 43. Chana, G.; Landau, S.; Beasley, C.; Everall, I.P.; Cotter, D. Two-Dimensional Assessment of Cytoarchitecture in the Anterior Cingulate Cortex in Major Depressive Disorder, Bipolar Disorder, and Schizophrenia: Evidence for Decreased Neuronal Somal Size and Increased Neuronal Density. Biol. Psychiatry 2003,53, 1086–1098. [CrossRef] 44. Rajkowska, G.; Halaris, A.; Selemon, L.D. Reductions in Neuronal and Glial Density Characterize the Dorsolateral Prefrontal Cortex in Bipolar Disorder. Biol. Psychiatry 2001,49, 741–752. [CrossRef] 45. Machado-Santos, A.R.; Alves, N.D.; Araújo, B.; Correia, J.S.; Patrício, P.; Mateus-Pinheiro, A.; Loureiro-Campos, E.; Bessa, J.M.; Sousa, N.; Pinto, L. Astrocytic Plasticity at the Dorsal Dentate Gyrus on an Animal Model of Recurrent Depression. Neuroscience 2019,454, 94–104. [CrossRef] [PubMed] 46. Selemon, L.D.; Rajkowska, G.; Goldman-Rakic, P.S. Elevated Neuronal Density in Prefrontal Area 46 in Brains from Schizophrenic Patients: Application of a Three-dimensional, Stereologic Counting Method. J. Comp. Neurol. 1998,392, 402–412. [CrossRef] 47. Oliveira, J.F.; Sardinha, V.M.; Guerra-Gomes, S.; Araque, A.; Sousa, N. Do Stars Govern Our Actions? Astrocyte Involvement in Rodent Behavior. Trends Neurosci. 2015,38, 535–549. [CrossRef] [PubMed] 48. Guerra-Gomes, S.; Sousa, N.; Pinto, L.; Oliveira, J.F. Functional Roles of Astrocyte Calcium Elevations: From Synapses to Behavior. Front. Cell. Neurosci. 2018,11, 427. [CrossRef] 49. Steiner, B.; Kronenberg, G.; Jessberger, S.; Brandt, M.D.; Reuter, K.; Kempermann, G. Differential Regulation of Gliogenesis in the Context of Adult Hippocampal Neurogenesis in Mice. Glia 2004,46, 41–52. [CrossRef] 50. Ninkovic, J.; Götz, M. Fate Specification in the Adult Brain - Lessons for Eliciting Neurogenesis from Glial Cells. BioEssays 2013 , 35, 242–252. [CrossRef] 51. Von Bohlen Und Halbach, O. Immunohistological Markers for Proliferative Events, Gliogenesis, and Neurogenesis within the Adult Hippocampus. Cell Tissue Res. 2011,345, 1–19. [CrossRef] [PubMed] 52. Kraus-Ruppert, R.; Laissue, J.; Bürki, H.; Odartchenko, N. Kinetic Studies on Glial, Schwann and Capsular Cells Labelled with [3H]Thymidine in Cerebrospinal Tissue of Young Mice. J. Neurol. Sci. 1975,26, 555–563. [CrossRef] 53. Kornack, D.R.; Rakic, P. Cell Proliferation without Neurogenesis in Adult Primate Neocortex. Science 2001 ,294, 2127–2130. [CrossRef] 54. Gensert, J.M.; Goldman, J.E. Heterogeneity of Cycling Glial Progenitors in the Adult Mammalian Cortex and White Matter. J. Neurobiol. 2001,48, 75–86. [CrossRef] 55. Eriksson, P.S.; Perfilieva, E.; Björk-Eriksson, T.; Alborn, A.M.; Nordborg, C.; Peterson, D.A.; Gage, F.H. Neurogenesis in the Adult Human Hippocampus. Nat. Med. 1998,4, 1313–1317. [CrossRef] 56. Bhardwaj, R.D.; Curtis, M.A.; Spalding, K.L.; Buchholz, B.A.; Fink, D.; Björk-Eriksson, T.; Nordborg, C.; Gage, F.H.; Druid, H.; Eriksson, P.S.; et al. Neocortical Neurogenesis in Humans Is Restricted to Development. Proc. Natl. Acad. Sci. USA 2006 ,103, 12564–12568. [CrossRef] [PubMed] 57. Alonso, G. Prolonged Corticosterone Treatment of Adult Rats Inhibits the Proliferation of Oligodendrocyte Progenitors Present throughout White and Gray Matter Regions of the Brain. Glia 2000,31, 