Rodentolepis microstoma isolated from different species of Sigmodontinae rodents (Rodentia: Cricetidae) in the Cuenca del Plata, Argentina: Morphological aspects and molecular characterization

International Journal for Parasitology: Parasites and Wildlife 19 (2022) 56–67 Available online 11 August 2022 2213-2244/© 2022 Published by Elsevier Ltd on behalf of Australian Society for Parasitology. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Rodentolepis microstoma isolated from different species of Sigmodontinae rodents (Rodentia: Cricetidae) in the Cuenca del Plata, Argentina: Morphological aspects and molecular characterization Natalia Beatriz Guerreiro Martins a , * , María del Rosario Robles a , 1 , Marcelo Knoff b , Graciela Teresa Navone a , Rocío Callej´ on c a Centro de Estudios Parasitol´ ogicos y de Vectores (CEPAVE), Bv 120 e/ 60 y 64, (1900). CCTCONICET- La Plata, Universidad Nacional de La Plata, Buenos Aires, Argentina b Laborat´ orio de Helmintos Parasitos de Vertebrados, Instituto Oswaldo Cruz, Fiocruz, Avenida Brasil, 4365, Manguinhos, Rio de Janeiro, Brazil c Departamento de Microbiología y Parasitología, Facultad de Farmacia, Universidad de Sevilla, Sevilla, Spain ARTICLE INFO Keywords: Hymenolepididae Rodentolepis Rodents Argentina Taxonomy ABSTRACT The purpose of this paper was to study specimens of the genus Rodentolepis isolated from eight species of Sigmodontinae rodents (Rodentia: Cricetidae) from six provinces in the Cuenca del Plata, Argentina, based on morphological, morphometric and molecular characteristics (ITS1 rDNA and cox1 mtDNA). The genetic distances among studied specimens and other Hymenolepididae from rodents available in the GenBank were analyzed and phylogenetic inferences were provided. A total of 955 specimens of Sigmodontinae rodents were examined from seven localities of six provinces in the Cuenca del Plata region in Argentina. Tapeworms were removed from the rodents’ small intestines. Conventional studies were used for the morphological and molecular analysis. Specimens of R. microstoma were identified. An amended diagnosis and detailed morphological description of this species is provided. The molecular analyses showed that the specimens studied form the same clade as that of R. microstoma previously studied from other hosts and regions. The genetic polymorphisms of R. microstoma observed corresponded to different groups of species hosts and regions. Moreover, eight species of sigmodontine rodents and 33 localities from the Cuenca del Plata region in Argentina constitute new host and geographical records. This study shows the importance of using integrative taxonomic approaches that combine morphological and molecular characters to understand biological diversity. Moreover, the discovery of R. microstoma in humans suggests the importance of further studies on this zoonotic cestode. This study provides important data on the taxonomy and distribution of R. microstoma to advance knowledge of the transmission dynamics of this parasite. 1. Introduction The Hymenolepididae (Cyclophyllidea) are the family with the highest species richness recorded among the Cestoda, with more than 920 valid species (Czaplinski and Vaucher, 1994; Mariaux et al., 2017). This family includes tapeworms that parasitize mostly birds and mammals. Among mammals, most of the genera and species occur in Soricomorpha, Chiroptera, and Rodentia (e.g., Vaucher, 1971; Czaplinski and Vaucher, 1994; Georgiev et al., 2006; Mariaux et al., 2017). Among rodents, the families with the most frequently recorded host species of Hymenolepididae are Muridae, Geomyidae, Sciuridae, Cricetidae, and Spalacidae (Gardner and Schmidt, 1988; Makarikov and Tkach, 2013; Makarikov et al., 2013, 2015; Gardner et al., 2014). Phylogenetic hypotheses on Cyclophyllidea have been proposed based on partial genes of mitochondrial DNA (cox1) and on regions of nuclear ribosomal DNA (12S, 18S, and ITS2) (Von Nickisch-Rosenegk et al., 1999; Foronda et al., 2004; Tandon et al., 2011; Sharma et al., 2016). Also, morphological and molecular analyses have been provided for various genera and species of Hymenolepididae (e.g., Hoberg et al., 2001; Olson et al., 2001; Georgiev et al., 2006; Haukisalmi et al., 2010). In addition, a hypothesis about the relationship of mammalian hymenolepidids based on partial 28S rDNA sequencing showed a pronounced morphological variation * Corresponding author. E-mail address: [email protected] (N.B. Guerreiro Martins). 