New insights into Socs2 role in hepatic metabolism

NEW INSIGHTS INTO SOCS2 ROLE IN HEPATIC METABOLISM Ruymán Santana Farré Faculty of Health Sciences Department of Biochemistry and Molecular Biology, Physiology, Genetics and Immunology Department of Clinical Sciences Pharmacology Unit UNIVERSITY OF LAS PALMAS DE GRAN CANARIA ABSTRACT A well-known and thoroughly studied function of Growth Hormone (GH) is the regulation of postnatal longitudinal growth but it also affects a wide range of other biological processes such as metabolism and inflammation. GH actions are predominately mediated by the Janus Kinase (JAK)/Signal Transducer and Activator of the Transcription (STAT) signalling pathway. This pathway is regulated, in a negative feedback manner, by Suppressor of Cytokine Signalling (SOCS) family of proteins. SOCS2 knock-out (SOCS2-/-) mice are 40% larger that their Wild Type (WT) littermates due to increased GH sensitivity. This phenotype evidences SOCS2 important role as a modulator of GH signalling. In this thesis, our main goal was to extend the knowledge about the hepatic metabolism and its relationship with the GH-SOCS2 axis. Thyroid Hormone (TH) exhibits most of its effects through interaction with TH Receptor (TR), which can bind to the TH Response Element (TRE) located in several target genes, including the GH gene. Then, we first studied how congenital hypothyroidism (CH) might imprint the liver gene expression program in adulthood. To that end, pregnant rats were treated with the anti-thyroid drug Methimazole (MMI) to induce CH in their male offspring. Growth defects were evident, as reduction of body weight and tail length, from the second week of life. Once MMI treatment was discontinued, feed efficiency increased accompanied by significant catch-up growth, but these animals failed to complete full recovery of body mass, tail length and Insulin-like Growth Factor 1 (IGF-1) levels. Conversely, GH target genes, such as SOCS2, were upregulated and the CH rats showed significant changes in the expression of hepatic genes related to lipid metabolism, including increased transcription of PPAR! signalling and reduced expression of genes involved in fatty acid and cholesterol uptake, cellular sterol efflux, Trygliceride (TG) assembly, bile acid synthesis, and lipogenesis. These changes were associated with a decrease of intrahepatic lipids. Despite being euthyroid, adult CH animals showed a modified transcriptional profile in liver which might be explained by an altered tissue responsiveness to TH or GH hormonal replacement. Next, by using a SOCS2-/- mice model, we focused our investigation on the role that SOCS2 could play in the hepatic metabolism. SOCS2-/- mice and their WT littermates were fed for 4 months with control or High Fat Diet (HFD), followed by assessment of insulin sensitivity, hepatic lipid content, and expression of inflammatory cytokines. SOCS2-/- mice exhibited increased hepatic TG secretion by 77,6%, decreased liver TG levels by 49,3%, and were protected against HFD-induced hepatic steatosis. In contrast, we found that HFD-triggered attenuation of systemic insulin sensitivity was more marked in SOCS2-/- mice. Livers from HFD-fed SOCS2-/- mice showed increased Nuclear Factor "B (NF-"B) activity as well as elevated expression of genes for the inflammatory cytokines Interferon (IFN)-# and Interleukin (IL)-6. Also, an inhibitory role for SOCS2 on Toll-like Receptor (TLR) 4 signalling was demonstrated in macrophages obtained from these SOCS2-/- mice. The key regulatory role of GH on liver lipid metabolism and insulin sensitivity opens the question of whether some of the physiological actions that are attributed to other pathways could be explained by interference with GH signalling. Liver X Receptor (LXR) activation can cause hepatic lipid steatosis in experimental animals, a situation similar to the one found in the absence of liver GH Receptor (GHR). So, finally, we analysed whether actions of LXR signalling could involve interaction with GH signalling. LXR agonists impaired GH signalling in hepatocytes and attenuated GH induction of SOCS2, SOCS3 and Cytokine-inducible SH2 protein (CIS) mRNA levels in BRL-4 cells. Likewise, the activity of a luciferase reporter vector, driven by GH Responsive Element (GHRE) of the SOCS2 gene, was inhibited by simultaneous treatment with the LXR agonists. The inhibitory effect of LXR activation on GH signalling can be mimicked by overexpression of the LXR-regulated factors Sterol Regulatory Element Binding Proteins (SREBP) 1 and 2 in hepatic cells. In both cases, total and phosphorylated STAT5b protein levels were significantly reduced. DNA binding assay demonstrated that SREBP1 binds to an E-box in SOCS2 gene promoter but does not compete with STAT5b binding to a nearby site in the same promoter construct. In conclusion, we provide evidence that a growth-inhibiting condition during the neonatal period of life, such as CH, causes a long-lasting influence on the liver transcriptome and provokes an altered hormonal responsiveness in adulthood; we identify SOCS2 as an important regulator of hepatic homeostasis in response to high-fat dietary stress, and unveil its anti-inflammatory role as a TLR4 negative regulator; and we prove an inhibitory effect of LXR activation on GH signalling mediated by SREBP proteins, through downregulation of STAT5b gene transcription and stimulation of STAT5b protein degradation. LIST OF PUBLICATIONS This thesis is based on the following papers, which are referred by their roman number in the text: I. Influence of neonatal hypothyroidism on hepatic gene expression and lipid metabolism in adulthood. Santana-Farré R, Mirecki-Garrido M, Bocos C, Henríquez-Hernández LA, Kahlon N, Herrera E, Norstedt G, Parini P, Flores-Morales A and Fernández-Pérez L. PLoS One. Volume 7, Issue 5, Pages e37386. May 2012. eISSN: 1932-6203. II. SOCS2 deletion protects against hepatic steatosis but worsens insulin resistance in high-fat-diet-fed mice. Zadjali F, Santana-Farré R, Vesterlund M, Carow B, Mirecki-Garrido M, HernándezHernández I, Flodström-Tullberg M, Parini P, Rottenberg M, Norstedt G, FernándezPérez L and Flores-Morales A. FASEB Journal. Volume 26, Issue 8, Pages 3282-3291. August 2012. ISSN: 0892-6638. III. Liver X receptor agonist downregulates growth hormone signaling in the liver. Zadjali F, Santana-Farré R, Mirecki-Garrido M, Ellis E, Norstedt G, Fernández-Pérez L and Flores-Morales A. Hormone Molecular Biology and Clinical Investigation. Volume 8, Issue 2, Pages 471–478. November 2011. ISSN: 1868-1891. RELATED WORKS Lipid profiling and transcriptomic analysis reveal a functional interplay between estradiol and growth hormone in Liver. Fernández-Pérez L, Santana-Farré R, Mirecki-Garrido M, García I, Borja G, Mateo-Díaz C, Iglesias-Gato D, Díaz-Chico JC, Flores-Morales A and Díaz M. PLoS One. Volume 9, Issue 5, Pages e96305. May 2014. eISSN: 1932-6203. The effect of in vivo growth hormone treatment on blood gene expression in adults with growth hormone deficiency reveals potential biomarkers to monitor growth hormone therapy. Fernández-Pérez L, Novóa J,Ståhlberg N, Santana-Farré R, Boronat M, Marrero D, Henríquez-Hernández LA, Norstedt G and Flores-Morales A. Clinical Endocrinology. Volume 72, Issue 6, Pages 800-806. June 2010. ISSN: 0300-0664. TABLE OF CONTENTS .......................................................................................................................Abbreviations!9 ....................................................................................................................INTRODUCTION!13 ...............................................................................................................Growth Hormone!13 .........................................................................................................................Structure$13 .........................................................................................................................Secretion$13 .......................................................................................................................Regulation$14 ...............................................................................................Growth Hormone Receptor!15 .........................................................................................................................Structure$15 .....................................................................................Growth hormone binding protein$16 .............................................................................................................Gene expression$18 ......................................Growth Hormone and Growth Hormone Receptor Signalling!19 ...........................................................................Growth hormone receptor dimerisation$19 .....Growth hormone binding, receptor rotation and activation of cytoplasmatic kinases$19 ........................................................................................................Signalling pathways$20 .......................................................Signal transducers and activators of transcription$21 ...............................................................................Mitogen-activated protein kinases$24 .........................................Insulin receptor substrates and phosphoinositide 3-kinase$24 .......................................................................Phospholipase C and protein kinase C$24 ...........................................................................FAK-multiprotein signalling complex$25 .........................................................................SH2 containing tyrosine phosphatase$25 .......................................................................................................................SH2-B%$ 25 .........................................................................................................Nuclear factor "B$25 .....................................................................................................Autocrine signalling$26 .....................................................Negative Regulation of Growth Hormone Signalling!27 ......................................................................Growth hormone receptor downregulation$27 .............................................................................The ubiquitin-proteosome pathway$27 ................................Internalisation and degradation of the growth hormone receptor$28 .......................................................................................Mechanisms of desensitisation$28 ..............................................................................Suppressors of cytokine signalling$28 .............................................................................................................Phosphatases$31 ..........................................................................................Signal regulatory protein !$ 31 ...........................................................................Protein inhibitors of activated STATs$31 .....................................................................Growth factor receptor-bound protein 10$32 ........................................................................................Negative regulation of JAK2$32 .........................................................................Physiological roles of Growth Hormone!34 .............................................................................................................Postnatal growth$34 .....................................................................................................................Metabolism$35 .............................................................................................Inflammation and immunity$36 .............................................................Pathologies associated with Growth Hormone !38 ..................................................................................................OUTLINE OF THIS THESIS!40 ...................................................................................................SUMMARISING RESULTS!41 Influence of Neonatal Hypothyroidism on Hepatic Gene Expression and Lipid .................................................................................................Metabolism in Adulthood!41 SOCS2 deletion protects against hepatic steatosis but worsens insulin resistance in ........................................................................................................high-fat-diet-fed mice!44 .......Liver X receptor agonist downregulates growth hormone signalling in the liver!46 ......................................................................................................GENERAL DISCUSSION!48 .................................................CONCLUDING REMARKS AND FUTURE PERSPECTIVE!52 .....................................................................................................ACKNOWLEDGEMENTS!54 ......................................................................................................................REFERENCES!55 Growth Hormone Receptor GHR is a single membrane-spanning cell surface protein member of the type I cytokine receptor superfamily [44]. Like other members of the family, GHR lacks intrinsic kinase activity so it has long been known to utilise the Janus Kinase (JAK) 2 as a mediator for signal transduction [45, 46]. However, emerging evidences have indicated that GHR is able to signal through additional pathways, like via the activation of Sarcoma tyrosine kinases (Src), independently of JAK2 [47, 48]. Responsiveness to GH in target cells is dependent upon expression of GHR [49, 50]. GHR is found in multiple tissues, including muscle, bone, kidney, mammary gland, adipose tissue, and embryonic stem cells but the highest concentration appears in the liver, specifically in hepatocytes. Accordingly, GH regulates multiple aspects of liver metabolism, including urea cycle, bile acid synthesis, cholesterol and lipoprotein metabolism, glucose homeostasis, xenobiotic metabolism, etc. [51]. Structure The existence of the GHR was first reported by Tsushima and Friesen in 1973 [49] but it was not until 1987 that it was purified, sequenced and cloned [50]. Five years later the extracellular domain was crystallised [16]. The 620 amino acids of the GHR form a Nterminal extracellular domain of 246 amino acids (the hormone binding site), a transmembrane domain of 24 amino acids, and an intracellular domain of 350 amino acids, which contain the C-terminus (Figure 1). The GHR extracellular domain contains two fribronectin type III subdomains separated by a hinge region of four amino acids [52]. Both subdomains fold into an antiparallel %-sheet, composed of seven %-strands [16]. The subdomain 1 presents five potential Asparagine (N)- linked glycosilation sites [50] and six cysteine residues conforming three disulfide bonds [53]. GH binds the receptor at this subdomain 1 and, even though site 1 and 2 in the GH molecule are different, they bind the same residues on the GHR. The subdomain 2 contains an interface where two GHR interact. Here, a tandem of amino acids connects similar residues in the opposite GHR via salt bridges and hydrogen bonds forming the so-called dimerisation domain [54, 55]. This domain was hypothesised to be involved in the dimerisation and stabilisation of the GH-GHR complex [56] but other studies showed that these residues can be mutated without affecting the dimerisation of the receptor [57]. Subdomain 2 also contains the tryptophan-serine-X-tryptophan-serine (WSXWS) homologous motif tyrosine-glycine-isoleucine-phenylalanine-serine (YGEFS) [52, 58]. Mutations in this region result in lower ligand binding affinity and decreased signalling [56, 59]. Finally, close to the transmembrane region, the extracellular domain contains an unpaired cysteine residue suggested to be involved in the stabilisation of the dimerised GHR via intermolecular disulfide bonds. But again, mutation on this residue do not affect the dimerisation or phosphorylation of the complex [57]. The transmembrane domain of the GHR is an hydrophobic segment, spanning the membrane as a helix [60]. The crystal structure revealed the organisation of the extracellular domain of the GHR, but the exact topology of the intracellular region is still unknown. The intracellular domain contains nine tyrosine residues, phosphorylated upon activation of the GHR. There are two important domains in the intracellular tail. The first one, called Box-1, lies between amino acids 280 and 287, and it is present in multiple members of the cytokine receptor family. This region is a prolin-rich sequence (PPVPVP), essential for signal New insights into SOCS2 role in hepatic metabolism 15 transduction [61]. The second conserved domain, known as Box-2, is less well defined. It is made of hydrophobic and charged residues [62] and contains the Ubiquitin-dependent Endocytosis (UbE) motif. This motif, composed by the amino acids DSWVEFIELD and located between 322 and 331 positions, is important for the internalisation and posterior degradation of the GHR [63]. Finally, the intracellular domain contains a DSGFXS-like motif similar to the one involved in the degradation of PRL and Interferon (IFN) receptors but it is clear that this scenario differs in the case of GHR where mutations of this region do not affect the GHR endocytosis [64]. Figure 1. Structure of growth hormone receptor The GHR contains an extracellular domain of 246 amino acids, with five potencial N-glycosylation sites (N), seven cysteine residues (C), of which six form disulfide bonds, and a WSXWS-homologous structural domain (YGEFS). The intracellular domain consists of 350 amino acids and contains nine tyrosine residues (Y), phosphorylated upon GHR activation, a Box-1 motif, involved in signal transduction, and an ubiquitin-dependent endocytosis motif (UbE motif), involved in the internalisation of the receptor. Adapted from [3] with modifications. Growth hormone binding protein In humans, at the cell surface, the extracellular domain of the GHR is suitable to suffer proteolytical cleavage. This process, also known as shedding, results in a soluble, circulating form, which can be measured in blood [65]. This cleaved ectodomain is called Growth Hormone Binding Protein (GHBP). In rodents, the GHBP is generated by alternative splicing [66]. GHBP can still bind GH and at least 50% of circulating GH is complexed to this high affinity binding protein [67]. Several studies indicate that the formation of these complex can have both, positive and negative effects on GH actions. On one hand, it increases the half-life of GH by preventing its renal clearance, since the complex is too large for glomerular filtration. On the contrary, GHBP acts as an inhibitor through competition for Box-1 N-terminus Y C C C C C C C Y Y Y Y Y Y Y Y UbE motif YGEFS extracellular intracellular C-terminus N N N N N ! ! ! Ruymán Santana Farré 16 ligand binding with membrane-bound GHR and by the formation of GHR/GHBP heterodimers that are unable to signal. GHBP also reduces the availability of intact GHR at the cell surface as an indirect effect of the proteolysis phenomena [68]. The exact function of GHBP is still unclear; it may be work as a buffer normalising free GH oscillations in the blood, or may serve as a GH reservoir, prolonging GH bioavailavility and enhancing GH actions. Table 1. Growth Hormone Receptor modulators Table 1. Growth Hormone Receptor modulators Table 1. Growth Hormone Receptor modulators Table 1. Growth Hormone Receptor modulators Table 1. Growth Hormone Receptor modulators Factor Effect on GHR System Model Reference Nutrition Undernutrition and fasting ! GHR (mRNA) ! GHR (mRNA) Liver Hepatocytes Rat [69, 70] [71] Glucose starvation ! GHR (mRNA) Hepatocytes Pig [72] Endocrine System Chronic GH treatment " GHR (binding) Liver Rat, pig and sheep [73, 74] GH deficiency (hypophysectomy) ! GHR (number) Liver Rabbit [75] Acute GH treatment " GHR, 1h (binding) ! GHR, 6h (binding) Liver Rat [76] GH overexpression " GHR (binding) Liver Transgenic mouse [77] Pregnancy " GHR (mRNA and binding) Liver Mouse [78] Estrogen " GHR (mRNA) ! GHR (mRNA) Liver Rat Rabbit [79] [80] Testosterone " GHR (mRNA) Liver Rabbit [80] Dexamethasone ! GHR (mRNA) Liver Rat [79] Insulin " GHR (mRNA and protein) ! GHR (surface) ! GHR (binding) Hepatoma HuH7 cells HuH7 cells H4 cells [81] [81] [82] T3 " GHR (mRNA) Hepatoma HuH7 cells [83] IGF-I " GHR (mRNA) Liver Rat [84] Abbreviations: IGF-1, Insulin-like Growth Factor 1; GH, Growth Hormone; GHR, Growth Hormone Receptor; T3, Triiodothyronine. The arrows indicates the effect on GHR: ": increase; !: decrease. Abbreviations: IGF-1, Insulin-like Growth Factor 1; GH, Growth Hormone; GHR, Growth Hormone Receptor; T3, Triiodothyronine. The arrows indicates the effect on GHR: ": increase; !: decrease. Abbreviations: IGF-1, Insulin-like Growth Factor 1; GH, Growth Hormone; GHR, Growth Hormone Receptor; T3, Triiodothyronine. The arrows indicates the effect on GHR: ": increase; !: decrease. Abbreviations: IGF-1, Insulin-like Growth Factor 1; GH, Growth Hormone; GHR, Growth Hormone Receptor; T3, Triiodothyronine. The arrows indicates the effect on GHR: ": increase; !: decrease. Abbreviations: IGF-1, Insulin-like Growth Factor 1; GH, Growth Hormone; GHR, Growth Hormone Receptor; T3, Triiodothyronine. The arrows indicates the effect on GHR: ": increase; !: decrease. a [69, 70] b [71] c [72] d [73, 74] e [75] f [76] g [77] h [78] i [79] j [80] k [80] l [79] m [81] n [81] o [82] p [83] q [84] New insights into SOCS2 role in hepatic metabolism 17 Gene expression GHR is present on almost every cell throughout the body but it levels have, however, great individual, temporal and tissue variations. The first recognised GH-responsive tissue was the liver, mainly because of the high amount of GHR present in the hepatic cells [85]. By using more sensitive techniques, it has been possible to quantify the amount of this receptor in a vast range of extrahepatic tissues such as muscle, bone, kidney, mammary gland, adipocytes and embryonic stem cells [86]. The GHR has also been found in the brain [87] and the immune system [88]. GHR expression rises concordantly with postnatal age, being maximal at puberty but the factors controlling the regulation of its expression are poorly known. GHR synthesis was suggested to be inversely correlated to the pulsatile GH levels [89]. In contrast, chronic GH treatment increases GH binding in hepatic tissues [73, 74]. There are many factors that influence the expression of GHR either at the transcriptional or translational level. These include, among others the developmental and physiological status, malnutrition, obesity and fasting, renal failure, diabetes and glucose starvation [58, 69, 82]. Corticosteroids, testosterone, estradiol, estrogen receptor and, through the last substances, the state of pregnancy, influence GHR levels [90]. Various tissue/cell specific mechanisms control GHR mRNA transcription, as well [3]. Most of the GHR regulators are also determinants of GH secretory dynamics [89]. It is important to mention that studies regarding GHR regulation, particularly by GH and insulin, can be often contradictory. This is due to the differences in cell or tissue types used and/or GH doses and exposure times analysed (Table 1). Ruymán Santana Farré 18 Growth Hormone and Growth Hormone Receptor Signalling Growth hormone receptor dimerisation First time the GHR was crystallised, in the early 1990&s, it was proposed that GH binding provokes dimerisation of the GHR [91]. The hypothesis exposes that GH would bind one receptor with the high affinity binding site 1, then a second receptor would be recruited using the binding site 2 and this dimerisation event would activate the GHRs [62]. In the following years, some groups started to question this model. Studies with the Erythropoietin (EPO) receptor [92, 93], mutations of the GHR [56] and antibody-linking [94, 95] or cross-linking studies [96, 97], suggested that dimerisation could not lead to full signalling by itself without a conformational change. Additionally, later findings showed that GHR dimerises in the Endoplasmic Reticulum and is present on the cell surface as a pre-formed dimer [98]. From all this information rises the idea that not dimerisation but a conformational change induced by GH binding would start the signal transduction routes. This was later confirmed by the group of M. Waters, who compared the crystal structures of the unliganded and the liganded GHR and found this small conformational difference. Upon GH binding, the transmembrane and the intracellular domains rotate, and this initiates GHR activation [99]. There are many studies that tried to find the region where two GHR dimerise but the location of this exact area is still an unresolved question. Neither point mutations in both extracellular and transmembrane domain, or replacement of the transmembrane region [57] or the complete extracellular domain removal [98], avoid dimerisation of the GHRs. Even GHR lacking the cytosolic tail could still dimerise with full-length receptors, but the result is a nonproductive dimer [100]. Growth hormone binding, receptor rotation and activation of cytoplasmatic kinases As previously mentioned, the event that triggers the signalling is the binding of GH to the pre-formed GHR homodimer. The interaction of GH with the receptors is sequential. Firstly, GH binds to a GHR through site 1 and then to a second receptor through site 2. The second bind is only possible if the first GHR is already bound to a molecule of GH [101]. This binding forces a conformational change in the extracellular domain of the second GHR, resulting in a vertical movement and a rotation of the transmembrane and intracellular domains [99]. GHR lacks intrinsic enzymatic activity and requires the phosphorylation of a 121 kDa protein for the signal transduction process [102, 103]. In 1993, C. Carter-Su group identified this protein as the GHR-associated cytosolic tyrosine kinase JAK2 [45]. JAK2 belongs to the Janus kinase family which also include: JAK1, JAK3 and Tyk2 [104]. GH is able to induce JAK1 and JAK3 phosphorylation too [105, 106], but with much lower activation levels than for JAK2 [107]. Although, there is no evidence regarding Tyk2 activation by GH, but association of Tyk2 to the receptor has been detected in human liver cells [108] suggesting the possibility that GH may also use this kinase. N-terminal region of JAK2 is involved in GHR association, whereas the C-terminal region, which includes a tyrosine kinase domain, is the functional site [109, 110]. Previously, it was believed that GH binding to a GHR recruited JAK2 proteins to the receptor. However, there New insights into SOCS2 role in hepatic metabolism 19 are evidences indicating that this kinase is constitutively associated with the receptors [107] and it is suggested that JAK2 enhances the stability of the mature GHR [111]. JAK2 associates to GHR through the Box-1 domain of the receptor [112]. In an inactivated receptor dimer, the JAK2 molecules do not contact each other. After the GH binding and the consistent conformational changes in the receptors, the Box-1 sequences align and the JAK2 proteins get connected [113]. This connection results in catalytic activation of the kinase domain of the paired JAK2 molecules, cross-phosphorylation of the JAK2 proteins [114] and phosphorylation of GHRs on their tyrosine residues [115] (Figure 2). Activation of JAK2 is a very fast and transient event. Interaction of the cytosolic tails of the GHR occurs rapidly after GH binding lasting only 2-3 minutes [116]. Phosphorylated GHR/JAK2 complexes provide multiple docking sites for other signal transduction molecules, containing Src homology 2 (SH2) or phosphotyrosine binding (PTB) motifs. The crucial importance of JAK2 has been demonstrated by mutagenesis of the Box-1 site on the receptor and deletion of JAK2 itself showing, in both cases, that GHR had become inactive [112, 117]. Figure 2. Activation mechanism of the growth hormone receptor The GHR is present at the cell as a pre-formed dimer. GH binds to the first GHR of the dimer through its site 1 and then to the second one through its site 2. This binding process forces a rotation of the transmembrane and the intracellular domains of the GHRs and provokes the contact of the associated JAK2 molecules that crossphosphorylate each other starting the signalling cascade. Signalling pathways JAK2 cross-phosphorylation and phosphorylation of GHR by JAK2 provoke the initiation of several signal transduction pathways. Many of these pathways are shared by other cytokines and growth factors and have been well characterised in vitro. But, its significance in vivo is mostly unknown. GH is known to be able to cause more than 400 different extracellular intracellular GH 12 GHR dimer JAK2 ! ! ! ! Ruymán Santana Farré 20 reactions [113, 118]. The key for all these reactions is the phosphorylation/ dephosphorylation event that acts as a molecular switch for the pathways. Signal transducers and activators of transcription One of the most important and rather direct pathway that connects the activated GHR to the gene transcription involves a family of transcription factors called Signal Transducers and Activators of Transcription (STAT). STAT proteins, originally identified in IFN signalling pathways [119], are latent, SH2-domain containing, cytoplasmatic factors. At least seven mammalian STATs have been identified: STAT1 to STAT4, STAT5a, STAT5b and STAT6 [120, 121]. The two STAT5 isoforms are encoded by two different genes and present near 90% homology in their amino acid sequences. They diverge primarily in their C-Terminal transcription activation domains [122], exhibit differences in their DNA binding specificity [123, 124] and exhibit differences with respect to their tissue distribution [125, 126]. All STAT proteins share a common molecular topology and are organised into five distinct functional domains: the N-terminal domain, the DNA binding domain, a coiled-coil domain, a SH2 domain and the transcription activation domain (located at the C-terminus). STAT proteins bind the cytokine receptors through the SH2 domain. All the structural domains on STAT proteins are important for the transcriptional activity. The SH2 domain and the Nterminus are crucial for STAT-DNA interaction stability. The coiled-coil domain forms an hydrophilic interface for potential protein interactions. The DNA binding domain represents, as its name suggests, the place for union with the DNA and the C-terminal domain is responsible of the activation of the transcription [122, 127, 128]. STAT1, 3, 5a and 5b have each shown to become activated in response to GH, with STAT5b being the most relevant mediator of GH signalling [129]. The regions of the GHR required for activation of the different STATs have been mapped. STAT1, 3 and 5 all required the membrane proximal part of the GHR, including Box-1, and therefore JAK2, to become activated. Shortly after phosphorylation of the GHR/JAK2 complex, STAT5 are recruited. STAT5 binds to tyrosines within the C-terminal part of the cytosolic tail of GHR [130] and its C-terminal tyrosine residue is phosphorylated by JAK2. Upon phosphorylation, STAT5 molecules dissociate from the receptor, dimerise (homoor hetero-dimerisation) via phosphotyrosine-SH2 interactions and migrate to the nucleus [131] where they bind to specific target genes and activate transcription (Figure 3). STAT1 and STAT3 both bind the c-sis-inducible element (SIE), whereas STAT5 isoforms activate transcription of GHregulated genes by binding the GH responsive element (GHRE) or IFN-!-sequence GASlike response element (GLE) [20]. STAT knockout mice have provided a significant insight into the physiological role of this family of transcription factors. In the particular case of GH signalling, mice lacking STAT5a and/or STAT5b have been such a great tool to unveil the implications of these two proteins in the actions of GH. In contrast, STAT1 and STAT3 knockout studies have been less informative. The absence of STAT3 results in embryonic lethality [132] while the STAT1deficient mice were not small, suggesting that this protein is not a major determinant of body growth [133, 134]. Whether it plays a role in other actions of GH has not been investigated (Table 2). New insights into SOCS2 role in hepatic metabolism 21 When STAT5a-deficient mice were generated, STAT5a was found to be required for mammary gland development and lactogenesis, two processes mediated by PRL [135]. In fact, STAT5a-/- phenotype resembles the one found in PRL Receptor (PRLR) deficient mice [136]. Body growth, serum IGF-1 levels, and expression of GH-regulated genes were not altered on either sex [137, 138] suggesting that STAT5a plays a minor role in GH-regulated processes or that its loss can easily be compensated by other factors, most notably STAT5b. Figure 3. JAK2/STAT5 Signalling pathway GH binds to GHR dimer on the surface on target cells inducing tyrosine phosphorylation of GHR/JAK2, which is followed by recruitment of STAT5 proteins to the receptor. Phosphorylation of STAT5 allows the dimerisation and consequent traslocation of STAT5 to the nucleous where they bind to specific target genes and activate the transcripition. In striking contrast, the analysis of knockout mice shows that STAT5b is directly involved in longitudinal growth and in the sexually dimorphic responses to GH in liver. STAT5b deficiency (STAT5b-/-) results in 27% reduction in body growth in males, elevated GH plasma levels, reduced circulating IGF-1 and obesity [139]. In fact, male STAT5b-deficient mice grow at a rate similar to normal females. Male STAT5b-/- mice also show loss of GH pulseSTAT5 STAT5 P P Nucleous Cytosol STAT5 STAT5 STAT5 P P P P P STAT5 P ! ! docking site STAT5 P GHR extracellular intracellular JAK2 JAK2 GH DNA Ruymán Santana Farré 22 regulated, sexually dimorphic liver gene expression. Genes, normally expressed higher in male, such as Major Urinary Protein (MUP) or testosterone 16!