The Terminal Extensions of Dbp7 Influence Growth and 60S Ribosomal Subunit Biogenesis in Saccharomyces cerevisiae

Citation: Contreras, J.; Ruiz-Blanco, Ó.; Dominique, C.; Humbert, O.; Henry, Y.; Henras, A.K.; de la Cruz, J.; Villalobo, E. The Terminal Extensions of Dbp7 Influence Growth and 60S Ribosomal Subunit Biogenesis in Saccharomyces cerevisiae.Int. J. Mol. Sci. 2023,24, 3460. https://doi.org/ 10.3390/ijms24043460 Academic Editor: Lasse Lindahl Received: 19 January 2023 Revised: 30 January 2023 Accepted: 7 February 2023 Published: 9 February 2023 Copyright: © 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). International Journal of Molecular Sciences Article The Terminal Extensions of Dbp7 Influence Growth and 60S Ribosomal Subunit Biogenesis in Saccharomyces cerevisiae Julia Contreras 1,2,Óscar Ruiz-Blanco 1,2, Carine Dominique 3, Odile Humbert 3, Yves Henry 3, Anthony K. Henras 3, Jesús de la Cruz 1,2,* and Eduardo Villalobo 1,4,* 1Instituto de Biomedicina de Sevilla, Hospital Universitario Virgen del Rocío/CSIC/Universidad de Sevilla, 41013 Seville, Spain 2Departamento de Genética, Facultad de Biología, Universidad de Sevilla, 41004 Seville, Spain 3Molecular, Cellular and Developmental Biology Unit (MCD), Centre de Biologie Intégrative (CBI), Universitéde Toulouse, CNRS, UPS, 31000 Toulouse, France 4Departamento de Microbiología, Facultad de Biología, Universidad de Sevilla, 41004 Seville, Spain *Correspondence: [email protected] (J.d.l.C.); [email protected] (E.V.); Tel.: +34-955923126 (J.d.l.C. & E.V.) Abstract: Ribosome synthesis is a complex process that involves a large set of protein trans-acting factors, among them DEx(D/H)-box helicases. These are enzymes that carry out remodelling activities onto RNAs by hydrolysing ATP. The nucleolar DEGD-box protein Dbp7 is required for the biogenesis of large 60S ribosomal subunits. Recently, we have shown that Dbp7 is an RNA helicase that regulates the dynamic base-pairing between the snR190 small nucleolar RNA and the precursors of the ribosomal RNA within early pre-60S ribosomal particles. As the rest of DEx(D/H)-box proteins, Dbp7 has a modular organization formed by a helicase core region, which contains conserved motifs, and variable, non-conserved N- and C-terminal extensions. The role of these extensions remains unknown. Herein, we show that the N-terminal domain of Dbp7 is necessary for efficient nuclear import of the protein. Indeed, a basic bipartite nuclear localization signal (NLS) could be identified in its N-terminal domain. Removal of this putative NLS impairs, but does not abolish, Dbp7 nuclear import. Both N- and C-terminal domains are required for normal growth and 60S ribosomal subunit synthesis. Furthermore, we have studied the role of these domains in the association of Dbp7 with pre-ribosomal particles. Altogether, our results show that the N- and C-terminal domains of Dbp7 are important for the optimal function of this protein during ribosome biogenesis. Keywords: Dbp7; DEAD-box protein; RNA helicase; Saccharomyces cerevisiae; ribosome; 60S ribosomal subunit; ribosome assembly factor 1. Introduction The ribosome is one of the most complex machines that any cell synthesises and assembles [ 1 ]. Ribosomes are made of two subunits, the large ribosomal subunit (r-subunit) and the small r-subunit. In the yeast Saccharomyces cerevisiae, as in other eukaryotes, these subunits are also referred to as the 60S and 40S r-subunits, respectively. In this yeast, the ribosome synthesis process implicates 4 different ribosomal RNA (rRNA) species (18S for the 40S r-subunit and 25S, 5.8S, and 5S for the 60S r-subunit), 79 ribosomal proteins (r-proteins; 33 for the 40S r-subunit and 46 for the 60S r-subunit), about 75 small nucleolar RNAs (snoRNAs), and more than 250 protein trans-acting factors, also known as assembly factors (AFs) [2,3]. RNA helicases of the DEx(D/H)-box protein family and related families (e.g., Ski2-like family) represent the largest class of AFs involved in ribosome biogenesis. Indeed, up to 21 RNA helicases have been described to participate in this process in S. cerevisiae, 20 of them in the