1 María del Rosario Robles and NBGM contributed equally to this paper and should be considered as co-first authors. Contents lists available at ScienceDirect International Journal for Parasitology: Parasites and Wildlife journal homepage: www.elsevier.com/locate/ijppaw https://doi.org/10.1016/j.ijppaw.2022.07.002 Received 23 May 2022; Received in revised form 8 July 2022; Accepted 9 July 2022 International Journal for Parasitology: Parasites and Wildlife 19 (2022) 56–67 57 among parasites infecting unrelated hosts which form a monophyletic group (Haukisalmi et al., 2010). Some species of hymenolepidids are important for public health, particularly the species that parasitize rodents, such as Hymenolepis diminuta (Rudolphi, 1819), Rodentolepis nana (Von Siebold, 1852), and Rodentolepis microstoma (Dujardin, 1845), capable of infecting humans (Macnish et al., 2003; Marangi et al., 2003; Nkouawa et al., 2016). Around six hymenolepidid genera from rodents have been reported in North and South America (e.g., Arostrilepis Mas-Coma and Tenora, 1997, Hobergia Gardner, Dursahinhan, Campbell and R´ acz, 2020, Hymenandrya Smith, 1954, Hymenolepis Weinland, 1858, Monogynolepis Czaplinski and Vaucher, 1994, Rodentolepis Spasskii, 1954), of which 17 species of the genus Rodentolepis have been reported parasitizing Cricetidae, two from South America, and only one from Argentina (Barker, 1915; Rider and Macy, 1947; Neiland and Senger, 1952; Schiller, 1952; Wardle and McLeod, 1952; Rˆ ego, 1967, 1970; Sutton, 1974; Cunningham and Olson, 2010; Guerreiro Martins et al., 2014; Panisse et al., 2017). The species with the widest geographic and host range are R. nana and R. microstoma, parasitizing several genera of Muridae and Cricetidae, such as Apodemus, Arvicanthis, Mastomys, Mesocricetus, Microtus, Mus, Rattus, and Sigmodon (e.g., Litchford, 1963; Cunningham and Olson, 2010; Gomez-Puerta and Valdivia-Carrera, 2018). Rodentolepis akodontis Rˆ ego (1967) and R. srivastavai Rˆ ego (1970) have also been recorded for different sigmodontine rodents (Cricetidae) in Brazil: Akodon cursor (Winge, 1887), Akodon montensis Thomas, 1913 and Necromys lasiurus (Lund, 1840) (e.g., Rˆ ego, 1967; Sim˜ oes et al., 2011; Costa et al., 2019). Sigmodontine rodents are endemic to the American continent, with a wide environmental and geographical distribution and a great diversity of diets (Redford and Eisenberg, 1992; Patton et al., 2015; Wilson et al., 2017). This group of rodents includes around 110 species grouped in 40 genera in Argentina (Galliari et al., 1996; Pardi˜ nas et al., 2006; Teta et al., 2018). In this country, specimens of genus Rodentolepis sp. were found from Oxymycterus rufus (Fischer, 1814) and Deltamys kempi Thomas, 1917 in different locations of Buenos Aires province (Navone et al., 2009). Later, specimens assigned to Rodentolepis cf. akodontis of O. rufus and A. montensis were recorded in different locations of Buenos Aires, Corrientes, Entre Ríos, and Misiones provinces (Guerreiro Martins et al., 2014; Panisse et al., 2017). The purpose of this paper was to study specimens of the genus Rodentolepis isolated from eight species of Sigmodontinae rodents (Rodentia: Cricetidae) from six provinces included in the Cuenca del Plata, Argentina, based on morphological and molecular characteristics. For the molecular characterization, nuclear Internal Transcribed Spacer 1 (ITS1) and mitochondrial partial gene cytochrome c oxidase 1 (cox1) sequences were used. The genetic distances among the specimens studied and other Hymenolepididae from rodents available in the Gen- Bank were analyzed and phylogenetic inferences were provided. 2. Materials and methods 2.1. Study area and host sampling A total of 955 Sigmodontinae rodents were examined: 251 specimens of Akodon azarae (Fischer, 1829) from 18 localities, 16 specimens of Akodon dolores Thomas, 1916 from one locality, 259 specimens of Akodon montensis from six localities, 15 specimens of Akodon philipmiyersi Pardi˜ nas, D’Elía, Cirignoli y Suarez, 2005 from one locality, 112 specimens of Necromys lasiurus from nine localities, 10 specimens of Oxymycterus misionalis Sanborn, 1931 from two localities, 260 specimens of Oxymycterus rufus from 17 localities, and 32 specimens of Thaptomys nigrita (Lichtenstein, 1829) from seven localities, of six provinces in the Cuenca del Plata region in Argentina (Table 1). Rodents were obtained and identified by several collaborators between 1994 and 2018 (see Acknowledgments). 2.2. Ethics statement The research was conducted according to Argentine laws. Sample collection was carried out during fieldwork under official permission. This study was conducted in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institute of Health. Rodent specimens were collected following the procedures and protocols approved by national laws (National Animal Protection law 14.346 and references in the provincial permits), and the ethical recommendations for Research on Laboratory Animals, Farm and Obtained from Nature of the National Council of Scientific and Technical Research (CONICET), and subsequently approved by the National Agency for the Promotion of Science and Technology of Argentina (ANPCYT). No endangered species were involved in this study. Table 1 List of new localities records for Rodentolepis microstoma from Cuenca del Plata region in Argentina. Province Locality Latitude (S) Longitude (W) Buenos Aires Arana 35◦00′25.00′′ 57◦54′34.00′′ Buenos Aires Laguna de Chascomús 35◦32′38.52′′ 58◦04′46.47′′ Buenos Aires Arroyo de las Brusquitas 38◦14′05.97′′ 57◦46′49.98′′ Buenos Aires Cerro de la Gloria 36◦01′00.00′′ 57◦26′00.00′′ Buenos Aires La Balandra 34◦55′45.47′′ 57◦42′58.39′′ Buenos Aires Olavarría 36◦58′34.00′′ 60◦14′13.00′′ Buenos Aires Parque Provincial Ernesto Tornquist, Sierra de la Ventana 38◦04′44.55′′ 62◦00′19.04′′ Buenos Aires Pereyra 34◦50′14.00′′ 58◦05′23.00′′ Buenos Aires Pergamino 33◦52.9′39.56′′ 60◦46.07′4.6′′ Buenos Aires Punta Indio 35◦16′00.00′′ 57◦15′00.00′′ Buenos Aires Reserva Natural de Hudson 34◦44′00.00′′ 58◦12′00.00′′ Buenos Aires Reserva Selva Marginal de Punta Lara 34◦47′30.00′′ 58◦00′05.00′′ Corrientes Estancia San Juan Poriahú 27◦42′00.00′′ 57◦12′14.00′′ Corrientes Estaci´ on Biol´ ogica Corrientes (ex Caprim) 27◦33′00.62 58◦40′52.33′′ Corrientes Finca La Adelita, Laguna Paiva 27◦28′41.76′′ 58◦44′41.14′′ Corrientes Reserva Santo Domingo 20 km al N de Paso de los Libres 29◦36′14.27′′ 56◦58′50.63′′ Corrientes Estancia El Cimarr´ on, RP 118, km 169 27◦41′10.73′′ 57◦12′41.91′′ Entre Ríos Arroyo Feliciano 30◦58′21.00′′ 59◦41′49.00′′ Entre Ríos Arroyo Caraballo 32◦05′06.00′′ 58◦10′30.00′′ Entre Ríos Estancia Santa Ana de Carpinchorí 30◦47′39.25′′ 58◦38′51.10′′ Entre Ríos Villa Elisa 32◦09′14.73′′ 58◦20′10.40′′ Formosa Estaci´ on de Animales Silvestres Guaycolec, Ruta Nacional 11, km 1201 25◦58′57.80′′ 58◦10′04.00′′ Formosa Reserva El Bagual 26◦18′21.96′′ 58◦49′53.34′′ Formosa Río Bermejo 26◦19′45.00′′ 59◦06′43.00′′ Misiones 2 km aguas abajo desembocadura Parana-í Guazú 26◦40′39.30′′ 54◦50′08.20′′ Misiones Campo Anexo M. Belgrano, INTA, San Antonio 26◦02′54.21′′ 53◦46′32.40′′ Misiones Cu˜ na Pirú 27◦05′17.00′′ 54◦57′09.00′′ Misiones Estancia Santa In´ es 27◦31′53.69′′ 55◦52′30.48′′ Misiones Parque Provincial Pi˜ nalito 26◦25′40.07′′ 53◦50′38.26′′ Misiones Parque Provincial Urugua-í 25◦51′25.58′′ 54◦09′59.87′′ Misiones Refugio Mocon´ a 27◦08′29.04′′ 53◦55′40.40′′ Misiones Reserva de Vida Silvestre Urugua-í, Fundaci´ on Vida Silvestre 25◦58′32.29′′ 54◦07′00.08′′ Santa Fe Oliveros 32◦34′00.00′′ 60◦51′00.00′′ N.B. Guerreiro Martins et al. International Journal for Parasitology: Parasites and Wildlife 19 (2022) 56–67 58 Rodent specimens were deposited in the Mammalogy Collection of the Centro Nacional Patag´ onico (CNP), Puerto Madryn, Chubut, and in the Mammalogy Collection of the Museo de La Plata (MLP), La Plata, Buenos Aires. 2.3. Morphological analysis Viscera were studied under a stereomicroscope (Olympus SZ61-TR). Cestode specimens were removed from the rodent’s small intestines, fixed in 10% formalin and preserved in 70% ethanol. Some specimens were stained with hydrochloric carmine, dehydrated in a graded ethanol series, cleared in eugenol, and mounted in natural Canada balsam. In addition, serial histological sections of two specimens were made for a complete study of the internal morphology. One specimen was dried using the critical point method, examined and photographed by scanning electron microscopy (SEM) (JEOL, JSM 6360 LV). Specimens were studied and photographed using a polarized light microscope (Olympus BX51®), and drawings were made with the aid of a drawing tube. Types of Rodentolepis akodontis (CHIOC 29.316a-b, 29.317, 29.318a- c, 29.319, 29.320) were studied with a Carl Zeiss Axiophot light microscope equipped with a Canon Power Shot S80 camera at the Coleç˜ ao Helmintol´ ogica do Instituto Oswaldo Cruz, Rio de Janeiro, Brazil. The specimens identified as Rodentolepis cf. akodontis from previous surveys such as Guerreiro Martins et al. (2014) and Panisse et al. (2017) were restudied. Table 2 shows measurements of specimens of Rodentolepis microstoma and other species of Rodentolepis recorded in Sigmodontinae rodents (R. srivastavai and R. akodontis) as follows: mean, standard deviation, and range in parentheses. All measurements are given in millimeters (mm) unless otherwise indicated. The scales of Figs. 1 and 2 are given in micrometers ( μ m). Voucher specimens were deposited in the Helminthological Collection of Museo de La Plata (MLP-He), La Plata, Buenos Aires province. 2.4. Molecular analysis 2.4.1. DNA extraction, amplification, and sequencing Fourteen specimens studied morphologically from six rodent species were stored in 96% ethanol until used for DNA extraction: A. azarae (n =2), A. montensis (n =4), N. lasiurus (n =3), O. misionalis (n =1), O. rufus (n =3), and T. nigrita (n =1). Genomic DNA from individual Hymenolepididae was extracted and purified using the Wizard® Genomic DNA Purification Kit (Promega), according to the manufacturer’s protocol for tissues. Quality of extractions was assessed using 0.8% agarose gel electrophoresis and ethidium bromide staining. The ITS1 rDNA region was PCR-amplified using the forward F3 (5′ GCGGAAGGATCATTACACGTTC 3′) and the reverse R3 (5′ GCTCGACTCTTCATCGATCCACG 3′) (Macnish et al., 2002), and the cox1 mtDNA partial gene region was PCR-amplified using the forward pr-a (5′TGGTTTTTTGTGCATCCTGAGGTTTA 3′) and the reverse pr-b (5′AGAAAGAACGTAATGAAAATGAGCAAC 3’) (Okamoto et al., 1997). The amplification conditions were: 95 ◦C for 15 min (initial denaturation), 35 amplification cycles (95 ◦C for 30 s, 57 ◦C for 25 s, 72 ◦C for 1 min), followed by final extension at 72 ◦C for 7 min for ITS1 region and 94 ◦C for 3 min (initial denaturation), 30 amplification cycles (94 ◦C for 50 s, 42 ◦C for 1 min 30 s, 72 ◦C for 1 min 30 s), followed by final extension at 72 ◦C for 7 min for cox1. The PCR was performed in a Multigene Labnet Internation, Inc. thermocycler and the products were checked on ethidium bromide-stained 1.5% Tris-Borate-EDTA (TBE) using 0.8% agarose gels electrophoresis and examined by UV transillumination. All PCR products were purified and sequenced in both directions using amplifying primers (Macrogen, Seoul, Korea). 