-hydroxylase Cyp2D9, were decreased to the same levels as female wild type (WT). In contrast, testosterone 15!- hydroxylase Cyp2A4, normally repressed in males, is increased in STAT5b-deficient male mice to female levels [137, 139]. Moreover, STAT5b is required for the GH-dependant hepatic expression of IGF-1, IGF Binding Protein (IGFBP) 3, Acid Labile Subunit (ALS), Suppressors of Cytokine Signalling (SOCS) 1, SOCS2, SOCS3 and Cytokine-inducible SH2 protein (CIS) [140-142], as well as for the stimulation of lipolysis in adipose tissue [143]. Thus, STAT5b appears to be of major importance in transducing the sexual dimorphic pattern of GH secretion, an idea supported by studies that compare liver gene expression in hypophysectomized normal and STAT5b-defficient mice given GH pulse replacement [144]. The double knockout (STAT5a/b-/-) reveals additional phenotypical characteristics not observed in the single knockouts, such as female infertility and a more pronounced defect in growth [137]. Table 2. Phenotypical characteristics of mice lacking specific STAT proteins Table 2. Phenotypical characteristics of mice lacking specific STAT proteins Table 2. Phenotypical characteristics of mice lacking specific STAT proteins STAT Phenotype of the null mice Reference STAT1 Impaired response to interferons; impaired growth control and increased susceptibility to tumors. [133, 134] STAT2 Impaired response to interferons. [145] STAT3 Embryonic lethality; impaired response to pathogens and multiple defects in adult tissues including cell survival. [132] STAT4 Impaired Th1 cell differentiation caused by loss of IL-12 responsiveness. [146, 147] STAT5a Impaired mammary gland development owing to loss of PRL responsiveness. [135] STAT5b Impaired growth due to altered GH responsiveness. [139] STAT6 Impaired Th2 cell differentiation caused by loss of IL-4 responsiveness. [148-150] Abbreviations: IL, Interleukin; GH, Growth Hormone; PRL, Prolactin; STAT, Signal Transducer and Activator of Transcription; Th, T helper cells. Abbreviations: IL, Interleukin; GH, Growth Hormone; PRL, Prolactin; STAT, Signal Transducer and Activator of Transcription; Th, T helper cells. Abbreviations: IL, Interleukin; GH, Growth Hormone; PRL, Prolactin; STAT, Signal Transducer and Activator of Transcription; Th, T helper cells. a [133, 134] b [145] c [132] d [146, 147] e [135] f [139] g [148-150] Despite the high homology of the two STAT5 isoforms, all the evidences show that they have clearly distinct roles [137]. This discrepancy in function may be influenced by factors such as the relative abundance of these proteins in the different tissues and, probably, the selective interactions with other proteins and transcription factors. It is well established that the expression of STAT5b is 10-fold higher than the STAT5a one in liver and also significantly higher in males compared to females [151, 152]. In other hand, even though there is evidence that other STAT-interacting molecules may facilitate STAT recruitment to receptor complexes and therefore enhance the signalling [153, 154], these mechanisms are not yet described in relation to STAT5 proteins. New insights into SOCS2 role in hepatic metabolism 23 Mitogen-activated protein kinases The Mitogen-activated Protein Kinase (MAPK) pathway refers to a cascade of protein kinases that are highly conserved in evolution and play central roles in signal transduction in all eukaryotic cells, ranging from yeast to humans. The best-characterized forms of MAPK in mammalian cells belong to the Extracellular Signal-Regulated Kinase (ERK) family. ERK activation by a number of receptor and non-receptor kinases has an important role in the regulation of gene transcription, cellular proliferation and differentiation, and prevention of apoptosis [155]. GHR phosphorylation provides docking sites for SH2 domain containing transforming protein C (Shc). JAK2 phosphorylates Shc, which recruits Growth factor receptor-bound protein (Grb) 2 leading to activation of the MAPK pathway [156]. Grb2 protein are bound to the guanine nucleotide exchange proteins Sons of sevenless (Sos) in the cytosol of unstimulated cells. Association of Grb2 with activated receptors localizes Sos to the plasma membrane, where it is able to interact with Ras proteins, which are anchored to the inner leaflet by lipids attached to the Ras C-terminus. This interaction stimulates a guanine nucleotide exchange, resulting in formation of the active Ras-GTP complex. In its active form, Ras interacts with a number of affector proteins, including the Raf protein-serine/ threonine kinase [157]. Raf, in turn, phosphorylates and activates the MAP-ERK kinase (MEK), which then phosphorylates and activates ERK1 and ERK2 (also kown as MAPK p44 and p42) [158]. The cascade results in, among other effects, serine phosphorylation of STAT. GH is also able to stimulate other members of the MAPK superfamily such as MAPK p38 and c-Jun amino-terminal kinase (JNK) [159, 160]. Insulin receptor substrates and phosphoinositide 3-kinase Insulin Receptor Substrates (IRS) represents another pathway by which GH elicits some of its effects. Insulin and IGFs also activates the IRS; therefore IRS activation is proposed to mediate the insulin-like effects of GH. These effects include stimulation of glucose transport, protein synthesis, amino acid transport, lipogenesis, differentiation, mitogenesis, prevention of apoptosis and reorganization of the cytoskeleton network [161-163]. GH stimulates tyrosine phosphorylation of IRS 1, 2 and 3 via JAK2 providing binding site for signalling molecules like the 85-KDa regulatory subunit of Phosphoinositide 3-kinase (PI3K) [164]. PI3K is implicated in several pathways, including cell cycle regulation via p70 ribosomal subunit kinase (Rsk) [165], activation and inhibition of apoptosis via Akt serine threonine kinase [166], cell proliferation by induction of the expression of c-Myc and Cyclins E and A proteins [4, 167] and stimulation of glucose uptake via stimulation of translocation of Glucose transporter (GLUT) 4 to the cell membrane [20] among others. Inhibition of PI3K blocks GH-stimulated lipid synthesis and the anti-lipolytic actions of GH, remarking the importance of PIK3 activity on, at least, some of the insulin-like actions of GH [168]. Phospholipase C and protein kinase C GH causes an increase in intracellular Ca2+ concentration. This action seems to be dependent on L-type calcium channel activation by a mechanism including Phospholipase C (PLC) and Protein Kinase C (PKC) activations [169]. PLC# has been shown to be phosphorylated in response to GH through its direct binding to GHR/JAK2 complex [170]. Ruymán Santana Farré 24 gigantism [261] and in high-growth mice, which have a spontaneous deletion within the chromosome 10 resulting in a disruption and inactivation of the socs2 locus [262]. Phosphatases Activation of GH-dependent signalling pathways is based on protein phosphorylation of tyrosine, serine, or threonine residues. So an obvious mechanism for deactivation of this process is the one that involves Protein-tyrosine Phosphatases (PTP), a family of proteins with the ability to dephosphorylate them. The human PTP family comprises 37 “classical” PTPs (which exclusively deposphorylate tyrosine residues) plus 65 “dual specific phosphatases” (most of which dephosphorylate serine and threonine residues) [263]. Some of the classical PTPs have been implicated in GH signalling, namely SHP-1 and SHP-2, PTP-1B, and T cell PTP (TC-PTP). SHP-1 and SHP-2 share a common architecture, consisting of two SH2 domains followed by a PTP domain and a C-terminal extension [264]. Both binds to the activated JAK2 proteins. The enzymatic activity of SHP-1 limits the extent and duration of JAK2 activation upon GH stimulation [265]. Activated SHP-1 is also able to traslocate to the nucleus, where it binds to phosphorylated STAT5b, resulting in the attenuation of its activity [219]. By contrast, SHP-2 has been shown to act, as previously mentioned, as both a positive and a negative regulator of GH signalling, depending on its local concentration and cell context [178]. Once it binds to JAK2, SHP-2 associates with phosphorylated tyrosine 595 of the human GHR, depohosphorylates the receptor and attenuates JAK/STAT signalling [266]. GHR, JAK2, STAT5a and STAT5b are all physiological substrates for PTP-1B [267, 268]. TC45 is a nuclear splice form of TC-PTP that dephosphorylates STAT1 [269] and STAT5 [270]. PTP-H1 is the first PTP whose mutation results in increased body weight and affects GHR signalling and IGF-1 secretion in vivo [271]. Signal regulatory protein ! SIRP-! is a transmembrane glycoprotein that becomes tyrosine phosphorylated in response to GH and associates with the SH2 domain of SHP-2 [272]. Overexpression of SIRP-! negatively regulates GH-activated signalling by inhibition of the phosphorylation of JAK2, STAT5b, STAT3, ERK1 and ERK2 [273]. The exact mechanism by which SIRP-! negatively controls GH signalling is not clear but it could involve binding to SHP-1, to act on JAK2 and STAT5 [265, 274], or competion with GHR for biding of positive regulators such as SHP-2 or JAK2 [219]. Protein inhibitors of activated STATs There are four members of the Protein Inhibitors of Activated STATs (PIAS) family in mammals that, unlike members of the SOCS family, are constitutively expressed [275]: PIAS1, PIAS2 (originally named PIASx, with two splicing variants ! and %), PIAS3, and PIAS4 (a.k.a. PIASy). Despite they share a high degree of sequence homology with each other, they display specificity in regulating particular STAT proteins. These proteins can inhibit STATs by blocking their DNA binding sites, or by acting as E3-like ligases in facilitating New insights into SOCS2 role in hepatic metabolism 31 SUMOylation, a process similar to ubiquitination [275, 276]. PIAS1, but not the other PIAS members, blocks DNA binding by STAT1 [277]; and PIAS2, but not PIAS3, inhibits STAT4 [278]. PIAS3 inhibits STAT3-mediated transcription by blocking their DNA binding activity [279]. PIAS4 can also associate with STAT1, but it inhibits STAT1 transcription without affecting its DNA binding activity [280]. PIAS3 is the only member of the PIAS family that has been shown to directly interact with STAT5a/b and repress STAT5-mediated transcription [281]. Studies employing N-terminus truncated STAT5 shows that it physically interacts with PIAS3 and this interaction is mediated by this N-terminus of STAT5 [282]. Apart from STAT, there are several GHactivated transcription factors which are potential targets for the action of PIAS such as Interferon Regulatory Factor (IRF) 1, CCAAT/Enhancer Binding Protein ! (C/EBP!) or JNK. There are also growing evidences of PIAS function as transcriptional coregulators in various other important cellular pathways, including Wnt signalling, the p53 pathway and steroid hormone signalling [283]. Growth factor receptor-bound protein 10 GHR associates with the adaptor protein Grb10 after GH stimulation. Functional tests demonstrate that Grb10 inhibits transcription of two reporter genes containing, respectively, the serum response element of c-fos and the GH response element 2 of the Spi2.1 gene, whereas it has no effect on a reporter gene containing only STAT5 binding elements. It shows Grb10 as a negative regulator of some GH signalling pathways downstream of JAK2 and independently of STAT5 [170]. Negative regulation of JAK2 In addition to dephosphorylation and SOCS-mediated degradation, JAK2 can be phosphorylated at its Ser523 residue, potentially by ERK1 and/or ERK2 or another as-yetunknown kinase downstream of MEK1 cascade, in response to GH. When Ser523 in JAK2 was mutated, JAK2 kinase activity as well as GH-dependent tyrosyl phosphorylation of JAK2 and STAT5 was enhanced, suggesting that phosphorylation of Ser523 inhibits JAK2 kinase activity [284]. JAK2 can also autophosphorylate its tyrosine residue Y119 in its FERM domain after ligand binding of an associated receptor. Autophosphorylation of JAK2 results in a dissociation of the activated JAK2 from the receptor complex and subsequent degradation [285]. Ruymán Santana Farré 32 Figure 5. Signalling pathways activated by GH and the negative regulators of GH signalling Upon GH activation of GHR, several signal transduction routes are activated, most of them shortly summarised here. GH signals mainly through the JAK-STAT pathway but can also activate IRS-PI3K and MAPK signalling among others. The negative regulation of GHR signalling involves dephosphorylation by phosphatases, inhibition of JAK and STAT, and endocytosis and degradation of GHR. MAPK PKC STAT PIAS IRS PI3K NF!B FAK SH2-B" SOCS SIRP# PTP JAK2 JAK2 GH New insights into SOCS2 role in hepatic metabolism 33 Physiological roles of Growth Hormone Postnatal growth Although several hormones and nutrition factors participate importantly in normal postnatal growth, GH is considered the central endocrine regulator at this respect [286]. The crucial role of GH on longitudinal growth is highlighted by the 50% decrease in body weight observed in GHR-/- mice [287], the 60% decrease observed in GHRH-/- mice [288, 289], and the markedly reduced postnatal growth exhibited by hypophysectomized animals [290]. A widely discussed question involves whether the stimulatory effect of GH on postnatal growth acts directly on target tissues or is mediated by a liver-derived growth factor. In 1957, Salmon and Daughaday group postulated the somatomedin hypothesis which stated that GH induces skeletal growth by stimulating liver production of an intermediate signalling substance [291]. This substance, initially called sulfaction factor but later renamed somatomedin [292], was finally identified as IGF-1 [293]. IGF-1-/- mice exhibit a 60% reduction in growth compared to their WT littermates resembling the importance of IGF-1 for longitudinal growth [294]. However, the original somatomedin hypothesis has been challenged by new findings through the years. Several studies on hypophysectomized rats and GH-deficient mice confirmed a stimulatory role of GH on IGF-1 local production in multiple nonhepatic tissues, such as muscle, bone and fat [295]. The specific inactivation of the liver IGF-1 resulted in a substantial reduction in serum IGF-1 levels with essentially unaffected body length [296, 297]. A potential explanation for this observation is that the remaining circulating IGF-1 might be more bioavailable and, therefore, be sufficient for skeletal growth, but several findings have demonstrated that circulating IGF-1 may have little or no effect on growth, whereas local production of this factor is probably the responsible for the growth-promoting properties of IGF-1 [298-300]. An important study that compares the body length of GHR-/- mice, IGF-1-/- mice, and mice with a double inactivation of both genes, established IGF-1independent effects of GH on body growth. The phenotypes observed allows to estimate that 17% of the postnatal growth rate can be attributed to processes unrelated to GH and IGF-1, 35% is directly associated with GH-independent effects of IGF-1, 14% to IGFindependent effects of GH, and the remaining 34% to the actions of GH mediated by IGF-1 [301]. Finally, comparison of GH-deficient mice with IGF-1-/- mice revealed that GH contributed more to longitudinal bone growth than IGF-1 during post-pubertal growth [302] (Figure 6). SOCS2 is a negative regulator of GH signalling and plays an important role in the GH regulation of postnatal growth. SOCS2-/- mice exhibit an excessive growth that commences after weaning. These animals are lean and the overweight observed is associated with significantly increased long bone length and proportionate enlargement of most organs. There is no elevation in systemic IGF-1 levels but its local expression is increased in several organs [249]. Dual knock-out of SOCS2 and STAT5b and crossing of SOCS2-/- mice with GHRH-deficient mice abolish the original phenotype and confirms that the growth alterations observed are due to increased GH sensitivity [259, 303]. Contrary to what expected, SOCS2 transgenic mice also show enhanced growth and in vitro experiments reveal a dual behaviour of SOCS2 as GH regulator [248]. Low SOCS2 levels provoke an inhibitory effect on GH actions while increased levels lead to a signalling enhanced effect. It has been Ruymán Santana Farré 34 suggested that this might be caused by SOCS2 mediated inhibition of other SOCS family members, specifically SOCS1 and SOCS3 [304-306]. Figure 6. Evolution of the somatomedin hypothesis Adapted from reference [295] with modifications. Metabolism GH has diverse and pleiotropic effects on carbohydrate, lipid, protein, nitrogen and mineral metabolism [266]. It plays an important role in hepatic metabolism, the organ with the highest expression levels of GHR, but also exerts its metabolic actions in other tissues such as muscle, bone and fat. In muscle, GH actions are anabolic. It stimulates protein synthesis, enhance amino acids uptake and decrease nitrogen excretion [307, 308]. By promoting adipose tissue lipolysis and hepatic lipid mobilisation, GH increases circulating FFA and promotes their utilisation in muscle at expenses of glucose. This process leads to hyperglycemia and decreased insulin sensitivity, reason why GH is generally considered to have diabetogenic properties. In fact, muscle specific deletion of GHR in mice protects against High Fat Diet (HFD) induced insulin resistance. The exact mechanisms behind this phenotype are not clear but might be attributable to a decreased diabetogenic action of GH on the muscle [309]. In adipose tissue, GH activity has a profound effect on the metabolism of adipocytes. It promotes lipolysis and blocks the Triglyceride (TG) accumulation in adipose cells by inhibiting the lipoprotein lipase [310]. This process leads to increased circulating levels of LIVER BONE PITUITARY GH IGF-1 A (1950-1980) LIVER BONE PITUITARY GH IGF-1 B (1980-2000) ! ⤴ " IGF-1 GH C (2009- ) ENDOCRINE IGF-1 75% Liver-derived 25% Non liver-derived BONE PITUITARY GH IGF-1 ! ⤴ " IGF-1 GH New insights into SOCS2 role in hepatic metabolism 35 FFA and glycerol. In fact, a single exogenous GH pulse is able to provoke a marked increase in blood levels of FFA and glycerol [311], as well as a dose-response increase in the lipid oxidation rates [312]. This is highlighted by the decreased body fat (and the severe insulin resitance) observed in GH transgenic mice [313]. Adult GH-deficient patients characteristically develop abdominal obesity [314], and target deletion of GHR in mice adipose tissue leads to a doubling in fat mass, but has no effects on glucose homeostasis [315]. In liver, GH promotes gluconeogenesis and glycogenolysis, and reduces the uptake of glucose. It also promotes lipogenesis, inhibits lipolysis and increases lipid output by hepatic cells [316]. Mice with liver specific deletion of GHR exhibit decreased hepatic lipid secretion, insulin resistance and spontaneous hepatic steatosis [317]. In contrast to the diabetogenic effects of GH, IGF-1 mimics the actions of insulin and produces hypoglycemia by selectively enhancing glucose uptake, inhibits gluconeogenesis and enhances adipogenesis [318, 319]. This indicates that, besides acting as a mediator of the growth promoting actions of GH, IGF-1 also counters its deleterious diabetogenic effects. In fact, hepatic specific inactivation of IGF-1 results in elevated levels of GH and insulin, pancreatic islet hyperplasia and insulin resistance in liver muscle and fat [320]. The inhibition of GH actions improves the insulin sensitivity in the liver of these animals [321]. Inflammation and immunity Besides its actions on postnatal growth and metabolism, GH also plays a role in the regulation of the immune system. GH has several biological actions on immune cells: enhancing thymopoiesis and T cell development, modulating cytokine production, enhancing B cell development and antibody production, priming neutrophils and monocytes for superoxide anion secretion, and enhancing neutrophils adhesion and monocytes migration and anti-apoptotic actions [322]. GHR is expressed in all these cell types, which suggests the clear implication of GH direct effects on immune functions. Interestingly, all these cells also express GH, which implies the importance of paracrine and autocrine hormone secretion in the immune response. The intracellular mechanisms of action of immune cellderived GH are still largely unexplored, and it is anticipated that further work in this particular area will establish an important role for this source of GH in normal physiology and in pathologic situations [323]. In mice, transgenic overexpression of GH alters T cells function and decreases cytokine production [324]. GHR-/- mice shows increased levels of pro-inflammatory cytokines and decreased levels of anti-inflammatory cytokines. Since inflammation are linked to obesity and insulin resitance, it is possible that the effects of GH on this somatic processes could be mediated, at least in part, by its actions on the immune system [325]. GH has been shown to promote production of pro-inflammatory cytokines such as IL-1!, IL-6 and Tumor Necrosis Factor (TNF) ! in immune cells both in vitro [326] and in vivo [327]. A study on critically ill patients showed that GH treatment increases morbidity and mortality, likely through modulation of the immune function [328]. Also, high levels of GH and low levels of IGF-1 are linked to septic shock [329, 330]. However, other studies have found that GH treatment, in vivo and in vitro, has an inhibitory effect on pro-inflammatory cytokines production [331, 332]. These contradictory findings unveils the need for further investigations to understand the exact mechanisms involved. Ruymán Santana Farré 36 SOCS1 and SOCS3 are induced by diverse mechanisms in macrophages in response to microbial products and may be responsible for suppressing JAK/STAT signalling in these cells [333]. Lipopolysaccharide (LPS) activation of Toll-like Receptor (TLR) 4 induces SOCS1 expression and the sensitivity of SOCS1-deficient mice to sub-lethal doses of LPS is dependent on STAT1, suggesting that SOCS1 may be regulating both, TLR and IFN innate immune signalling pathways [334, 335]. Mice with a conditional deletion of SOCS3 gene in hematopoietic and endothelial cells die as young adults due to severe inflammatory lesions in the peritoneal and pleural cavities [336]. In rheumatoid arthritis patients, SOCS3 levels are elevated [337], and patients with ulcerative colitis and Crohn's disease, also shows elevated SOCS3 expression [338], suggesting a regulatory role for SOCS3 in these diseases. Finally, SOCS2-induced proteasomal degradation of TNF Receptor Associated Factor (TRAF) 6 has been found to be an important mechanism in mediating the antiinflammatory actions of aspirin-induced lipoxins [339]. New insights into SOCS2 role in hepatic metabolism 37 Pathologies associated with Growth Hormone Since GH signalling is involved in so many basic physiological processes, an altered GH functioning may result in several pathologies. The most well-known GH-associated pathologies are dwarfism and gigantism [20]. GH deficiency, if not treated, may lead to dwarfism and can, in some cases, be related to mutations that affect the secretion and function of GH [266]. Another cause for dwarfism is the Laron syndrome, which is characterised by GH insensitivity [340]. This syndrome is normally caused by mutations identified in the extracellular domain of the GHR but also a few mutations in the cytoplasmatic domain are known [341, 342]. Patients with Laron syndrome exhibit raised GH levels, absent, low or dysfunctional GHBP, and low IGF-1 levels [287]. These patients find their equivalent in the GHR-/- mice model. On contrary, high serum concentrations of GH before the puberty lead to gigantism. If the increase in GH levels occurs or persists after the puberty, when the epiphyseal plate is fused, the condition is termed acromegaly [343]. The most prevalent cause of acromegaly is the excessive GH secretion from pituitary adenomas derived from somatotropic cells. In some cases, increased GH or GHRH secretion from tumours in other parts of the body lead to the condition. Large fingers, large hands and feet, as well as prognathism and macroglossia, are distinguishing characteristics of this disorder [344]. This phenotype is in line with the one observed in GH transgenic mice [313]. Gigantism may also be caused by alterations in SOCS molecules, as shown in SOCS2 knock-out mice [219]. GH is closely connected to the insulin pathway and is also suggested to be involved in diabetes-associated pathologies. In fact, GH promotes catabolism of fatty acids instead of glucose, leading to hyperglycemia and decreased insulin sensitivity, a motive to consider that GH exerts diabetogenic properties [308, 345]. High amounts of circulating GH, as occurring in acromegaly and GH transgenic mice, have an increased risk for developing diabetes [346]. GH is also implicated in the diabetic eye and the kindney damage. A positive correlation between GH concentrations and the progression of diabetic retinopathy has been established, and GH transgenic mice develop glomerulosclerosis [20]. As expected, GHR-/- mice and Laron syndrome patients are protected against diabetes [347]. Interestingly, overexpression of SOCS2 in the % cells of the pancreas leads to diminished insulin secretion and hyperglycemia [348], and single nucleotide polymorphisms in the human SOCS2 gene have been linked to an increased risk of diabetes [349]. Our own studies have also revealed that SOCS2 deletion worsens insulin sensitivity in mice challenged with a HFD (Paper II, [350]). GH actions provoke a reduced TG accumulation in liver. In fact, patients afflicted with Nonalcoholic Fatty Liver Disease (NAFLD) show low plasma GH levels [351]. Adult GH deficiency is associated with NAFLD [352, 353], and 29% of the children with GH deficiency develop NAFLD after GH therapy cessation [314]. GH transgenic mice exhibit reduced hepatic steatosis and GH replacement therapy in GH-deficient adults leads to reduction in hepatic lipids accumulation [346]. Liver specific inactivation of GHR [317], its associated kinase JAK2 [354], or its downstream signalling intermediary STAT5b [355] leads to hepatic steatosis highlighting the protective actions of GH. Interestingly, these mice exhibit elevated circulating levels of GH due to the disrupted IGF-1 negative feedback. The abrogation of GH reverts the development of fatty liver in the mice with liver specific inactivation of JAK2 [354]. In this context, increased steatosis observed is attributed to the GH-augmented adipose tissue lipolysis and the subsequent increase in FFA levels. While SOCS2-/- mice do not display any obvious phenotype under normal dietary conditions, our studies show that Ruymán Santana Farré 38 deletion of SOCS2 protects against HFD-related hepatic steatosis, revealing a role of SOCS2 in lipid metabolism (Paper II, [350]). Less is known about the possible role that GH plays in the development of cancer. The link of GH/IGF-1 axis, with the emphasis on IGF-1, and carcinogenesis has been subject of several studies since the nineties [20, 356, 357]. In the last two decades, a rising number of articles strongly suggest roles for autocrine GH in oncogenic transformation and metastasis [358-361]. It is still unclear whether acromegalic patients have higher risk of cancer [362] and GHR deficiency is associated with a major reduction in cancer development in both mice and humans [347]. Terminally ill patients, such as those suffering from cancer or AIDS, present a major weigh loss caused by catabolism of skeletal muscle [363]. This condition is characterised by high levels of circulating GH and low IGF-1 levels so, an implication of an enhanced ubiquitin-proteosome is suggested [96, 364, 365]. It is clear that GH modulates immune functions but the distinct effects observed and the underlying mechanisms remain to be elucidated. Acute and chronic inflammatory diseases are characterised by GH resistance, resulting in weight loss, poor wound healing and muscle wasting. It is suggested a role for increased SOCS1, SOCS3 and CIS proteins in this process [366, 367]. SOCS2-/- mice are more susceptible to infection and exhibit increased levels of pro-inflammatory cytokines in response to certain pathogens, enriched macrophage population (even further enriched upon LPS treatment), and highly susceptibility to LPSinduced septic shock [339]. These findings, together with the evidences observed by our group (Paper II, [350]), highlight an anti-inflammatory role for SOCS2 protein. New insights into SOCS2 role in hepatic metabolism 39 OUTLINE OF THIS THESIS The overall goal of this study was to extend the knowledge about the hepatic metabolism and its relationship with the GH signalling pathway, in particular, with its negative regulator protein SOCS2. To that end, the following specific aims were set: 1. To assess the influence of Congenital Hypothyroidism, a growth-inhibiting condition, on the somatotropic axis, the liver transcriptome and the hepatic lipid metabolism in adulthood (Paper I). 2. To investigate the physiological role of SOCS2 in the hepatic metabolism under conditions of dietary stress. (Paper II). 