biogenesis of cytoplasmic ribosomes and 1 in the biogenesis of mitoribosomes [ 4 – 6 ]. RNA helicases are motor proteins that use the energy of ATP hydrolysis to exert work onto RNA [ 7 – 9 ]. In vitro , RNA helicases have been found to perform a wide range of biochemical Int. J. Mol. Sci. 2023,24, 3460. https://doi.org/10.3390/ijms24043460 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2023,24, 3460 2 of 21 activities. Some of these enzymes are able to catalyse ATP-dependent double-stranded RNA (dsRNA) unwinding, hence the name given to this family of proteins. Other activities include RNA clamping, dsRNA destabilization, RNA annealing, and protein displacement [ 10 – 17 ]. Thus, RNA helicases act as enzymes able to bind and remodel RNA or ribonucleoprotein particles (RNPs) in an NTP-dependent manner [ 18 , 19 ]; consequently, RNA helicases are found ubiquitously in nature, participating in virtually all aspects of cellularRNA metabolism [ 20 , 21 ]: notably transcription, pre-mRNA splicing, RNA editing, RNA interference, RNA export, small RNA biogenesis, ribosome biogenesis, translation, RNA degradation, and RNA quality control mechanisms (e.g., [11,22]). RNA helicases of the DEx(D/H)-box protein family are members of the superfamily 2 (SF2); superfamilies are classified according to the occurrence and characteristics of various conserved motifs in their primary sequence [ 8 , 23 , 24 ]. Among the conserved motifs, all RNA helicases harbour the Walker A and B motifs [ 25 ], required for NTP binding and hydrolysis, as well as other motifs required for nucleic acid binding and for coupling NTP hydrolysis to helicase activity (e.g., [ 8 , 9 , 16 ]). From structural analyses, it becomes evident that the motifs are a signature for a structurally conserved helicase core region, which consists of two tandem RecA-like domains connected by a flexible short linker [ 4 , 9 , 14 ]. In all cases, the core region is flanked by specific N- and C-terminal extensions of variable lengths, which could confer physiological specificity (e.g., recruitment to distinct target RNPs, subcellular localisation, platform for interaction of cofactors, etc.) or provide complementary catalytic activities to RNA helicases [ 8 , 16 , 26 ]. Figure 1outlines the primary sequence of Dbp7, the RNA helicase of the DExD-box protein family studied in this work, and highlights the different conserved motifs of the core region along with the sequence, length, and characteristics of its non-conserved N- and C-terminal extensions. Terminal extensions of RNA helicases, especially at the N-terminus, have few predicted structures or consist of intrinsically disordered domains, and are poorly characterized. In any case, it has been suggested that sequence elements within the extensions help to modulate the functional activities of the proteins, either directly or through interactions with other factors [ 27 ]. In S. cerevisiae, the non-conserved C-terminal region of Dhh1 is required for recruitment of the helicase to specific mRNAs to promote their decay [ 28 ]; the N-terminus of Prp16 is essential for its nuclear localisation and for its interaction with specific partners on the spliceosome, among which is another RNA helicase called Brr2 [ 29 , 30 ]. The N- and C-terminal domains of Mss116 contribute to its RNA chaperone function, at least in part by mediating interactions with RNA and RNP substrates [ 31 , 32 ]; the C-terminal extension of Prp22 has been described as a binding platform for interaction partners and to regulate its ATPase activity [ 33 ]. The N- and C-terminal domains of Dhr1 have important functions in ribosome biogenesis in vivo [ 34 ]. The structure of unique C-terminal domains of RNA helicases has been determined for Prp43 and Mtr4, which have been demonstrated to function in RNA binding, RNA-dependent ATPase activity, and interactions with specific adaptor proteins [35,36]. Dbp7 is a non-essential DEGD-box protein involved in the synthesisof 60S r-subunits [ 37 ]. Recently, Dbp7, which has RNA-dependent ATPase activity, has been shown to regulate the dynamic base-paring between the snoRNP chaperone