2.4.2. Sequence alignment Molecular analyses were performed on the rDNA (ITS1) and mtDNA (cox1) sequences and aligned using the MUSCLE alignment method included in MEGA, version 7.0 (Kumar et al., 2016). Additional Hymenolepididae species sequences from the National Centre for Biotechnology Information (NCBI) GenBank database were incorporated into the alignments (Table 3). The nucleotide sequences of the protein-coding genes (cox1) were first translated into amino acids to confirm that they lacked internal stop codons and to predict cestode protein. To assess the similarity among the marker sequences of specimens analyzed in the present study and other Hymenolepididae species, the number of base differences per sequence with respect to those under investigation was assessed using the number of differences method of the MEGA 7 program version 7.0 (Kumar et al., 2016). 2.4.3. Comparative sequences analyses and phylogenetic inferences Since we were looking to measure the diversity and conservancy between a set of sequences, considering that rDNA (ITS1) dataset sequences present a substantial length variation which compromises inferences of positional homology, an unrooted tree is proposed. Nevertheless, we propose a rooted tree for the mtDNA (cox1) dataset, using Hymenolepis diminuta, Arostripelis horrida, Coronacanthus spp. and Staphylocystoides spp. as outgroups (Table 3). Phylogenetic inferences were performed by Maximum Likelihood (ML) using the PHYML package from Guindon and Gascuel (2003) and Bayesian inferences (BI) were generated using MrBayes, version 3.2.6 (Ronquist and Huelsenbeck, 2003). Each dataset was analyzed separately, and both mitochondrial and ribosomal datasets were combined into a total evidence dataset. jModeltest was employed to compute the best partitioning scheme, as well as the best nucleotide substitution models for each partition (Posada, 2008). Models of evolution were chosen for subsequent analysis according to the Akaike Information Criterion (Posada and Buckley, 2004). For the study of the dataset containing the concatenation of two markers (ITS1 and cox1), analyses based on BI were partitioned by gene, and models for individual genes within partitions were those selected by the jModelTest. For ML inference, best-fit nucleotide substitution models included the general time-reversible model with gamma-distributed rate GTR +G (ITS1), the general time-reversible model with gammadistributed rate variation, and a proportion of invariable sites GTR + I +G (cox1 mtDNA) and general time-reversible models with gammadistributed rate GTR +G (concatenated markers). Support for the topology was examined using bootstrapping (heuristic option) (Felsenstein, 1985) over 1000 replications to assess the relative reliability of clades. The commands used in MrBayes for BI were nst =6 with gamma rates (ITS1), nst =6 with invgamma rates (cox1) and nst =mixed (concatenated phylogenetic trees). Bayesian posterior probabilities (BPP) comprise the percentage converted for BI. The standard deviation of split frequencies was used to determine whether the number of generations completed was sufficient. Each analysis was run for 10 million generations, and the tree was sampled every 500 generation. Trees from the first million generations were discarded based on an assessment of convergence. Burn-in was determined empirically by examination of the log likelihood values of the chains. After eliminating the first million trees as “burn-in”, we constructed a 50% majority-rule consensus tree, with nodal values representing the probability (posterior probability) that the recovered clades exist, given the aligned sequence data. We accepted a clade in the Bayesian tree at around 70% posterior probability. 3. Results 3.1. Morphological analysis Specimens of R. microstoma based on morphological characteristics were identified from the eight species of sigmodontine rodents, being the first records for these host species (number of recovery cestodes of N.B. Guerreiro Martins et al. International Journal for Parasitology: Parasites and Wildlife 19 (2022) 56–67 59 Table 2 Morphometrical characteristics of Rodentolepis microstoma and of the species of Rodentolepis recorded in Sigmodontinae rodents. Rodentolepis akodontis Rodentolepis srivastavai Rodentolepis microstoma Reference Rˆ ego (1967) Rˆ ego (1970) Rˆ ego (1967) Casanova et al. (2001) Cunningham and Olson (2010) G´ omez Puerta and Valdivia Carrera, 2018 This paper a Host Akodon cursor (=A. arviculoides) Necromys lasiurus (=Zygodontomys pixuna) – Mus musculus (natural host) Mus musculus (experimental) Mus musculus (natural host) Akodon Oxymycterus Necromys Thaptomys Countries Brazil Brazil Brazil Spain and France England Peru Argentina Argentina Argentina Argentina Site of Infection Small intestine Small intestine – – Bile duct and small intestine Bile duct Small intestine Small intestine Small intestine Small intestine Maximum width 0.82 0.98-1.40 1.42 – 0.45-1.42 0.83-1.38 0.68 (0.36–0.86) 0.77 (0.35–1.80) 1.11 (0.43–1.8) 0.80 Rostellum length 0.15 0.05 0.06 0.04-0.06 00.05-0.07 0.05-0.07 0.05 (0.05–0.06) 0.06 (0.04–0.10) 0.06 (0.06–0.07) 0.05 Rostellum width 0.07 0.05 0.05 0.03-0.06 0.02-0.05 0.03-0.05 0.04 (0.04–0.05) 0.07 (0.06–0.09) 0.05 (0.05–0.06) 0.04 Scolex length 0.30 0.15 0.25 0.14-0.20 0.11-0.15 – 0.14 (0.07–0.23) 0.13 (0.09–0.21) 0.15 (0.12–0.17) 0.15 Scolex width 0.36 0.21 – 0.18-0.29 0.20-0.28 0.21-0.26 0.19 (0.12–0.30) 0.18 (0.13–0.30) 0.18 (0.13–0.22) 0.16 Sucker maximum diameter 0.08 0.07 0.09 0.05-0.09 0.08-0.13 0.08-0.11 0.06 (0.05–0.11) 0.06 (0.05–0.08) 0.07 (0.06–0.08) 0.08 Sucker minimum diameter 0.08 0.07 – – 0.07-0.11 – 0.05 (0.03–0.09) 0.06 (0.04–0.08) 0.06 (0.05–0.08) 0.06 Number of rostellar hooks 24 26–30 25–29 25 (23–29) 25 (22–26) 24–26 24 (23–29) 26 (22–31) 24 (24–27) 23 Rostellar hooks length 0.018 0.015-0.017 0.015 0.010-0.023 0.013 0.014-0.016 0.017 (0.015–0.020) 0.018 (0.011–0.023) 0.013 (0.013–0.016) 0.015 (0.014–0.016) Length of testes 0.11 0.10 – 0.05-0.11 0.06-0.11 0.12-0.18 0.06 (0.04–0.12) 0.06 (0.04–0.12) 0.06 (0.04–0.09) 0.06 Width of testes 0.09 0.08 – 0.04-0.08 0.05-0.11 0.11-0.16 0.04 (0.02–0.06) 0.03 (0.02–0.06) 0.02 (0.02–0.04) 0.02 Length of cirrus sac 0.10 0.12 0.18 0.09-0.18 0.09-0.30 0.14-0.20 0.09 (0.05–0.17) 0.08 (0.04–0.17) 0.06 (0.04–0.09) 0.07 Width of cirrus sac 0.03 0.05 0.05 0.03-0.04 0.04-0.09 00.03-0.05 0.03 (0.02–0.05) 0.03 (0.02–0.06) 0.02 (0.02–0.04) 0.04 Eggs length 0.05 0.07 0.082- 0.09 0.062-0.098 – 0.083-0.094 0.03 (0.02–0.04) 0.03 (0.02–0.04) 0.054 (0.052–0.057) 0.04 Eggs width 0.05 0.06 0.067 0.051-0.075 – 0.069-0.087 0.02 (0.02–0.03) 0.02 (0.02–0.03) 0.038 (0.036–0.041) 0.03 Oncosphera length 0.026 0.028 – 0.027-0.047 – 0.038-0.044 0.014 (0.014–0.016) 0.017 (0.016–0.018) 0.032 (0.029–0.036) 0.03 Oncosphera width 0.026 0.028 – 0.029-0.054 – – 0.012 (0.012–0.013) 0.012 (0.012–0.013) 0.022 (0.020–0.025) 0.02 a Specimens previously studied from Guerreiro Martins et al. (2014) and Panisse et al. (2017) were included. Measurements are given in millimeters. N.B. Guerreiro Martins et al. International Journal for Parasitology: Parasites and Wildlife 19 (2022) 56–67 60 each species host: A. azarae, n =63; A. dolores, n =3; A. montensis, n = 171; A. philipmyersi, n =8; N. lasiurus, n =62; T. nigrita, n =1, O. misionalis, n =1; O. rufus, n =173). Moreover, 33 localities from the Cuenca del Plata region in Argentina constitute new geographical records for the species (see Table 1). 3.1.1. Rodentolepis microstoma (Figs. 1 and 2) Amended diagnosis: Cyclophyllidea, Hymenolepididae. Strobila long, craspedote, with proglottids wider than long, and in gradual maturation. Scolex with four muscular suckers. Rostellum armed with a single crown of hooks of the cricetoid type (Nº =22–31), retractable into contractile rostellar pouch. Entire worm covered with acicular filitriches (sensu Chervy, 2009). Young proglottids contain only primordia of testes. Mature proglottids containing three spherical to oval testes, arranged one poral and two aporal, are disposed aligned or in a triangle; vas deferens form an external seminal vesicle; cirrus sac ovoid, does not touch or extends beyond osmoregulatory canals, enclosing cirrus smooth and internal seminal vesicle; lobated ovary, located in the medial zone; vitelline gland compact, lobated, median; vagina located below the cirrus sac; well-developed seminal receptacle, visible even in gravid proglottids; common genital pore unilateral, dextral, near the midpoint of the margin. In gravid segments, the uterus occupies almost the entire proglottid, and contains numerous eggs. Eggs are ovoid, enclosing embryophore with polar filaments (difficult to observe) and oncosphere with embryonic hooks. 3.1.2. Taxonomic summary Rodent hosts: Mus musculus Linnaeus, 1758, Apodemus spp. Kaup, 1829, Mastomys spp. Thomas, 1915, Mus musculus Linnaeus, 1758, Rattus norvegicus, R. rattus, Meriones spp. Illiger, 1811 (Muridae); Dendromus spp. Smith, 1829 (Nesomyidae); Mesocricetus auratus (Waterhouse, 1839), Microtus spp. Schrank, 1798, Akodon azarae, A. dolores, Fig. 1. Morphological features of Rodentolepis microstoma: (A, D, G, J) scolex and rostellar hooks; (B, E, H, K) mature proglottids; (C, F, I, L) egg from different host species, (A–C) Akodon; (D–F) Necromys; (G–I) Thaptomys; (J–L) Oxymycterus. N.B. Guerreiro Martins et al. International Journal for Parasitology: Parasites and Wildlife 19 (2022) 56–67 61 A. montensis, A. philipmyersi, Necromys lasiurus, Thaptomys nigrita, Oxymycterus misionalis, O. rufus. (Cricetidae) (Hughes, 1940; Dvorak et al., 1961; Litchford, 1963; Cunningham and Olson, 