3. To provide new insights into the relationship between LXR and GH signalling pathways in hepatocytes. (Paper III). Ruymán Santana Farré 40 elevated expression of SREBP1a, suggesting that this LXR-stimulated transcription factor would have an important role in the negative regulation of SOCS2 gene transcription at a promoter level. Therefore, we tested the influence of SREBP1a overexpression on the activity of the SOCS2 promoter by co-transfecting it with the active nuclear form of SREBP1a. We observed a significant downregulation of SOCS2 promoter activity after cotransfection, a result that mimic the findings observed in the previous LXR agonist experiment. But, which is the mechanism that SREBP1a uses to inhibit GH-induced SOCS2 expression? SOCS2 gene promoter presents a highly conserved putative SREBP1a binding site, the Ebox, only 13 bp upstream of the STAT5b binding site [389] so, the inhibitory effect of SREBP1a could potentially be explained by a steric hindrance of STAT5b binding to the SOCS2 promoter. To analyse this possibility, we performed protein-DNA binding assays and demonstrated that SREBP1a can bind to the SOCS2 promoter but the binding of STAT5b was not affected in the presence of high levels of SREBP1a binding activity. This findings does not support the model of competition between STAT5b and SREBP1a binding to the SOCS2 promoter and open the door to the hypothesis that inhibition of SOCS2 promoter activity upon LXR activation is due to downregulation of STAT5b protein levels. Thus, we analysed STAT5b protein levels in BRL-4 overexpressing SREBP1a or SREBP2 and we found a significant reduction in both total and phosphorylated amount of STAT5b proteins. To investigate if this reduction of STAT5b protein levels by LXR results from post-translational instability, we treated BRL-4 cells with Cycloheximide (CHX) for inhibiting de novo protein synthesis and followed the degradation of STAT5b in cells overexpressing SREBP1a and SREBP2. We found a faster decrease of STAT5b protein levels and a modest decrease in STAT5b gene expression, indicating that elevation of SREBP1a and SREBP2 levels may mediate the inhibitory effects of the LXR ligand T0901317 on GH stimulated transcripition through inhibition of STAT5b gene expression and by increasing the degradation of STAT5b protein. In conclusion, the results presented in this paper indicate that LXR ligands downregulate STAT5b and GHR levels suppressing GH signalling in hepatocytes. Further investigation of the physiological consequences of the LXR/GHR interaction should provide new evidence for a better informed use of LXR agonists and may explain some of their effects across a range of metabolic phenotypes. New insights into SOCS2 role in hepatic metabolism 47 GENERAL DISCUSSION With the works collected in this thesis, we tried to provide new evidences about the influence of the liver somatotropic axis in development, growth and metabolism. From a mechanistic point of view, we have added new insights about the role that SOCS2, a main negative regulator of somatic growth, plays in the hepatic metabolism. In Paper I, we investigated the influence of Congenital-neonatal Hypothyroidism (CH) on the liver somatotropic axis during rat development, as well as its consequences on liver gene expression and lipid metabolism. We found that transient CH is followed by catch-up growth, and this growth-inhibiting conditions during foetal-neonatal period of life may influence lipid metabolism, hormone responsiveness and liver transcriptome in adulthood. It is well known that malnutrition [390], glucocorticoid excess [391], systemic diseases [392, 393], GH-IGF-1 deficiency [394] or hypothyroidism [395, 396] are associated with retarded growth during development. As expected, in our animal model, establishment of CH provoked a delayed somatic growth rate. This delayed somatic growth rate, once the growth-inhibiting condition was removed, was followed by catch-up growth [375, 397], characterised by increased somatic growth rate and feed efficiency. Noticeably, we observed that these animals showed a higher feed efficiency along with significant differences in body weight and size in comparison with the normal rats. These findings suggest that the development of rats exposed to CH was characterised by a higher but less efficient rate of metabolism [398]. For the first time, it was shown that rats with transient CH developed a significant increased of SOCS2 (and CIS), which is a key negative regulator of GH-dependent somatic growth [219, 399] that also plays a significant role in liver metabolism (see Paper II, [350]). Interestingly, an increased expression of SOCS2 has been associated with GH resistance in sepsis [400] and uraemia [401], and in rats too small for their gestational age without evident catch-up growth [402]. Conversely, in our model, SOCS2 overexpression was associated with catchup growth and a higher activity of GH pathway in liver. We hypothesised a possible relationship of SOCS2 alterations with the delayed growth development observed in CH rats. An exploratory analysis of genome expression profile revealed that transient CH caused long-lasting alterations of hepatic lipid metabolism in adulthood. Particularly, the CH rats showed an altered lipid profiling that most likely contributed to the diminished hepatic levels of TG, cholesteryl esters and FFA found in our animals. Interestingly, expression levels of several lipid genes in CH group were altered in similar direction that detected in the WP group, suggesting that our data could be explained, in part, as a consequence of delayed growth [403, 404]. Furthermore, the reduced content of hepatic lipids in CH rats could be caused by prolonged catch-up growth which might provoke increased lipid catabolism in growing animals in comparison with those that have completed their body growth. In disagreement with our hypothesis, it has been shown that humans and rats that showed catch-up growth and increased feed efficiency after withdrawal of growth-inhibiting conditions had higher risk of liver steatosis and increased adiposity in adulthood [405-408]. Additionally, despite the changes observed in the liver, the levels of circulating lipids and lipoproteins were similar to those in the intact aged-matched littermates, which insinuate that CH rats are able to maintain lipid homeostasis and support the increased energy demands required by an accelerated growth rate. This is apparently achieved by redistributing lipids from the liver to the peripheral tissues rather than through active hepatic lipogenesis, which is an energy-consuming process that would compete with peripheral energy needs. Finally, we observed that adult CH animals, despite being euthyroid, showed a modified transcriptional profile in liver, which might be explained by altered tissue responsiveness to Ruymán Santana Farré 48 T3 and/or GH, two hormones drastically reduced by hypothyroidism [83, 371]. To test this possibility, we performed a second burst of hypothyroidism (TX) in adult animals, followed by T3 or GH replacement treatment. Notably, only the animals previously exposed to CH showed a significant reduction in FFA and resistance to GH-regulated lipid metabolism (resistance to increase hepatic cholesterol esterification and reduce VLDL and TG levels in blood). However, the absence of an altered GH response in liver, in terms of lipid changes, suggests that those findings were most likely due to altered GH activity in extrahepatic tissues, such as fat and muscle [316]. Interestingly, the lipid homeostatic capacity of the CH liver in response to T3 was not dramatically affected but, in contrast, it showed a disproportionate enhanced expression of ME in response to T3 treatment. At this point, we cannot exclude the possibility that CH effects on transcription factors and other nuclear coregulators influence ME expression, but additional experiments are needed to test this hypothesis. Likewise, a clearer mechanistic explanation for the metabolic changes in CH rats would require, among others, the analysis of fat and muscle metabolism and the exploration of its long-lasting metabolic consequences. In Paper II, we wanted to focus on the influence of SOCS2 on liver metabolism. A role for SOCS proteins in the aetiology of NAFLD is starting to emerge. There are a lot of studies that link SOCS1 and SOCS3 with liver metabolic disease [245, 409-411] but SOCS2 implication has not yet been investigated. Its importance is suggested by studies showing that changes in SOCS2 mRNA levels in human steatotic livers [382]. Also, of possible relevance for the development of NAFLD is the role of SOCS2 as an inhibitor of GH actions on hepatic TG metabolism [249, 256, 259, 317]. However, the mechanisms involved still need to be clarified. To that end, we analysed the metabolic response of SOCS2-/- mice under conditions of high-fat dietary stress. These animals exhibited enhanced hepatic TG secretion and were protected against HFD-induced liver steatosis. However, they displayed severe systemic insulin resistance associated with hyperinsulinemia and worsened insulin sensitivity in the liver. The HFD-fed SOCS2-/- mice also exhibited enhanced expression of inflammatory cytokines in liver, demonstrating a novel role of SOCS2 as a negative regulator of macrophage activation. For the first time, we demonstrated that SOCS2-/- phenotype clearly differs from the liver-specific SOCS1-, SOCS3-knockout phenotypes [247, 411, 412], which show enhanced liver steatosis, highlighting the functional disparity between members of the SOCS family. The reduced steatosis observed in the HFD-fed SOCS2-/- mice is in agreement with the well-known actions of GH in promoting hepatic lipid mobilisation [317, 352] and strongly suggest that enhanced GH signalling in the liver is, in part, responsible for this effect. Other mice models of altered GH sensitivity, such as those with liver specific deletion of JAK2 [354], GHR [317] or STAT5 [355], spontaneously develop hepatic steatosis. This is in line with our hypothesis that the lack of hepatic steatosis in the SOCS2-/- mice is due to increased GH sensitivity. Interestingly, the studies on hepatocyte-specific deletion of JAK2 have unveiled another mechanism whereby GH may control liver fat content [354, 413]. These mice, denoted JAK2L, show elevated levels of circulating GH, which in turn leads to increased adipose tissue lipolysis, increased FFA supply to the liver and, finally, steatosis. On contrary, SOCS2-/- mice present reduced levels of circulating GH and, in opposition to JAK2L, exhibit increased fat mass, suggesting that reduced lipolysis may also contribute to reduced hepatic TG accumulation. Noticeably, we did not detect changes in circulating FFA levels between both animal models so, further experiments are needed to analyse the exact role of GH and adipose tissue lipolysis in the SOCS2-/- mice liver. In addition, the exacerbated insulin resistance showed by HFD-fed SOCS2-/- mice matches the phenotype of GH transgenic mice fed on normal diet [313] but, the need of a trigger (in the form of HFD), underscores the difference between models of increased hormone New insights into SOCS2 role in hepatic metabolism 49 secretion and models of increased hormone sensitivity. As previously mentioned, SOCS2-/- mice shows decreased plasma levels of GH under normal circumstances but, interestingly, retained normal levels of IGF-1. GH transgenic mice, on the other hand, have elevated levels of both GH and IGF-1 [414]. Despite increased GH sensitivity, this particularity allows the SOCS2-/- mice to avoid the deleterious diabetogenic effects of elevated GH, likely through negative feedback on the pituitary by IGF-1. This finding suggests that hyperactivity of GHR signalling, by itself, is unlikely to account for the diet-dependant deterioration in glucose control observed in SOCS2-/- mice. A more plausible explanation is that the antiinsulinic actions of GH are exacerbated by diet-related mechanisms under SOCS2 control. We provide evidence that excessive production of inflammatory cytokines is one of them. Macrophage activation in liver and adipose tissue by HFD leads to the production of inflammatory cytokines, a process required for diet-induced insulin resistance [380]. Transgenic mice with enhanced hepatocyte NF-"B activity exhibit insulin resistance driven by inflammation [415], a phenotype that resembles the HFD-fed SOCS2-/- mice one. In our model, the loss of SOCS2 leads to an altered response to HFD, resulting in increased expression of inflammatory cytokines and enhanced NF-"B activation. BMDMs from SOCS2-/- mice show increased phagocytic activity in vitro and are hyperresponsive to LPS stimulation suggesting that the anti-inflammatory actions of SOCS2 may be mediated, to some extent, through inhibition of the LPS response in macrophages. Since we have not noted any GH contribution to the augmented LPS signalling in SOCS2-/- macrophages, it is evident that GH plays a part in the regulation of the inflammatory response. Transgenic GH mice suffer from chronic inflammation [416] and short term GH treatment on healthy volunteers leads to increased plasma levels of pro-inflammatory cytokines [417]. Surprisingly, a recent publication shows that macrophage-specific deletion of GHR in mice leads to exacerbated insulin resistance after HFD feeding [418], similarly to what is observed in our SOCS2-/- mice model. This may suggest that GH has an anti-inflammatory effect during dietary stress. A possible way to reconcile this two opposite findings is that avoid of GHR is a synonym of low SOCS2 levels which, as our experiments showed, leads to increased secretion of inflammatory cytokines. Then, speculatively, SOCS2 might be considered an anti-inflammatory agent that counters the pro-inflammatory effects of GH by direct inhibition of GH signalling but also by decreasing the pro-inflammatory cytokine production. In Paper III, we worked on the hypothesis that some of the physiological actions on lipid metabolism could be explained by crosstalk between GH and other relevant signalling pathways. This is the case of LXRs which are critical modulators of cholesterol, fatty acids and glucose homeostasis. Interestingly, pharmacological activation of LXR in mice also leads to severe hepatic steatosis [385]. LXR-/- mice are resistant to HFD induced steatosis [387, 388], a phenotype that resembles our SOCS2-/- mice model. LXR and GHR activations in the liver also show antagonising effects on glucose metabolism: inhibition [384] and induction [3] of hepatic gluconeogenesis, respectively. In this study, we demonstrated that in vitro LXR activation attenuates GH signalling by reducing STAT5b activity, leading to inhibition of the transcription of GH-induced genes, such as SOCS2. We also provided evidence that this attenuation is mimicked by overexpression of SREBP1 and SREBP2, both LXR downstream target genes. These effects can be partly explained at two different levels: inhibition of STAT5b gene transcription, and enhancement of STAT5b protein degradation. Noticeably, in primary human hepatocytes, LXR stimulation also leads to a severe reduction of GHR levels. We observed that LXR activation by its agonist T0901317, or overexpression of SREBP1a or SREBP2, causes a significant inhibition of GH-induced gene expression. Our group has previously identified a novel response element within the first intron of the Ruymán Santana Farré 50 human SOCS2 gene composed of an E-box followed by a tandem of STAT5b binding sites, both of which are required for full GH responsiveness. Interestingly, the E-box motif is a putative binding site for SREBP1 and is located only 13 bp upstream of the STAT5b binding site of the SOCS2 gene promoter [389]. Thus, the inhibitory effect of SREBP1 on GHinduced SOCS2 expression could be explained by sterical hindrance of STAT5b binding to the promoter. Our protein-DNA binding assays did not support such model. We showed that post-translational instability contribute to the reduction of STAT5b levels by LXR where SREBP1a and SREBP2 promote a fast degradation of STAT5b protein in hepatocytes. Previous work has implicated proteosomal degradation in the downregulation of activated STAT5a and demonstrated its ubiquitination in the nucleus [419]. This proteosomal degradation is modulated by a short motif comprising amino acids 751-762 of the C-terminal domain of STAT5a. This region is highly conserved in STAT5b, and corresponds to amino acids 757-768 [420]. Furthermore, a recent in depth proteome screening of ubiquitination sites has identified the ubiquitin modification of lysine 567 of the human STAT5b [421]. The E3 ubiquitin ligase complex responsible for STAT5b ubiquitination in the nucleus remains to be identified. Our data would suggest that the activity of this unknown E3 ligase could be modulated by SREBP1a and SREBP2 activation. In addition, Microarray analysis of humans, mice and rats livers have demonstrated that LXR activation leads to decreased GHR mRNA levels, providing the most likely explanation for these effects [384, 422, 423]. Therefore, we conclude that the LXR driven mechanisms that inhibit GH signalling pathway seem to operate on both GHR and STAT5b. This redundant behaviour suggests that GH antagonism may be an important aspect of LXR physiological actions. Further in vivo studies should provide interesting information about the relationship between LXR and STAT5b mediated transcription. . New insights into SOCS2 role in hepatic metabolism 51 CONCLUDING REMARKS AND FUTURE PERSPECTIVE In this thesis we explored the influence of congenital-neonatal deprivation of hormones in growth and development, and its long-lasting metabolic effects in adulthood. We studied the physiological role of SOCS2 and the lipid associated molecular mechanisms that regulate GH signalling in liver. Conclusions are summarised below. 1. Congenital-neonatal hypothyroidism causes long-lasting influence on the liver transcriptome and provokes an altered hormonal responsiveness in adulthood. 2. Deletion of SOCS2 protects against HFD-induced hepatic steatosis but worsens insulin resistance. Increased levels of pro-inflammatory cytokines contributes to the insulin resistance phenotype. 3. SOCS2 acts as an anti-inflammatory agent by inhibiting TLR4 mediated release of pro-inflammatory cytokines from macrophages in vitro. This effect seems to be independent of GH. 4. LXR-SREBP activity inhibits GH-regulated transcription in liver by targeting GHR and STAT5b resulting in reduced SOCS2 expression. We shown that rats with transient CH developed a significant increase of hepatic SOCS2 (and CIS), which was associated with altered liver metabolism and altered sensitivity to GH or T3 hormone replacement in adulthood. These findings suggest SOCS2-/- mice as a possible tool for understanding the link between transient CH and its metabolic consequences in adulthood. More evident is that SOCS2-/- mice provide a novel and useful model to understand the complex relationship between inflammation, GH actions and nutrition in the control of hepatic glucose and lipid homeostasis. It is important to understand under which conditions SOCS2 is a merely negative regulator of GH, a mediator of GH actions or an independent agent. Cross breeding of SOCS2-/- mice with GH-deficient mice, or the use of GH or GHR antagonists, seem to be interesting tools to better understand the GH-independent functions of SOCS2. Our results unveil a previously unrecognised function of SOCS2 as a negative regulator of LPS-activated TLR4, but the signalling molecules within the TLR4 pathway that are targeted by SOCS2 need to be identified, and the possible role of GH in this process need to be elucidated. Also, it is important to clarify the role that inflammation plays in the insulin resistance observed in the SOCS2-/- mice. A simple approach to start with may include analysis of SOCS2-/- mice systemic treated with NF-"B inhibitors. GH regulatory actions on hepatic metabolism implies a possible direct relationship with several metabolic pathways such as PPAR! and LXR. We have just started analysing the LXR interaction with GH signalling but, the level of redundancy showed by LXR, suggests that GH antagonism is an important aspect of its physiological actions in the liver. Further in vivo studies should provide interesting information about the relationship between these two pathways. It is intriguing that intracellular sterols might initiate an inflammatory response, as well as activate LXR. Thus, the anti-inflammatory effect of LXR actions may have evolved as Ruymán Santana Farré 52 a response to the pro-inflammatory actions of intracellular sterols. Interestingly, we demonstrated that LXR activation leads to SOCS2 inhibition, an anti-inflammatory agent in conditions of dietary stress. Therefore, the mechanisms that drive LXR and SOCS2 interaction, and their physiopathological implications, deserve further studies too. New insights into SOCS2 role in hepatic metabolism 53 ACKNOWLEDGEMENTS So, here we are. It is time for me to take a trip down memory lane. I would like to express my sincere gratitude to: Leandro Fernández, my supervisor, for accepting me in your group and guiding me in my first steps as a scientist. Thanks for all these years working together at the lab. Amilcar Flores, for receiving me with open arms at the Karolinska Institute. Your passion for science and your positivism is contagious. All the past and present inhabitants of the Physiology Department at the fifth floor: Cristina Bilbao, Raquel Ramírez, Germán Rodríguez, Juan Carlos Díaz, Nicolás Díaz, Yeray Brito, Julia Wiebe, Laura López, Ricardo Chirino, Carlos Mateos, Patricia Martín, Sara Rubio, Borja Guerra, and Roberto Jiménez. Luis Henríquez, for being my “partner in crime” in the good old days. Elisa Pérez, for your support from the distance. Ignacio González, for your cheerful spirit and your priceless help in such difficult times. Mercedes de Mirecki and Dionisio Lorenzo, for all the incredible after-lunch conversations spent together. All the amazing people I met at the Center for Molecular Medicine during my months at Stockholm: Gunnar Norstedt, Yin-Choy Chuan, Elisabeth Rico, Louisa Cheung, Oscar Vidal, Christina von Gertten, Kåre Hulten, Roxana Merino, Diego Iglesias, Mattias Vesterlund, and Fahad Al-Zadjali. Víctor Nassar, Fran González and Kuly Rivero, my bandmates, for all the hours sharing our passion for the music. Antonio Cabrera for all the coffee-break moments and for your countless encouraging words. Tana Rodríguez, Laura Cabrera, Enríque Batista, Marcos Martín, and David Martel, my “Mighty Avengers”, thanks for being who you are. And last, but not least, I want to send all my whole-hearted thanks to my Mother and my Brother, my beloved family. Thanks for believing in me and always being my haven in the middle of the storm. After so many years, we did it! This work was supported by grants from: The Spanish Ministry of Science and Innovation (MICINN) with the European Regional Development Fund - European Social Fund [SAF2003-02117 and SAF2006-07824]. The Canary Islands Agency of Research, Innovation and Society of the Information (ACIISI) [PI2007/033 and SE-10/13]. The Cancer Research Institute of the Canary Islands (ICIC) [ACIISI-ICIC 2010]. The University Foundation of Las Palmas (FULP) [Innova Canarias 2020]. Ruymán Santana Farré 54 REFERENCES [1]$Isaksson OG, Jansson JO, Gause IA. Science 1982;216(4551):1237-1239. [2]$Press M. Diabetes Metab Rev 1988;4(4):391-414. [3]$Kopchick JJ, Andry JM. Mol Genet Metab 2000;71(1-2):293-314. [4]$Jeay S, Sonenshein GE, Postel-Vinay MC, Kelly PA, Baixeras E. Mol Cell Endocrinol 2002;188(1-2):1-7. [5]$Lombardi G, Colao A, Ferone D, Marzullo P, Orio F, Longobardi S, Merola B. Horm Res 1997;48 Suppl 4:38-42. [6]$Yoshizato H, Fujikawa T, Soya H, Tanaka M, Nakashima K. Endocrinology 1998;139(5):2545-2551. [7]$Li CH, Evans HM, Simpson ME. J Biol Chem 1945;159(2):353-366. [8]$Li CH, Papkoff H. Science 1956;124(3235):1293-1294. [9]$Martial JA, Hallewell RA, Baxter JD, Goodman HM. Science 1979;205(4406): 602-607. [10]$Abdel-Meguid SS, Shieh HS, Smith WW, Dayringer HE, Violand BN, Bentle LA. Proc Natl Acad Sci U S A 1987;84(18):6434-6437. [11]$Miller WL, Eberhardt NL. Endocr Rev 1983;4(2):97-130. [12]$Lewis UJ, Singh RN, Tutwiler GF, Sigel MB, VanderLaan EF, VanderLaan WP. Recent Prog Horm Res 1980;36:477-508. [13]$Lewis UJ, Sinha YN, Lewis GP. Endocr J 2000;47 Suppl:S1-8. [14]$Horseman ND, Yu-Lee LY. Endocr Rev 1994;15(5):627-649. [15]$Kopchick JJ. Horm Res 2003;60 Suppl 3:103-112. [16]$de Vos AM, Ultsch M, Kossiakoff AA. Science 1992;255(5042):306-312. [17]$Watahiki M, Yamamoto M, Yamakawa M, Tanaka M, Nakashima K. J Biol Chem 1989;264(1):312-316. [18]$Nicoll CS, Mayer GL, Russell SM. Endocr Rev 1986;7(2):169-203. [19]$Besson A, Salemi S, Deladoey J, Vuissoz JM, Eble A, Bidlingmaier M, Burgi S, Honegger U, Fluck C, Mullis PE. J Clin Endocrinol Metab 2005;90(5):2493-2499. [20]$Okada S, Kopchick JJ. Trends Mol Med 2001;7(3):126-132. [21]$Shuto Y, Shibasaki T, Otagiri A, Kuriyama H, Ohata H, Tamura H, Kamegai J, Sugihara H, Oikawa S, Wakabayashi I. J Clin Invest 2002;109(11):1429-1436. [22]$Tannenbaum GS. Endocrinology 1980;107(6):2117-2120. [23]$Gillies G. Trends Pharmacol Sci 1997;18(3):87-95. [24]$Mauras N, Blizzard RM, Link K, Johnson ML, Rogol AD, Veldhuis JD. J Clin Endocrinol Metab 1987;64(3):596-601. [25]$Jansson JO, Eden S, Isaksson O. Endocr Rev 1985;6(2):128-150. [26]$Eden S. Endocrinology 1979;105(2):555-560. [27]$Tannenbaum GS, Choi HK, Gurd W, Waxman DJ. Endocrinology 2001;142(11): 4599-4606. [28]$Gebert CA, Park SH, Waxman DJ. Mol Endocrinol 1999;13(2):213-227. [29]$Scheepens A, Moderscheim TA, Gluckman PD. Horm Res 2005;64 Suppl 3:66-72. [30]$Beyea JA, Olson DM, Vandergriend RA, Harvey S. Cell Tissue Res 2005;322(3): 379-392. [31]$Harvey S, Kakebeeke M, Sanders EJ. J Mol Neurosci 2004;22(1-2):139-145. [32]$Kirpensteijn J, Timmermans-Sprang EP, van Garderen E, Rutteman GR, Lantingavan Leeuwen IS, Mol JA. Mol Cell Endocrinol 2002;197(1-2):179-185. [33]$Kelley KW, Weigent DA, Kooijman R. Brain Behav Immun 2007;21(4):384-392. New insights into SOCS2 role in hepatic metabolism 55 [34]$Lantinga van Leeuwen IS, Teske E, van Garderen E, Mol JA. Anticancer Res 2000;20(4):2371-2376. [35]$Mukhina S, Liu D, Guo K, Raccurt M, Borges-Bendris S, Mertani HC, Lobie PE. Endocrinology 2006;147(4):1819-1829. [36]$Alsat E, Guibourdenche J, Luton D, Frankenne F, Evain-Brion D. Am J Obstet Gynecol 1997;177(6):1526-1534. [37]$Alsat E, Guibourdenche J, Couturier A, Evain-Brion D. Mol Cell Endocrinol 1998;140(1-2):121-127. [38]$Perry JK, Emerald BS, Mertani HC, Lobie PE. Growth Horm IGF Res 2006;16(5-6): 277-289. [39]$Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K. Nature 1999;402(6762):656-660. [40]$Nass R, Gilrain J, Anderson S, Gaylinn B, Dalkin A, Day R, Peruggia M, Thorner MO. Endocrinology 2000;141(6):2084-2089. [41]$Namba H, Morita S, Melmed S. Endocrinology 1989;124(4):1794-1799. [42]$Lavin TN, Baxter JD, Horita S. J Biol Chem 1988;263(19):9418-9426. [43]$Tamura H, Kamegai J, Sugihara H, Kineman RD, Frohman LA, Wakabayashi I. J Neuroendocrinol 2000;12(6):481-485. [44]$Cosman D. Cytokine 1993;5(2):95-106. [45]$Argetsinger LS, Campbell GS, Yang X, Witthuhn BA, Silvennoinen O, Ihle JN, Carter-Su C. Cell 1993;74(2):237-244. [46]$Carter-Su C, Argetsinger LS, Campbell GS, Wang X, Ihle J, Witthuhn B. Proc Soc Exp Biol Med 1994;206(3):210-215. [47]$Zhu T, Ling L, Lobie PE. J Biol Chem 2002;277(47):45592-45603. [48]$Manabe N, Kubota Y, Kitanaka A, Ohnishi H, Taminato T, Tanaka T. Leuk Res 2006;30(11):1391-1398. [49]$Tsushima T, Friesen HG. J Clin Endocrinol Metab 1973;37(2):334-337. [50]$Leung DW, Spencer SA, Cachianes G, Hammonds RG, Collins C, Henzel WJ, Barnard R, Waters MJ, Wood WI. Nature 1987;330(6148):537-543. [51]$Mathews LS, Enberg B, Norstedt G. J Biol Chem 1989;264(17):9905-9910. [52]$Bazan JF. Proc Natl Acad Sci U S A 1990;87(18):6934-6938. [53]$Fuh G, Mulkerrin MG, Bass S, McFarland N, Brochier M, Bourell JH, Light DR, Wells JA. J Biol Chem 1990;265(6):3111-3115. [54]$Chen C, Brinkworth R, Waters MJ. J Biol Chem 1997;272(8):5133-5140. [55]$Bernat B, Pal G, Sun M, Kossiakoff AA. Proc Natl Acad Sci U S A 2003;100(3): 952-957. [56]$Behncken SN, Waters MJ. J Mol Recognit 1999;12(6):355-362. [57]$Gent J, Van Den Eijnden M, Van Kerkhof P, Strous GJ. Mol Endocrinol 2003;17(5): 967-975. [58]$Kelly PA, Ali S, Rozakis M, Goujon L, Nagano M, Pellegrini I, Gould D, Djiane J, Edery M, Finidori J, et al. Recent Prog Horm Res 1993;48:123-164. [59]$Baumgartner JW, Wells CA, Chen CM, Waters MJ. J Biol Chem 1994;269(46): 29094-29101. [60]$Grotzinger J. Biochim Biophys Acta 2002;1592(3):215-223. [61]$Dinerstein H, Lago F, Goujon L, Ferrag F, Esposito N, Finidori J, Kelly PA, PostelVinay MC. Mol Endocrinol 1995;9(12):1701-1707. [62]$Postel-Vinay MC, Finidori J. Eur J Endocrinol 1995;133(6):654-659. [63]$Govers R, ten Broeke T, van Kerkhof P, Schwartz AL, Strous GJ. EMBO J 1999;18(1):28-36. [64]$van Kerkhof P, Putters J, Strous GJ. J Biol Chem 2007;282(28):20475-20483. Ruymán Santana Farré 56 [243]$Fujimoto M, Naka T, Nakagawa R, Kawazoe Y, Morita Y, Tateishi A, Okumura K, Narazaki M, Kishimoto T. J Immunol 2000;165(4):1799-1806. [244]$Kawazoe Y, Naka T, Fujimoto M, Kohzaki H, Morita Y, Narazaki M, Okumura K, Saitoh H, Nakagawa R, Uchiyama Y, Akira S, Kishimoto T. J Exp Med 2001;193(2): 263-269. [245]$Alexander WS, Starr R, Fenner JE, Scott CL, Handman E, Sprigg NS, Corbin JE, Cornish AL, Darwiche R, Owczarek CM, Kay TW, Nicola NA, Hertzog PJ, Metcalf D, Hilton DJ. Cell 1999;98(5):597-608. [246]$Chong MM, Thomas HE, Kay TW. J Biol Chem 2002;277(31):27945-27952. [247]$Starr R, Metcalf D, Elefanty AG, Brysha M, Willson TA, Nicola NA, Hilton DJ, Alexander WS. Proc Natl Acad Sci U S A 1998;95(24):14395-14399. [248]$Greenhalgh CJ, Metcalf D, Thaus AL, Corbin JE, Uren R, Morgan PO, Fabri LJ, Zhang JG, Martin HM, Willson TA, Billestrup N, Nicola NA, Baca M, Alexander WS, Hilton DJ. J Biol Chem 2002;277(43):40181-40184. [249]$Metcalf D, Greenhalgh CJ, Viney E, Willson TA, Starr R, Nicola NA, Hilton DJ, Alexander WS. Nature 2000;405(6790):1069-1073. [250]$Croker BA, Krebs DL, Zhang JG, Wormald S, Willson TA, Stanley EG, Robb L, Greenhalgh CJ, Forster I, Clausen BE, Nicola NA, Metcalf D, Hilton DJ, Roberts AW, Alexander WS. Nat Immunol 2003;4(6):540-545. [251]$Yasukawa H, Ohishi M, Mori H, Murakami M, Chinen T, Aki D, Hanada T, Takeda K, Akira S, Hoshijima M, Hirano T, Chien KR, Yoshimura A. Nat Immunol 2003;4(6): 551-556. [252]$Marine JC, McKay C, Wang D, Topham DJ, Parganas E, Nakajima H, Pendeville H, Yasukawa H, Sasaki A, Yoshimura A, Ihle JN. Cell 1999;98(5):617-627. [253]$Seki Y, Hayashi K, Matsumoto A, Seki N, Tsukada J, Ransom J, Naka T, Kishimoto T, Yoshimura A, Kubo M. Proc Natl Acad Sci U S A 2002;99(20):13003-13008. [254]$Krebs DL, Uren RT, Metcalf D, Rakar S, Zhang JG, Starr R, De Souza DP, Hanzinikolas K, Eyles J, Connolly LM, Simpson RJ, Nicola NA, Nicholson SE, Baca M, Hilton DJ, Alexander WS. Mol Cell Biol 2002;22(13):4567-4578. [255]$Krebs DL, Metcalf D, Merson TD, Voss AK, Thomas T, Zhang JG, Rakar S, O'Bryan M K, Willson TA, Viney EM, Mielke LA, Nicola NA, Hilton DJ, Alexander WS. Proc Natl Acad Sci U S A 2004;101(43):15446-15451. [256]$Greenhalgh CJ, Rico-Bautista E, Lorentzon M, Thaus AL, Morgan PO, Willson TA, Zervoudakis P, Metcalf D, Street I, Nicola NA, Nash AD, Fabri LJ, Norstedt G, Ohlsson C, Flores-Morales A, Alexander WS, Hilton DJ. J Clin Invest 2005;115(2): 397-406. [257]$LeRoith D, Nissley P. J Clin Invest 2005;115(2):233-236. [258]$Dey BR, Spence SL, Nissley P, Furlanetto RW. J Biol Chem 1998;273(37): 24095-24101. [259]$Rico-Bautista E, Greenhalgh CJ, Tollet-Egnell P, Hilton DJ, Alexander WS, Norstedt G, Flores-Morales A. Mol Endocrinol 2005;19(3):781-793. [260]$Kopchick JJ, Bellush LL, Coschigano KT. Annu Rev Nutr 1999;19:437-461. [261]$Colao A, Merola B, Ferone D, Lombardi G. J Clin Endocrinol Metab 1997;82(9): 2777-2781. [262]$Horvat S, Medrano JF. Genomics 2001;72(2):209-212. [263]$Tonks NK. Nat Rev Mol Cell Biol 2006;7(11):833-846. [264]$Hof P, Pluskey S, Dhe-Paganon S, Eck MJ, Shoelson SE. Cell 1998;92(4):441-450. [265]$Hackett RH, Wang YD, Sweitzer S, Feldman G, Wood WI, Larner AC. J Biol Chem 1997;272(17):11128-11132. [266]$Pilecka I, Whatmore A, Hooft van Huijsduijnen R, Destenaves B, Clayton P. Trends Endocrinol Metab 2007;18(1):12-18. New insights into SOCS2 role in hepatic metabolism 63 [267]$Aoki N, Matsuda T. J Biol Chem 2000;275(50):39718-39726. [268]$Pasquali C, Curchod ML, Walchli S, Espanel X, Guerrier M, Arigoni F, Strous G, Hooft van Huijsduijnen R. Mol Endocrinol 2003;17(11):2228-2239. [269]$ten Hoeve J, de Jesus Ibarra-Sanchez M, Fu Y, Zhu W, Tremblay M, David M, Shuai K. Mol Cell Biol 2002;22(16):5662-5668. [270]$Aoki N, Matsuda T. Mol Endocrinol 2002;16(1):58-69. [271]$Pilecka I, Patrignani C, Pescini R, Curchod ML, Perrin D, Xue Y, Yasenchak J, Clark A, Magnone MC, Zaratin P, Valenzuela D, Rommel C, Hooft van Huijsduijnen R. J Biol Chem 2007;282(48):35405-35415. [272]$Stofega MR, Wang H, Ullrich A, Carter-Su C. J Biol Chem 1998;273(12):7112-7117. [273]$Stofega MR, Argetsinger LS, Wang H, Ullrich A, Carter-Su C. J Biol Chem 2000;275(36):28222-28229. [274]$Ram PA, Waxman DJ. J Biol Chem 1997;272(28):17694-17702. [275]$Lim CP, Cao X. Mol Biosyst 2006;2(11):536-550. [276]$Kotaja N, Karvonen U, Janne OA, Palvimo JJ. Mol Cell Biol 2002;22(14): 5222-5234. [277]$Liu B, Liao J, Rao X, Kushner SA, Chung CD, Chang DD, Shuai K. Proc Natl Acad Sci U S A 1998;95(18):10626-10631. [278]$Arora T, Liu B, He H, Kim J, Murphy TL, Murphy KM, Modlin RL, Shuai K. J Biol Chem 2003;278(24):21327-21330. [279]$Chung CD, Liao J, Liu B, Rao X, Jay P, Berta P, Shuai K. Science 1997;278(5344): 1803-1805. [280]$Liu B, Gross M, ten Hoeve J, Shuai K. Proc Natl Acad Sci U S A 2001;98(6): 3203-3207. [281]$Rycyzyn MA, Clevenger CV. Proc Natl Acad Sci U S A 2002;99(10):6790-6795. [282]$Dagvadorj A, Tan SH, Liao Z, Xie J, Nurmi M, Alanen K, Rui H, Mirtti T, Nevalainen MT. Int J Biochem Cell Biol 2010;42(12):2037-2046. [283]$Schmidt D, Muller S. Cell Mol Life Sci 2003;60(12):2561-2574. [284]$Mazurkiewicz-Munoz AM, Argetsinger LS, Kouadio JL, Stensballe A, Jensen ON, Cline JM, Carter-Su C. Mol Cell Biol 2006;26(11):4052-4062. [285]$Funakoshi-Tago M, Pelletier S, Matsuda T, Parganas E, Ihle JN. EMBO J 2006;25(20):4763-4772. [286]$Ohlsson C, Bengtsson BA, Isaksson OG, Andreassen TT, Slootweg MC. Endocr Rev 1998;19(1):55-79. [287]$Zhou Y, Xu BC, Maheshwari HG, He L, Reed M, Lozykowski M, Okada S, Cataldo L, Coschigamo K, Wagner TE, Baumann G, Kopchick JJ. Proc Natl Acad Sci U S A 1997;94(24):13215-13220. [288]$Alba M, Salvatori R. Endocrinology 2004;145(9):4134-4143. [289]$Alba M, Fintini D, Salvatori R. Growth Horm IGF Res 2005;15(4):275-282. [290]$Walker DG, Simpson ME, Asling CW, Evans HM. Anat Rec 1950;106(4):536-554. [291]$Salmon WD, Jr., Daughaday WH. J Lab Clin Med 1957;49(6):825-836. [292]$Daughaday WH, Hall K, Raben MS, Salmon WD, Jr., van den Brande JL, van Wyk JJ. Nature 1972;235(5333):107. [293]$Klapper DG, Svoboda ME, Van Wyk JJ. Endocrinology 1983;112(6):2215-2217. [294]$Powell-Braxton L, Hollingshead P, Warburton C, Dowd M, Pitts-Meek S, Dalton D, Gillett N, Stewart TA. Genes Dev 1993;7(12B):2609-2617. [295]$Ohlsson C, Mohan S, Sjogren K, Tivesten A, Isgaard J, Isaksson O, Jansson JO, Svensson J. Endocr Rev 2009;30(5):494-535. [296]$Sjogren K, Liu JL, Blad K, Skrtic S, Vidal O, Wallenius V, LeRoith D, Tornell J, Isaksson OG, Jansson JO, Ohlsson C. Proc Natl Acad Sci U S A 1999;96(12): 7088-7092. Ruymán Santana Farré 64 [297]$Yakar S, Liu JL, Stannard B, Butler A, Accili D, Sauer B, LeRoith D. Proc Natl Acad Sci U S A 1999;96(13):7324-7329. [298]$Spencer EM, Liu CC, Si EC, Howard GA. Bone 1991;12(1):21-26. [299]$Tixier-Boichard M, Huybrechts LM, Decuypere E, Kuhn ER, Monvoisin JL, Coquerelle G, Charrier J, Simon J. J Endocrinol 1992;133(1):101-110. [300]$Verhaeghe J, Suiker AM, Visser WJ, Van Herck E, Van Bree R, Bouillon R. J Endocrinol 1992;134(3):485-492. [301]$Lupu F, Terwilliger JD, Lee K, Segre GV, Efstratiadis A. Dev Biol 2001;229(1): 141-162. [302]$Mohan S, Richman C, Guo R, Amaar Y, Donahue LR, Wergedal J, Baylink DJ. Endocrinology 2003;144(3):929-936. [303]$Greenhalgh CJ, Bertolino P, Asa SL, Metcalf D, Corbin JE, Adams TE, Davey HW, Nicola NA, Hilton DJ, Alexander WS. Mol Endocrinol 2002;16(6):1394-1406. [304]$Favre H, Benhamou A, Finidori J, Kelly PA, Edery M. FEBS Lett 1999;453(1-2): 63-66. [305]$Pezet A, Favre H, Kelly PA, Edery M. J Biol Chem 1999;274(35):24497-24502. [306]$Tannahill GM, Elliott J, Barry AC, Hibbert L, Cacalano NA, Johnston JA. Mol Cell Biol 2005;25(20):9115-9126. [307]$Kostyo JL, Hotchkiss J, Knobil E. Science 1959;130(3389):1653-1654. [308]$Kaplan SA, Cohen P. J Clin Endocrinol Metab 2007;92(12):4529-4535. [309]$Vijayakumar A, Wu Y, Sun H, Li X, Jeddy Z, Liu C, Schwartz GJ, Yakar S, LeRoith D. Diabetes 2012;61(1):94-103. [310]$Richelsen B. Horm Res 1997;48 Suppl 5:105-110. [311]$Moller N, Jorgensen JO, Schmitz O, Moller J, Christiansen J, Alberti KG, Orskov H. Am J Physiol 1990;258(1 Pt 1):E86-91. [312]$Moller N, Schmitz O, Porksen N, Moller J, Jorgensen JO. Metabolism 1992;41(2): 172-175. [313]$Bartke A, Chandrashekar V, Bailey B, Zaczek D, Turyn D. Neuropeptides 2002;36(2-3):201-208. [314]$Colao A, Di Somma C, Savanelli MC, De Leo M, Lombardi G. Growth Horm IGF Res 2006;16 Suppl A:S41-48. [315]$List EO, Berryman DE, Funk K, Gosney ES, Jara A, Kelder B, Wang X, Kutz L, Troike K, Lozier N, Mikula V, Lubbers ER, Zhang H, Vesel C, Junnila RK, Frank SJ, Masternak MM, Bartke A, Kopchick JJ. Mol Endocrinol 2013;27(3):524-535. [316]$LeRoith D, Yakar S. Nat Clin Pract Endocrinol Metab 2007;3(3):302-310. [317]$Fan Y, Menon RK, Cohen P, Hwang D, Clemens T, DiGirolamo DJ, Kopchick JJ, Le Roith D, Trucco M, Sperling MA. J Biol Chem 2009;284(30):19937-19944. [318]$Jacob