snR190 and the pre-rRNA within early pre-60S particles [ 38 , 39 ]. In this work, we report on the functional relevance of the specific N- and C-terminal extensions of Dbp7 in relation to its function during 60S r-subunit biogenesis. We show that the N-terminal extension of Dbp7 is responsible for targeting the protein to the nucleus, in part via a standard bipartite nuclear localization signal (NLS). Consistently, we found that removal of this NLS slightly affected growth and ribosome maturation, while the complete deletion of Dbp7 N-terminal extension restrained growth and led to abnormal 60S r-subunit biogenesis. Likewise, we have made truncations in the C-terminal extension, which were also detrimental for cell growth and 60S r-subunit biogenesis. Importantly, both the N-terminal and C-terminal extensions of Dbp7 seem to be important, but not essential, for the association of the protein with pre-ribosomal particles. In conclusion, the truncation of the Int. J. Mol. Sci. 2023,24, 3460 3 of 21 N- or C-terminal extension of Dbp7 underscores the relative importance of these regions of the protein for its functions during ribosome biogenesis. Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 3 of 20 60S r-subunit biogenesis. Importantly, both the N-terminal and C-terminal extensions of Dbp7 seem to be important, but not essential, for the association of the protein with preribosomal particles. In conclusion, the truncation of the N- or C-terminal extension of Dbp7 underscores the relative importance of these regions of the protein for its functions during ribosome biogenesis. Figure 1. Dbp7 is a DExD-box protein. (A) Schematic representation (not to scale) of the primary amino acid sequence of Dbp7. The figure shows the helicase core composed of two RecA-like domains and the flanking N-terminal and C-terminal extensions. The length of each extension is depicted by numbers. The different conserved sequence motifs found in RNA helicases are also shown. They are coloured according to their predominant biochemical function: red, ATP binding and hydrolysis; blue, nucleic acid binding; green, coupling between nucleic acid and ATP binding sites. (B) Amino acid sequence of Dbp7. Motifs are highlighted in a pale red colour; a putative nuclear localization signal is highlighted in pale blue; and the C-terminal DUF4217 domain of unknown function in pale yellow. The conserved motifs are defined according to [9]. The helicase core region between the end of the N-terminal extension (M162) and the beginning of the C-terminal extension (K560) is delimited by green half ellipse symbols. The different mutations described in this work are also shown. Figure 1. Dbp7 is a DExD-box protein. ( A ) Schematic representation (not to scale) of the primary amino acid sequence of Dbp7. The figure shows the helicase core composed of two RecA-like domains and the flanking N-terminal and C-terminal extensions. The length of each extension is depicted by numbers. The different conserved sequence motifs found in RNA helicases are also shown. They are coloured according to their predominant biochemical function: red, ATP binding and hydrolysis; blue, nucleic acid binding; green, coupling between nucleic acid and ATP binding sites. ( B ) Amino acid sequence of Dbp7. Motifs are highlighted in a pale red colour; a putative nuclear localization signal is highlighted in pale blue; and the C-terminal DUF4217 domain of unknown function in pale yellow. The conserved motifs are defined according to [ 9 ]. The helicase core region between the end of the N-terminal extension (M162) and the beginning of the C-terminal extension (K560) is delimited by green half ellipse symbols. The different mutations described in this work are also shown. Int. J. Mol. Sci. 2023,24, 3460 4 of 21 2. Results 2.1. Truncation of the N- and C-Terminal Extensions of Yeast Dbp7 Yeast Dbp7 is a quasi-essential DEGD-box protein involved in rRNA remodelling on the earliest pre-60S r-particles [ 37 – 40 ]. While the ATPase activity of Dbp7 is clearly important for its function during ribosome biogenesis [ 38 , 39 ], the role of its terminal extensions