2010; Guerreiro Martins et al., 2014; Panisse et al., 2017; Panti-May et al., 2018). New localities: see Table 1. Voucher specimens: MLP-He 6804, 6806, 6810, 6811, 7592-7622. Remarks: The specimens here studied show diagnostic morphological features of genus Rodentolepis and the parasitic species of American rodents are compared below (Czaplinski and Vaucher, 1994). Rodentolepis microstoma can be separated from R. evaginata (Barker and Andrews, 1915), R. johnsoni (Schiler, 1952), R. octocoronata (Von Linstow, 1879) and R. oregonensis (Neiland and Senger, 1952) by the number of rostellar hooks (22–31 vs. 10, 10, 8, 10, respectively). The specimens of R. microstoma studied have scolex smaller than R. nana (Von Siebold, 1852) and R. octocoronata (0.07–0.23 vs. 0.30–0.40, 0.39, respectively). Moreover, R. microstoma has the cirrus sac longer than R. nana and R. johnsoni (0.04–0.17 x 0.02–0.05 vs. 0.05–0.07 x 0.02–0.025, 0.11 x 0.04, respectively), and is smaller than R. octocoronata (0.04–0.17 x 0.02–0.05 vs. 0.30 x 0.37). Rodentolepis microstoma can be separated from R. evaginata, R. nana, R. octocoronata, R. oregonensis and R. srivastavai (Rˆ ego, 1970) by the size of the eggs (Barker, 1915; Neiland and Senger, 1952; Schiller, 1952; Wardle and McLeod, 1952; Rˆ ego, 1970; Sutton, 1974). Although some features, e.g., cirrus sac, size of eggs, length and shape of hooks, may separate R. microstoma and R. srivastavai, these should be reviewed in detail, (Rˆ ego, 1970). In addition, R. microstoma and R. akodontis show a similar morphology of scolex, length and shape of hooks, number of rostellar hooks, size of suckers, size of cirrus sac and eggs (e.g., Rˆ ego, 1967; Casanova et al., 2001; Cunningham and Olson, 2010; Gomez-Puerta and Valdivia-Carrera, 2018). 3.2. Molecular analysis Nucleotide sequence data of the ITS1 rDNA fragment and cox1 partial sequences of mtDNA from R. microstoma are reported and are available in GenBank (GenBank accession number) (Table 3). The ITS1 rDNA region revealed 13 haplotypes (ON000402- ON000414): these sequences were 517 base pairs (bp) (exclusive of the primers) and their G +C content was 50.9–52% The multiple alignment of 38 ITS1 sequences (including sequences of species representing members of the genus Rodentolepis from rodents and H. sapiens, and H. diminuta from Rattus spp. and Lemur catta available in GenBank, Table 3) shows a dataset of 559 characters. The intra-specific similarity observed in ITS1 sequences of R. microstoma from Argentina ranged from 94.91 to 99.74% (Table 4). Similar values of intra-specificity are found among other species of hymenolepidids. For the genus Rodentolepis, the minimum values of inter-specific similarity were observed between R. microstoma (T. nigrita) and R. nana (80.28%) and the maximum between R. microstoma (O. rufus) and R. nana (81.44%). Between different genera, the minimum and maximum values of inter-specific similarity were observed in H. diminuta vs. R. microstoma (N. temchuki) (53.59%) and H. diminuta vs. R. microstoma (A. azarae) (55.20%), respectively (Table 4). Cox1 mtDNA encoding gene revealed 12 haplotypes (ON005424– ON005435): these sequences were 350 base pairs (bp) (exclusive of the primers) and their G +C content was 32–33.5%. The multiple alignment of 43 cox1 partial sequences (including sequences of species representing members of the genus Rodentolepis and H. diminuta from Rattus spp. and H. sapiens and other outgroups available in GenBank [Table 3]) yields a dataset of 350 characters. The intra-specific similarity observed in cox1 sequences of R. microstoma from Argentina ranged from 88 to 99.74% (Table 5). Similar values of intra-specificity are found among other species of hymenolepidids. For the genus Rodentolepis, the minimum values of inter-specific similarity were observed between R. microstoma (A. montensis) and R. nana (81.10%) and the maximum between R. microstoma (Australia, Portugal, Spain) and R. nana (85.45%). Between different genera, the minimum and maximum values of interspecific similarity were observed in H. diminuta vs. R. microstoma (A. montensis) (77.97%) and H. diminuta vs. R. nana (82.41%), respectively (Table 5). Phylogenetic trees based on ITS1 rDNA provided robust phylogenetic resolution among Hymenolepididae taxa studied, regardless of the inference method (ML and BPP). The topology showed the existence of two main clades within genus Rodentolepis: Clade 1 including R. microstoma, with three subclades, and Clade 2 including R. nana and Fig. 2. Scanning electron micrographs of Rodentolepis microstoma: (A) scolex with invaginated rostellum, lateral view; (B) scolex with invaginated rostellum, apical view; (C) acicular filitriches (mature proglottids). Histological section of Rodentolepis microstoma: (D) testes (t), ovary (o), external seminal vesicle (esv), cirrus sac (cs) and cirrus (c) in mature proglottid. N.B. Guerreiro Martins et al. International Journal for Parasitology: Parasites and Wildlife 19 (2022) 56–67 62 R. fraterna with strong support of branches (100% ML bootstrap values BV and Bayesian posterior