R, Barrett E, Plewe G, Fagin KD, Sherwin RS. J Clin Invest 1989;83(5): 1717-1723. [319]$Ranke MB, Savage MO, Chatelain PG, Preece MA, Rosenfeld RG, Wilton P. Horm Res 1999;51(3):128-134. [320]$Yakar S, Liu JL, Fernandez AM, Wu Y, Schally AV, Frystyk J, Chernausek SD, Mejia W, Le Roith D. Diabetes 2001;50(5):1110-1118. [321]$Yakar S, Setser J, Zhao H, Stannard B, Haluzik M, Glatt V, Bouxsein ML, Kopchick JJ, LeRoith D. J Clin Invest 2004;113(1):96-105. [322]$Hattori N. Growth Horm IGF Res 2009;19(3):187-197. [323]$Weigent DA. Cell Immunol 2013;285(1-2):118-132. [324]$Gonzalo JA, Mazuchelli R, Mellado M, Frade JM, Carrera AC, von Kobbe C, Merida I, Martinez AC. J Immunol 1996;157(8):3298-3304. [325]$Masternak MM, Bartke A. Pathobiol Aging Age Relat Dis 2012;2. New insights into SOCS2 role in hepatic metabolism 65 [326]$Uronen-Hansson H, Allen ML, Lichtarowicz-Krynska E, Aynsley-Green A, Cole TJ, Hoiden-Guthenberg I, Fryklund L, Klein N. Growth Horm IGF Res 2003;13(5): 282-286. [327]$Bozzola M, De Benedetti F, De Amici M, Jouret B, Travaglino P, Pagani S, Conte F, Tauber M. Eur J Endocrinol 2003;149(5):397-401. [328]$Takala J, Ruokonen E, Webster NR, Nielsen MS, Zandstra DF, Vundelinckx G, Hinds CJ. N Engl J Med 1999;341(11):785-792. [329]$de Groof F, Joosten KF, Janssen JA, de Kleijn ED, Hazelzet JA, Hop WC, Uitterlinden P, van Doorn J, Hokken-Koelega AC. J Clin Endocrinol Metab 2002;87(7):3118-3124. [330]$Onenli-Mungan N, Yildizdas D, Yapicioglu H, Topaloglu AK, Yuksel B, Ozer G. J Paediatr Child Health 2004;40(4):221-226. [331]$Haeffner A, Thieblemont N, Deas O, Marelli O, Charpentier B, Senik A, Wright SD, Haeffner-Cavaillon N, Hirsch F. J Immunol 1997;158(3):1310-1314. [332]$Serri O, St-Jacques P, Sartippour M, Renier G. J Clin Endocrinol Metab 1999;84(1): 58-63. [333]$Croker BA, Kiu H, Nicholson SE. Semin Cell Dev Biol 2008;19(4):414-422. [334]$Kinjyo I, Hanada T, Inagaki-Ohara K, Mori H, Aki D, Ohishi M, Yoshida H, Kubo M, Yoshimura A. Immunity 2002;17(5):583-591. [335]$Nakagawa R, Naka T, Tsutsui H, Fujimoto M, Kimura A, Abe T, Seki E, Sato S, Takeuchi O, Takeda K, Akira S, Yamanishi K, Kawase I, Nakanishi K, Kishimoto T. Immunity 2002;17(5):677-687. [336]$Croker BA, Metcalf D, Robb L, Wei W, Mifsud S, DiRago L, Cluse LA, Sutherland KD, Hartley L, Williams E, Zhang JG, Hilton DJ, Nicola NA, Alexander WS, Roberts AW. Immunity 2004;20(2):153-165. [337]$Shouda T, Yoshida T, Hanada T, Wakioka T, Oishi M, Miyoshi K, Komiya S, Kosai K, Hanakawa Y, Hashimoto K, Nagata K, Yoshimura A. J Clin Invest 2001;108(12): 1781-1788. [338]$Suzuki A, Hanada T, Mitsuyama K, Yoshida T, Kamizono S, Hoshino T, Kubo M, Yamashita A, Okabe M, Takeda K, Akira S, Matsumoto S, Toyonaga A, Sata M, Yoshimura A. J Exp Med 2001;193(4):471-481. [339]$Machado FS, Johndrow JE, Esper L, Dias A, Bafica A, Serhan CN, Aliberti J. Nat Med 2006;12(3):330-334. [340]$Laron Z, Pertzelan A, Mannheimer S. Isr J Med Sci 1966;2(2):152-155. [341]$Milward A, Metherell L, Maamra M, Barahona MJ, Wilkinson IR, Camacho-Hubner C, Savage MO, Bidlingmaier M, Clark AJ, Ross RJ, Webb SM. J Clin Endocrinol Metab 2004;89(3):1259-1266. [342]$Tiulpakov A, Rubtsov P, Dedov I, Peterkova V, Bezlepkina O, Chrousos GP, Hochberg Z. J Clin Endocrinol Metab 2005;90(1):542-547. [343]$Ayuk J, Sheppard MC. Postgrad Med J 2006;82(963):24-30. [344]$Chanson P, Salenave S. Orphanet J Rare Dis 2008;3:17. [345]$Isaksson OG, Eden S, Jansson JO. Annu Rev Physiol 1985;47:483-499. [346]$Ribeiro-Oliveira A, Jr., Barkan A. Nat Rev Endocrinol 2012;8(10):605-611. [347]$Guevara-Aguirre J, Balasubramanian P, Guevara-Aguirre M, Wei M, Madia F, Cheng CW, Hwang D, Martin-Montalvo A, Saavedra J, Ingles S, de Cabo R, Cohen P, Longo VD. Sci Transl Med 2011;3(70):70ra13. [348]$Lebrun P, Cognard E, Gontard P, Bellon-Paul R, Filloux C, Berthault MF, Magnan C, Ruberte J, Luppo M, Pujol A, Pachera N, Herchuelz A, Bosch F, Van Obberghen E. Diabetologia 2010;53(9):1935-1946. [349]$Kato H, Nomura K, Osabe D, Shinohara S, Mizumori O, Katashima R, Iwasaki S, Nishimura K, Yoshino M, Kobori M, Ichiishi E, Nakamura N, Yoshikawa T, Ruymán Santana Farré 66 Tanahashi T, Keshavarz P, Kunika K, Moritani M, Kudo E, Tsugawa K, Takata Y, Hamada D, Yasui N, Miyamoto T, Shiota H, Inoue H, Itakura M. Genomics 2006;87(4):446-458. [350]$Zadjali F, Santana-Farre R, Vesterlund M, Carow B, Mirecki-Garrido M, HernandezHernandez I, Flodstrom-Tullberg M, Parini P, Rottenberg M, Norstedt G, Fernandez-Perez L, Flores-Morales A. FASEB J 2012;26(8):3282-3291. [351]$Langendonk JG, Meinders AE, Burggraaf J, Frolich M, Roelen CA, Schoemaker RC, Cohen AF, Pijl H. Am J Physiol 1999;277(5 Pt 1):E824-829. [352]$Takahashi Y, Iida K, Takahashi K, Yoshioka S, Fukuoka H, Takeno R, Imanaka M, Nishizawa H, Takahashi M, Seo Y, Hayashi Y, Kondo T, Okimura Y, Kaji H, Kitazawa R, Kitazawa S, Chihara K. Gastroenterology 2007;132(3):938-943. [353]$Wang Z, Masternak MM, Al-Regaiey KA, Bartke A. Endocrinology 2007;148(6): 2845-2853. [354]$Sos BC, Harris C, Nordstrom SM, Tran JL, Balazs M, Caplazi P, Febbraio M, Applegate MA, Wagner KU, Weiss EJ. J Clin Invest 2011;121(4):1412-1423. [355]$Cui Y, Hosui A, Sun R, Shen K, Gavrilova O, Chen W, Cam MC, Gao B, Robinson GW, Hennighausen L. Hepatology 2007;46(2):504-513. [356]$Jenkins PJ, Bustin SA. Eur J Endocrinol 2004;151 Suppl 1:S17-22. [357]$Cascio S, Bartella V, Garofalo C, Russo A, Giordano A, Surmacz E. J Biol Chem 2007;282(6):3498-3506. [358]$Mukhina S, Mertani HC, Guo K, Lee KO, Gluckman PD, Lobie PE. Proc Natl Acad Sci U S A 2004;101(42):15166-15171. [359]$Zhu T, Starling-Emerald B, Zhang X, Lee KO, Gluckman PD, Mertani HC, Lobie PE. Cancer Res 2005;65(1):317-324. [360]$Pandey V, Perry JK, Mohankumar KM, Kong XJ, Liu SM, Wu ZS, Mitchell MD, Zhu T, Lobie PE. Endocrinology 2008;149(8):3909-3919. [361]$Nakonechnaya AO, Jefferson HS, Chen X, Shewchuk BM. J Cell Biochem 2013;114(6):1322-1335. [362]$Jenkins PJ. Neuroendocrinology 2006;83(3-4):218-223. [363]$Bing C. Br J Nutr 2005;93(6):761-763. [364]$Tisdale MJ. Nutrition 2001;17(5):438-442. [365]$Lin SY, Chen WY, Lee FY, Huang CJ, Sheu WH. Am J Physiol Endocrinol Metab 2005;288(3):E493-501. [366]$Denson LA, Held MA, Menon RK, Frank SJ, Parlow AF, Arnold DL. Am J Physiol Gastrointest Liver Physiol 2003;284(4):G646-654. [367]$Yumet G, Shumate ML, Bryant DP, Lang CH, Cooney RN. Crit Care Med 2006;34(5):1420-1427. [368]$Yen PM, Feng X, Flamant F, Chen Y, Walker RL, Weiss RE, Chassande O, Samarut J, Refetoff S, Meltzer PS. EMBO Rep 2003;4(6):581-587. [369]$De Felice M, Di Lauro R. Endocr Rev 2004;25(5):722-746. [370]$Samuels MH, Wierman ME, Wang C, Ridgway EC. Endocrinology 1989;124(5): 2277-2282. [371]$Nanto-Salonen K, Muller HL, Hoffman AR, Vu TH, Rosenfeld RG. Endocrinology 1993;132(2):781-788. [372]$Rasmussen MH, Frystyk J, Andersen T, Breum L, Christiansen JS, Hilsted J. Metabolism 1994;43(3):315-319. [373]$Moreno B, Rodriguez-Manzaneque JC, Perez-Castillo A, Santos A. Endocrinology 1997;138(3):1194-1203. [374]$Nanto-Salonen K, Glasscock GF, Rosenfeld RG. Endocrinology 1991;129(5): 2563-2570. [375]$Boersma B, Wit JM. Endocr Rev 1997;18(5):646-661. New insights into SOCS2 role in hepatic metabolism 67 [376]$Waxman DJ, Holloway MG. Mol Pharmacol 2009;76(2):215-228. [377]$Byrne CD. Diabet Med 2012;29(9):1098-1107. [378]$Zhang D, Christianson J, Liu ZX, Tian L, Choi CS, Neschen S, Dong J, Wood PA, Shulman GI. Cell Metab 2010;11(5):402-411. [379]$Kodama Y, Kisseleva T, Iwaisako K, Miura K, Taura K, De Minicis S, Osterreicher CH, Schnabl B, Seki E, Brenner DA. Gastroenterology 2009;137(4):1467-1477 e1465. [380]$Saberi M, Woods NB, de Luca C, Schenk S, Lu JC, Bandyopadhyay G, Verma IM, Olefsky JM. Cell Metab 2009;10(5):419-429. [381]$Barclay JL, Nelson CN, Ishikawa M, Murray LA, Kerr LM, McPhee TR, Powell EE, Waters MJ. Endocrinology 2011;152(1):181-192. [382]$Elam MB, Cowan GS, Jr., Rooney RJ, Hiler ML, Yellaturu CR, Deng X, Howell GE, Park EA, Gerling IC, Patel D, Corton JC, Cagen LM, Wilcox HG, Gandhi M, Bahr MH, Allan MC, Wodi LA, Cook GA, Hughes TA, Raghow R. Obesity (Silver Spring) 2009;17(8):1563-1573. [383]$Wojcicka G, Jamroz-Wisniewska A, Horoszewicz K, Beltowski J. Postepy Hig Med Dosw (Online) 2007;61:736-759. [384]$Loffler M, Bilban M, Reimers M, Waldhausl W, Stulnig TM. J Pharmacol Exp Ther 2006;316(2):797-804. [385]$Grefhorst A, Elzinga BM, Voshol PJ, Plosch T, Kok T, Bloks VW, van der Sluijs FH, Havekes LM, Romijn JA, Verkade HJ, Kuipers F. J Biol Chem 2002;277(37): 34182-34190. [386]$Ichikawa T, Hamasaki K, Ishikawa H, Ejima E, Eguchi K, Nakao K. Gut 2003;52(6): 914. [387]$Kalaany NY, Gauthier KC, Zavacki AM, Mammen PP, Kitazume T, Peterson JA, Horton JD, Garry DJ, Bianco AC, Mangelsdorf DJ. Cell Metab 2005;1(4):231-244. [388]$Korach-Andre M, Archer A, Gabbi C, Barros RP, Pedrelli M, Steffensen KR, Pettersson AT, Laurencikiene J, Parini P, Gustafsson JA. Am J Physiol Endocrinol Metab 2011;301(1):E210-222. [389]$Vidal OM, Merino R, Rico-Bautista E, Fernandez-Perez L, Chia DJ, Woelfle J, Ono M, Lenhard B, Norstedt G, Rotwein P, Flores-Morales A. Mol Endocrinol 2007;21(1):293-311. [390]$Grantham-McGregor SM, Powell C, Stewart M, Schofield WN. Dev Med Child Neurol 1982;24(3):321-331. [391]$Hyams JS, Carey DE. J Pediatr 1988;113(2):249-254. [392]$Barr DG, Shmerling DH, Prader A. Pediatr Res 1972;6(5):521-527. [393]$Damen GM, Boersma B, Wit JM, Heymans HS. J Pediatr Gastroenterol Nutr 1994;19(4):394-400. [394]$Albanese A, Hamill G, Jones J, Skuse D, Matthews DR, Stanhope R. Clin Endocrinol (Oxf) 1994;40(5):687-692. [395]$Von Harnack GA, Tanner JM, Whitehouse RH, Rodriguez CA. Z Kinderheilkd 1972;112(1):1-17. [396]$Bucher H, Prader A, Illig R. Helv Paediatr Acta 1985;40(4):305-316. [397]$Lui JC, Baron J. Endocr Rev 2011;32(3):422-440. [398]$Davenport JW, Hennies RS. Dev Psychobiol 1976;9(1):67-82. [399]$Ahmed SF, Farquharson C. J Endocrinol 2010;206(3):249-259. [400]$Chen Y, Sun D, Krishnamurthy VM, Rabkin R. Am J Physiol Endocrinol Metab 2007;292(6):E1856-1862. [401]$Schaefer F, Chen Y, Tsao T, Nouri P, Rabkin R. J Clin Invest 2001;108(3):467-475. [402]$Huang Y, Du M, Zhuang S, Shen Z, Li Y. Horm Res Paediatr 2010;74(2):106-113. Ruymán Santana Farré 68 [403]$Marino R, Hegde A, Barnes KM, Schrier L, Emons JA, Nilsson O, Baron J. Endocrinology 2008;149(4):1820-1828. [404]$Finkielstain GP, Forcinito P, Lui JC, Barnes KM, Marino R, Makaroun S, Nguyen V, Lazarus JE, Nilsson O, Baron J. Endocrinology 2009;150(4):1791-1800. [405]$Fraser A, Hughes R, McCarthy A, Tilling K, Davies D, Rumley A, Lowe GD, Smith GD, Ben-Shlomo Y. Am J Epidemiol 2008;168(2):179-187. [406]$Shahkhalili Y, Moulin J, Zbinden I, Aprikian O, Mace K. Am J Physiol Regul Integr Comp Physiol 2010;298(1):R141-146. [407]$Chen LL, Hu X, Zheng J, Kong W, Zhang HH, Yang WH, Zhu SP, Zeng TS, Zhang JY, Deng XL, Hu D. Metabolism 2011;60(4):569-578. [408]$Morrison JL, Duffield JA, Muhlhausler BS, Gentili S, McMillen IC. Pediatr Nephrol 2010;25(4):669-677. [409]$Rui L, Yuan M, Frantz D, Shoelson S, White MF. J Biol Chem 2002;277(44): 42394-42398. [410]$Ueki K, Kondo T, Tseng YH, Kahn CR. Proc Natl Acad Sci U S A 2004;101(28): 10422-10427. [411]$Sachithanandan N, Fam BC, Fynch S, Dzamko N, Watt MJ, Wormald S, Honeyman J, Galic S, Proietto J, Andrikopoulos S, Hevener AL, Kay TW, Steinberg GR. Hepatology 2010;52(5):1632-1642. [412]$Emanuelli B, Macotela Y, Boucher J, Ronald Kahn C. Biochem Biophys Res Commun 2008;377(2):447-452. [413]$Shi SY, Martin RG, Duncan RE, Choi D, Lu SY, Schroer SA, Cai EP, Luk CT, Hopperton KE, Domenichiello AF, Tang C, Naples M, Dekker MJ, Giacca A, Adeli K, Wagner KU, Bazinet RP, Woo M. J Biol Chem 2012;287(13):10277-10288. [414]$Palmiter RD, Norstedt G, Gelinas RE, Hammer RE, Brinster RL. Science 1983;222(4625):809-814. [415]$Cai D, Yuan M, Frantz DF, Melendez PA, Hansen L, Lee J, Shoelson SE. Nat Med 2005;11(2):183-190. [416]$Friedbichler K, Themanns M, Mueller KM, Schlederer M, Kornfeld JW, Terracciano LM, Kozlov AV, Haindl S, Kenner L, Kolbe T, Mueller M, Snibson KJ, Heim MH, Moriggl R. Hepatology 2012;55(3):941-952. [417]$Andreassen M, Frystyk J, Faber J, Kristensen LO. Eur J Endocrinol 2012;166(5): 811-819. [418]$Lu C, Kumar PA, Sun J, Aggarwal A, Fan Y, Sperling MA, Lumeng CN, Menon RK. J Biol Chem 2013;288(22):15725-15735. [419]$Chen Y, Dai X, Haas AL, Wen R, Wang D. Blood 2006;108(2):566-574. [420]$Lin JX, Mietz J, Modi WS, John S, Leonard WJ. J Biol Chem 1996;271(18): 10738-10744. [421]$Wagner SA, Beli P, Weinert BT, Nielsen ML, Cox J, Mann M, Choudhary C. Mol Cell Proteomics 2011;10(10):M111 013284. [422]$Stulnig TM, Steffensen KR, Gao H, Reimers M, Dahlman-Wright K, Schuster GU, Gustafsson JA. Mol Pharmacol 2002;62(6):1299-1305. [423]$Kotokorpi P, Gardmo C, Nystrom CS, Mode A. Endocrinology 2004;145(12): 5704-5713. New insights into SOCS2 role in hepatic metabolism 69 I group could be explained by altered tissue responsiveness to T3 and/or GH, two hormones that are drastically reduced by hypothyroidism [6,7,8]. To test this hypothesis, we developed a second burst of hypothyroidism (TX) in adulthood, which was followed by hormone replacement as described in ‘‘Materials and Methods’’. As expected, in vehicle or GH-treated TX rats, the serum levels of T3 were significantly reduced whereas the levels of T3-replaced animals did not differ from the INTACT control rats (data not shown). We showed a decrease in the total body weights of TX rats (P,0.001) and little subsequent weight gain in the TX/ 2CH (Fig. 7A) and TX/+CH rats (Fig. 7B). Independent of CH status, we showed the following: 1) the development of TX increased the circulating cholesterol levels and decreased the triglyceride serum levels (Table 1), which were mainly due to an increase of LDL and HDL cholesterol and a decrease of VLDL (data not shown), respectively, while the T3 hormone replacement restored the circulating cholesterol; 2) T3 and GH treatments increased the body weight gain in TX rats but it was unable to normalize it completely (Fig. 7A,B); and 3) T3 and GH treatments increased the hepatic level of IGF-I mRNA and, unlike T3, GH was capable of fully restoring the level to normal (Fig. 7C). However, the development of TX in the CH group (i.e., TX/ +CH) resulted in a greater than 3-fold reduction of circulating FFAs, which was not observed in the TX/2CH group, and the T3 replacement restored it (Table 1). Next, we evaluated the effects of hormone replacement on the hepatic lipid content (Table 2). Independent of the CH status, T3 treatment restored hepatic cholesterol levels. However, in comparison with INTACT, GH increased the hepatic cholesteryl esters in the TH/2CH but not in the TH/+CH group. Additionally, to evaluate whether an altered response to the T3 treatment was associated with an altered transcriptional response, we measured the changes in gene expression of T3-regulated genes such as ME and FAS. The effect of GH was also measured. As expected, the development of TX in TX/2CH rats significantly reduced the mRNA levels of ME (Fig. 7D) and FAS (Fig. 7E). However, the development of TX in the TX/+CH group did not decrease ME (Fig. 7D) and, surprisingly, increased the mRNA levels of FAS up to 5-fold Figure 4. Effects of neonatal hypothyroidism on mRNA expression levels of genes related with lipid metabolism in adult rat liver. On PND80, the hepatic mRNA levels of PPARa(A), CPT1 (B), ME (C), SREBP1c (D), ACC1 (E), FAS (F), CYP4FI (G), AOX (H), and L-FABP (I) were measured by qPCR in CH, age-matched INTACT, or weight-paired (WP) control groups. The mean mRNA expression level of each gene in the INTACT group is defined as 1, with all other expression values reported relative to this level. Bars represent mean 6SD from at least five individual animals. *, P,0.05; ***, P,0.001 for comparison with INTACT group. ++,P,0.01; +++,P,0.001 for comparison with WP group. doi:10.1371/journal.pone.0037386.g004 Congenital Hypothyroidism and Liver PLoS ONE | www.plosone.org 7 May 2012 | Volume 7 | Issue 5 | e37386 (Fig. 7E). Furthermore, T3 replacement in the TX/2CH rats increased the mRNA expression levels of ME and FAS by 12and 3-fold, respectively. However, T3 replacement in the TX/+CH rats increased the expression of ME up to 30-fold which suggested an altered tissue sensitivity to T3 replacement. Taken together, these findings suggest that the tissue responsiveness to TH was altered in rats previously exposed to CH. At this point, we can only speculate about the molecular mechanisms that could support our hypothesis. However, because altered hepatic levels of TR might support a different metabolic response to TH in the liver [12,14,59], we made an exploratory analysis of the expression of TRb/TRamRNA in the CH rats. The hepatic mRNA level of TRa(Fig. 7F) was significantly reduced in the CH group whereas the TRbmRNA (Fig. 7G) remained unaltered. However, the mRNA expression levels of TRaand TRbwere downregulated in the WP group, which suggests that TRa, unlike TRbwas influenced by CH. Discussion The THs are essential for development, growth, and metabolism [1,2,3]. The present study shows that transient neonatal hypothyroidism in male rats gave rise to endocrine alterations that not only affected postnatal growth but also influenced hepatic physiology and responsiveness to THs replacement in adulthood. Growth-inhibiting conditions exist during development in association with malnutrition, glucocorticoid excess, systemic diseases, GH-IGF-I deficiency, or hypothyroidism [44,60,61]. In this work, several biomarkers of neonatal hypothyroidism (i.e., decreased circulating THs and hepatic mRNA expression levels of ME and Spot14) and high expression of IGFBP-2 were associated Figure 5. Effects of congenital hypothyroidism on mRNA expression levels of INSIG-1, SREBP2, LXR, and genes involved in lipid transport in adult rat liver. On PND80, the hepatic mRNA levels of INSIG1 (A), SREBP2 (B), LDLR (C), CD36 (D), ABCA (E), LXR (F), HLipase (G), HMGCoAS (H), and HMHCoAR (I) were measured by qPCR in CH, age-matched INTACT or weight-paired (WP) control groups. The mean mRNA expression level of each gene in the INTACT group is defined as 1, with all other expression values reported relative to this level. Bars represent mean 6SD from at least five individual animals. *, P,0.05; ***, P,0.001 for comparison with INTACT group. +,P,0.05; ++,P,0.01; +++,P,0.001 for comparison with WP group. doi:10.1371/journal.pone.0037386.g005 Congenital Hypothyroidism and Liver PLoS ONE | www.plosone.org 8 May 2012 | Volume 7 | Issue 5 | e37386 with decreased circulating IGF-I and a delayed somatic growth rate on PND30. Furthermore, when the growth-inhibiting condition (i.e., MMI) was removed, somatic growth rate (weight and tail lenght gain) and food efficiency increased in CH rats, which is a phenomenon known as catch-up growth [44,60]. By PND80, however, this effect had subsided, and somatic growth rate (see body weight gain and tail length gain in Supplementary File S3) in CH animals was similar to age-matched INTACT controls. Alternatively, higher food efficiency remained in euthyroid CH group on PND80 along with significance differences in total body weight and size in comparison with INTACT group, which suggests, in agreement with previously reported data [62], a higher but less efficient rate of metabolism (i.e., a reduced ability to transform calories consumed into total body weight and size) in rats previously exposed to CH. The CH rats on PND80 also showed increased mRNA levels of several GH target genes (i.e., IGF-I, SOCS-2, CIS, CYP2C11, CYP2C13) suggesting that the increased hepatic GH activity observed in these animals was possibly associated with catch-up growth. In contrast, other wellknown GH target genes in female rats such as CYP2C7 and CD36 were downregulated in CH group. This apparent paradox could be explained by sexually dimorphic pattern of gene expression in rat liver [63,64]. The downregulation of female-predominant genes (e.g., CYP2C7 and CD36) concomitant with the induction of male-predominant genes (e.g., CYP2C11 and CYP2C13) suggests that a male pattern of gene expression was enhanced in CH rat liver. In the current study, we show that transient CH is associated with changes in SOCS-2 and CIS expression, which are key negative regulators of GH-dependent somatic growth in vivo [51,65]. GH resistance can be shown in rat models of sepsis and uremia and in small rats for gestational age (SGA) without catchup growth. This was associated with an increased expression of SOCS-2 and CIS and impaired JAK/STAT signaling [66,67,68]. In our model, however, catch-up growth was associated with the overexpression of SOCS-2 and CIS in adult CH rats. Whether the overexpression of SOCS and CIS is associated with delayed growth development and catch-up growth in CH rats requires further research. Growth-inhibiting conditions during fetal-neonatal period of life may influence lipid metabolism in adulthood [69,70,71,72]. Human and rats, who do show catch-up of somatic growth and increased feed efficiency after withdrawal of growth-inhibiting condition (e.g., SGA or caloric restriction), have higher risk of fat in the liver and increased adiposity in adulthood [69,70,71,72]. Now, we show that somatic growth inhibition by neonatal hypothyroidism influences hepatic lipid metabolism in adulthood. CH rats showed a concomitant upregulation of PPARaand CPT1, a gene related to fatty acid catabolism.Furthermore, adult CH rats showed a downregulation of CD36, which is involved in fatty acid uptake and a well-known PPARatarget gene, along with the reduced transcription of genes involved in cholesterol uptake (LDLR), cellular sterol efflux (ABCA), triglyceride assembly (MTTP), bile acid synthesis (CYP8B1, CYP7A1 and CYP27A1), and lipogenesis (SREBP1c) [73].These data indicate that CH significantly influenced lipid metabolism in adulthood and, most likely, contributed to the diminished hepatic levels of triglycerides, cholesteryl esters, and FFA. Conversely, because expression levels Figure 6. Effects of congenital hypothyroidism on mRNA expression levels of genes involved in bile acid synthesis in adult rat liver. On PND80, the hepatic mRNA levels of CYP7A1 (A), CYP27A1 (B), CYP8B1 (C), FXR (D), and SHP (E) were measured by qPCR in CH, age-matched INTACT or weight-paired (WP) control groups. The mean mRNA expression level of each gene in the INTACT group is defined as 1, with all other expression values reported relative to this level. Bars represent mean 6SD from at least five individual animals. **, P,0.01; ***, P,0.001 for comparison with INTACT group. +++,P,0.001 for comparison with WP group. doi:10.1371/journal.pone.0037386.g006 Congenital Hypothyroidism and Liver PLoS ONE | www.plosone.org 9 May 2012 | Volume 7 | Issue 5 | e37386 of several lipid genes in CH adult group were altered in similar direction to that detected in WP group, our data could be explained, in part, as a consequence of delayed growth [33,34]. Furthermore, a reduced content of hepatic lipids in CH group could be caused by prolonged catch-up growth which might cause an increased lipid catabolism in growing animals (i.e., CH group) in comparison with those that have completed their body growth (i.e., INTACT). To determine whether some of these changes caused by CH are life-long adaptations, similar analysis would need to be performed in older animals [33,34]. Furthermore, the reduced content of hepatic lipids in CH group could be caused by prolonged catch-up growth which might cause increased lipid catabolism in growing animals (i.e., CH group) in comparison with those that have completed their body growth (i.e., INTACT). However, several reports have suggested that catch-up growth is likely associated with increased level of hepatic lipids and adiposity [72], which would not be in agreement with this explanation. Additionally, despite all of the changes observed in liver, the levels of circulating lipids (triglycerides and cholesterol) and lipoproteins (data not shown) were similar to those in the INTACT agedmatched littermates, which suggest that CH rats were able to maintain lipid homeostasis and support the increased energy demands imposed by an accelerated growth rate. This is apparently achieved by redistributing lipids from the liver towards peripheral tissues rather than through active hepatic lipogenesis, which is an energy-consuming process that would compete with peripheral energy needs. In this study, we show that transient neonatal hypothyroidism influences transcriptional program in adult liver. Despite being euthyroid, adult CH animal showed a modified transcriptional Figure 7. Effects of hormonal replacement on body weight and hepatic mRNA expression levels of IGF-I, ME, and FAS in adult hypothyroid rats without or with transient exposure to neonatal hypothyroidism. Four groups were studied: 1) age-matched rats (INTACT); 2) adult rats with neonatal hypothyroidism (CH); 3) hypothyroid adult rats without CH (TX/2CH); and 4) hypothyroid adult rats with CH (TX/ +CH). During the last week of life, TX/2CH and TX/+CH groups were treated with either T3 or GH daily. Control animals were injected with saline (VEH). Body weight (A and B) as well as hepatic mRNA levels of IGF-I (C), ME (D) and FAS (E) were measured. The hepatic mRNA levels of TRa(F) and TRb(G) were also measured by qPCR in CH, age-matched INTACT or weight-paired (WP) control groups. The mean mRNA expression level of each gene in the INTACT group is defined as 1, with all other expression values reported relative to this level. Results represent mean 6SD from at least six individual rats *, P,0.05; **, P,0.01; ***, P,0.001 for comparison with INTACT group (panel A) and for comparison with CH group (panel B); +, P,0.05; ++,P,0.01; +++,P,0.001 for comparison with vehicle-treated TX group.ˆ ˆ ˆ,P,0.001 for comparison with WP group. doi:10.1371/journal.pone.0037386.g007 Congenital Hypothyroidism and Liver PLoS ONE | www.plosone.org 10 May 2012 | Volume 7 | Issue 5 | e37386 profile in liver in comparison with age-matched INTACT rats, which might be explained by altered tissue responsiveness to T3 and/or GH, two hormones that are drastically reduced by hypothyroidism [6,7,8]. However, independent of CH status, several of the responses to hypothyroidism and hormone replacement were similar. As expected, development of TX increased circulating cholesterol levels and decreased the serum triglyceride levels, while T3 hormone replacement restored circulating cholesterol level. Additionally, T3 and GH treatments increased the body weight gain and hepatic levels of IGF-I mRNA. At first glance, these results suggested that the CH rats, after suffering a biological insult (i.e., a second burst of hypothyroidism in adulthood), showed a biological response similar to agematched INTACT rats. However, several of the responses to TX or hormone replacement suggested an altered lipid metabolism in the CH rats. First, a significant reduction of circulating FFAs by TX in TX/+CH group but not in TX/2CH group, an effect that was restored by T3 replacement. Second, GH-increased hepatic cholesterol esterification occurred in the TH/2CH animals but not in the TH/+CH animals. Third, GH treatment reduced serum VLDL fraction in the TX/2CH but not in the TX/+CH rats (data not shown). We did not observe major alterations in hepatic reactivity to GH in terms of lipid changes which suggests that the capacity of GH treatment to reduce serum triglyceride levels in TX/2CH rats, but not in TX/+CH rats, is most likely due to altered GH activity in extrahepatic tissues, such as fat and muscle [3]. Finally, hepatic concentrations of lipids in T3-treated TX/+CH rats did not differ significantly from TX/2CH group, which suggested that the homeostatic capacity of CH tissue in response to T3 was not dramatically affected. However, this is in contrast to the enhanced ME expression in the TX/+CH group in response to the T3 treatment. Increased ME mRNA expression did not seem to be a general response to T3 replacement because SREBP1c and 2 showed a less pronounced change (data not shown). ME is directly regulated by the binding of TR to a TRE in the promoter of the ME gene [74]. Our measurement of mRNA levels for TR receptors in liver showed unaltered expression of the major isoform TRband reduced levels of TRa, making it unlikely that changes in ME expression can be attributed to altered TR content. Noticeably, the ME regulatory region also contains binding sites for PBX1 and 2 [75], CEBPa[76], and an E-box [77] that can modulate the response to T3. At this point, we cannot exclude the possibility that CH effects on these transcription factors and other nuclear co-regulators influence ME expression but additional experiments are needed to test this hypothesis. Likewise, a clearer mechanistic explanation for the Table 1. Serum lipids from PND80 male rats at baseline (INTACT), without (2CH) or with (+CH) transient neonatal exposure to MMI, during thyroid hormone deprivation (vehicle) and hormonal replacement. Cholesterol (mM) Triglycerides (mM) FFA (mM) INTACT 1.3860.13 1.5960.65 0.6960.17 TX/2CH Vehicle 3.0160.13*** 0.6260.17** 0.5860.17 T3 1.6960.16+++ 0.6760.20** 0.7560.30 GH 2.7760.39*** 0.4460.13*** 0.2860.04***; ++ TX/+CH Vehicle 3.1560.31*** 0.7260.05** 0.2460.07*** T3 1.5260.18+++ 0.6160.17** 0.5960.13+++ GH 2.7060.57*** 0.6660.20** 0.2560.06*** INTACT and CH animals were exposed to MMI at PND60 as described in Materials and Methods. From day 73, animals were injected daily with vehicle, T3 or GH for 7 d. The animals were sacrificed on PND80 and serum lipids were measured. Results are expressed as mean ±SD (n = 6). Statistical comparison was performed for treated animals using INTACT animals or vehicle as controls. **, P ,0.01; ***, P ,0.001 for comparison with INTACT rats; ++ , P ,0.01; +++ , P ,0.001 for comparison with vehicle. doi:10.1371/journal.pone.0037386.t001 Table 2. Hepatic lipids in liver from PND80 male rats at baseline (INTACT), without (2CH) or with (+CH) transient neonatal exposure to MMI, during thyroid hormone deprivation (vehicle) and hormonal replacement. Free cholesterol (mg/g of tissue) Triglycerides (mg/g of tissue) Cholesteryl esters (mg/g of tissue) Fatty acids (mg/g of tissue) Phospholipids (mg/g of tissue) INTACT 2.460.2 3.960.6 0.3060.02 0.1860.03 57.864.1 TX/2CH Vehicle 1.960.1** 2.160.2*** 0.3760.04* 0.1560.01* 51.663.4* T3 2.360.3++ 1.560.2***;+0.3360.05 0.1460.01** 58.265.9 GH 2.160.2** 1.460.1***;++ 0.5460.15 ***;++ 0.1260.01***;+50.764.9* TX/+CH Vehicle 1.960.2** 2.160.3*** 0.2160.02** 0.1360.01** 48.964.8* T3 2.060.3* 1.760.4*** 0.3460.09++ 0.1360.01** 54.665.5 GH 1.760.2*** 1.660.3*** 0.3160.07++ 0.1260.01** 43.862.3***;+ INTACT and CH animals were exposed to MMI at PND60 as described in Materials and Methods. From day 73, animals were injected daily with vehicle, T3 or GH for 7 d. The animals were sacrificed on PND80 and hepatic lipids were measured. Results are expressed as mean ±SD (n = 6). Statistical comparison was performed for treated animals using INTACT animals or vehicle as controls. *, P ,0.05; **, P ,0.01; ***, P ,0.001 for comparison with INTACT rats; + , P ,0.05; ++ , P ,0.01 for comparison with vehicle. doi:10.1371/journal.pone.0037386.t002 Congenital Hypothyroidism and Liver PLoS ONE | www.plosone.org 11 May 2012 | Volume 7 | Issue 5 | e37386 metabolic changes observed in the CH rats would require, among others measures, the analysis of fat and muscle metabolism. Androgens may influence the hepatic response to CH. It is well known that neonatal hypothyroidism results in increased circulating levels of testosterone in male rats, which is secondary to increased testis size [29]. We also observed two-fold higher serum testosterone levels in the CH rats compared to the age-matched adult INTACT rats (data not shown). Although the liver is not considered to be a primary target of testosterone action, androgens maintain specific male pattern of pituitary GH secretion and actions on liver [78], and it has been shown that specific deletion of androgen receptor (AR) in liver of male animals causes hepatic insulin resistance with decreased fatty acid b-oxidation and steatosis [79], which implicates the hepatic AR as a positive factor in maintaining physiological control of glucose and lipid homeostasis. Alternatively, in prostate, a well-known target tissue of androgen action, testosterone has lipogenic effects, such as inducing the expression of FAS [80]. Therefore, we cannot exclude the possibility that some of the transcriptional effects detected in the liver of the CH rats (e.g., increased CYP2C11, CYP2C13, and PPARa) were secondary to increased levels of circulating testosterone. In summary, our findings support the hypothesis that TH deprivation during neonatal period of life causes long-lasting influence on the liver transcriptome and provokes an altered responsiveness to biological insult in adulthood. Several findings that cannot be explained by the lower body weight in CH rats, compared to WP, include genes regulated by GH (e.g., IGF-I, CIS, CYP2C11, and CYP2C13) and genes involved in hepatic lipid metabolism (e.g., PPARa, CPT1, ME, ACC1, FAS, CYP4F1, AOX, L-FABP, LXR, HMGCoA-S, and HMGCoAR). Being clinically relevant, the changes observed in the transcriptional responses to T3 highlight the possibility that CH influences tissue reactivity to thyromimetic drugs in adulthood [81]. Interestingly, thyroid-disrupting compounds, which can cause neonatal hypothyroidism, include a wide range of chemicals from naturally occurring compounds, pharmaceuticals, and a number of xenobiotics [82]. The long-lasting influence of growthinhibiting conditions on hepatic metabolism is intriguing and warrants further study to explore whether the alterations observed in this study cause metabolic disruptions or chronic diseases. Supporting Information File S1 Schematic diagram of rat model used to study the effects of congenital hypothyroidism on adult rat liver. Congenital-neonatal hypothyroid male rats (CH) were produced by 0.02%-MMI administration in the drinking water of pregnant rats (GD12) until weaning at PND30. For generation of adult hypothyroid rats (TX), 0.05% MMI was added to the drinking water for 3 weeks starting at PND58. Four groups were studied: 1) euthyroid age-matched rats (INTACT); 2) CH; 3) TX rats without CH (TX/2CH); and 4) TX rats with CH (TX/ +CH). During the last week of life, TX/2CH and TX/+CH groups were treated with either T3 or GH daily for 7 days as described in Materials and Methods. Control animals were injected with saline. Each group included six individual animals. (TIF) File S2 Gene names and primer sequences (59-39) used for real-time PCR. (TIF) File S3 Effects of neonatal hypothyroidism on body growth development. Body weight (A) and tail length (B) were measured at 7-d intervals. On PND30, the hepatic mRNA levels of IGFBP2 (C) were measured by qPCR in rats exposed to neonatal hypothyroidism (CH), age-matched (INTACT) or weight-paired (WP30) control groups. Body weight gain (D), tail growth gain (E) and food efficiency (F) were measured at 7-d intervals as described in Material and Methods. Results are expressed as mean 6SD from six individual animals in each group. **, P,0.01, ***, P,0.001 for comparison with INTACT group. +++,P,0.001 for comparison with WP group. (TIF) Acknowledgments The excellent technical assistance of M. Morante and C. J. Mateos-Dı ´az is greatly appreciated. R.S-F was recipient of pre-doctoral fellowships from the MCYT (SAF2003-02117) and ACIISI-FSE (SE-10/13) and M.M-G and L.H-H were recipients from University of Las Palmas de GC and MEC (AP2001-3499), respectively. Author Contributions Conceived and designed the experiments: LF-P AF-M CB GN EH. Performed the experiments: RS-F MM-G CB NK LF-P PP LH-H. Analyzed the data: LF-P AF-M PP GN CB. Wrote the paper: LF-P AF-M CB. References 1. Yen PM, Feng X, Flamant F, Chen Y, Walker RL, et al. (2003) Effects of ligand and thyroid hormone receptor isoforms on hepatic gene expression profiles of thyroid hormone receptor knockout mice. EMBO Rep 4: 581–587. 