219–231. [CrossRef] 58. Wennström, M.; Hellsten, J.; Ekstrand, J.; Lindgren, H.; Tingström, A. Corticosterone-Induced Inhibition of Gliogenesis in Rat Hippocampus Is Counteracted by Electroconvulsive Seizures. Biol. Psychiatry 2006,59, 178–186. [CrossRef] 59. Patrício, P.; Mateus-Pinheiro, A.; Irmler, M.; Alves, N.D.; Machado-Santos, A.R.; Morais, M.; Correia, J.S.; Korostynski, M.; Piechota, M.; Stoffel, R.; et al. Differential and Converging Molecular Mechanisms of Antidepressants’ Action in the Hippocampal Dentate Gyrus. Neuropsychopharmacology 2015,40, 338–349. [CrossRef] [PubMed] 60. Vogel-Ciernia, A.; Wood, M.A. Examining Object Location and Object Recognition Memory in Mice. Curr. Protoc. Neurosci. 2014 , 69, 8–31. [CrossRef] [PubMed] Cells 2022,11, 390 18 of 18 61. Alves, N.D.; Correia, J.S.; Patrício, P.; Mateus-Pinheiro, A.; Machado-Santos, A.R.; Loureiro-Campos, E.; Morais, M.; Bessa, J.M.; Sousa, N.; Pinto, L. Adult Hippocampal Neuroplasticity Triggers Susceptibility to Recurrent Depression. Transl. Psychiatry 2017 , 7, 1058. [CrossRef] [PubMed] 62. Patrício, P.; Mateus-Pinheiro, A.; Alves, N.D.; Morais, M.; Rodrigues, A.J.; Bessa, J.M.; Sousa, N.; Pinto, L. MiR-409 and MiR-411 Modulation in the Adult Brain of a Rat Model of Depression and After Fluoxetine Treatment. Front. Behav. Neurosci. 2020 , 14, 00136. [CrossRef] [PubMed] 63. Tavares, G.; Martins, M.; Correia, J.S.; Sardinha, V.M.; Guerra-Gomes, S.; das Neves, S.P.; Marques, F.; Sousa, N.; Oliveira, J.F. Employing an Open-Source Tool to Assess Astrocyte Tridimensional Structure. Brain Struct. Funct. 2017 ,222, 1989–1999. [CrossRef] [PubMed] 64. Cavanagh, B.L.; Walker, T.; Norazit, A.; Meedeniya, A.C.B. Thymidine Analogues for Tracking DNA Synthesis. Molecules 2011 ,16, 7980–7993. [CrossRef] [PubMed] 65. Tynan, R.J.; Beynon, S.B.; Hinwood, M.; Johnson, S.J.; Nilsson, M.; Woods, J.J.; Walker, F.R. Chronic Stress-Induced Disruption of the Astrocyte Network Is Driven by Structural Atrophy and Not Loss of Astrocytes. Acta Neuropathol. 2013 ,126, 75–91. [CrossRef] 66. Raponi, E.; Agenes, F.; Delphin, C.; Assard, N.; Baudier, J.; Legraverend, C.; Deloulme, J.C. S100B Expression Defines a State in Which GFAP-Expressing Cells Lose Their Neural Stem Cell Potential and Acquire a More Mature Developmental Stage. GLIA 2007,55, 165–177. [CrossRef] [PubMed] 67. Kim, R.; Healey, K.L.; Sepulveda-Orengo, M.T.; Reissner, K.J. Astroglial Correlates of Neuropsychiatric Disease: From Astrocytopathy to Astrogliosis. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2018,87, 126–146. [CrossRef] 68. Saur, L.; Baptista, P.P.A.; Bagatini, P.B.; Neves, L.T.; de Oliveira, R.M.; Vaz, S.P.; Ferreira, K.; Machado, S.A.; Mestriner, R.G.; Xavier, L.L. Experimental Post-Traumatic Stress Disorder Decreases Astrocyte Density and Changes Astrocytic Polarity in the CA1 Hippocampus of Male Rats. Neurochem. Res. 2016,41, 892–904. [CrossRef] [PubMed] 69. Torres-Platas, S.G.; Hercher, C.; Davoli, M.A.; Maussion, G.; Labonté, B.; Turecki, G.; Mechawar, N. Astrocytic Hypertrophy in Anterior Cingulate White Matter of Depressed Suicides. Neuropsychopharmacology 2011,36, 2650–2658. [CrossRef] 70. Herman, J.P.; McKlveen, J.M.; Ghosal, S.; Kopp, B.; Wulsin, A.; Makinson, R.; Scheimann, J.; Myers, B. Regulation of the Hypothalamic-PituitaryAdrenocortical Stress Response. Compr. Physiol. 