probability BPP). Furthermore, within Clade 1 were observed: subclade 1a including 12 haplotypes from H. sapiens from Australia, Mus musculus from Canary Islands and Mus spretus from Portugal (100% ML BV and BPP), subclade 1b including haplotypes of O. rufus from Buenos Aires province and O. misionalis from Misiones province (99% ML BV and BPP) and subclade 1c with a polytomy of three branches (100% ML BV and 100% BPP) including haplotypes of A. montensis from Misiones province (100% ML BV and 73% BPP), haplotypes of N. lasiurus and T. nigrita from Misiones province (100% ML BV and BPP), and haplotypes of A. azarae from Buenos Aires province (99% ML BV and 85% BPP). Subclades including R. microstoma from Argentina (b and c) form a group separate from subclade 1a including those of other geographical origin (100% ML BV and 84% BPP). In addition, a separate group is observed formed by H. diminuta as an outgroup (100% ML BV and 100% BPP) (Fig. 3). Table 3 Sequences of Rodentolepis from rodents and other Hymenolepididae species used for phylogenetic analyses (GenBank Accession numbers). Species Host species/ Geographical origin Code Gene/ Region GenBank Accession numbers Rodentolepis microstoma This paper Akodon montensis/ Misiones RmC18 ITS1 ON000414 RmC19 ON000413 RmC24 ON000412 Thaptomys nigrita/Misiones RmC41 ON000411 Oxymycterus misionalis/ Misiones RmC57 ON000410 Necromys lasiurus/ Misiones RmC70 ON000407 RmC73 ON000408 RmC74 ON000409 Akodon azarae/ Buenos Aires RmC76 ON000405 RmC77 ON000406 Oxymycterus rufus/Buenos Aires RmC79 ON000402 RmC80 ON000403 RmC82 ON000404 Rodentolepis microstoma Homo sapiens/ Australia Rm1 AY221156 Rm2 AY221158 Rm3 AY221160 Rm4 AY221161 Rm5 AY221162 Rm6 AY221163 Rm7 AY221164 Rm8 AY221167 Rm10 AY221155 Mus musculus/ Canary Islands Rm9 JN258040 Rm11 JN258040 Mus spretus/ Portugal Rm12 AY221165 Rodentolepis nana Homo sapiens/ Asia Rn1 MH629970 Rn2 MH629973 Rn3 AF461124 Rattus rattus/Iran Rn4 KJ917784 Mus musculus/ M´ exico Rn5 HM447238 Homo sapiens/ Asia Rn6 MH629972 Rn7 MH629969 Rn8 MH829968 Rn9 MH629967 Rodentolepis fraterna Rattus rattus/ Spain Rf JN258041 Rodentolepis microstoma This paper Akodon montensis/ Misiones RmC18 Cox1 ON005434 RmC34 ON005433 Thaptomys nigrita/Misiones RmC41 ON005432 Oxymycterus misionalis/ Misiones RmC57 ON005431 Necromys lasiurus/ Misiones RmC70 ON005430 RmC73 ON005429 RmC74 ON005425 Akodon azarae/ Buenos Aires RmC76 ON005424 RmC77 ON005435 Oxymycterus rufus/Buenos Aires RmC79 ON005428 RmC80 ON005426 RmC82 ON005427 Rodentolepis microstoma Mus musculus/ Peru Rm1 MG570384 Mus musculus/ China Rm2 LC063188 Mus musculus/ Japan Rm3 AB494473 Rodentolepis nana Mus musculus/ Japan Rn1 AB494471 Mesocricetus auratus/Uruguay Rn2 AB494472 Homo sapiens/ Mexico Rn3 HM447234 Rn4 HM447235 Table 3 (continued) Species Host species/ Geographical origin Code Gene/ Region GenBank Accession numbers Homo sapiens/ Mexico Mus sp./Mexico Rn5 HM447238 Mus musculus/ China Rn6 LC063187 Rattus rattus/ India Rn7 KU821727 Rattus norvergicus/China Rn8 KY079336 Rattus sp./Egypt Rn9 GU433102 Rattus sp./Egypt Rn10 GU433103 Homo sapiens/ Egypt Rn11 GU433104 Rodentolepis fraternal Rattus rattus, Mus musculus/Spain Rf JN258053 Outgroups Hymenolepis diminuta Rattus norvergicus/South Africa Hd1 ITS1 MG322245 Rattus rattus/ South Africa Hd2 MG322244 Lemur catta/ China Hd3 KP317833 Hymenolepis diminuta Rattus norvergicus/ United State Hd1 Cox1 MH472979 Hd2 MH472980 Rattus rattus/ United State Hd3 MH472981 Homo sapiens/ United State Hd4 MH472982 Rattus norvergicus/ United State Hd5 MH472983 Rattus rattus/ United State Hd6 MH472986 Hd7 KF689687 Rattus norvergicus/China Hd8 LC063185 Rattus norvergicus/ Poland Hd9 KF689686 Arostripelis horrida Cletrhionomys gloereolus/ Lithuania Ah1 DQ340976 Ah2 DQ340977 Coronacanthus magnihamatus Clethrionomys glareolus/Belarus Cm KJ710327 Coronacanthus vassilevi Neomys fodiens/ Bulgary Cv KJ710328 Coronacathus integrus Ci KJ710329 Staphylocystoides gulyaevi Sg KC789837 Staphylocystoides parissima Sorex monticolus/ USA Sp KC789840 N.B. Guerreiro Martins et al. International Journal for Parasitology: Parasites and Wildlife 19 (2022) 56–67 63 Table 4 Intra-specific and inter-specific similarity observed in ITS1 partial sequences in Rodentolepis and Hymenolepis species isolated from different host species and geographical origin. Rodentolepis microstoma (Oxymycterus rufus) Rodentolepis microstoma (Oxymycterus misionalis) Rodentolepis microstoma (Akodon azarae) Rodentolepis microstoma (Akodon montensis) Rodentolepis microstoma (Necromys temchuki) Rodentolepis microstoma (Thaptomys nigrita) Rodentolepis microstoma Rodentolepis nana Hymenolepis diminuta Rodentolepis microstoma (Oxymycterus rufus) 98.71% Rodentolepis microstoma (Oxymycterus misionalis) 98.77% – Rodentolepis microstoma (Akodon azarae) 94.91% 95.09% 97.58% Rodentolepis microstoma (Akodon montensis) 96.89% 97.34% 97.02% 99.61% Rodentolepis microstoma (Necromys temchuki) 96.05% 96.37% 96.89% 97.93% 99.74% Rodentolepis microstoma (Thaptomys nigrita) 95.40%% 95.73% 95.05% 97.09% 98.89% – Rodentolepis microstoma 94.81% 95.129% 