2. De Felice M, Di Lauro R (2004) Thyroid development and its disorders: genetics and molecular mechanisms. Endocr Rev 25: 722–746. 3. LeRoith D, Yakar S (2007) Mechanisms of disease: metabolic effects of growth hormone and insulin-like growth factor 1. Nat Clin Pract Endocrinol Metab 3: 302–310. 4. Nanto-Salonen K, Glasscock GF, Rosenfeld RG (1991) The effects of thyroid hormone on insulin-like growth factor (IGF) and IGF-binding protein (IGFBP) expression in the neonatal rat: prolonged high expression of IGFBP-2 in methimazole-induced congenital hypothyroidism. Endocrinology 129: 2563–2570. 5. Samuels MH, Wierman ME, Wang C, Ridgway EC (1989) The effect of altered thyroid status on pituitary hormone messenger ribonucleic acid concentrations in the rat. Endocrinology 124: 2277–2282. 6. Nanto-Salonen K, Muller HL, Hoffman AR, Vu TH, Rosenfeld RG (1993) Mechanisms of thyroid hormone action on the insulin-like growth factor system: all thyroid hormone effects are not growth hormone mediated. Endocrinology 132: 781–788. 7. Mullis PE, Eble A, Marti U, Burgi U, Postel-Vinay MC (1999) Regulation of human growth hormone receptor gene transcription by triiodothyronine (T3). Mol Cell Endocrinol 147: 17–25. 8. Rasmussen MH, Frystyk J, Andersen T, Breum L, Christiansen JS, et al. (1994) The impact of obesity, fat distribution, and energy restriction on insulin-like growth factor-1 (IGF-1), IGF-binding protein-3, insulin, and growth hormone. Metabolism 43: 315–319. 9. Moreno B, Rodriguez-Manzaneque JC, Perez-Castillo A, Santos A (1997) Thyroid hormone controls the expression of insulin-like growth factor I receptor gene at different levels in lung and heart of developing and adult rats. Endocrinology 138: 1194–1203. 10. Hoogerbrugge N, Jansen H, Staels B, Kloet LT, Birkenhager JC (1996) Growth hormone normalizes low-density lipoprotein receptor gene expression in hypothyroid rats. Metabolism 45: 680–685. 11. Lazar MA, Willson TM (2007) Sweet dreams for LXR. Cell Metab 5: 159–161. 12. Sjogren M, Alkemade A, Mittag J, Nordstrom K, Katz A, et al. (2007) Hypermetabolism in mice caused by the central action of an unliganded thyroid hormone receptor alpha1. Embo J 26: 4535–4545. 13. Klieverik LP, Janssen SF, van Riel A, Foppen E, Bisschop PH, et al. (2009) Thyroid hormone modulates glucose production via a sympathetic pathway Congenital Hypothyroidism and Liver PLoS ONE | www.plosone.org 12 May 2012 | Volume 7 | Issue 5 | e37386 from the hypothalamic paraventricular nucleus to the liver. Proc Natl Acad Sci U S A 106: 5966–5971. 14. Vujovic M, Nordstrom K, Gauthier K, Flamant F, Visser TJ, et al. (2009) Interference of a mutant thyroid hormone receptor alpha1 with hepatic glucose metabolism. Endocrinology 150: 2940–2947. 15. Angelin B, Rudling M (2010) Lipid lowering with thyroid hormone and thyromimetics. Curr Opin Lipidol 21: 499–506. 16. Lopez D, Abisambra Socarras JF, Bedi M, Ness GC (2007) Activation of the hepatic LDL receptor promoter by thyroid hormone. Biochim Biophys Acta 1771: 1216–1225. 17. Gullberg H, Rudling M, Forrest D, Angelin B, Vennstrom B (2000) Thyroid hormone receptor beta-deficient mice show complete loss of the normal cholesterol 7alpha-hydroxylase (CYP7A) response to thyroid hormone but display enhanced resistance to dietary cholesterol. Mol Endocrinol 14: 1739–1749. 18. Ness GC, Lopez D (1995) Transcriptional regulation of rat hepatic low-density lipoprotein receptor and cholesterol 7 alpha hydroxylase by thyroid hormone. Arch Biochem Biophys 323: 404–408. 19. Fang X, Hillgartner FB (1998) Cell-specific regulation of transcription of the malic enzyme gene: characterization of cis-acting elements that modulate nuclear T3 receptor activity. Arch Biochem Biophys 349: 138–152. 20. Gonzalez-Manchon C, Butta N, Ferrer M, Ayuso MS, Parrilla R (1997) Molecular cloning and functional characterization of the human cytosolic malic enzyme promoter: thyroid hormone responsiveness. DNA Cell Biol 16: 533–544. 21. Xiong S, Chirala SS, Hsu MH, Wakil SJ (1998) Identification of thyroid hormone response elements in the human fatty acid synthase promoter. Proc Natl Acad Sci U S A 95: 12260–12265. 22. Flores-Morales A, Gullberg H, Fernandez L, Stahlberg N, Lee NH, et al. (2002) Patterns of liver gene expression governed by TRbeta. Mol Endocrinol 16: 1257–1268. 23. Henriquez-Hernandez LA, Flores-Morales A, Santana-Farre R, Axelson M, Nilsson P, et al. (2007) Role of pituitary hormones on 17alpha-ethinylestradiolinduced cholestasis in rat. J Pharmacol Exp Ther 320: 695–705. 24. Hashimoto K, Yamada M, Matsumoto S, Monden T, Satoh T, et al. (2006) Mouse sterol response element binding protein-1c gene expression is negatively regulated by thyroid hormone. Endocrinology 147: 4292–4302. 25. Rodd C, Schwartz HL, Strait KA, Oppenheimer JH (1992) Ontogeny of hepatic nuclear triiodothyronine receptor isoforms in the rat. Endocrinology 131: 2559–2564. 26. Morreale de Escobar G, Obregon MJ, Ruiz de Ona C, Escobar del Rey F (1988) Transfer of thyroxine from the mother to the rat fetus near term: effects on brain 3,5,39-triiodothyronine deficiency. Endocrinology 122: 1521–1531. 27. Oppenheimer JH, Schwartz HL (1997) Molecular basis of thyroid hormonedependent brain development. Endocr Rev 18: 462–475. 28. Holness MJ, Sugden MC (2006) Epigenetic regulation of metabolism in children born small for gestational age. Curr Opin Clin Nutr Metab Care 9: 482–488. 29. Kirby JD, Arambepola N, Porkka-Heiskanen T, Kirby YK, Rhoads ML, et al. (1997) Neonatal hypothyroidism permanently alters follicle-stimulating hormone and luteinizing hormone production in the male rat. Endocrinology 138: 2713–2721. 30. Cooke PS, Hess RA, Porcelli J, Meisami E (1991) Increased sperm production in adult rats after transient neonatal hypothyroidism. Endocrinology 129: 244–248. 31. de GC (1963) Tail growth in the thyroxine-treated hypophysectomized rat as a sensitive criterion for growth hormone activity. Acta Endocrinol (Copenh) 42: 423–431. 32. Lee MM, Chu PC, Chan HC (1969) Effects of cold on the skeletal growth of albino rats. Am J Anat 124: 239–249. 33. Marino R, Hegde A, Barnes KM, Schrier L, Emons JA, et al. (2008) Catch-up growth after hypothyroidism is caused by delayed growth plate senescence. Endocrinology 149: 1820–1828. 34. Finkielstain GP, Forcinito P, Lui JC, Barnes KM, Marino R, et al. (2009) An extensive genetic program occurring during postnatal growth in multiple tissues. Endocrinology 150: 1791–1800. 35. Meyer JH, Nelson AO (1963) Efficiency of Feed Utilization by Various Animal Species Fed Similar Rations. J Nutr 80: 343–349. 36. Parini P, Johansson L, Broijersen A, Angelin B, Rudling M (2006) Lipoprotein profiles in plasma and interstitial fluid analyzed with an automated gel-filtration system. Eur J Clin Invest 36: 98–104. 37. Folch J, Lees M, Sloane Stanley GH (1957) A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226: 497–509. 38. Ruiz JI, Ochoa B (1997) Quantification in the subnanomolar range of phospholipids and neutral lipids by monodimensional thin-layer chromatography and image analysis. J Lipid Res 38: 1482–1489. 39. Quackenbush J (2002) Microarray data normalization and transformation. Nat Genet 32 Suppl. pp 496–501. 40. Tusher VG, Tibshirani R, Chu G (2001) Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 98: 5116–5121. 41. Huang da W, Sherman BT, Lempicki RA (2009) Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4: 44–57. 42. Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132: 365–386. 43. Pfaffl MW (2001) A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res 29: e45. 44. Boersma B, Wit JM (1997) Catch-up growth. Endocr Rev 18: 646–661. 45. Peake GT, Birge CA, Daughaday WH (1973) Alterations of radioimmunoassayable growth hormone and prolactin during hypothroidism. Endocrinology 92: 487–493. 46. Cooper DS, Kieffer JD, Saxe V, Mover H, Maloof F, et al. (1984) Methimazole pharmacology in the rat: studies using a newly developed radioimmunoassay for methimazole. Endocrinology 114: 786–793. 47. Calvo R, Obregon MJ, Ruiz de Ona C, Escobar del Rey F, Morreale de Escobar G (1990) Congenital hypothyroidism, as studied in rats. Crucial role of maternal thyroxine but not of 3,5,39-triiodothyronine in the protection of the fetal brain. J Clin Invest 86: 889–899. 48. Knipper M, Zinn C, Maier H, Praetorius M, Rohbock K, et al. (2000) Thyroid hormone deficiency before the onset of hearing causes irreversible damage to peripheral and central auditory systems. J Neurophysiol 83: 3101–3112. 49. Lee EK, Gorospe M (2010) Minireview: posttranscriptional regulation of the insulin and insulin-like growth factor systems. Endocrinology 151: 1403–1408. 50. Rico-Bautista E, Flores-Morales A, Fernandez-Perez L (2006) Suppressor of cytokine signaling (SOCS) 2, a protein with multiple functions. Cytokine Growth Factor Rev 17: 431–439. 51. Ahmed SF, Farquharson C (2010) The effect of GH and IGF1 on linear growth and skeletal development and their modulation by SOCS proteins. J Endocrinol 206: 249–259. 52. Waxman DJ, Holloway MG (2009) Sex differences in the expression of hepatic drug metabolizing enzymes. Mol Pharmacol 76: 215–228. 53. Rakhshandehroo M, Hooiveld G, Muller M, Kersten S (2009) Comparative analysis of gene regulation by the transcription factor PPARalpha between mouse and human. PLoS One 4: e6796. 54. Castelein H, Gulick T, Declercq PE, Mannaerts GP, Moore DD, et al. (1994) The peroxisome proliferator activated receptor regulates malic enzyme gene expression. J Biol Chem 269: 26754–26758. 55. Tong L (2005) Acetyl-coenzyme A carboxylase: crucial metabolic enzyme and attractive target for drug discovery. Cell Mol Life Sci 62: 1784–1803. 56. Horton JD, Shah NA, Warrington JA, Anderson NN, Park SW, et al. (2003) Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc Natl Acad Sci U S A 100: 12027–12032. 57. Vlahcevic ZR, Heuman DM, Hylemon PB (1991) Regulation of bile acid synthesis. Hepatology 13: 590–600. 58. Hunt MC, Yang YZ, Eggertsen G, Carneheim CM, Gafvels M, et al. (2000) The peroxisome proliferator-activated receptor alpha (PPARalpha) regulates bile acid biosynthesis. J Biol Chem 275: 28947–28953. 59. Pelletier P, Gauthier K, Sideleva O, Samarut J, Silva JE (2008) Mice lacking the thyroid hormone receptor-alpha gene spend more energy in thermogenesis, burn more fat, and are less sensitive to high-fat diet-induced obesity. Endocrinology 149: 6471–6486. 60. Lui JC, Baron J (2011) Mechanisms limiting body growth in mammals. Endocr Rev 32: 422–440. 61. Saenger P, Czernichow P, Hughes I, Reiter EO (2007) Small for gestational age: short stature and beyond. Endocr Rev 28: 219–251. 62. Davenport JW, Hennies RS (1976) Perinatal hypothyroidism in rats: persistent motivational and metabolic effects. Dev Psychobiol 9: 67–82. 63. Vidal OM, Merino R, Rico-Bautista E, Fernandez-Perez L, Chia DJ, et al. (2007) In vivo transcript profiling and phylogenetic analysis identifies suppressor of cytokine signaling 2 as a direct signal transducer and activator of transcription 5b target in liver. Mol Endocrinol 21: 293–311. 64. Waxman DJ, O’Connor C (2006) Growth hormone regulation of sex-dependent liver gene expression. Mol Endocrinol 20: 2613–2629. 65. Flores-Morales A, Greenhalgh CJ, Norstedt G, Rico-Bautista E (2006) Negative regulation of growth hormone receptor signaling. Mol Endocrinol 20: 241–253. 66. Schaefer F, Chen Y, Tsao T, Nouri P, Rabkin R (2001) Impaired JAK-STAT signal transduction contributes to growth hormone resistance in chronic uremia. J Clin Invest 108: 467–475. 67. Chen Y, Sun D, Krishnamurthy VM, Rabkin R (2007) Endotoxin attenuates growth hormone-induced hepatic insulin-like growth factor I expression by inhibiting JAK2/STAT5 signal transduction and STAT5b DNA binding. Am J Physiol Endocrinol Metab 292: E1856–1862. 68. Huang Y, Du M, Zhuang S, Shen Z, Li Y (2010) Impaired growth hormone receptor signaling during non-catch-up growth in rats born small for gestational age. Horm Res Paediatr 74: 106–113. 69. Fraser A, Hughes R, McCarthy A, Tilling K, Davies D, et al. (2008) Early life growth and hemostatic factors: the Barry Caerphilly Growth study. Am J Epidemiol 168: 179–187. 70. Shahkhalili Y, Moulin J, Zbinden I, Aprikian O, Mace K (2010) Comparison of two models of intrauterine growth restriction for early catch-up growth and later development of glucose intolerance and obesity in rats. Am J Physiol Regul Integr Comp Physiol 298: R141–146. 71. Chen LL, Hu X, Zheng J, Kong W, Zhang HH, et al. (2011) Lipid overaccumulation and drastic insulin resistance in adult catch-up growth rats induced by nutrition promotion after undernutrition. Metabolism 60: 569–578. 72. Morrison JL, Duffield JA, Muhlhausler BS, Gentili S, McMillen IC (2010) Fetal growth restriction, catch-up growth and the early origins of insulin resistance and visceral obesity. Pediatr Nephrol 25: 669–677. Congenital Hypothyroidism and Liver PLoS ONE | www.plosone.org 13 May 2012 | Volume 7 | Issue 5 | e37386 73. Desvergne B, Michalik L, Wahli W (2006) Transcriptional regulation of metabolism. Physiol Rev 86: 465–514. 74. Petty KJ, Desvergne B, Mitsuhashi T, Nikodem VM (1990) Identification of a thyroid hormone response element in the malic enzyme gene. J Biol Chem 265: 7395–7400. 75. Wang Y, Yin L, Hillgartner FB (2001) The homeodomain proteins PBX and MEIS1 are accessory factors that enhance thyroid hormone regulation of the malic enzyme gene in hepatocytes. J Biol Chem 276: 23838–23848. 76. Yin L, Wang Y, Dridi S, Vinson C, Hillgartner FB (2005) Role of CCAAT/ enhancer-binding protein, histone acetylation, and coactivator recruitment in the regulation of malic enzyme transcription by thyroid hormone. Mol Cell Endocrinol 245: 43–52. 77. Wang Y, Zhang Y, Hillgartner FB (2002) Chicken ovalbumin upstreampromoter transcription factor and E-box-binding proteins enhance thyroidhormone responsiveness of the malic enzyme gene in avian hepatocytes. Biochem J 361: 391–400. 78. Ho KK, Gibney J, Johannsson G, Wolthers T (2006) Regulating of growth hormone sensitivity by sex steroids: implications for therapy. Front Horm Res 35: 115–128. 79. Lin HY, Yu IC, Wang RS, Chen YT, Liu NC, et al. (2008) Increased hepatic steatosis and insulin resistance in mice lacking hepatic androgen receptor. Hepatology 47: 1924–1935. 80. Heemers HV, Verhoeven G, Swinnen JV (2006) Androgen activation of the sterol regulatory element-binding protein pathway: Current insights. Mol Endocrinol 20: 2265–2277. 81. Larsen PR (2009) Thyroid hormone analogs and metabolites: new applications for an old hormone? Nat Clin Pract Endocrinol Metab 5: 1. 82. Brucker-Davis F (1998) Effects of environmental synthetic chemicals on thyroid function. Thyroid 8: 827–856. Congenital Hypothyroidism and Liver PLoS ONE | www.plosone.org 14 May 2012 | Volume 7 | Issue 5 | e37386 II pose tissue lipolysis. This condition increases FFA supply to the liver, leading to steatosis (26). The SOCS2 !/! mice have reduced levels of circulating GH and, in opposition to JAK2L, exhibit increased fat mass, which suggests that reduced adipose tissue lipolysis in SOCS2 !/! mice may also contribute to reduced hepatic TG accumulation. Noticeably, we did not detect significant changes in circulating FFA or hepatic expression of CD36 in SOCS2 !/! mice compared to what has been reported in the JAK2L mice. Further experiFigure 2. SOCS2 !/! mice show severe glucose intolerance and insulin resistance after high-fat feeding. A) ipGTT. Blood glucose after overnight food withdrawal and after an i.p. injection of glucose (2 g/kg body weight; n"9–10 mice/group). *P#0.05 between diets within genotype group, # P#0.05 between genotypes within diet group; 2-way ANOVA. B,C) Area under the curve (AUC) analysis for ipGTT (B) and ipITT (C). AUC for ipITT was generated from percentage reduction of plasma glucose after insulin administration. D) Plasma insulin after overnight food withdrawal. E) HOMA-IR index measured after overnight food withdrawal. F) Mice, unfed for 4 h, were administered an i.p. injection of saline (!INS) or insulin ($INS; 0.75 U/kg body weight) for 10 min before tissue collection. Intensities of pIRS-1 corrected to those of total IRS-1 were measured by a luminex multiplex assay (n"4–5/treatment group) in liver and muscle lysates, respectively. Data are shown as means %se.*P#0.05, **P#0.001, ***P#0.0001; Student’s ttest (B–E) or 1-way ANOVA post hoc analysis performed separately in the !INS and $INS groups (F). separately. # P#0.05 between diets within genotype group; $ P#0.05 between genotypes within diet group. Figure 3. Morphological and functional analysis of pancreatic islets from SOCS2 !/! mice. A) Pancreatic histology and immunohistochemical staining for insulin and glucagon in sections from the WT and SOCS2 !/! mice after 4 h food withdrawal. Slides were counterstained with hematoxylin and eosin.B) Insulin content per gram pancreas weight (3–4 mice/group).C) HOMA-&as a product of plasma insulin and blood glucose after overnight food withdrawal (n"9–10 mice/group). *P#0.05; Student’sttest. 3288 Vol. 26 August 2012 ZADJALI ET AL.The FASEB Journal !www.fasebj.org ments are needed to analyze the influence of GH and adipose tissue lipolysis in the SOCS2 !/! mice liver. Surprisingly, the SOCS2 !/! mice showed an exacerbated response to high-fat feeding, leading to worsened insulin sensitivity, whereas the SOCS2 !/! and WT mice showed few differences in insulin signaling when maintained on a normal CD. This finding suggests that hyperactivity of the hepatic GH receptor signaling alone, as it is observed in SOCS2 !/! mice, is unlikely to account for the diet-dependent deterioration in glucose control observed in this study. A more likely explanation is that the anti-insulinic actions of GH are exacerbated by diet-related mechanisms under SOCS2 control. We provide evidence for the existence of three such mechanisms: hyperinsulinemia, peripheral adiposity, and excessive production of inflammatory cytokines. Toll-like receptor-driven macrophage activation in liver and adipose tissues by high-fat feeding leads to the production of inflammatory cytokines, a process that is required for diet-induced hepatic insulin resistance (3). The loss of SOCS2 leads to an altered response to HFD in mice, resulting in increased expression of inflammatory cytokines and enhanced NF-"B activation. This seems to be mediated by direct actions of SOCS2 on macrophage activation, as demonstrated in ex vivo experiments showing that BMDMs from the SOCS2 !/! mice exhibit increased phagocytic activity in vitro and are hyperresponsive to LPS stimulation, leading to expression of IL-6,iNOS,IL-1#, and IFN-$ (Supplemental Fig. S4A). A previous study described an anti-inflammatory role of SOCS2, mediating the activity of aspirin-triggered lipoxins (27). Our data suggest that the anti-inflammatory actions of SOCS2 may be mediated to some extent through inhibition of the LPS response in macrophages, leading to NF-"B activation. Transgenic mice with enhanced NF-"B activity in hepatocytes exhibit insulin resistance driven by inflammation, which resembles the HFD-fed SOCS2 !/! mice (28). Measurements of cytokine mRNA levels in hepatic tissue provide a strong indication that liver nonparenchimal cells participate in the hepatic response to HFD in SOCS2 !/! mice. However, whether this altered reactivity is related to GH or other signals remains unknown. In relation to GH, we showed previously that GH treatment of SOCS2 !/! mice results in enhanced hepatic expression of cytokine-regulated genes (12, 13) and GH is known to exacerbate the inflammatory response in LPS-treated rodents and worsen the conditions of critically ill patients (29). Further work is needed to clarify the role of GH signaling in different tissues and cell types in the HFD-fed SOCS2 !/! mice. It is often postulated that inflammation contributes Figure 4. Enhanced proinflammatory signaling in the liver and macrophages of SOCS2 !/! mice. A) Hepatic inflammatory signaling was measured by immunoblotting for pNF-"B, NF-"B, and I"B%, followed by the densitometric measurement of band intensities (n&3–4 mice/group). B) Cytokine levels in cell media collected from BMDMs stimulated at different time points (h) with 10 ng/ml of LPS. Data are presented as means 'se of 3 independent experiments. C) Percentage of total BMDMs that ingested carbon particles over8h(n&5). D) Western blot of pNF-"B, NF-"B, pJNK, JNK, and I"B%proteins from BMDMs ex vivo stimulated with 10 ng/ml LPS. *P(0.05, **P(0.001, ***P(0.0001; Student’s ttest. 3289HEPTATIC STEATOSIS AND INSULIN RESISTANCE IN SOCS2 to hepatic steatosis, although the causality of this relationship is not always supported by experimental data (30, 31). Although in certain models, such as mice fed a methionineand choline-deficient diet or the SOCS1 !/! mice, severe inflammation can contribute to liver steatosis (24, 32); this situation does not reflect the subacute inflammation that is observed in human nonalcoholic steatohepatitis (NASH; ref. 33). Mimicking this situation in a mouse model through low-level activation of NF-"B in hepatocytes is sufficient to trigger subacute inflammation, but this is not accompanied by steatosis (28). In another example, inhibition of 5-lipoxygenase expression in the ApoE !/! model of NASH can revert inflammation and insulin resistance but has little effect on hepatic lipid content (31). Therefore, inflammation per se does not necessarily cause hepatosteatosis. This concept is strengthened by our studies in SOCS2 !/! mice that demonstrate that modest inflammation can be accompanied by diminished levels of steatosis, a phenotype that is also observed in mice with reduced capacity to synthesize TG due to reduced expression of DGAT2 (34). In summary, our results demonstrate that SOCS2 plays an important role in regulating the response to high-fat dietary stress. The SOCS2 !/! mice provide a novel model to understand the complex relationship between inflammation, GH actions, and nutrition in the control of hepatic glucose and lipid homeostasis. Future use of this model may help to outline the contribution of different mechanisms in the development of fat-induced hepatic insulin resistance and components related to lipid overload in comparison with components related to inflammatory stress. The SOCS2 !/! mice were provided by Dr. D. Hilton (Walter and Eliza Hall Institute, Melbourne, VIC, Australia). The authors are indebted to Carlos Mateos-Díaz, M. Mercedes Díaz, and Michael Hühn for their technical assistance. This work was supported by grants from the Novo Nordisk Foundation, The Swedish Research Council (no. 2009-3738), and the Danish Research Council to A.F.-M. and in part by grants to L.F.-P. from the Spanish Ministry of Science and Innovation with funding from the European Regional Development Fund–European Social Fund (SAF2006-07824; SAF200913296). F.Z., M.V., and M.M.-G. were supported by fellowships from Sultan Qaboos University, Karolinska Institutet, and the University of Las Palmas de Gran Canaria, respectively. REFERENCES 1. Zhang, D., Christianson, J., Liu, Z. X., Tian, L., Choi, C. S., Neschen, S., Dong, J., Wood, P. A., and Shulman, G. I. (2010) Resistance to high-fat diet-induced obesity and insulin resistance in mice with very long-chain acyl-CoA dehydrogenase deficiency. Cell Metab. 11, 402–411 2. Kodama, Y., Kisseleva, T., Iwaisako, K., Miura, K., Taura, K., De Minicis, S., Osterreicher, C. H., Schnabl, B., Seki, E., and Brenner, D. A. (2009) c-Jun N-terminal kinase-1 from hematopoietic cells mediates progression from hepatic steatosis to steatohepatitis and fibrosis in mice. Gastroenterology 137, 1467– 1477 e1465 3. Saberi, M., Woods, N. B., de Luca, C., Schenk, S., Lu, J. C., Bandyopadhyay, G., Verma, I. M., and Olefsky, J. M. (2009) Hematopoietic cell-specific deletion of toll-like receptor 4 ameliorates hepatic and adipose tissue insulin resistance in high-fatfed mice. Cell Metab. 10, 419–429 4. Rico-Bautista, E., Flores-Morales, A., and Fernandez-Perez, L. (2006) Suppressor of cytokine signaling (SOCS) 2, a protein with multiple functions. Cytokine Growth Factor Rev. 17, 431–439 5. Wormald, S., Zhang, J. G., Krebs, D. L., Mielke, L. A., Silver, J., Alexander, W. S., Speed, T. P., Nicola, N. A., and Hilton, D. J. (2006) The comparative roles of suppressor of cytokine signaling-1 and -3 in the inhibition and desensitization of cytokine signaling. J. Biol. Chem. 281, 11135–11143 6. Lang, R., Pauleau, A. L., Parganas, E., Takahashi, Y., Mages, J., Ihle, J. N., Rutschman, R., and Murray, P. J. (2003) SOCS3 regulates the plasticity of gp130 signaling. Nat. Immunol. 4, 546–550 7. Rui, L., Yuan, M., Frantz, D., Shoelson, S., and White, M. F. (2002) SOCS-1 and SOCS-3 block insulin signaling by ubiquitinmediated degradation of IRS1 and IRS2. J. Biol. Chem. 277, 42394–42398 8. Ueki, K., Kondo, T., Tseng, Y. H., and Kahn, C. R. (2004) Central role of suppressors of cytokine signaling proteins in hepatic steatosis, insulin resistance, and the metabolic syndrome in the mouse. Proc. Natl. Acad. Sci. U. S. A. 101, 10422–10427 9. Sachithanandan, N., Fam, B. C., Fynch, S., Dzamko, N., Watt, M. J., Wormald, S., Honeyman, J., Galic, S., Proietto, J., Andrikopoulos, S., Hevener, A. L., Kay, T. W., and Steinberg, G. R. (2010) Liver-specific suppressor of cytokine signaling-3 deletion in mice enhances hepatic insulin sensitivity and lipogenesis resulting in fatty liver and obesity. Hepatology 52, 1632–1642 10. Alexander, W. S., Starr, R., Fenner, J. E., Scott, C. L., Handman, E., Sprigg, N. S., Corbin, J. E., Cornish, A. L., Darwiche, R., Owczarek, C. M., Kay, T. W., Nicola, N. A., Hertzog, P. J., Metcalf, D., and Hilton, D. J. (1999) SOCS1 is a critical inhibitor of interferon gamma signaling and prevents the potentially fatal neonatal actions of this cytokine. Cell 98, 597–608 11. Elam, M. B., Cowan, G. S., Jr., Rooney, R. J., Hiler, M. L., Yellaturu, C. R., Deng, X., Howell, G. E., Park, E. A., Gerling, I. C., Patel, D., Corton, J. C., Cagen, L. M., Wilcox, H. G., Gandhi, M., Bahr, M. H., Allan, M. C., Wodi, L. A., Cook, G. A., Hughes, T. A., and Raghow, R. (2009) Hepatic gene expression in morbidly obese women: implications for disease susceptibility. Obesity 17, 1563–1573 12. Greenhalgh, C. J., Rico-Bautista, E., Lorentzon, M., Thaus, A. L., Morgan, P. O., Willson, T. A., Zervoudakis, P., Metcalf, D., Street, I., Nicola, N. A., Nash, A. D., Fabri, L. J., Norstedt, G., Ohlsson, C., Flores-Morales, A., Alexander, W. S., and Hilton, D. J. (2005) SOCS2 negatively regulates growth hormone action in vitro and in vivo. J. Clin. Invest. 115, 397–406 13. Rico-Bautista, E., Greenhalgh, C. J., Tollet-Egnell, P., Hilton, D. J., Alexander, W. S., Norstedt, G., and Flores-Morales, A. (2005) Suppressor of cytokine signaling-2 deficiency induces molecular and metabolic changes that partially overlap with growth hormone-dependent effects. Mol. Endocrinol. 19, 781– 793 14. Metcalf, D., Greenhalgh, C. J., Viney, E., Willson, T. A., Starr, R., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (2000) Gigantism in mice lacking suppressor of cytokine signalling-2. Nature 405, 1069–1073 15. Fan, Y., Menon, R. K., Cohen, P., Hwang, D., Clemens, T., DiGirolamo, D. J., Kopchick, J. J., Le Roith, D., Trucco, M., and Sperling, M. A. (2009) Liver-specific deletion of the growth hormone receptor reveals essential role of growth hormone signaling in hepatic lipid metabolism. J. Biol. Chem. 284, 19937– 19944 16. Vesterlund, M., Zadjali, F., Persson, T., Nielsen, M. L., Kessler, B. M., Norstedt, G., and Flores-Morales, A. (2011) The SOCS2 ubiquitin ligase complex regulates growth hormone receptor levels. PLoS One 6, e25358 17. Harris, J., Stanford, P. M., Sutherland, K., Oakes, S. R., Naylor, M. J., Robertson, F. G., Blazek, K. D., Kazlauskas, M., Hilton, H. N., Wittlin, S., Alexander, W. S., Lindeman, G. J., Visvader, J. E., and Ormandy, C. J. (2006) Socs2 and elf5 mediate prolactin-induced mammary gland development. Mol. Endocrinol. 20, 1177–1187 18. Hu, J., Winqvist, O., Flores-Morales, A., Wikstrom, A. C., and Norstedt, G. (2009) SOCS2 influences LPS induced human monocyte-derived dendritic cell maturation. PLoS One 4, e7178 3290 Vol. 26 August 2012 ZADJALI ET AL.The FASEB Journal !www.fasebj.org 19. Knosp, C. A., Carroll, H. P., Elliott, J., Saunders, S. P., Nel, H. J., Amu, S., Pratt, J. C., Spence, S., Doran, E., Cooke, N., Jackson, R., Swift, J., Fitzgerald, D. C., Heaney, L. G., Fallon, P. G., Kissenpfennig, A., and Johnston, J. A. (2011) SOCS2 regulates T helper type 2 differentiation and the generation of type 2 allergic responses. J. Exp. Med. 208, 1523–1531 20. Goodpaster, B. H., Theriault, R., Watkins, S. C., and Kelley, D. E. (2000) Intramuscular lipid content is increased in obesity and decreased by weight loss. Metabolism 49, 467–472 21. Parini, P., Johansson, L., Broijersen, A., Angelin, B., and Rudling, M. (2006) Lipoprotein profiles in plasma and interstitial fluid analyzed with an automated gel-filtration system. Eur. J. Clin. Invest. 36, 98–104 22. Li, X., Catalina, F., Grundy, S. M., and Patel, S. (1996) Method to measure apolipoprotein B-48 and B-100 secretion rates in an individual mouse: evidence for a very rapid turnover of VLDL and preferential removal of B-48relative to B-100-containing lipoproteins. J. Lipid Res. 37, 210–220 23. Emanuelli, B., Macotela, Y., Boucher, J., and Ronald Kahn, C. (2008) SOCS-1 deficiency does not prevent diet-induced insulin resistance. Biochem. Biophys. Res. Commun. 377, 447–452 24. Starr, R., Metcalf, D., Elefanty, A. G., Brysha, M., Willson, T. A., Nicola, N. A., Hilton, D. J., and Alexander, W. S. (1998) Liver degeneration and lymphoid deficiencies in mice lacking suppressor of cytokine signaling-1. Proc. Natl. Acad. Sci. U. S. A. 95, 14395–14399 25. Takahashi, Y., Iida, K., Takahashi, K., Yoshioka, S., Fukuoka, H., Takeno, R., Imanaka, M., Nishizawa, H., Takahashi, M., Seo, Y., Hayashi, Y., Kondo, T., Okimura, Y., Kaji, H., Kitazawa, R., Kitazawa, S., and Chihara, K. (2007) Growth hormone reverses nonalcoholic steatohepatitis in a patient with adult growth hormone deficiency. Gastroenterology 132, 938–943 26. Sos, B. C., Harris, C., Nordstrom, S. M., Tran, J. L., Balazs, M., Caplazi, P., Febbraio, M., Applegate, M. A., Wagner, K. U., and Weiss, E. J. (2011) Abrogation of growth hormone secretion rescues fatty liver in mice with hepatocyte-specific deletion of JAK2. J. Clin. Invest. 121, 1412–1423 27. Machado, F. S., Johndrow, J. E., Esper, L., Dias, A., Bafica, A., Serhan, C. N., and Aliberti, J. (2006) Anti-inflammatory actions of lipoxin A4 and aspirin-triggered lipoxin are SOCS-2 dependent. Nat. Med. 12, 330–334 28. Cai, D., Yuan, M., Frantz, D. F., Melendez, P. A., Hansen, L., Lee, J., and Shoelson, S. E. (2005) Local and systemic insulin resistance resulting from hepatic activation of IKK-beta and NF-kappaB. Nat. Med. 11, 183–190 29. Takala, J., Ruokonen, E., Webster, N. R., Nielsen, M. S., Zandstra, D. F., Vundelinckx, G., and Hinds, C. J. (1999) Increased mortality associated with growth hormone treatment in critically ill adults. N. Engl. J. Med. 341, 785–792 30. Seppala-Lindroos, A., Vehkavaara, S., Hakkinen, A. M., Goto, T., Westerbacka, J., Sovijarvi, A., Halavaara, J., and Yki-Jarvinen, H. (2002) Fat accumulation in the liver is associated with defects in insulin suppression of glucose production and serum free fatty acids independent of obesity in normal men. J. Clin. Endocrinol. Metab. 