2016,6, 603–621. [CrossRef] 71. Sawangjit, A.; Oyanedel, C.N.; Niethard, N.; Salazar, C.; Born, J.; Inostroza, M. The Hippocampus Is Crucial for Forming Non-Hippocampal Long-Term Memory during Sleep. Nature 2018,564, 109–113. [CrossRef] 72. Takano, K.; Yamasaki, H.; Kawabe, K.; Moriyama, M.; Nakamura, Y. Imipramine Induces Brain-Derived Neurotrophic Factor MRNA Expression in Cultured Astrocytes. J. Pharmacol. Sci. 2012,120, 176–186. [CrossRef] [PubMed] 73. Kedracka-Krok, S.; Swiderska, B.; Bielecka-Wajdman, A.M.; Prus, G.; Skupien-Rabian, B.; Jankowska, U.; Obuchowicz, E. Impact of Imipramine on Proteome of Rat Primary Glial Cells. J. Neuroimmunol. 2018,320, 25–37. [CrossRef] [PubMed] 74. Kim, Y.; Kim, S.H.; Kim, Y.S.; Lee, Y.H.; Ha, K.; Shin, S.Y. Imipramine Activates Glial Cell Line-Derived Neurotrophic Factor via Early Growth Response Gene 1 in Astrocytes. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2011 ,35, 1026–1032. [CrossRef] [PubMed] 75. Jhaveri, D.J.; Mackay, E.W.; Hamlin, A.S.; Marathe, S.V.; Nandam, L.S.; Vaidya, V.A.; Bartlett, P.F. Norepinephrine Directly Activates Adult Hippocampal Precursors via B3-Adrenergic Receptors. J. Neurosci. 2010,30, 2795–2806. [CrossRef] [PubMed] 76. Liu, B.; Teschemacher, A.G.; Kasparov, S. Neuroprotective Potential of Astroglia. J. Neurosci. Res. 2017 ,95, 2126–2139. [CrossRef] [PubMed] 77. Cheng, X.; Wang, J.; Sun, X.; Shao, L.; Guo, Z.; Li, Y. Morphological and Functional Alterations of Astrocytes Responding to Traumatic Brain Injury. J. Integr. Neurosci. 2019,18, 203–215. [CrossRef] [PubMed] 78. Encinas, J.M.; Michurina, T.V.; Peunova, N.; Park, J.-H.; Tordo, J.; Peterson, D.A.; Fishell, G.; Koulakov, A.; Enikolopov, G. Division-Coupled Astrocytic Differentiation and Age-Related Depletion of Neural Stem Cells in the Adult Hippocampus. Cell Stem Cell 2011,8, 566–579. [CrossRef] 79. Rosenblat, J.D.; Kakar, R.; McIntyre, R.S. The Cognitive Effects of Antidepressants in Major Depressive Disorder: A Systematic Review and Meta-Analysis of Randomized Clinical Trials. Int. J. Neuropsychopharmacol. 2015,19, pyv082. [CrossRef] 80. Leiser, S.C.; Pehrson, A.L.; Robichaud, P.J.; Sanchez, C. Multimodal Antidepressant Vortioxetine Increases Frontal Cortical Oscillations Unlike Escitalopram and Duloxetine – a Quantitative EEG Study in Rats. Br. J. Pharmacol. 2014 ,171, 4255–4272. [CrossRef] [PubMed] 81. Pehrson, A.L.; Sanchez, C. Serotonergic Modulation of Glutamate Neurotransmission as a Strategy for Treating Depression and Cognitive Dysfunction. CNS Spectr. 2014,19, 121–133. [CrossRef] [PubMed] 82. Katona, C.; Hansen, T.; Olsen, C.K. A Randomized, Double-Blind, Placebo-Controlled, Duloxetine-Referenced, Fixed-Dose Study Comparing the Efficacy and Safety of Lu AA21004 in Elderly Patients with Major Depressive Disorder. Int. Clin. Psychopharmacol. 2012,27, 215–223. [CrossRef] [PubMed] 83. Pan, L.A.; Martin, P.; Zimmer, T.; Segreti, A.M.; Kassiff, S.; McKain, B.W.; Baca, C.A.; Rengasamy, M.; Hyland, K.; Walano, N.; et al. Neurometabolic Disorders: Potentially Treatable Abnormalities in Patients With Treatment-Refractory Depression and Suicidal Behavior. Am. J. Psychiatry 2017,174, 42–50. [CrossRef] [PubMed]