94.09% 95.97% 94.61% 93.77% 99.59% Rodentolepis nana 81.44% 80.86% 80.77% 80.47% 80.54% 80.28% 80.58% 99.78% Hymenolepis diminuta 53.63% 53.98% 55.20% 54.20% 53.59% 54.56% 54.05% 54.75% 98.95% Table 5 Intra-specific and inter-specific similarity observed in cox1 partial sequences in Rodentolepis and Hymenolepis species isolated from different host species. Rodentolepis microstoma (Oxymycterus rufus) Rodentolepis microstoma (Oxymycterus misionalis) Rodentolepis microstoma (Akodon azarae) Rodentolepis microstoma (Akodon montensis) Rodentolepis microstoma (Necromys temchuki) Rodentolepis microstoma (Thaptomys nigrita) Rodentolepis microstoma Rodentolepis nana Hymenolepis diminuta Rodentolepis microstoma (Oxymycterus rufus) 98.71% Rodentolepis microstgoma (Oxymycterus misionalis) 94.29% – Rodentolepis microstoma (Akodon azarae) 89.61% 90.29% 97.58% Rodentolepis microstoma (Akodon montensis) 88.29% 89.86% 88% 99.61% Rodentolepis microstoma (Necromys temchuki) 92.57% 91.33% 89.05% 88% 99.74% Rodentolepis microstoma (Thaptomys nigrita) 92.47% 92.86% 89.43% 88.29% 96.86% – Rodentolepis microstoma 89.81% 88.86% 89.23% 86.67% 90.35% 91.43% 99.62% Rodentolepis nana 82.36% 82.60% 83.48% 81.10% 83.65% 84.10% 85.45% 98.65% Hymenolepis diminuta 81.41% 80.25% 81.11% 77.97% 81.78% 82.83% 81.94.7% 83.413% 99.70% N.B. Guerreiro Martins et al. International Journal for Parasitology: Parasites and Wildlife 19 (2022) 56–67 64 The analysis of the dataset based on cox1 mtDNA showed partial congruence with respect to the phylogenetic relationships between Rodentolepis spp. based on dataset ITS1. Phylogenetic analysis provided robust phylogenetic resolution among Hymenolepididae taxa, regardless of the inference method (ML and BPP). The topology showed the existence of two main clades within genus Rodentolepis: Clade 1 including R. microstoma, with five subclades, and Clade 2 including R. nana with strong support of branches (100% ML bootstrap values BV and Bayesian posterior probability BPP). Furthermore, within Clade 1 were observed: subclade 1a including 3 haplotypes from M. musculus from Peru, China, and Japan (100% ML BV and 95% BPP); subclade 1b including haplotypes of O. rufus from Buenos Aires province and O. misionalis from Misiones province (80% ML BV), and 1c with a polytomy of three branches including a haplotype of A. montensis from the province of Misiones (100% ML BV and BPP); haplotypes of A. azarae from the province of Buenos Aires and A. montensis from the province of Misiones (100% ML BV and BPP); and haplotypes of N. lasiurus and T. nigrita from the province of Misiones. Subclades including R. microstoma from Argentina (b y c) form a separate group of subclade 1a including those of other geographical origin (100% ML BV and BPP). In addition, a separate grouped is formed including H. diminuta and other Hymenolepidids as an outgroup (100% ML BV and BPP) (Fig. 4). The concatenated dataset of ribosomal (ITS1) and mitochondrial (cox1) gene sequences included 931 aligned sites and only 22 taxa (outgroups not included for phylogenetic analysis). Phylogenetic analyses of this dataset yielded a tree with branches that were strongly supported (100% ML BV and 92–100% BPP). Phylogenetic inferences match the phylogenetic results based on separate markers. Thus, two main clades were observed: Clade 1 including R. microstoma and Clade 2 including R. nana. Clade 1 includes the same clades as shown in ITS1 and the cox1 trees, but the relation among them is slightly different, since subclade 1b forms a sister group with a part of subclade 1c (100% ML bootstrap values BV and BPP) (Fig. 5). 4. Discussion Rodentolepis microstoma was first described as Taenia microstoma by Dujardin (1845) from bile ducts of mice, and was later transferred to the genus Hymenolepis Weinland, 1858 (Blanchard, 1891). Later, Spasskii (1954) in a revision of the Hymenolepididae family, transferred H. microstoma again to the genus Rodentolepis. Since Schmidt (1986) considered Rodentolepis as synonymous with Vampirolepis Spasskii, 1954 genus, a new combination, Vampirolepis microstoma, was proposed. In the last taxonomic revision of the Hymenolepididae family, Czaplinski and Vaucher (1994) considered the genus Rodentolepis as valid. Rodentolepis microstoma is recorded in America, Africa, Europe, and Asia from a wide range of rodent genera (e.g., Apodemus, Arvicanthis, Dendromys, Leggada, Mastomys, Merionis, Mesocricetus, Microtus, Mus, Promomys, Rattus, and Sigmodon) (Dvorak et al., 1961; Litchford, 1963; Hickman, 1964; Casanova et al., 2001). Rodentolepis microstoma infection in humans feces in Australia suggests the possibility of a potential zoonosis (Macnish et al., 2003). Mature tapeworms occur in the small intestine; however, Fig. 3. Phylogenetic tree of Rodentolepis spp. (Hymenolepididae: Cestoda) based on ITS1 mitochondrial DNA. Phylogenetic tree inferred using Bayesian method. Maximum Likelihood bootstrap values of clades are listed first, followed by Bayesian Posterior Probabilities respectively, for clade frequencies exceeding 65%. N.B. Guerreiro Martins et al.