87, 3023–3028 31. Martinez-Clemente, M., Ferre, N., Gonzalez-Periz, A., LopezParra, M., Horrillo, R., Titos, E., Moran-Salvador, E., Miquel, R., Arroyo, V., Funk, C. D., and Claria, J. (2010) 5-lipoxygenase deficiency reduces hepatic inflammation and tumor necrosis factor alpha-induced hepatocyte damage in hyperlipidemiaprone ApoE-null mice. Hepatology 51, 817–827 32. Schattenberg, J. M., Singh, R., Wang, Y., Lefkowitch, J. H., Rigoli, R. M., Scherer, P. E., and Czaja, M. J. (2006) JNK1 but not JNK2 promotes the development of steatohepatitis in mice. Hepatology 43, 163–172 33. Festa, A., D’Agostino, R., Jr., Tracy, R. P., Haffner, S. M., and Insulin Resistance Atherosclerosis, S. (2002) Elevated levels of acute-phase proteins and plasminogen activator inhibitor-1 predict the development of type 2 diabetes: the insulin resistance atherosclerosis study. Diabetes 51, 1131–1137 34. Yu, X. X., Murray, S. F., Pandey, S. K., Booten, S. L., Bao, D., Song, X. Z., Kelly, S., Chen, S., McKay, R., Monia, B. P., and Bhanot, S. (2005) Antisense oligonucleotide reduction of DGAT2 expression improves hepatic steatosis and hyperlipidemia in obese mice. Hepatology 42, 362–371 Received for publication February 29, 2012. Accepted for publication April 23, 2012. 3291HEPTATIC STEATOSIS AND INSULIN RESISTANCE IN SOCS2 III Horm Mol Biol Clin Invest 2011;8(2):471–478 © 2011 by Walter de Gruyter • Berlin • Boston. DOI 10.1515/HMBCI.2011.125 Liver X receptor agonist downregulates growth hormone signaling in the liver Fahad Zadjali 1 – 3, *, Ruyman Santana-Farre 4 , Mercedes Mirecki-Garrido 4 , Ewa Ellis 5 , Gunnar Norstedt 2 , Leandro Fernandez-Perez 4 and Amilcar Flores-Morales 1 1 Novo Nordisk Foundation Center for Protein Research , Faculty of Health Sciences, University of Copenhagen, Copenhagen, Denmark 2 Department of Molecular Medicine and Surgery , Karolinska Institutet, Stockholm, Sweden 3 Department of Biochemistry , College of Medicine and Health Sciences, Sultan Qaboos University, Kodh, Oman 4 Department of Clinical Sciences-Pharmacology Unit , Faculty of Health Sciences, University of Las Palmas GC, Canary Institute for Cancer Research (ICIC), Las Palmas, Spain 5 Unit for Transplantation Surgery , Liver Cell Laboratory, Karolinska Institutet, Huddinge, Sweden Abstract Liver X receptor (LXR) agonists have been shown to infl uence the development of hyperlipidemia and atherosclerosis in mouse models. It has also been demonstrated that some LXR agonists can cause hepatic steatosis in experimental animals. Growth hormone (GH) is known to regulate hepatic metabolism and the absence of hepatic GH receptors (GHR) leads to hepatic steatosis. In this study, we analyzed whether the actions of LXR agonists could involve interference with GH signaling. We showed that LXR agonists impair GH signaling in hepatocytes. LXR agonist treatment attenuated GH induction of suppressor of cytokine signaling 2 (SOCS2), SOCS3, and CIS mRNA levels in BRL-4 cells. Likewise, the activity of a luciferase reporter vector driven by the GH response element (GHRE) of the SOCS2 gene was inhibited by simultaneous treatment with an LXR agonist. The inhibitory effect of LXR agonists on GH signals can be mimicked by overexpression of the LXR regulated factors, sterol regulatory element binding protein 1 (SREBP1) and SREBP2, in hepatic cells. In both cases total and phosphorylated signal transducers and activators of transcription 5b (STAT5b) protein levels were signifi cantly reduced. DNA binding assays demonstrated that SREBP1 binds to an E-box within a previously defi ned GHRE in the SOCS2 gene promoter, but does not compete with STAT5b binding to a nearby site in the same promoter construct. Taken together, our fi ndings indicate that the inhibitory effects of LXR agonists on GH signaling are mediated by SREBP1, through the downregulation of STAT5b gene transcription and stimulation of STAT5b protein degradation. The fi ndings provide a new insight into the understanding of the molecular actions of LXR agonists, which may be of relevance to their pharmacological actions. Keywords: 9-cis retinoic acid; growth hormone; lipid; LXR; RXR; SOCS2; T0901317. Introduction The liver X receptorα (LXR α ) and LXR β (also known as NR1H3 and NR1H2, respectively), belong to the nuclear receptor superfamily of ligand activated transcription factors [1] . LXRs heterodimerize with the retinoic acid receptor (RXR), to regulate transcription of target genes, upon activation by oxidized derivatives of cholesterol, also known as oxysterols [1] . In the liver, LXR α activation induces a complex transcriptional network involved in the control of intracellular nonesterifi ed cholesterol levels. Experimental studies with synthetic ligands, T0901317 and GW3965, indicate that the pharmacological activation of LXR protects against atherosclerosis, reduces plasma cholesterol levels and improves glucose tolerance in models of type 2 diabetes [2] . Unfortunately, these positive effects are accompanied by hypertriglyceridemia and hepatic steatosis, which presents risks for the development of cardiovascular disease [3] . This raises concerns regarding the application of LXR agonists in the management of common metabolic disorders linked to obesity and type 2 diabetes. A better understanding of the molecular basis for the pleiotropic effects of LXR in the liver, may lead to an improved safety profi le for future LXR modulators. Growth hormone (GH) actions are triggered by its binding to the GH receptor (GHR) and the activation of its associated kinase, JAK2. This, in turn, results in the tyrosine phosphorylation of the transcription factor signal transducers and activators of transcription 5b (STAT5b), which translocates to the nucleus to modulate expression of GH target genes, such as insulin growth factor-1 (IGF-1) and the suppressor of cytokine signaling 2 (SOCS2) [4] . The main metabolic actions of GH are anabolic, promoting protein synthesis in the muscle through the catabolism of fatty acids as the energy source. Because of GH effects on lipid mobilization from the liver, GH defi cient patients and mice where GH signaling is specifi cally inactivated in the liver [5] , are characterized by hepatic steatosis [6] . It is interesting to note that treatment of animals with the LXR agonist T0901317 also causes severe hepatic steatosis [3] and LXR α / β *Corresponding author: Fahad Zadjali, Department of Molecular Medicine and Surgery, Karolinska Institutet, CMM L8:01, 17176 Stockholm, Sweden Phone: + 46 (0) 851773203, E-mail: [email protected] Received August 29, 2011; accepted November 9, 2011 !"#$%&'('#()#$(*)(+(,-./$0(12345(678(9*7830:#(;,-./$0(12345(678(9*7830:#< =$'&72'3:-'76(+(>?@5>A5>5@@A B#C28#-6(B-'7(+(@D>AD>@(>EFG(HI 472 Zadjali et al.: Downregulation of GH signaling in the liver knockout mice (LXR -/- ) are resistant to high fat diet induced hepatic steatosis [7, 8] . Interestingly, in this model, the levels of hepatic type 2 deiodinase mRNA, which is under GH control, were elevated [7] . LXR and GHR activations in the liver also lead to antagonizing effects on glucose metabolism. LXR agonists show an antidiabetic effect by inhibition of gluconeogenesis and reduction of the expression of phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase [2] , while GHR activation induces hepatic gluconeogenesis and increases the mRNA levels of gluconeogenic enzymes [9] . The key regulatory role of GH on liver lipid metabolism and insulin sensitivity opens the question of whether some of the physiological actions that are attributed to the LXR ligands could be explained by interference with GH signaling. We performed this study to provide new insights into the relationship between LXR and GHR signaling in hepatocytes. Materials and methods Materials Recombinant rat GH was from the National Hormone and Pituitary Program, National Institutes of Health (NIH, Bethesda, MD, USA) and recombinant human GH was from Novo Nordisk A/S (Gentofte, Denmark). Oligonucleotides were obtained from ThermoElectron (Bremen, Germany). T0901317 and GW3965 (LXR agonists), 9-cis retinoic acid (RXR agonist) and cycloheximide (CHX) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Plasmid cloning and site-directed mutagenesis The luciferase reporter vector containing the GHRE (696bp) in the fi rst intron of SOCS2 human gene, named P5, has been previously described [10] . The fatty acid synthase (FAS) promoter constructs (pFAS) were a generous gift of Dr. T. Osborne [11] and the promoter construct of ATP-binding cassette (pABCA1) was a gift from Dr. Castrillo A [12] . Myc-SREBP1a and myc-SREBP2 (sterol regulatory element binding protein) expressing vectors were a generous gift from Dr. J. Ericsson [13] . Cell culture and transfection assays Buffalo rat liver (BRL) cells stably transfected with the rat GHR, designated BRL-4 cells, were cultured as described [10] . Primary human hepatocytes were isolated from discarded organ-donor tissue. Isolated hepatocytes were obtained from the liver cell laboratory, KICLINTEC, Huddinge University Hospital. Ethics approval to use hepatocytes was given by the local Ethical Committee, Stockholm (DNr: 2010/678-31/3). Cells were maintained in Williams E medium as described previously [14] . DNA plasmid transfections were carried as recommended by the manufacturer ’ s instructions on 70 % – 80 % confl uent cells using lipofectamine with Plus reagent (Invitrogen, Carlsbad, CA, USA). Cells were treated with 1 µ M LXR agonists, 10 µ M RXR agonist or 0.1 % DMSO as vehicle control and with GH 50 nM. Reporter gene assay pSOCS2-TK-LUC (1 ug) was co-transfected with 10 or 50 ng of the nuclear form of SREBP1a, SREBP2 or pCDNA3 (Invitrogen), and 50 ng β -galactosidase reporter plasmid. Medium was replaced with serum-free DMEM 16 – 18 h posttransfection, and cells were treated with rGH and harvested 36 h after transfection in reporter lysis buffer for luciferase assays (Promega, Madison, WI, USA). Transfection experiments were performed at least three times. Analysis of gene transcription Total RNA was isolated from treated cells using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). cDNA synthesis and quantitative realtime PCR were performed as described previously [10] . Expression levels of genes were normalized to those of ribosomal RNA S18 or cyclophilin genes. Cell lysis and immunoblotting Cells were treated as described in the fi gure legends. Protein extraction and SDS-PAGE were performed as described previously [10] . Antibodies against STAT5, pSTAT5 (Tyr694) and SOCS2 were purchased from Cell Signaling Technology (Frankfurt A. M., Germany) and, SREBP1, SREBP2, β -actin, myc and GHR antibodies were purchased from Santa Cruz Biotechnology (Beverly, MA, USA). CHX chase experiments BRL-4 cells were transfected with myc-SREBP1a, myc-SREBP2 or control plasmid. Cells were split into different plates for treatment with 100 µ g/mL CHX (Sigma-Aldrich) 24 h post-transfection and then lysed at different time points for protein extraction. ABCD assay (avidin, biotin, complex, DNA) In this assay, protein-DNA complexes were immobilized by biotinylated oligonucleotides to a streptavidin matrix. BRL-4 cells were treated with LXR/RXR agonists for 48 h and then stimulated with GH for 10 min, before lysis in 50 mM HEPES pH 7.5, 150 mM KCl, 1 mM EGTA, 1 % NP-40, 10 % glycerol, 1.5 mM MgCl 2 , 1 mM Na 3 VO 4 , 1X cocktail inhibitor, 50 mM NaF and 1 mM PMSF. BRL4 cell extracts (250 µ g) were incubated with 2 µ g biotinylated oligonucleotide and 5 µ g salmon sperm DNA (Stratagene, La Jolla, CA, USA). Mixtures were incubated overnight at 4 ° C under constant rotation. Then 40 µ L equilibrated streptavidin agarose beads (Amersham, Arlington Heights, IL, USA) were added to the mix and further incubated for 2 h at 4 ° C on a rotator. After centrifugation, beads were washed repeatedly with lysis buffer containing 50 mM KCl, then boiled in sample buffer and separated by SDS-PAGE. SREBP1 and STAT5b bindings were detected by Western blot. We also repeated the ABCD assay using extracts from separately treated cells after 48 h treatment with LXR/ RXR agonist or after 10 min treatment with GH. Equal amounts of total protein from each cell lysate were used for the assay. As control oligonucleotides for SREBP1 and STAT5b binding, we used sterol response element (SRE) element in the acetyl-CoA carboxylase (ACC1) genes and GHRE, containing two STAT5b sites, in SPI-2.1 gene. 3 ′ Biotinylated oligonucleotides were ordered from Thermo Electron (Bremen, Germany) with the following forward oligonucleotides sequences: WT: 5 ′ -cccgcg-gtcacgtgaggccgattcctggaaagttcctggaaagcc g-3 ′ , mut-Ebox: 5 ′ -cccgcggt gt cgtgaggccgatt-cctggaaagttcctggaaagcc g-3 ′ , mut-STAT5b: 5 ′ -cccgcggtcacgtgaggccga aa cctggaaag aa cc tggaaagcc g-3 ′ , mut-Ebox/STAT5b: 5 ′ -ccc cggt gt cgtgaggccga aa cctggaaag aa cctggaaa gccg-3 ′ , SRE: 5 ′ -tcgcatcacaccaccgcg g-3 ′ , GHRE: 5 ′ -tcgacgctt ctactaatcccatgttctgag aaatcatccag-3 ′ . The forward and complementary oligonucleotides were heated for 10 min at 95 ° C then cooled down to anneal at room temperature. !"#$%&'('#()#$(*)(+(,-./$0(12345(678(9*7830:#(;,-./$0(12345(678(9*7830:#< =$'&72'3:-'76(+(>?@5>A5>5@@A B#C28#-6(B-'7(+(@D>AD>@(>EFG(HI Zadjali et al.: Downregulation of GH signaling in the liver 473 Statistical analysis Statistically signifi cant differences were assessed with the two-tailed Student ’ s t-test. All statistical analysis was performed using SPSS for Windows (version 10.0, Chicago, IL, USA). Statistical signifi cance was reported for p < 0.05. Results GH induced gene expression is inhibited by LXR agonist We used BRL cells stably transfected with the rGHR (BRL-4) [15] to analyze GH signals. These cells express endogenous JAK2 and STAT5b and respond to GH with the transcriptional induction of STAT5b-regulated genes, such as CIS and SOCS2, although they express little IGF-1 [15] . We fi rst performed a dose-response experiment in BRL-4 cells to assess their response to T0901317, by measuring changes in SREBP1c expression (Figure 1 A). Maximal activity was observed at 1 µ M, thus this was chosen as the working concentration for the following experiments. In order to understand the interaction between LXR and GH signaling, we studied the effect of the LXR synthetic ligand T0901317 on the mRNA levels of selected genes. As shown in Figure 1 B, 40 h treatment of BRL-4 cells with the LXR agonist resulted in signifi cantly increased mRNA levels of LXR α , SREBP1a and SREBP2, as well as its downstream target fatty acid synthase (FAS) gene. In addition, we observed a marked downregulation of GH-regulated genes, SOCS2, SOCS3 and CIS. We further studied the LXR agonist effect after 2 h stimulation in the presence or absence of GH. As expected, GH has a signifi cant stimulatory activity on the expression of SOCS2, SOCS3 and cytokine-induced SH2 protein (CIS) (Figure 1 C). It also increased SREBP2 expression but failed to stimulate the expression of SREBP1a (Figure 1 D). In a combined treatment with the LXR agonist, signifi cant inhibition of GH induced gene expression was detected (Figure 1 C). LXRs form heterodimeric complexes with RXRs [1] . Hence, we examined the effect of short-term treatment (4 h) with the RXR ligand, 9-cis retinoic acid, alone or in combination with the LXR agonist, in the regulation of GH induction of SOCS2 gene expression. Treatment of BRL-4 cells with GH resulted in a 14-fold increase in the levels of SOCS2 mRNA while 4 h pretreatment with the RXR and mRNA expression (fold change) 12.5 T0901317, 1µM VEH SREBP1a FAS LXRα SREBP2 SOCS2 CIS SOCS3 SREBP1c B C D *** *** ** *** *** ** ** *** 0 1 2 3 4 5 6 7 8socs2 cis socs3 mRNA (fold induction) GH T0901317 VEH + +- -- - - + + + - + + - - + - - + - - - + + + + + ++++ +------ - - - - - *** * ** * *** *** ### ### ### mRNA (fold induction) 0.0 2.5 5.0 7.5 10.0 12.5 GH VEH SREBP1a SREBP2 *** *** ** ## T0901317 SREBP1c mRNA (fold induction) GH VEH + + + + ### *** T0901317, µM 0.01 0.1001 0 1 2 3 4 5 6 7 8 ### *** ### *** A 2.5 0.0 5.0 7.5 10.0 Figure 1 Effects of T0901317 on GH-dependent expression of SOCS2 mRNA in BRL-4 cells. (A) BRL-4 cells were treated for 4 h with different doses of LXR agonist (T0901317) or vehicle (VEH) then followed with 2 h rGH stimulation before quantifi cation of gene expression, normalized to cyclophiline gene expression. (B) BRL-4 cells were treated for 40 h with 1 µ M LXR agonist (T0901317) followed by quantifi cation of gene expression. (C) + (D) BRL-4 cells were treated similarly as (B) then followed with rGH (50 nM) stimulation for 2 h before quantifi cation of gene expression. VEH = 0.1 % DMSO, Me 2 SO. Values are expressed as means ± SEM. *Indicates signifi cant differences compared to GH-unstimulated cells, # indicates signifi cant differences to cells treated with GH alone. **p < 0.01, ***p < 0.001. !"#$%&'('#()#$(*)(+(,-./$0(12345(678(9*7830:#(;,-./$0(12345(678(9*7830:#< =$'&72'3:-'76(+(>?@5>A5>5@@A B#C28#-6(B-'7(+(@D>AD>@(>EFG(HI 474 Zadjali et al.: Downregulation of GH signaling in the liver 0 2 4 6 8 10 12 14 16 18 GH T0901317 VEH+ - - - - - - - +- - - -- + - +- + + ++ - + 9-cis RA -- - + + - + + SOCS2 (fold change) ** *** *** *** # *** *** *** AB 0 8 16 24 32 40 SREBP1c (fold change) GH VEH+ - - - - - - - +- - - -- + - +- + + ++ - + -- - + + - + + *** ****** *** *** *** *** ### ### ### T0901317 9-cis RA 0 15 30 45 GH T0901317 + +- + + + +- -- - + pSOCS2 + +- + 3 6 24 T0901317, h ** **** * ## C 0 2 4 6 8 10 12 14 pFAS RLU/B-GAL RLU/B-GAL T0901317 -+ *** 0 50 100 150 200 250 300 RLU/B-GAL pABCA1 T0901317 -+ *** STAT5bSTAT5b pSOCS2 E-box Luciferase TK Figure 2 LXR and RXR agonist represses GH-dependent transcriptional activation of SOCS-2. (A, B) Expression of SOCS2 and SREBP1c was measured after 4 h treatment with LXR (T0901317), RXR (9-cis RA) agonists or a combination of both. The relative expression levels were scaled to the vehicle-matched control group. (C) Luciferase activity of SOCS2 promoter (pSOCS2) from BRL-4 cells after treatment with LXR agonist (T0901317) for 3, 6, and 24 h with or without 12 h stimulation with rGH. Transfection of plasmids pFAS (marker of SREBP1 activity) and pABCA1 (marker of SREBP2 activity) were used as positive controls for LXR agonist treatment. Data shown are means ± SD. *Indicates signifi cant differences compared to GH-unstimulated cells, # indicates signifi cant differences to cells treated with GH alone. *p < 0.05, **p < 0.01, ***p < 0.001. LXR agonist alone or in combination resulted in a moderate induction of SOCS2 mRNA levels (Figure 2 A). Individual pretreatment with each of the agonists did not have an effect on GH-stimulated SOCS2 expression. In contrast, the combined pretreatment resulted in a signifi cant inhibition of the GH effect parallel to maximal induction of SREBP1c (Figure 2 B). Together, these data demonstrate that GH-dependent gene expression is negatively regulated by LXR activation in hepatic cells. LXR agonist inhibits STAT5b activation by GH We have previously identifi ed two evolutionary conserved cis GAS-like elements (TTCNNNAGG) in the SOCS2 gene that bind to STAT5b and mediate GH transcriptional activity [10] . In order to better understand the effects of the LXR ligand T0901317 on GH signaling, we analyzed the activity of a luciferase reporter gene driven by the GHRE identifi ed in the SOCS2 promoter [10] . As controls, we used promoters of LXR responsive genes: ABCA1 transporter (pABCA1) and FAS (pFAS). The latter contains an SREBP1 binding site that indirectly mediates LXR actions. As shown in Figure 2 C, GH stimulates the luciferase activity of pSOCS2 while 6 and 24 h treatment with the LXR agonist resulted in inhibition of this effect, while stimulating its targets pABCA1 and pFAS. This fi nding suggests that the mechanisms of LXR mediated inhibition of GH signaling involve the regulation of STAT5b activity. Having demonstrated the antagonistic effect of the LXR ligand T0901317 on STAT5b mediated transcription, we next analyzed its effects on GHR signaling. Firstly, we analyzed GH activation of STAT5b in BRL-4 cells treated with the LXR and RXR agonists, alone or in combination. As observed in Figure 3 A, GH treatment increased STAT5b phosphorylation, but had minor effects on SREBP1 protein precursor levels. On the other hand, treatment with either the LXR or RXR agonist did not alter basal STAT5b phosphorylation levels, but led to an increased level of SREBP1, an effect that was further enhanced by the combined treatment. In this setup, pretreatment with either the RXR or LXR agonist, or the combination of both, signifi cantly decreased the levels of STAT5b in the presence of GH, while the amount of active (phosphorylated) STAT5b was only signifi cantly affected by the combined treatment. In order to explore the wider relevance of these fi ndings, we analyzed the effects of LXR and RXR agonists in human primary hepatocytes, which express high GH receptor levels endogenously. As shown in Figure 3 B, treatment with LXR and RXR agonists enhanced the expression of premature and mature forms of SREBP1 protein. After 30 min of GH treatment, we observed reduced levels of total and phosphorylated STAT5b as well as GHR in cells treated with the LXR and RXR agonists, as compared with cells treated with vehicle control. To confi rm our fi ndings, we analyzed the effects of another LXRspecifi c, but weaker, agonist GW3965 [16] . As can be seen in Figure 3 C, GW3965 treatment of BRL-4 cells increased SREBP1 expression and decreased STAT5b protein levels, similar to the effects observed for T0901317. SREBP-1 downregulates SOCS2 promoter activity The effects of the LXR ligand T0901317 on GH induction of SOCS2 expression, coincide with the elevated expression of SREBP1a, suggesting the involvement of this transcription factor in the negative regulation of SOCS2 gene transcription at the promoter level. Therefore, we tested the infl uence of SREBP1a overexpression on the activity of the SOCS2 promoter. The luciferase-driven SOCS2 promoter was transiently co-transfected in BRL-4 cells, with different concentrations !"#$%&'('#()#$(*)(+(,-./$0(12345(678(9*7830:#(;,-./$0(12345(678(9*7830:#< =$'&72'3:-'76(+(>?@5>A5>5@@A B#C28#-6(B-'7(+(@D>AD>@(>EFG(HI RESUMEN La función más conocida y plenamente estudiada de la Hormona de Crecimiento (GH) es la de regular el crecimiento longitudinal postnatal pero también puede afectar a un amplio rango de procesos biológicos tales como el metabolismo y la inflamación. Las acciones de la GH son mediadas, predominantemente, por la ruta de señalización Janus Quinasa (JAK)/ Transductor de la Señal y Activador de la Transcripción (STAT). Esta ruta es regulada, mediante retroalimentación negativa, por la familia de los Supresores de la Señalización de Citoquinas (SOCS). Los ratones carentes de SOCS2 (SOCS2-/-) son un 40% más grandes que los animales de control debido al incremento en la sensibilidad a la GH. Este fenotipo evidencia el importante papel que desempeña SOCS2 como modulador de la señalización de GH. En esta tesis, nuestro principal objetivo fue el de ampliar el conocimiento sobre el metabolismo hepático y su relación con el eje GH-SOCS2. La Hormona Tiroidea (TH) exhibe la mayoría de sus efectos a través de su interacción con el Receptor de TH (TR), el cual a su vez puede unirse al Elemento de Respuesta a la TH (TRE) localizado en varios genes diana, tales como el gen de la GH. Por ello, primero estudiamos como el Hipotiroidismo Congénito (CH) podría dejar su huella en el programa de expresión génica hepático en la edad adulta. A tal fin, se trató a ratas embarazadas con la droga anti-tiroidea Metimazol (MMI) para inducir el CH en su descendencia masculina. Desde la segunda semana de vida se comenzaron a apreciar defectos en el crecimiento, evidenciados por la reducción del peso corporal y de la longitud de la cola. Una vez que el tratamiento con MMI fue retirado, la eficiencia alimentaria se vio incrementada, acompañada de una compensación en el crecimiento, pero los animales no consiguieron recuperase por completo en términos de masa corporal, longitud de la cola y niveles del Factor de Crecimiento Insulínico 1 (IGF-1). En cambio, los genes diana de la GH, tales como SOCS2, aparecieron inducidos y las ratas con CH mostraban cambios significativos en la expresión hepática de genes relacionados con el metabolismo de los lípidos, incluyendo una transcripción aumentada de la señalización de Receptor Activado por Prolliferadores del Peroxisoma (PPAR) ! y una expresión reducida de genes involucrados en la absorción de colesterol y ácidos grasos, la expulsión celular de esteroles, el ensamblaje de Triglicéridos (TG), la síntesis de ácidos biliares, y la lipogénesis. Esos cambios se asociaron con una disminución de los lípidos intrahepáticos. A pesar de ser eutiroideos, los animales CH adultos mostraron un perfil transcripcional modificado en el hígado el cual podría explicarse por una respuesta tisular alterada a la sustitución hormonal con TH o GH. A continuación, usando un modelo de ratones SOCS2-/-, enfocamos nuestra investigación sobre el papel que SOCS2 pudiera desempeñar en el metabolismo hepático. Los ratones SOCS2-/- y sus animales de control fueron alimentados durante 4 meses con una dieta normal o una Dieta Alta en Grasa (HFD), y seguidamente se midieron la sensibilidad a insulina, el contenido hepático de lípidos, y la expresión de citoquinas inflamatorias. Los ratones SOCS2-/- exhibían un incremento en la secreción hepática de TG de un 77.6%, un descenso en los niveles de TG acumulados en el hígado del 49,3%, y se encontraban protegidos contra la esteatosis hepática inducida por la HFD. En contraste, encontramos que la atenuación en la sensibilidad sistémica a insulina producida por la HFD era más marcada en los ratones SOCS2-/-. Los hígados de los ratones SOCS2-/- alimentados con HFD mostraban un incremento en la actividad del Factor Nuclear "B (NF-"B) al igual que una expresión elevada de los genes que codifican las citoquinas inflamatorias Interferón (IFN)-! e Interleucina (IL)-6. También se demostró un rol inhibitorio de SOCS2 sobre la señalización de los Receptores de tipo Toll (TLR) 4 en macrófagos procedentes de los ratones SOCS2-/-. El papel regulador de la GH sobre el metabolismo lipídico y la sensiblidad a la insulina nos hizo cuestionarnos cuales de las acciones fisiológicas que son atribuidas a otras rutas metabólicas podrían ser explicadas por su interferencia con la señalización de GH. La activación del Receptor X Hepático (LXR) puede causar esteatosis lipídica hepática en animales de experimentación, una situación similar a la encontrada en ausencia del Receptor de GH (GHR) en el hígado. Por ello, finalmente analizamos cuales de las acciones de la ruta de LXR podrían involucrar su interacción con la señalización de GH. Los agonistas de LXR disminuyeron la señalización de GH en los hepatocitos y atenuaron la inducción de GH sobre los niveles de mRNA de SOCS2, SOCS3 y la Proteína SH2 Inducida por Citoquinas (CIS) en células BRL-4. Asimismo, la actividad de un vector reportero de luciferasa, conducido por el Elemento de Respuesta a GH (GHRE) del gen de SOCS2, fue inhibida por el tratamiento simultáneo con los agonistas de LXR. El efecto inhibitorio de la activación del LXR sobre la señalización de GH pudo ser reproducido en las células hepáticas mediante la sobre expresión de las Proteínas de Unión al Elemento de Regulación de Esteroles (SREBP) 1 y 2, dos factores regulados por LXR. En ambos casos, los niveles totales y fosforilados de la proteína STAT5b aparecieron significativamente reducidos. Un ensayo de unión al ADN demostró que SREBP1 se une al E-box localizado en la región promotora del gen de SOCS2 pero no compite con la unión de STAT5b a un sitio cercano del mismo promotor. En conclusión, en este trabajo hemos proporcionado evidencias de que una condición inhibitoria del crecimiento, tal como el CH, causa una influencia perdurable en el transcriptoma del hígado y provoca una respuesta hormonal alterada en la edad adulta; hemos identificado a SOCS2 como un importante regulador de la homeostasis hepática en respuesta al estrés producido por una dieta alta en grasa, y hemos desvelado su papel antiinflamatorio como regulador negativo de la señalización de TLR4; y hemos probado el efecto inhibitorio de la activación del LXR sobre la señalización de GH, un efecto mediado por las proteínas SREBP, a través de la represión de la transcripción génica de STAT5b y de la estimulación de su degradación proteica. CONTENIDOS .................................................................................................................INTRODUCCIÓN!115 ..........................................................................................La Hormona de Crecimiento!115 ......................................................................................................................Estructura!115 ......................................................................................................................Secreción!116 ....................................................................................................................Regulación!116 .................................................................El Receptor de la Hormona de Crecimiento!118 ......................................................................................................................Estructura!118 .......................................................La proteína de unión a la hormona de crecimiento!119 ...........................................................................................................Expresión génica!119 La Señalización de la Hormona de Crecimiento y el Receptor de la Hormona de .....................................................................................................................Crecimiento!121 .........................................La dimerización del receptor de la hormona de crecimiento!121 La unión de la hormona de crecimiento, la rotación del receptor y la activación de las ..............................................................................................quinasas citoplasmáticas!121 .......................................Los transductores de señal y activadores de la transcripción!122 .............La Regulación Negativa de la Señalización de la Hormona de Crecimiento!125 ...................................................Inhibición del receptor de la hormona de crecimiento!125 ...................................................................................La ruta ubiquitina-proteosoma!125 ...............Internalización y degradación del receptor de la hormona de crecimiento!126 .........................................................Los supresores de la señalización de citoquinas!126 .....................................................El papel fisiológico de la Hormona de Crecimiento!129 ..................................................................................................Crecimiento post-natal!129 ..................................................................................................................Metabolismo!130 ...............................................................................................Inflamación e inmunidad!131 .............................................................................................OBJETIVOS DE ESTA TESIS!133 .....................................................................................METODOLOGÍA Y RESULTADOS!134 La influencia del hipotiroidismo neonatal sobre la expresión génica hepática y el .........................................................................metabolismo lipídico en la edad adulta!134 La deleción de SOCS2 protege contra la esteatosis hepática pero empeora la ..............resistencia a insulina en ratones alimentados con una dieta alta en grasa!137 El agonista del receptor X del hígado inhibe la señalización hepática de la hormona .................................................................................................................de crecimiento!139 .......................................................................................................DISCUSIÓN GENERAL!141 ..........................................................CONCLUSIONES Y PERSPECTIVAS DE FUTURO!146 ...................................................................................................................BIBLIOGRAFÍA!148 INTRODUCCIÓN La Hormona de Crecimiento La Hormona de Crecimiento (GH) es el factor principal de eje somatotrópico implicado en la promoción del crecimiento longitudinal de los mamíferos [1]. También presenta otros efectos de importancia tales como la modulación del metabolismo de lípidos, glucosa, nitrógeno y minerales. Ciertamente, promueve la lipólisis, la absorción de aminoácidos y la síntesis proteica, y reduce la descomposición de las proteínas [2]. La GH actúa de manera simultánea como un factor de crecimiento autocrino y paracrino para regular la proliferación, la apoptosis, la diferenciación y la quemostasis en varios tipos celulares procedentes de diferentes tejidos [3]. Es también importante para el mantenimiento del sistema inmune [4] y el desarrollo cardiaco [5], y en el cerebro puede modular las emociones, la respuesta al estrés y el comportamiento [6]. Estructura En 1944, la hormona fue aislada por vez primera a partir de pituitarias bovinas [7]. No sería hasta 1956 cuando la GH humana (hGH) fue aislada y, cuatro años más tarde, empleada como tratamiento en niños deficientes de GH [8]. En 1979, el cDNA que codifica la hGH fue clonado [9] y su estructura cristalina fue resuelta en 1987 [10]. El gen de la hGH mide 3 Kb aproximadamente y se localiza en el cromosoma 17. Este gen es parte de un grupo de cinco genes estrechamente relacionados entre si los cuales presentan más de un 92% de homología en su secuencia de nucleótidos [11]. La principal forma circulante de la molécula es la GH Normal (GH-N), una proteína de 22 KDa que puede dar lugar, por empalme genético alternativo, a una variante de 20 KDa (GHV) que difiere en 13 aminoácidos [12]. Otras dos formas, de 27 KDa y 17KDa, también se encuentran presentes en el plasma pero su papel fisiológico aún no ha quedado claro [13]. Los 191 aminoácidos de la estructura de la GH-N comprenden cuatro !-hélices largas antiparalelas separadas por bucles de conexión y ordenadas en una configuración arribaarriba-abajo-abajo, de manera similar a otros miembros de la familia de los Péptidos Empaquetados en Hélice (HBP) la cual incluye también a la Prolactina (PRL), el Lactógeno Placentario (PL), y varios otros factores de crecimiento [14]. Las hélices 1, 2, 3 y 4 se encuentras localizadas entre los residuos de cisteína 9-34, 72-92, 106-128 y 155-184, respectivamente [15]. La hGH presenta un núcleo central hidrófobo, compuesto de 20 aminoácidos y cuatro residuos de cisteína [16] los cuales se encuentran conservados en las diferentes especies de vertebrados [17, 18]. Los cuatro residuos de cisteína forman dos puentes de disulfito: uno entre Cys53 y Cys165, resultando en un bucle largo, y el otro entre Cys182 y Cys189. A pesar de que la ruptura del bucle corto no afecta ni a la secreción ni a la actividad biológica de la GH, la ruptura del bucle largo provoca una clara reducción en su secreción, así como en su actividad y su capacidad de unión [19]. Resumen en castellano 115 Secreción La GH es secretada por las células somatotrópicas de la glándula pituitaria anterior [20]. Es la hormona más abundante de todas las hormonas secretadas por esa glándula y su síntesis y liberación están regulados por dos péptidos hipotalámicos: la Hormona Liberadora de GH (GHRH), un factor estimulador, y la Somatostaina (SRIH), un inhibidor de su secreción. Ambos factores son sintetizados por las neuronas endocrinas y actúan a través de receptores propios en la superficie de las células somatotrópicas [21]. Existe una miríada de hormonas y de situaciones fisiológicas que contribuyen al control de la secreción de GH, bien por regulación de la expresión o de la actividad de la GHRH y la SRIH, o bien por regulación directa de la síntesis de GH [22]. En los humanos, los niveles de GH son altos durante las dos primeras semanas de vida, caen de manera gradual y permanecen bajos en la infancia. Justo antes de la pubertad, los niveles comienzan a incrementar, alcanzando su máximo en la pubertad y, una vez más, cayendo gradualmente con la edad [23, 24]. También se sabe que el patrón de secreción de la GH difiere entre géneros. La secreción masculina es fuertemente pulsátil, mientras que en las hembras los niveles de GH son mantenidos [25, 26]. Es durante la pubertad cuando las diferencias de género emergen y dan forma a los diferentes patrones de crecimiento macho/hembra (crecimiento de los huesos y los músculos, distribución de la grasa... ) [23]. Estos diferentes patrones de secreción son particularmente evidentes en el caso del dimorfismo sexual del metabolismo hepático [27, 28]. En las últimas dos décadas, un elevado número de publicaciones sobre la secreción de GH en tejidos extra-pituitarios han visto la luz. Existen multitud de ejemplos de células que producen GH incluyendo las neuronas [29], las células pulmonares [30], las células de la retina [31], las células óseas [32] y varias células pertenecientes al sistema inmune [33, 34]. En las células de los mamíferos, la producción de GH está involucrada en el desarrollo mamario durante la pubertad [35]. La placenta produce su propia GH-V la cual reemplaza a la GH pituitaria durante el embarazo [36]. La GH-V no es perceptible en la circulación fetal indicando su falta de efecto sobre el crecimiento del feto [37]. También, ciertas células tumorales son capaces de sintetizar tanto la GH como el Receptor de GH (GHR) [38] pero cómo se regula la síntesis y liberación de esta GH autocrina aún no se desconoce. Regulación Como se mencionó previamente, los principales responsables de la síntesis y liberación de la GH son la GHRH y la SRIH. La secreción de GH es estimulada también por la Ghrelina, un secretagogo endógeno secretado principalmente por el tracto intestinal [39]. La GH ejerce por si misma una retroalimentación negativa sobre su propia secreción mermando la producción de la GHRH y de su receptor (GHRHR), e incrementando la actividad de la SRIH [22, 40]. Los elevados niveles séricos del Factor de Crecimiento Insulínico 1 (IGF-1), producido en respuesta a la GH, inhiben la liberación de la GHRH y la GH [41]. Otras sustancias tales como la Hormona Tiroidea (TH) y los receptores de glucocorticoides, actúan directamente sobre el gen de la GH estimulando su transcripción mediante la interacción con elementos de respuesta específicos situados en el flanco 5! de su región promotora [42, 43]. El estrés, el sueño, el ejercicio, la hipoglucemia, los aminoácidos, los esteroides sexuales, los agonistas "-adrenérgicos los agonistas de los receptores de dopamina y el ayuno incrementan los niveles séricos de GH; mientras que los agonistas #- Ruymán Santana Farré 116 adrenérgicos, el glutamato, la glucosa y los Ácidos Grasos Libres (FFA) provocan una reducción de ellos [23]. Resumen en castellano 117 El Receptor de la Hormona de Crecimiento El GHR es una proteína localizada en la membrana de la superficie celular, perteneciente a la súper-familia de receptores de citoquinas del tipo I [44]. Al igual que otros miembros de la familia, el GHR carece de actividad quinasa intrínseca por lo que se sabe, desde hace tiempo, que se sirve de la Janus Quinasa (JAK) 2 como mediador de la transducción de señal [45, 46]. Sin embargo, nuevas evidencias indican que el GHR es capaz de señalizar a través de otras rutas, tales como la de la tirosina quinasa de Sarcoma (Src), independientemente de JAK2 [47, 48]. El grado de respuesta de las células diana depende de la expresión del GHR [49, 50]. El GHR se encuentra en múltiples tejidos, incluyendo músculo, hueso, riñón, glándula mamaria, tejido adiposo, y células madre embrionarias, pero sus concentraciones más altas aparecen en el hígado, específicamente en los hepatocitos. En consecuencia, la GH regula múltiples aspectos del metabolismo del hígado, incluyendo el ciclo de la urea, la síntesis de ácidos biliares, el metabolismo de colesterol y lipoproteínas, la homeostasis de la glucosa, el metabolismo de xenobióticos, etc. [51]. Estructura La existencia del GHR fue reportada por primera vez por Tsushima y Friesen en 1973 [49] pero no fue hasta 1987 cuando fue purificado, secuenciado y clonado [50]. Cinco años más tarde su dominio extracelular fue cristalizado [16]. Los 620 aminoácidos del GHR forman un dominio extracelular N-terminal de 246 aminoácidos (el lugar de unión de la hormona), un dominio transmembrana de 24 aminoácidos, y un dominio intracelular de 350 aminoácidos que contiene la región C-terminal. El dominio extracelular del GHR contiene dos subdominios de fibronectina tipo III separados por una región bisagra de cuatro aminoácidos [52]. Ambos subdominios se pliegan en una hoja-! antiparalela, compuesta de siete hebras-! [16]. El subdominio 1 presenta cinco sitios potenciales de glicosilación [50] y seis residuos de cisteína conformando tres puentes de disulfito [53]. La GH se une al receptor en este subdominio 1 y, aunque los sitios 1 y 2 de la molécula de GH son diferentes, estos se unen a los mismos residuos en el GHR. El subdominio 2 contiene una interfaz donde dos GHR interactuan. Aquí, un tándem de aminoácidos conectan residuos similares en los GHR opuestos empleando puentes salinos y puentes de hidrógeno formando el llamado dominio de dimerización [54, 55]. Este domino, se supone, está involucrado en la dimerización y estabilización del complejo GH-GHR [56] pero otros estudios han demostrado que esos residuos pueden ser mutados sin afectar la dimerización del receptor [57]. El subdominio 2 contiene también el motivo homólogo del triptófano-serina-X-triptófano-serina (WSXWS), el motivo tirosina-glicina-isoleucinafenilalanina-serina (YGEFS) [52, 58]. Mutaciones en esta región provocan una baja afinidad de unión por el ligando y disminuyen la señalización [56, 59]. Finalmente, cerca de la región transmembrana, el dominio extracellular contiene un residuo desapareado de cisteína el cual se sugiere está involucrado en la estabilización del GHR dimerizado mediante puentes disulfito intermoleculares. Pero una vez más, la mutación de este residuo no afecta la dimerización o la fosforilación del complejo [57]. El dominio transmembrana del GHR es un segmento hidrófobo que atraviesa la membrana a modo de hélice [60]. La estructura cristalina reveló la organización del dominio extracelular del GHR, pero la topología exacta de la región intracelular aún se desconoce. El dominio intracelular contiene nueve residuos de tirosina, los cuales son fosforilados Ruymán Santana Farré 118 cuando el GHR es activado. Existen dos sitios importantes en la cola intracelular del GHR. El primero de ellos, llamado Box-1, se encuentra entre los aminoácidos 280 y 287, y está presente en muchos de los miembros de la familia de receptores de citoquinas. Esta región es una Secuencia Rica en Prolina (PPVPVP), esencial para la transdución de señal [61]. El segundo dominio conservativo, conocido como Box-2, está menos definido. Está compuesto por residuos hidrófobos y con carga [62] y contiene un motivo de Endocitosis dependiente de la Ubiquitina (UbE). Este motivo, compuesto por los aminoácidos DSWVEFIELD y localizado entre las posiciones 322 y 331, es importante para la internalización y posterior degradación del GHR [63]. Finalmente, el dominio intracelular contiene un motivo DSGFXS similar al involucrado en la degradación de los receptores de PRL e Interferón (IFN) pero queda claro que este escenario difiere en el caso del GHR ya que las mutaciones en esta región no afectan a la endocitosis del GHR [64]. La proteína de unión a la hormona de crecimiento En humanos, en la superficie celular, el dominio extracelular del GHR puede sufrir una rotura proteolítica. Dicho proceso, conocido como shedding, da como resultado una forma soluble circulante que puede ser medida en sangre [65]. Este ectodominio separado es llamado Proteína de unión a la GH (GHBP). En roedores, la GHBP es generada por empalme genético alternativo [66]. La GHBP aún puede unirse a GH y al menos el 50% de la GH circulante se encuentra formando complejo con esta proteína de unión de alta afinidad [67]. Varios estudios indican que la formación de dicho complejo puede tener efectos tanto positivos como negativos sobre las acciones de GH. Por un lado, incrementa la vida media de la GH previniendo su aclaramiento renal, ya que el complejo es demasiado grande para la filtración glomerular. Por el contrario, la GHBP actúa como un inhibidor al competir por la unión del ligando con el GHR de la membrana celular y mediante la formación de heterodímeros de GHR/GHBP que no son capaces de señalizar. La GHBP también reduce la disponibilidad de GHR intactos en la superficie de la célula como efecto indirecto del fenómeno de proteólisis [68]. La función exacta de la GHBP aún no es clara; puede funcionar como un amortiguador que normaliza las oscilaciones de la GH libre en la sangre, o puede servir como una reserva de GH prolongando la biodisponibilidad de GH y mejorando sus acciones. Expresión génica El GHR está presente en casi cada célula a lo largo del cuerpo pero, sin embargo, sus niveles presentan grandes variaciones individuales, temporales y específicas de cada tejido. El primer tejido en que se reconoció la respuesta a GH fue el hígado, principalmente debido a la elevada cantidad de GHR presentes en las células hepáticas [69]. Empleando técnicas más sensitivas, ha sido posible cuantificar la cantidad de este receptor en un amplio rango de tejidos extrahepáticos tales como músculo, hueso, riñón, glándula mamaria, adipocitos y células madre embrionarias [70]. El GHR también ha sido localizado en el cerebro [71] y en el sistema inmune [72]. La expresión del GHR crece en concordancia con la edad postnatal, siendo máxima en la pubertad, pero los factores que controlan la regulación de su expresión son poco conocidos. La síntesis del GHR se supone inversamente correlacionada con los niveles pulsátiles de GH [73]. En contraste, los tratamientos crónicos con GH incrementan la unión de la GH en Resumen en castellano 119 el tejido hepático [74, 75]. Existen múltiples factores que influencian la expresión del GHR bien a nivel transcripcional o translacional. Estos incluyen, entre otros, el nivel de desarrollo y el estado fisiológico, la malnutrición, la obesidad y el ayuno, el fallo renal, la diabetes y la falta de glucosa [58, 76, 77]. Los corticosteroides, la testosterona, el estradiol, el receptor de estrógeno, y, a través de estas últimas sustancias, el embarazo, influyen sobre los niveles de GHR [78]. Del mismo modo, varios mecanismos específicos de un tejido/célula controlan la transcripción del mRNA del GHR [3]. La mayoría de los reguladores del GHR son también determinantes de la dinámica secretoria de GH [73]. Es importante mencionar que los estudios referentes a la regulación del GHR, particularmente por GH e insulina, pueden ser a menudo contradictorios. Esto se debe a los diferentes tipos de célula o tejido empleados y/o a la dosis y tiempo de exposición a GH analizados. Ruymán Santana Farré 120 Los niveles de SOCS se encuentran constitutivamente bajos pero son rápidamente inducidos por la estimulación de diferentes citoquinas y factores de crecimiento [177, 178]. Su diana principal es la ruta JAK/STAT por lo que regulan la acción de múltiples citoquinas. Los efectos de SOCS sobre dicha ruta quedan claramente demostrados por la reducción en la fosforilación de JAK y STAT, del mismo modo que por la reducción de la dimerización de STAT, su translocación al núcleo y su actividad transcripcional [170, 171, 179]. La promiscuidad y la redundancia son dos rasgos notables de las proteínas SOCS cuando son testadas in vitro. Cada SOCS puede ser inducida por múltiples citoquinas y, a posteriori, actuar sobre varios receptores de citoquina, no necesariamente aquellos que indujeron su expresión. Esta situación de cruzamiento complica la adquisición de conocimientos sobre el significado biológico de sus acciones inhibitorias. Afortunadamente, el análisis de ratones genéticamente modificados ha vertido luz sobre algunos de los papeles pato-fisiológicos esenciales de las proteínas SOCS. Los miembros de la familia SOCS inhiben la señalización de citoquinas mediante varios mecanismos los cuales no son mutuamente excluyentes. Pueden actuar como (a) inhibidores de la actividad quinasa intrínseca de JAK, (b) competidores por la unión de reguladores positivos mediante asociación con los receptores activados, y (c) parte del complejo ubiquitina ligasa marcando proteínas para su posterior degradación por el proteosoma. La GH induce la expresión de CIS, SOCS1, SOCS2 y SOCS3 en varios grados y con diferentes cinéticas [180-182]; todas las cuales han demostrado acciones negativas sobre el GHR cuando se han sobre-expresado en líneas celulares [180, 183, 184]. Generalmente, la expresión de CIS, SOCS1 y SOCS3 es inducida rápidamente tras la estimulación de GH pero es transitoria, mientras que la expresión de SOCS2 incrementa de manera constante. La sobre-expresión de SOCS1 y SOCS3 provoca una inhibición total de la señalización dependiente de GH, mientras que SOCS2 y CIS solo producen efectos parciales [180, 183, 184]. Cada uno de los miembros de SOCS presenta diferentes mecanismos de acción sobre la señalización de GH. SOCS1 se une a JAK2 fosforilado, con alta afinidad, en su tirosina 1007 a través de su dominio SH2 [172, 185, 186] y bloquea la actividad quinasa de JAK2 a través de su motivo KIR [185], previniendo el acceso de otros substratos a JAK2. SOCS1 induce también la degradación de JAK2 en el protesoma via su dominio SOCS box [187]. SOCS3 se une al GHR en sus residuos fosforilados de tirosina 333, 338 [184] y 487 [183], sugiriendo una inhibición de la unión de STAT5. SOCS3 es también capaz de unirse a JAK2 [188] y, de manera similar a SOCS1, inhibir su actividad quinasa a través de su región KIR. Es reseñable que SOCS1 también puede unirse al GHR pero, en este caso, no necesita que el receptor se encuentre activado [183, 184]. CIS se une a una región aún desconocida del GHR usando su dominio SH2 y probablemente compitiendo por la unión con las proteínas STAT [184, 189, 190]. Adicionalmente, CIS puede promover la degradación protesomal de GHR/JAK [191, 192]. SOCS7 es capaz de interactuar con las proteínas STAT ya activadas, una variación novedosa de los mecanismos clásicos de inhibición de las proteínas SOCS [193]. SOCS2 presenta un efecto dual sobre la activación de STAT5 inducida por GH in vitro: inhibición a bajas concentraciones y estimulación cuando se expresa a altas concentraciones [180]. No está claro si SOCS2 se une a JAK2, pero si que se une directamente al GHR fosforilado en sus residuos de tirosina 487 y 595, sugiriendo la Resumen en castellano 127 inhibición de la unión de STAT5 [194, 195]. Otra posibilidad es que SOCS2 actúe en la señalización de IGF-1 [196] o que actúe como una ligasa E3 para la degradación de GHR [195]. Los mecanismos de acción de SOCS2 aún no son del todo conocidos. El fenotipo de los ratones SOCS2!/! identifica a SOCS2 como el principal mediador fisiológico de la regulación negativa de la señalización de GH [197]. Los ratones SOCS2!/! son un 30-40% mayores que sus controles, siendo la ganancia de peso debida a un incremento en el tamaño de los huesos y a un crecimiento proporcionado de la mayoría de los órganos [198]. Se han encontrado también fenotipos similares en animales que sobre-expresan la GH [199], en pacientes con gigantismo [200], y en ratones con alto crecimiento, los cuales presentan una deleción espontánea del cromosoma 10 resultando en una disrupción e inactivación del locus de SOCS2 [201]. Ruymán Santana Farré 128 El papel fisiológico de la Hormona de Crecimiento Crecimiento post-natal A pesar de que varias hormonas y factores de crecimiento participan de manera importante en el normal crecimiento post-natal, la GH es considerada el regulador endocrino central a este respecto [202]. El papel crucial de la GH sobre el crecimiento longitudinal se hace evidente por el descenso en un 50% de peso observado en ratones GHR-/- [203], el descenso de un 60% observado en ratones GHRH-/- [204, 205], y la marcada reducción de crecimiento post-natal mostrada por los animales hipofisectomizados [206]. Una cuestión ampliamente discutida es aquella que plantea si los efectos de GH sobre el crecimiento post-natal son directos sobre los tejidos diana o mediados por un factor de crecimento derivado del hígado. En 1957, el grupo de Salmon y Daghaday postuló la hipótesis de la somatomedina la cual afirmaba que la GH induce el crecimiento esquelético mediante la estimulación de la producción hepática de una sustancia intermediaria de la señalización [207]. Esta sustancia, inicialmente llamada factor sulfactante pero posteriormente renombrada como somatomedina [208], fue finalmente identificada como IGF-1 [209]. Los ratones IGF-1-/- presentan una reducción en el crecimiento de un 60% en comparación con sus controles indicando la importancia de IGF-1 para el crecimiento longitudinal [210]. Sin embargo, la hipótesis original de la somatomedina ha sido sometida a revisión a través de los años. Varios estudios sobre ratas hipofisectomizadas y ratones deficientes de GH han confirmado un rol estimulador de la GH sobre la producción de IGF-1 local en múltiples tejidos extrahepáticos, tales como el músculo, el hueso y la grasa [211]. La inactivación específica de IGF-1 en el hígado resulta en una sustancial reducción de los niveles séricos de IGF-1 sin afectar al crecimiento corporal [212, 213]. Una explicación potencial para esta observación es que el IGF-1 circulante restante podría estar más disponible, y por lo tanto, ser suficiente para el crecimiento esquelético, pero varios hallazgos han demostrado que el IGF-1 circulante tiene poco o ningún efecto en el crecimiento, mientras que la producción local de este factor es probablemente la responsable de las propiedades promotoras del crecimiento de IGF-1 [214-216]. Un importante estudio que compara el tamaño del cuerpo de ratones GHR-/-, ratones IGF-1-/-, y ratones con doble deleción de ambos genes, estableció efectos independientes de IGF-1 para la GH sobre el crecimiento corporal. Los fenotipos observados permiten estimar que un 17% de la tasa de crecimiento post-natal puede ser atribuida a procesos sin relación con GH e IGF-1, un 35% está directamente asociada con efectos de IGF-1 independientes de GH, un 14% a efectos de GH independientes de IGF-1, y el restante 34% a acciones de GH mediadas por IGF-1 [217]. Finalmente, la comparación de ratones deficientes de GH con ratones IGF-1-/- reveló que GH contribuye más al crecimiento longitudinal óseo que IGF-1 durante la pubertad [218]. SOCS2 es un regulador negativo de la señalización de GH y juega un importante rol en la regulación del crecimiento post-natal inducido por ella. Los ratones SOCS2-/- exhiben un crecimiento excesivo que comienza tras el destete. Esos animales son magros y el sobrepeso observado está asociado con un incremento significativo de los huesos largos y un aumento proporcionado de la mayoría de los órganos. No aparece elevación de los niveles sistémicos de IGF-1 pero su expresión local está incrementada en varios órganos [198]. La doble deleción de SOCS2 y STAT5b y el cruzamiento de ratones SOCS2-/- con ratones deficientes de GHRH hace desaparecer el fenotipo original y confirma que las Resumen en castellano 129 alteraciones del crecimiento observadas se deben a una sensibilidad a GH incrementada [197, 219]. Al contrario de los esperado, los ratones transgénicos de SOCS2 también muestran un crecimiento aumentado y algunos experimentos in vitro revelan un comportamiento dual de SOCS2 como regulador de GH [220]. Bajos niveles de SOCS2 provocan inhibición de los efectos de GH mientras que niveles elevados causan una estimulación de la señalización. Se sugiere que esto puede ser debido a la inhibición de otras proteínas de la familia SOCS, específicamente SOCS1 y SOCS3, mediada por SOCS2 [221-223]. Metabolismo La GH presenta efectos diversos y pleiotrópicos sobre el metabolismo de carbohidratos, lípidos, proteínas, nitrógeno y minerales [224]. Juega un papel importante en el metabolismo hepático, el órgano con mayor expresión de su receptor GHR, pero también desempeña acciones metabólicas en otros tejidos tales como músculo, hueso y grasa. En el músculo, las acciones de GH son anabólicas. Estimula la síntesis de proteínas, aumenta la absorción de aminoácidos y disminuye la excreción de nitrógeno [225, 226]. Mediante la promoción de la lipolisis en el tejido adiposo y de la mobilización de lipidos hepáticos, la GH incrementa los FFA circulantes promoviendo su utilización en el músculo a expensas de la glucosa. Este proceso lleva a hiperglicemia y a un descenso de la sensibilidad a la insulina, razón por la cual a la GH se le consideran propiedades diabetogénicas. De hecho, la deleción específica del GHR en músculo protege contra la resistencia insulínica inducida por una dieta alta en grasa. El mecanismo exacto tras este fenotipo no está claro pero podría ser atribuido a un descenso de las acciones diabetogénicas de la GH sobre el músculo [227]. En el tejido adiposo, la actividad de la GH tiene una profunda influencia sobre el metabolismo de los adipocitos. Promueve la lipólisis y bloquea la acumulación de Triglicéridos (TG) en las células adiposas mediante inhibición de la lipoproteina lipasa [228]. Este proceso lleva a un incremento en los niveles circulantes de FFA y glicerol. De hecho, un único pulso exógeno de GH es capaz de producir un incremento marcado de los niveles sanguíneos de FFA y glicerol [229], así como un incremento dosis-dependiente del ratio de oxidación de los lípidos [230]. Esto queda demostrado por la reducción de la grasa corporal (y la severa resistencia a insulina) observada en los ratones transgénicos de GH [231]. Los pacientes adultos deficientes de GH desarrollan característicamente obesidad abdominal [232], y la deleción de GHR en el tejido adiposo en ratones lleva a un incremento del doble de masa grasa, pero no provoca efectos en la homeostasis de la glucosa [233]. En el hígado, la GH promueve la gluconeogénesis y la glicogenolisis y reduce la absorción de glucosa. Además, induce la absorción de TG, promueve la lipogenesis, inhibe la lipólisis e incrementa la salida de lípidos de las células hepáticas [234]. Los ratones con deleción específica de GHR en el hígado exhiben una secreción de lípidos hepáticos reducida, resistencia a insulina y desarrollan de manera espontánea esteatosis hepática [235]. En contraste con los efectos diabetogénicos de la GH, IGF-1 mimetiza las acciones de la insulina y produce hipoglucemia mediante un incremento selectivo de la absorción de glucosa, inhibe la gluconeogenesis e incrementa la adipogénesis [236, 237]. Esto indica que, además de actuar como mediador de las acciones promotoras del crecimiento de la GH, IGF-1 también contrarresta sus efectos diabetogénicos perjudiciales. De hecho, la Ruymán Santana Farré 130 inactivación específica del IGF-1 hepático resulta en elevados niveles de GH e insulina, hiperplasia de los islotes pancreáticos y resistencia a insulina en el hígado, el músculo y el tejido graso [238]. La inhibición de las acciones de la GH en esos animales mejora la sensibilidad a insulina en el hígado [239]. Inflamación e inmunidad Más allá de sus acciones sobre el crecimiento post-natal y el metabolismo, la GH también juega un importante papel en la regulación del sistema inmune. La GH presenta varias acciones biológicas sobre las células inmunes: incrementa la timopoyesis y el desarrollo de las células T, modula la producción de citoquinas, incrementa el desarrollo de las células B y la producción de anticuerpos, moviliza a los neutrófilos y los monocitos para la secreción aniónica de superoxido, aumenta la adhesión de los neutrófilos y la migración y las acciones anti-apoptóticas de los monocitos [240]. El GHR se expresa en todos esos tipos celulares, lo que sugiere la clara implicación directa de los efectos de la GH en las funciones inmunológicas. Interesantemente, todas esas células también expresan la GH, lo que implica la importancia de una secreción hormonal paracrina y autocrina en la respuesta inmune. Los mecanismos de acción intracelulares de la GH derivada de las células inmunes es un área poco explorada, por lo que futuros trabajos podrían desvelar un papel importante para esta fuente de GH tanto en condiciones normales como patológicas [241]. En ratones, la sobre-expresión transgénica de GH altera la función de las células T y reduce la produccuón de citoquinas [242]. Los ratones GHR-/- muestran niveles elevados de citoquinas pro-inflamatorias y niveles reducidos de citoquinas antinflamatorias. Como la inflamación está vinculada a la obesidad y la resistencia a insulina, es posible que los efectos de la GH sobre esos procesos somáticos pudieran estar mediados, al menos en parte, por sus acciones sobre el sistema inmune [243]. La GH ha demostrado promover la producción de citoquinas pro-inflamatorias tales como IL-1!, IL6 y el Factor de Necrosis Tumoral (TNF) ! en las células inmunes tanto in vitro [244] como in vivo [245]. Un estudio sobre pacientes críticos demostró que el tratamiento con GH incrementa la morbilidad y la mortalidad, probablemente a través de la modulación de la función inmune [246], y niveles altos de GH y bajos de IGF-1 están vinculados al shock séptico [247, 248]. Sin embargo, otros estudios han encontrado que el tratamiento con GH, in vivo e in vitro, tiene un efecto inhibidor sobre la producción de citoquinas pro-inflamatorias [249, 250]. Estos hallazgos contradictorios desvelan la necesidad de más investigaciones para comprender los mecanismos exactos involucrados. SOCS1 y SOCS3 son inducidos por diversos mecanismos en los macrófagos en respuesta al producto microbiano y podrían ser responsables de la supresión de la señalización de JAK/STAT [251]. La activación del Receptor del tipo Toll (TLR) 4 por Lipopolisacáridos (LPS) induce la expresión de SOCS1 y la sensibilidad de los ratones deficientes de SOCS1 a dosis subletales de LPS es dependiente de STAT1, lo que sugiere que SOCS1 podría regular ambas rutas de señalización de la respuesta inmune, TLR e IFN [252, 253]. Los ratones con una deleción condicional del gen de SOCS3 en las células hematopoyeticas y endoteliales mueren como jóvenes adultos debido a lesiones inflamatorias severas en el peritoneo y la cavidad pleural [254]. En pacientes con artritis reumatoide, los niveles de SOCS3 están elevados [255], y pacientes con colitis ulcerativa y enfermedad de Crohn también muestran niveles elevados de SOCS3 [256], sugiriendo un rol regulatorio para SOCS3 en dichas enfermedades. Finalmente, la degradación proteosomal del Factor Resumen en castellano 131 Asociado al Receptor de TNF (TRAF) 6 inducida por SOCS2 es un mecanismo de importancia en la mediación de las acciones antinflamatorias de las lipoxinas inducidas por la aspirina [257]. Ruymán Santana Farré 132 OBJETIVOS DE ESTA TESIS La meta principal de este estudio fue la de extender el conocimiento a cerca del metabolismo hepático y de su relación con la ruta de señalización de la GH, en particular con su regulador negativo la proteína SOCS2. Con tal fin, se plantearon los siguientes objetivos específicos: 1. Evaluar la influencia del hipotiroidismo congénito, una condición inhibidora del crecimiento, sobre el eje somatotrópico, el transcriptoma del hígado y el metabolismo lipídico hepático en la edad adulta (Artículo I). 2. Investigar el papel fisiológico de SOCS2 en el metabolismo hepático bajo condiciones de estrés dietético (Artículo II). 3. Proveer de nuevas evidencias a cerca de la relación existente entre las rutas metabólicas de LXR y de GH en los hepatocitos (Artículo III). Resumen en castellano 133 METODOLOGÍA Y RESULTADOS La influencia del hipotiroidismo neonatal sobre la expresión génica hepática y el metabolismo lipídico en la edad adulta La TH es imprescindible para el desarrollo, el crecimiento y el metabolismo [234, 258, 259]. Muchos de los efectos de TH resultan de su interacción con el Receptor de TH (TR), el cual puede unirse al Elemento de Respuesta a TH (TRE) localizado en varios genes diana [258], tales como el gen de la GH [260]. La expresión de la GH es inducida por la TH y se ve reducida bajo el estado de hipotiroidismo [261-263]. De hecho, los efectos promotores del crecimiento producidos por la TH pueden ser explicados, en su gran mayoría, por su habilidad para inducir la secreción normal de GH y regular los patrones de expresión de GHR en el hígado y del Recetor de IGF-1 (IGF-1R) en los tejidos periféricos [264]. Por lo tanto, la TH puede ejercer sus acciones fisiológicas en el hígado de dos maneras, a través de la regulación directa de la transcripción de genes diana y mediante otros mecanismos indirectos, tales como la modulación de la ruta de la GH. La relevancia fisiológica de la TH se hace evidente bajo la condición de Hipotiroidismo Congénito (CH) [259]. Durante la ontogenia, existe un periodo crítico donde se requieren niveles normales de TH por lo que, si no se trata de inmediato, el CH puede imprimir su huella de manera permanente en los sistemas neurológico y endocrino. En este contexto, la exposición a la droga anti-tiroidea Methimazole (MMI) durante el periodo fetal-neonatal se muestra como un atractivo modelo con el que evaluar la influencia que el CH ejerce sobre el eje somatotrópico y el metabolismo lipídico hepático, e investigar sus repercusiones fisiológicas sobre la sustitución hormonal en la edad adulta. Nuestra primera meta fue examinar los efectos del CH sobre la expresión génica en el hígado adulto. Tras el destete en el Día Post Natal (PND) 30, el hipotiroidismo ya estaba establecido, algo que quedó demostrado por los bajos niveles de T3 circulante y los elevado niveles de TSH observados en el grupo CH. Adicionalmente, los niveles de IGF-1 estaban reducidos en un 55% y los niveles de mRNA de la Enzima Málica (ME) y Spot14, dos genes regulados positivamente por TH [258], aparecían inhibidos en esos animales. También, los animales CH presentaban niveles mas elevados de IGFBP-2 que en el grupo control (en el hígado, el patrón de expresión fetal de IGFBP-2 elevado es sustituido por el patrón adulto de bajos niveles de esta proteína solo en presencia de niveles normales de TH durante el desarrollo de la rata [265]), sustentado la presencia del hipotiroidismo neonatal en el PND30. Tras la retirada del MMI en el PND30, los animales comenzaron a recuperarse gradualmente: se pusieron al día en su crecimiento [266] y sus niveles plasmáticos de TH se normalizaron rápidamente. Interesantemente, la eficiencia alimentaria apareció significativamente elevada en las ratas con CH pero aún se observaban diferencias significativas en lo referente a la masa corporal, el largo de la cola y los niveles circulantes de IGF-1 entre CH y sus controles de edad pareados en PND80, indicando un crecimiento incompleto. Los niveles de mRNA de IGFBP-2 aún aparecían elevados en el grupo de CH en comparación con sus controles de edad pareados en PND80 pero, sorprendentemente, los niveles eran iguales al comparar las ratas con CH con sus controles de peso pareado (WP). Este descubrimiento evidencia que la sobre-expresión es consecuencia del retardo en el crecimiento en lugar de ser un efecto perdurable del CH. Ruymán Santana Farré 134 Todos estos resultados sugieren que el hipotiroidismo neonatal altera el correcto desarrollo del programa de expresión génica del hígado, lo cual puede influir las funciones hepáticas relacionadas con la GH. Para probar esta hipótesis, analizamos los niveles de mRNA de dos bien conocidos genes regulados por la GH, CIS y SOCS2, los cuales actúan como reguladores negativos de la señalización de la GH. En el PND30, los niveles de mRNA de CIS aparecieron inducidos, mientras que SOCS2 permaneció sin cambio. Sin embargo, en el PND80, ambos genes aparecieron inducidos. A continuación, necesitábamos saber si el incremento de la expresión hepática de esos dos genes en las ratas adultas previamente expuestas al CH estaba asociado con la regulación negativa de genes diana de la GH o, por el contrario, reflejaba una señalización de GH aumentada. CYP2C11 y CYP2C13, dos marcadores biológicos del patrón masculino de expresión génica bajo el control de la GH [267] estaban inducidos, apuntando el hecho de que el CH influencia la regulación de los genes diana de la GH en el hígado adulto. Sin embargo, la ausencia de efectos evidentes sobre la expresión de IGF-1 hace sospechar la presencia de complejos mecanismos transcripcionales in vivo que merecen una investigación en profundidad. Para comprender mejor la influencia del hipotiroidismo neonatal transitorio sobre la fisiología del hígado adulto, se continuó con un análisis exploratorio de la expresión global génica hepática en el PND80 empleando la tecnología de Microarrays de ADN. Mediante el análisis de los procesos biológicos y las rutas representadas, se identificó un set de genes regulados de manera diferencial en el grupo CH, los cuales estaban relacionados con el metabolismo lipídico, en particular con la ruta de señalización de PPAR!. En consecuencia, los contenidos hepáticos de TG, ésteres de colesterol, FFA y fosfolípidos aparecieron significativamente reducidos en el grupo de CH pero no se observaron cambios en el contenido de colesterol libre, sugiriendo la presencia de alteraciones en el metabolismo lipídico del hígado incluso en ausencia de cambios evidentes en el colesterol circulante. Con el objetivo de determinar si el reducido contenido hepático de lípidos en las ratas con CH se debía a un metabolismo lipídico elevado, a un incremento en la excreción de lípidos, una reducción de la síntesis de lípidos, o a una combinación de estos mecanismos, se analizaron los niveles hepáticos de mRNA de varios genes involucrados en dichos procesos empleando qRT-PCR. Las ratas con CH mostraron una inducción concomitante de PPAR!, regulador maestro de la "-oxidación, y su gen diana Carnitine Palmitoyl Transferase-1 (CPT1). Por otro lado, los niveles de SREBP1c, una proteína clave en la lipogénesis, aparecieron significativamente inhibidos y sus genes diana no se mostraron afectados por lo que nuestros datos respaldan la presencia de un incremento del catabolismo lipídico y la no activación de un programa lipogénico en las ratas con CH. Interesantemente, los niveles de SREBP2 y su gen diana LDLR, relacionados con la absorción de colesterol, estaban bajos en un orden de 2-3 veces en las ratas con CH. Es más, las ratas adultas con CH mostraron represión de CD36, otro conocido gen diana de PPAR! relacionado con la absorción de FFA, y MTTP, el cual está relacionado con el ensamblaje de TG, indicando que la reducción en la absorción de FFA podría contribuir a los niveles reducidos de TG hepáticos observados en el grupo de CH. Adicionalmente, los animales CH mostraron una transcripción reducida de genes relacionados con el flujo de salida de colesterol de la célula (ABCA1), y con la síntesis de ácido biliar (CYP8B1, CYP7A1 y CYP27A1). Colectivamente, estos datos indican que la exposición transitoria al hipotiroidismo provoca cambios en el metabolismo lipídico hepático, en particular, en el metabolismo del colesterol, que persisten tras eliminar la exposición original. Resumen en castellano 135 Finalmente, se estableció la conjetura de que el diferente perfil transcripcional presentado por el grupo de CH podría ser explicado por una respuesta tisular alterada a la T3 y/o la GH, dos hormonas drásticamente reducidas por el hipotiroidismo [261-263]. Para probar esta hipótesis, se desarrolló un segundo brote de hipotiroidismo (TX) en la edad adulta, seguido de la sustitución hormonal con T3 o GH. TX, como se esperaba, provocó una reducción en el peso total del cuerpo de todos los animales. El tratamiento con T3 o GH incrementó la ganancia de peso pero ambas hormonas fueron incapaces de normalizar el peso por completo. También, independientemente del status previo de CH, el desarrollo de TX incremento los niveles circulantes de colesterol, principalmente debido a un incremento de las LDL y las HDL, y una reducción de las VLDL, mientras que el tratamiento con T3 restauró los niveles normales. Los niveles séricos de T3 y de mRNA de IGF-1 hepático estaban significativamente reducidos por el TX y fueron completamente restaurados por los tratamientos con T3 y GH, respectivamente. Sin embargo, el desarrollo de TX resultó en una gran reducción de los niveles de FFA circulantes solo en los animales con CH y el tratamiento con T3 los restauró. Adicionalmente, para evaluar si una respuesta alterada al tratamiento con T3 estaba asociada con una respuesta alterada del transcriptoma, se midieron los cambios de expresión de ME y FAS, dos genes regulados por T3. Como era de esperar, TX redujo significativamente los niveles de mRNA de ambos genes en los animales sin CH pero, sorprendentemente, no solamente no redujo sus niveles en el grupo de CH sino que se produjo un incremento del orden de 5 veces de FAS. El tratamiento con T3 incrementó los niveles de mRNA de ME y FAS independientemente de status previo de CH pero se produjo un incremento desproporcionado (de más de 30 veces) de la expresión de ME en las ratas con CH. Tomados en conjunto, estos resultados sugieren que la respuesta tisular a TH está alterada en las ratas previamente expuestas a CH pero, llegado a este punto, solo podemos especular sobre los mecanismos moleculares implicados. En resumen, nuestros hallazgos respaldan la hipótesis de que la privación de TH durante el periodo neonatal causa una influencia perdurable sobre el transcriptoma del hígado, principalmente sobre los genes regulados por GH y en aquellos implicados en el metabolismo lipídico, y provoca una respuesta alterada a la TH en la edad adulta. La influencia de una condición inhibitoria del crecimiento en el metabolismo hepático es intrigante y merece estudios adicionales para explorar si las alteraciones observadas en este trabajo pueden causar perturbaciones metabólicas o enfermedades crónicas. Ruymán Santana Farré 136 efecto. Otros modelos de ratones con sensibilidad alterada a la GH, tales como aquellos de deleción específica en el hígado de JAK2 [307], GHR [235] o STAT5 [308], desarrollan esteatosis hepática espontánea. Esto está en línea con nuestra hipótesis sobre que la ausencia de esteatosis hepática en los ratones SOCS2-/- es debida a un incremento de la sensibilidad a GH. Interesantemente, los estudios de la deleción hepato-específica de JAK2 han desvelado otro mecanismo mediante el cual GH puede controlar el contenido en grasa en el hígado [307, 309]. Estos ratones, conocidos como JAK2L, muestran elevados niveles de GH circulante, lo que acaba llevando a un incremento de la lipólisis en el tejido adiposo, un incremento de la llegada de FFA al hígado y. finalmente, a esteatosis. Por el contrario, los ratones SOCS2-/- presentan niveles reducidos de GH circulante y, en contraposición a los JAK2L, exhiben una masa grasa incrementada, sugiriendo que una lipólisis reducida podría contribuir a la acumulación reducida de TG en el hígado. Notoriamente, no detectamos cambios en los niveles de FFA circulantes entre ambos modelos animales por lo que, se necesitan más experimentos en un futuro para analizar el papel exacto de la GH y de la lipólisis de tejido adiposo en el hígado de los ratones SOCS2-/-. Adicionalmente, la exacerbada resistencia a insulina mostrada por los ratones SOCS2-/- alimentados con HFD se asemeja al fenotipo de los ratones transgénicos de GH alimentados con una dieta normal [231] pero, la necesidad de un disparador (en forma de HFD) demuestra las diferencias que existen entre modelos de incrementada secreción hormonal y modelos de incrementada sensibilidad hormonal. Como se mencionó previamente, los ratones SOCS2-/- presentaban niveles bajos de GH en plasma bajo circunstancias normales pero , interesantemente, retenían niveles normales de IGF-1. Los ratones transgénicos de GH, por otro lado, presentan elevados niveles de ambos, GH e IGF-1 [310]. A pesar del aumento de la sensibilidad a GH, esta particularidad permite a los ratones SOCS2-/- evitar los efectos diabetogénicos deteriorantes de la GH elevada, parece ser que mediante una retroalimentación negativa de IGF-1 en la pituitaria. Este hallazgo sugiere que la hiperactividad de la señalización de GHR, por si misma, no cuenta para el deterioro en el control de la glucosa dependiente de la dieta observado en los ratones SOCS2-/-. Un explicación más plausible es que las acciones anti-insulinicas de GH son exacerbadas por mecanismos dependientes de la dieta bajo el control de SOCS2. Nosotros proporcionamos la evidencia de que una excesiva producción de citoquinas inflamatorias es uno de esos mecanismos. La activación de los macrófagos en el hígado y el tejido adiposo por HFD lleva a la producción de citoquinas inflamatorias, un proceso que requerido para la resistencia insulínica inducida por la dieta [271]. Los ratones transgénicos con un incremento en la actividad de NF-!B en el hepatocito exhiben resistencia a insulina producida por la inflamación [311], un fenotipo que recuerda al de los ratones SOCS2-/- alimentados con HFD. En nuestro modelo, la perdida de SOCS2 lleva a una repuesta alterada a la HFD, resultando en un incremento de la expresión de citoquinas inflamatorias y un aumento de la activación de NF-!B. Los BMDMs de los ratones SOCS2-/- muestran una actividad fagocítica elevada in vitro y son hiperresponsivos a la estimulación por LPS, sugiriendo que las acciones antiinflamatorias de SOCS2 pueden estar mediadas, hasta cierto punto, por la inhibición de la respuesta a LPS de los macrófagos. Mientras que no notamos ninguna contribución de la GH al aumento de la señalización de LPS en los macrófagos SOCS2-/-, es evidente que la GH juega un papel en la regulación de la respuesta inflamatoria. Los ratones transgénicos de GH sufren de inflamación crónica [312] y el tratamiento con GH a corto plazo en voluntarios sanos lleva a un incremento plasmático de los niveles de citoquinas pro-inflamatorias [313]. Sorpresivamente, una publicación reciente muestra que la deleción específica de GHR en el macrófago de ratones lleva a una exacerbada Resumen en castellano 143 resistencia a insulina tras ser estos alimentados con HFD [314], de manera similar a lo observado en nuestro modelo de ratones SOCS2-/-. Esto podría sugerir que la GH tiene un efecto antiinflamatorio durante el estrés dietético. Una posible manera de reconciliar estos dos hallazgos opuestos es que abolir GHR es sinónimo de bajos niveles de SOCS2 lo que, como nuestros experimentos han demostrado, lleva a un incremento de la secreción de citoquinas inflamatorias. Por tanto, especulativamente hablando, SOCS2 puede ser considerado un agente antiinflamatorio que contrarresta los efectos pro-inflamatorios de la GH mediante inhibición directa de la señalización de GH pero también mediante la reducción de la producción de citoquinas pro-inflamatorias. En el Artículo III, trabajamos sobre la hipótesis de que algunas de las acciones fisiológicas sobre el metabolismo lipídico pueden ser explicadas por el cruce de GH con otras rutas de señalización relevantes. Este es el caso de los LXRs los cuales son moduladores críticos del colesterol, los ácidos grasos y la homeostasis de la glucosa. Interesantemente, la activación farmacológica de LXR también lleva a la aparición esteatosis hepática severa [277]. Los ratones LXR-/- son resistentes la esteatosis inducida por HFD [279, 280], un fenotipo que recuerda a nuestro modelo de ratones SOCS2-/-. La activación de LXR y GHR en el hígado también muestra efectos antagónicos sobre el metabolismo de la glucosa: inhibición [276] e inducción [3] de la gluconeogénesis hepática, respectivamente. En este estudio demostramos que la activación de LXR in vitro atenúa la señalización de la GH mediante la reducción de la actividad de STAT5b, llevando a una inhibición de la transcripción de genes inducidos por GH, tales como SOCS2. También presentamos evidencias de que esta atenuación puede ser reproducida por la sobre-expresión de SREBP1 y SREBP2, ambos genes diana de LXR. Estos efectos pueden ser parcialmente explicados a dos niveles diferentes: inhibición de la transcripción de STAT5b, e incremento de la degradación proteica de STAT5b. Notablemente, en hepatocitos primarios humanos, la estimulación de LXR con su agonista T0901317, o la sobre-expresión de SREBP1a o SREBP2, causa una inhibición significativa de la expresión de genes inducidos por GH. Nuestro grupo identificó con anterioridad un elemento novedoso de respuesta dentro de primer intron del gene de SOCS2 compuesto por un E-box seguido de un tándem de sitios de unión de STAT5b, ambos requeridos para una respuesta completa a la GH. Interesantemente, el motivo E-box es un lugar putativo de unión para SREBP1 y está localizado solo a 13 pares de bases del lugar de unión de STAT5b en el promotor de SOCS2 [281]. Por ello, el efecto inhibitorio de SREBP1 sobre la expresión de SOCS2 inducida por GH podría explicarse por su competitividad en la unión al promotor con STAT5b. Nuestros ensayos de unión proteína-DNA no soportan dicha hipótesis. Nosotros demostramos que la inestabilidad post-translacional contribuye a la reducción de los niveles de STAT5b por LXR donde SREBP1a y SREBP2 promueven la rápida degradación proteica de STAT5b en los hepatocitos. Trabajos anteriores implican a la degradación proteosomal en la inhibición de STAT5a y demuestran su ubiquitinación en el núcleo [315]. Esta degradación proteosomal es modulada por un motivo corto que comprende los aminoácidos 751-762 del dominio C-terminal de STAT5a. Esta región está altamente conservada en STAT5b, y corresponde a los aminoácidos 757-768 [316]. Es más, un reciente estudio en profundidad de los lugares de ubiquitinación, ha identificado ha identificado la modificación por ubiquitina de la lisina 567 del STAT5b humano [317]. El complejo E3 ligasa responsable de la ubiquitinación de STAT5b en el núcleo aún debe de ser identificado. Nuestros datos sugieren que la actividad de una E3 ligasa desconocida podría ser modulada por la activación de SREBP1a y SREBP2. Adicionalmente, el análisis de Microarray de hígados en humanos, ratones y ratas ha demostrado que la activación de LXR produce una descenso de los niveles de mRNA del GHR, proporcionando una explicación factible para estos efectos [276, 318, 319]. Por lo tanto, concluimos que el mecanismo inhibitorio de la ruta de Ruymán Santana Farré 144 señalización de la GH conducido por LXR parece operar en ambos, GHR y STAT5b. Este comportamiento redundante sugiere que el antagonismo de la GH debe ser un aspecto importante de las acciones fisiológicas de LXR. Son necesarios estudios in vivo en un futuro para poder proporcionar información interesante a cerca de la relación entre LXR y la transcripción mediada por STAT5b. Resumen en castellano 145 CONCLUSIONES Y PERSPECTIVAS DE FUTURO En esta tesis hemos explorado la influencia de la privación congénito-neonatal de hormonal sobre el crecimiento y el desarrollo, y sus efectos metabólicos perdurables en la edad adulta. Estudiamos el papel fisiológico de SOCS2 y los mecanismos moleculares asociados a lípidos que regulan la señalización de GH en el hígado Las conclusiones se encuentran resumidas a continuación. 1. El Hipotiroidismo Congénito neonatal causa una influencia duradera sobre el transcriptoma del hígado y provoca una respuesta hormonal alterada en la edad adulta. 2. La supresión de SOCS2 protege contra la esteatosis hepática provocada por una dieta alta en grasa pero empeora la resistencia a insulina. Los niveles elevados de citoquinas pro-inflamatorias observados contribuyen al fenotipo de resistencia insulínica. 3. SOCS2 actúa como un agente antiinflamatorio mediante la inhibición de la liberación de citoquinas pro-inflamatorias mediada por TLR4 in vitro en macrófagos. Este efecto parece ser independiente de la GH. 4. La actividad de LXR-SREBP inhibe la transcripción regulada por GH en el hígado mediante su acción sobre GHR y STAT5b resultando en una expresión reducida de SOCS2. Hemos demostrado que las ratas con CH transitorio desarrollan un significativo incremento hepático de SOCS2 (y de CIS), asociado con un metabolismo hepático alterado y una respuesta alterada a el reemplazo hormonal con GH o T3 en la edad adulta. Estos hallazgos sugieren que los ratones SOCS2-/- podrían ser una posible herramienta para entender el vínculo existente entre el CH transitorio y sus consecuencias metabólicas en la edad adulta. Más evidente es el hecho de que los ratones SOCS2-/- constituyen un novedoso y útil modelo para comprender la compleja relación que existe entre la inflamación, las acciones de GH y la nutrición en el control de la homeostasis de glucosa y lípidos. Es importante comprender bajo que condiciones SOCS2 es meramente un regulador negativo de GH, un mediador de las acciones de GH o un agente independiente. Cruzar ratones SOCS2-/- con ratones deficientes de GH, o usar antagonistas de GH o GHR, parecen ser interesantes herramientas para dilucidar aquellas funciones de SOCS2 que son independientes de GH. Nuestros resultados desvelan una función previamente desconocida de SOCS2 como regulador negativo de la activación de TLR4 por LPS, pero aún se necesita identificar las moléculas objetivo de SOCS2 dentro de la ruta de TLR4 y la posible implicación que GH pueda jugar en ello. También es importante aclarar el papel que juega la inflamación en el desarrollo de la resistencia a insulina observada en los ratones SOCS2-/-. Una simple aproximación con la que comenzar podría incluir el análisis de ratones SOCS2-/- tratados de manera sistémica con inhibidores de NF-!B. Las acciones reguladoras de GH sobre el metabolismo hepático implican un posible relación directa con varias rutas metabólicas tales como las de PPAR" y LXR. Tan solo Ruymán Santana Farré 146 hemos comenzado a analizar la interacción de LXR con la señalización de GH pero el nivel de redundancia demostrado por LXR sugiere que el antagonismo de GH es un aspecto importante de sus acciones fisiológicas en el hígado. Un estudio in vivo en profundidad podría proveer información interesante sobre la relación entre estas dos rutas. Es intrigante que los esteroles intracelulares inicien la respuesta inflamatoria, del mismo modo que activan LXR. Por lo tanto, el efecto antiinflamatorio de las acciones de GH podría haber evolucionado como respuesta a las acciones pro-inflamatorias de los esteroles. Interesantemente, hemos demostrado que la activación de LXR conlleva a la inhibición de SOCS2, un agente antiinflamatorio bajo condiciones de estrés dietario. Por ello, los mecanismos que conducen a la interacción entre LXR y SOCS2, y las implicaciones fisiológicas consecuentes, merecen un estudio en mayor profundidad. Resumen en castellano 147 BIBLIOGRAFÍA [1]!Isaksson OG, Jansson JO, Gause IA. Science 1982;216(4551):1237-1239. [2]!Press M. Diabetes Metab Rev 1988;4(4):391-414. [3]!Kopchick JJ, Andry JM. Mol Genet Metab 2000;71(1-2):293-314. [4]!Jeay S, Sonenshein GE, Postel-Vinay MC, Kelly PA, Baixeras E. Mol Cell Endocrinol 2002;188(1-2):1-7. [5]!Lombardi G, Colao A, Ferone D, Marzullo P, Orio F, Longobardi S, Merola B. Horm Res 1997;48 Suppl 4:38-42. [6]!Yoshizato H, Fujikawa T, Soya H, Tanaka M, Nakashima K. Endocrinology 1998;139(5):2545-2551. [7]!Li CH, Evans HM, Simpson ME. J Biol Chem 1945;159(2):353-366. [8]!Li CH, Papkoff H. Science 1956;124(3235):1293-1294. [9]!Martial JA, Hallewell RA, Baxter JD, Goodman HM. Science 1979;205(4406): 602-607. [10]!Abdel-Meguid SS, Shieh HS, Smith WW, Dayringer HE, Violand BN, Bentle LA. Proc Natl Acad Sci U S A 1987;84(18):6434-6437. [11]!Miller WL, Eberhardt NL. Endocr Rev 1983;4(2):97-130. [12]!Lewis UJ, Singh RN, Tutwiler GF, Sigel MB, VanderLaan EF, VanderLaan WP. Recent Prog Horm Res 1980;36:477-508. [13]!Lewis UJ, Sinha YN, Lewis GP. Endocr J 2000;47 Suppl:S1-8. [14]!Horseman ND, Yu-Lee LY. Endocr Rev 1994;15(5):627-649. [15]!Kopchick JJ. Horm Res 2003;60 Suppl 3:103-112. [16]!de Vos AM, Ultsch M, Kossiakoff AA. Science 1992;255(5042):306-312. [17]!Watahiki M, Yamamoto M, Yamakawa M, Tanaka M, Nakashima K. J Biol Chem 1989;264(1):312-316. [18]!Nicoll CS, Mayer GL, Russell SM. Endocr Rev 1986;7(2):169-203. [19]!Besson A, Salemi S, Deladoey J, Vuissoz JM, Eble A, Bidlingmaier M, Burgi S, Honegger U, Fluck C, Mullis PE. J Clin Endocrinol Metab 2005;90(5):2493-2499. [20]!Okada S, Kopchick JJ. Trends Mol Med 2001;7(3):126-132. [21]!Shuto Y, Shibasaki T, Otagiri A, Kuriyama H, Ohata H, Tamura H, Kamegai J, Sugihara H, Oikawa S, Wakabayashi I. J Clin Invest 2002;109(11):1429-1436. [22]!Tannenbaum GS. Endocrinology 1980;107(6):2117-2120. [23]!Gillies G. Trends Pharmacol Sci 1997;18(3):87-95. [24]!Mauras N, Blizzard RM, Link K, Johnson ML, Rogol AD, Veldhuis JD. J Clin Endocrinol Metab 1987;64(3):596-601. [25]!Jansson JO, Eden S, Isaksson O. Endocr Rev 1985;6(2):128-150. [26]!Eden S. Endocrinology 1979;105(2):555-560. [27]!Tannenbaum GS, Choi HK, Gurd W, Waxman DJ. Endocrinology 2001;142(11): 4599-4606. [28]!Gebert CA, Park SH, Waxman DJ. Mol Endocrinol 1999;13(2):213-227. [29]!Scheepens A, Moderscheim TA, Gluckman PD. Horm Res 2005;64 Suppl 3:66-72. [30]!Beyea JA, Olson DM, Vandergriend RA, Harvey S. Cell Tissue Res 2005;322(3): 379-392. [31]!Harvey S, Kakebeeke M, Sanders EJ. J Mol Neurosci 2004;22(1-2):139-145. [32]!Kirpensteijn J, Timmermans-Sprang EP, van Garderen E, Rutteman GR, Lantingavan Leeuwen IS, Mol JA. Mol Cell Endocrinol 2002;197(1-2):179-185. [33]!Kelley KW, Weigent DA, Kooijman R. Brain Behav Immun 2007;21(4):384-392. Ruymán Santana Farré 148 [34]!Lantinga van Leeuwen IS, Teske E, van Garderen E, Mol JA. Anticancer Res 2000;20(4):2371-2376. [35]!Mukhina S, Liu D, Guo K, Raccurt M, Borges-Bendris S, Mertani HC, Lobie PE. Endocrinology 2006;147(4):1819-1829. [36]!Alsat E, Guibourdenche J, Luton D, Frankenne F, Evain-Brion D. Am J Obstet Gynecol 1997;177(6):1526-1534. [37]!Alsat E, Guibourdenche J, Couturier A, Evain-Brion D. Mol Cell Endocrinol 1998;140(1-2):121-127. [38]!Perry JK, Emerald BS, Mertani HC, Lobie PE. Growth Horm IGF Res 2006;16(5-6): 277-289. [39]!Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K. Nature 1999;402(6762):656-660. [40]!Nass R, Gilrain J, Anderson S, Gaylinn B, Dalkin A, Day R, Peruggia M, Thorner MO. Endocrinology 2000;141(6):2084-2089. [41]!Namba H, Morita S, Melmed S. Endocrinology 1989;124(4):1794-1799. [42]!Lavin TN, Baxter JD, Horita S. J Biol Chem 1988;263(19):9418-9426. [43]!Tamura H, Kamegai J, Sugihara H, Kineman RD, Frohman LA, Wakabayashi I. J Neuroendocrinol 2000;12(6):481-485. [44]!Cosman D. Cytokine 1993;5(2):95-106. [45]!Argetsinger LS, Campbell GS, Yang X, Witthuhn BA, Silvennoinen O, Ihle JN, Carter-Su C. Cell 1993;74(2):237-244. [46]!Carter-Su C, Argetsinger LS, Campbell GS, Wang X, Ihle J, Witthuhn B. Proc Soc Exp Biol Med 1994;206(3):210-215. [47]!Zhu T, Ling L, Lobie PE. J Biol Chem 2002;277(47):45592-45603. [48]!Manabe N, Kubota Y, Kitanaka A, Ohnishi H, Taminato T, Tanaka T. Leuk Res 2006;30(11):1391-1398. [49]!Tsushima T, Friesen HG. J Clin Endocrinol Metab 1973;37(2):334-337. [50]!Leung DW, Spencer SA, Cachianes G, Hammonds RG, Collins C, Henzel WJ, Barnard R, Waters MJ, Wood WI. Nature 1987;330(6148):537-543. [51]!Mathews LS, Enberg B, Norstedt G. J Biol Chem 1989;264(17):9905-9910. [52]!Bazan JF. Proc Natl Acad Sci U S A 1990;87(18):6934-6938. [53]!Fuh G, Mulkerrin MG, Bass S, McFarland N, Brochier M, Bourell JH, Light DR, Wells JA. J Biol Chem 1990;265(6):3111-3115. [54]!Chen C, Brinkworth R, Waters MJ. J Biol Chem 1997;272(8):5133-5140. [55]!Bernat B, Pal G, Sun M, Kossiakoff AA. Proc Natl Acad Sci U S A 2003;100(3): 952-957. [56]!Behncken SN, Waters MJ. J Mol Recognit 1999;12(6):355-362. [57]!Gent J, Van Den Eijnden M, Van Kerkhof P, Strous GJ. Mol Endocrinol 2003;17(5): 967-975. [58]!Kelly PA, Ali S, Rozakis M, Goujon L, Nagano M, Pellegrini I, Gould D, Djiane J, Edery M, Finidori J, et al. Recent Prog Horm Res 1993;48:123-164. [59]!Baumgartner JW, Wells CA, Chen CM, Waters MJ. J Biol Chem 1994;269(46): 29094-29101. [60]!Grotzinger J. Biochim Biophys Acta 2002;1592(3):215-223. [61]!Dinerstein H, Lago F, Goujon L, Ferrag F, Esposito N, Finidori J, Kelly PA, PostelVinay MC. Mol Endocrinol 1995;9(12):1701-1707. [62]!Postel-Vinay MC, Finidori J. Eur J Endocrinol 1995;133(6):654-659. [63]!Govers R, ten Broeke T, van Kerkhof P, Schwartz AL, Strous GJ. EMBO J 1999;18(1):28-36. [64]!van Kerkhof P, Putters J, Strous GJ. J Biol Chem 2007;282(28):20475-20483. Resumen en castellano 149 [65]!Sotiropoulos A, Goujon L, Simonin G, Kelly PA, Postel-Vinay MC, Finidori J. Endocrinology 1993;132(4):1863-1865. [66]!Baumbach WR, Horner DL, Logan JS. Genes Dev 1989;3(8):1199-1205. [67]!Baumann G, Amburn K, Shaw MA. Endocrinology 1988;122(3):976-984. [68]!Baumann G. J Pediatr Endocrinol Metab 2001;14(4):355-375. [69]!Posner BI, Kelly PA, Shiu RP, Friesen HG. Endocrinology 1974;95(2):521-531. [70]!Kelly PA, Djiane J, Postel-Vinay MC, Edery M. Endocr Rev 1991;12(3):235-251. [71]!Nyberg F, Burman P. Horm Res 1996;45(1-2):18-22. [72]!Hull KL, Thiagarajah A, Harvey S. Cell Tissue Res 1996;286(1):69-80. [73]!Hochberg Z, Phillip M, Youdim MB, Amit T. Metabolism 1993;42(12):1617-1623. [74]!Gluckman PD, Breier BH, Sauerwein H. Acta Paediatr Scand Suppl 1990;366:73-78. [75]!Chung CS, Etherton TD. Endocrinology 1986;119(2):780-786. [76]!Bornfeldt KE, Arnqvist HJ, Enberg B, Mathews LS, Norstedt G. J Endocrinol 1989;122(3):651-656. [77]!Ji S, Guan R, Frank SJ, Messina JL. J Biol Chem 1999;274(19):13434-13442. [78]!Talamantes F, Ortiz R. J Endocrinol 2002;175(1):55-59. [79]!Cunningham BC, Ultsch M, De Vos AM, Mulkerrin MG, Clauser KR, Wells JA. Science 1991;254(5033):821-825. [80]!Livnah O, Stura EA, Middleton SA, Johnson DL, Jolliffe LK, Wilson IA. Science 1999;283(5404):987-990. [81]!Remy I, Wilson IA, Michnick SW. Science 1999;283(5404):990-993. [82]!Ross RJ, Leung KC, Maamra M, Bennett W, Doyle N, Waters MJ, Ho KK. J Clin Endocrinol Metab 2001;86(4):1716-1723. [83]!Rowlinson SW, Behncken SN, Rowland JE, Clarkson RW, Strasburger CJ, Wu Z, Baumbach W, Waters MJ. J Biol Chem 1998;273(9):5307-5314. [84]!van Kerkhof P, Smeets M, Strous GJ. Endocrinology 2002;143(4):1243-1252. [85]!Harding PA, Wang X, Okada S, Chen WY, Wan W, Kopchick JJ. J Biol Chem 1996;271(12):6708-6712. [86]!Gent J, van Kerkhof P, Roza M, Bu G, Strous GJ. Proc Natl Acad Sci U S A 2002;99(15):9858-9863. [87]!Brown RJ, Adams JJ, Pelekanos RA, Wan Y, McKinstry WJ, Palethorpe K, Seeber RM, Monks TA, Eidne KA, Parker MW, Waters MJ. Nat Struct Mol Biol 2005;12(9): 814-821. [88]!Ross RJ, Esposito N, Shen XY, Von Laue S, Chew SL, Dobson PR, Postel-Vinay MC, Finidori J. Mol Endocrinol 1997;11(3):265-273. [89]!Fuh G, Cunningham BC, Fukunaga R, Nagata S, Goeddel DV, Wells JA. Science 1992;256(5064):1677-1680. [90]!Carter-Su C, Stubbart JR, Wang XY, Stred SE, Argetsinger LS, Shafer JA. J Biol Chem 1989;264(31):18654-18661. [91]!Wang X, Moller C, Norstedt G, Carter-Su C. J Biol Chem 1993;268(5):3573-3579. [92]!Ihle JN. Proc Soc Exp Biol Med 1994;206(3):268-272. [93]!Johnston JA, Kawamura M, Kirken RA, Chen YQ, Blake TB, Shibuya K, Ortaldo JR, McVicar DW, O'Shea JJ. Nature 1994;370(6485):151-153. [94]!Smit LS, Meyer DJ, Billestrup N, Norstedt G, Schwartz J, Carter-Su C. Mol Endocrinol 1996;10(5):519-533. [95]!Carter-Su C, King AP, Argetsinger LS, Smit LS, Vanderkuur J, Campbell GS. Endocr J 1996;43 Suppl:S65-70. [96]!Hellgren G, Jansson JO, Carlsson LM, Carlsson B. Growth Horm IGF Res 1999;9(3):212-218. Ruymán Santana Farré 150 [97]!Frank SJ, Yi W, Zhao Y, Goldsmith JF, Gilliland G, Jiang J, Sakai I, Kraft AS. J Biol Chem 1995;270(24):14776-14785. [98]!He K, Wang X, Jiang J, Guan R, Bernstein KE, Sayeski PP, Frank SJ. Mol Endocrinol 2003;17(11):2211-2227. [99]!He K, Loesch K, Cowan JW, Li X, Deng L, Wang X, Jiang J, Frank SJ. Endocrinology 2005;146(11):4755-4765. [100]!Frank SJ, Gilliland G, Kraft AS, Arnold CS. Endocrinology 1994;135(5):2228-2239. [101]!Waters MJ, Hoang HN, Fairlie DP, Pelekanos RA, Brown RJ. J Mol Endocrinol 2006;36(1):1-7. [102]!Argetsinger LS, Carter-Su C. Physiol Rev 1996;76(4):1089-1107. [103]!Wang X, Darus CJ, Xu BC, Kopchick JJ. Mol Endocrinol 1996;10(10):1249-1260. [104]!Biener-Ramanujan E, Ramanujan VK, Herman B, Gertler A. Growth Horm IGF Res 2006;16(4):247-257. [105]!Sotiropoulos A, Perrot-Applanat M, Dinerstein H, Pallier A, Postel-Vinay MC, Finidori J, Kelly PA. Endocrinology 1994;135(4):1292-1298. [106]!Huo JS, McEachin RC, Cui TX, Duggal NK, Hai T, States DJ, Schwartz J. J Biol Chem 2006;281(7):4132-4141. [107]!Darnell JE, Jr., Kerr IM, Stark GR. Science 1994;264(5164):1415-1421. [108]!Shuai K. Prog Biophys Mol Biol 1999;71(3-4):405-422. [109]!Levy DE, Darnell JE, Jr. Nat Rev Mol Cell Biol 2002;3(9):651-662. [110]!Moriggl R, Gouilleux-Gruart V, Jahne R, Berchtold S, Gartmann C, Liu X, Hennighausen L, Sotiropoulos A, Groner B, Gouilleux F. Mol Cell Biol 1996;16(10): 5691-5700. [111]!Boucheron C, Dumon S, Santos SC, Moriggl R, Hennighausen L, Gisselbrecht S, Gouilleux F. J Biol Chem 1998;273(51):33936-33941. [112]!Verdier F, Chretien S, Muller O, Varlet P, Yoshimura A, Gisselbrecht S, Lacombe C, Mayeux P. J Biol Chem 1998;273(43):28185-28190. [113]!Liu X, Robinson GW, Gouilleux F, Groner B, Hennighausen L. Proc Natl Acad Sci U S A 1995;92(19):8831-8835. [114]!Mui AL, Wakao H, O'Farrell AM, Harada N, Miyajima A. EMBO J 1995;14(6): 1166-1175. [115]!Decker T, Kovarik P. Cell Mol Life Sci 1999;55(12):1535-1546. [116]!Kisseleva T, Bhattacharya S, Braunstein J, Schindler CW. Gene 2002;285(1-2): 1-24. [117]!Frank SJ. Growth Horm IGF Res 2001;11(4):201-212. [118]!Hansen LH, Wang X, Kopchick JJ, Bouchelouche P, Nielsen JH, Galsgaard ED, Billestrup N. J Biol Chem 1996;271(21):12669-12673. [119]!Ihle JN. Cell 1996;84(3):331-334. [120]!Takeda K, Noguchi K, Shi W, Tanaka T, Matsumoto M, Yoshida N, Kishimoto T, Akira S. Proc Natl Acad Sci U S A 1997;94(8):3801-3804. [121]!Durbin JE, Hackenmiller R, Simon MC, Levy DE. Cell 1996;84(3):443-450. [122]!Meraz MA, White JM, Sheehan KC, Bach EA, Rodig SJ, Dighe AS, Kaplan DH, Riley JK, Greenlund AC, Campbell D, Carver-Moore K, DuBois RN, Clark R, Aguet M, Schreiber RD. Cell 1996;84(3):431-442. [123]!Liu X, Robinson GW, Wagner KU, Garrett L, Wynshaw-Boris A, Hennighausen L. Genes Dev 1997;11(2):179-186. [124]!Ormandy CJ, Camus A, Barra J, Damotte D, Lucas B, Buteau H, Edery M, Brousse N, Babinet C, Binart N, Kelly PA. Genes Dev 1997;11(2):167-178. [125]!Teglund S, McKay C, Schuetz E, van Deursen JM, Stravopodis D, Wang D, Brown M, Bodner S, Grosveld G, Ihle JN. Cell 1998;93(5):841-850. Resumen en castellano 151 [126]!Ooi GT, Hurst KR, Poy MN, Rechler MM, Boisclair YR. Mol Endocrinol 1998;12(5): 675-687. [127]!Udy GB, Towers RP, Snell RG, Wilkins RJ, Park SH, Ram PA, Waxman DJ, Davey HW. Proc Natl Acad Sci U S A 1997;94(14):7239-7244. [128]!Davey HW, McLachlan MJ, Wilkins RJ, Hilton DJ, Adams TE. Mol Cell Endocrinol 1999;158(1-2):111-116. [129]!Davey HW, Xie T, McLachlan MJ, Wilkins RJ, Waxman DJ, Grattan DR. Endocrinology 2001;142(9):3836-3841. [130]!Woelfle J, Rotwein P. Am J Physiol Endocrinol Metab 2004;286(3):E393-401. [131]!Fain JN, Ihle JH, Bahouth SW. Biochem Biophys Res Commun 1999;263(1): 201-205. [132]!Davey HW, Park SH, Grattan DR, McLachlan MJ, Waxman DJ. J Biol Chem 1999;274(50):35331-35336. [133]!Waxman DJ, Ram PA, Park SH, Choi HK. J Biol Chem 1995;270(22):13262-13270. [134]!Park SH, Liu X, Hennighausen L, Davey HW, Waxman DJ. J Biol Chem 1999;274(11):7421-7430. [135]!Collum RG, Brutsaert S, Lee G, Schindler C. Proc Natl Acad Sci U S A 2000;97(18):10120-10125. [136]!Usacheva A, Smith R, Minshall R, Baida G, Seng S, Croze E, Colamonici O. J Biol Chem 2001;276(25):22948-22953. [137]!Lesniak MA, Roth J. J Biol Chem 1976;251(12):3720-3729. [138]!van Kerkhof P, Sachse M, Klumperman J, Strous GJ. J Biol Chem 2001;276(6): 3778-3784. [139]!Sachse M, van Kerkhof P, Strous GJ, Klumperman J. J Cell Sci 2001;114(Pt 21): 3943-3952. [140]!Strous GJ, van Kerkhof P, Govers R, Ciechanover A, Schwartz AL. EMBO J 1996;15(15):3806-3812. [141]!van Kerkhof P, Strous GJ. Biochem Soc Trans 2001;29(Pt 4):488-493. [142]!Ciechanover A, Heller H, Elias S, Haas AL, Hershko A. Proc Natl Acad Sci U S A 1980;77(3):1365-1368. [143]!Hershko A, Ciechanover A, Heller H, Haas AL, Rose IA. Proc Natl Acad Sci U S A 1980;77(4):1783-1786. [144]!Hicke L. Nat Rev Mol Cell Biol 2001;2(3):195-201. [145]!Polo S, Sigismund S, Faretta M, Guidi M, Capua MR, Bossi G, Chen H, De Camilli P, Di Fiore PP. Nature 2002;416(6879):451-455. [146]!Conaway RC, Brower CS, Conaway JW. Science 2002;296(5571):1254-1258. [147]!Hershko A, Ciechanover A. Annu Rev Biochem 1998;67:425-479. [148]!Pickart CM. Cell 2004;116(2):181-190. [149]!Weissman AM. Nat Rev Mol Cell Biol 2001;2(3):169-178. [150]!Adams J. Cancer Treat Rev 2003;29 Suppl 1:3-9. [151]!Zwickl P, Voges D, Baumeister W. Philos Trans R Soc Lond B Biol Sci 1999;354(1389):1501-1511. [152]!Vleurick L, Pezet A, Kuhn ER, Decuypere E, Edery M. Mol Endocrinol 1999;13(11): 1823-1831. [153]!Lobie PE, Sadir R, Graichen R, Mertani HC, Morel G. Exp Cell Res 1999;246(1): 47-55. [154]!Govers R, van Kerkhof P, Schwartz AL, Strous GJ. EMBO J 1997;16(16): 4851-4858. [155]!Dittrich E, Haft CR, Muys L, Heinrich PC, Graeve L. J Biol Chem 1996;271(10): 5487-5494. Ruymán Santana Farré 152