remains unknown. A search for similarities of these extensions in other proteins led us to conclude that the N-terminal extension has no homologies to other DEx(D/H)- box or non-related proteins, and apparently shows a disordered architecture. In contrast, the C-terminal extension shows some sort of ordered structure, as well as a DUF4217 domain of unknown function (from T638 to G703) which is present in the C-terminus of different RNA helicases, among which are yeast Has1, Dbp4 and Spb4 [ 41 ]. In agreement with this, the N-terminal part of Dbp7 shows a high probability of being intrinsically disordered, as predicted by both the Protein DisOrder prediction System (PrDOS) [ 42 ] and the DisEMBL TM tool [ 43 ]. Moreover, the Dbp7 structure predicted in the AlphaFold Protein Structure Database [ 44 , 45 ] features a mostly unstructured N-terminal extension of Dbp7, while the C-terminal extension comprises several alpha helices (see Figure S1). To address the importance of these extensions for the biological function of Dbp7, we generated a series of progressive and independent truncations in the N-terminal and C-terminal extensions that flank the helicase core, positioned between the amino acid 163, just upstream of the Q-motif, and the amino acid 559, just downstream of motif VI of Dbp7 (Figure 1). Different truncation alleles were generated by site-directed mutagenesis on a HA-tagged DBP7 ORF and cloned into the YCplac22 CEN TRP1 plasmid; then, their functions were tested in vivo in a dbp7∆strain using the plasmid shuffle procedure. We obtained the following dbp7 mutants (see Figures 1and S2 for details), all of which were expressed under the control of the cognate DBP7 promoter: (1) HA-dbp7 ∆ N10, an allele harbouring a deletion of the codons corresponding to the first 10 amino acid residues; (2) HA-dbp7 ∆ N162, an allele harbouring a deletion of codons corresponding to the first 162 amino acid residues from the N-terminus; (3) HA-dbp7 ∆ NLS, an allele expressing a HA-tagged Dbp7 variant lacking 31 amino acids residues (V48 to S78) of the N-terminus; (4) HA-dbp7 ∆ C694-742, an allele harbouring a deletion of the codons corresponding to the last 49 amino acids; and (5) HA-dbp7 ∆ C636-742, an allele harbouring a deletion of the codons corresponding to the last 107 amino acids. All of these alleles also encode an N-terminal double HA tag to allow for the detection of the different truncated proteins. As a control, we used a wild-type DBP7 allele also preceded by a N-terminal double HA tag, which has been previously proven to support wild-type growth [37]. 2.2. The N-Terminal Extension of Dbp7 Is Required for Efficient Cell Growth and for Production of 60S r-Subunits To address the in vivo function of the N-terminal extension of Dbp7, we first examined the growth phenotype of the truncated Dbp7-expressing strains on selective minimal SD- Trp plates. As shown in Figure 2A, deletion of the first N-terminal 10 amino acids of Dbp7 (HA-dbp7 ∆ N10) had only a mild effect on cell growth as compared to the wild-type counterpart, suggesting that this region is mostly dispensable under laboratory conditions. Elimination of the complete N-terminal extension of Dbp7 (HA-dbp7 ∆ N162) resulted in a slow growth similar to that caused by the absence of the Dbp7 protein. Consistently, doubling times of ca. 1.5, 1.9, 5.8, and 5.8 h were obtained in liquid SD-Trp medium at 30 ◦C for the HA-DBP7, HA-dbp7 ∆ N10, HA-dbp7 ∆ N162, and dbp7 ∆ strains, respectively. As shown in Figures 2B and S3, both N-terminal truncated forms of Dbp7 were detected by Western blotting, although they accumulated to a lesser extent than wild-type HA-Dbp7, especially the HA-Dbp7∆N162 variant protein. Int. J. Mol. Sci. 2023,24, 3460 5 of 21 Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 5 of 20 Figure 2. Growth phenotype of the truncated dbp7 mutants at the N- and C-terminal extensions. (A) Growth analysis of the indicated strains compared to their isogenic wild-type control. Strain JuCY1 was transformed with different plasmid-borne DBP7 alleles: HA-DBP7 (wild-type control), HA- dbp7∆N10, HA-dbp7∆N162, HA-dbp7∆C694-742, and HA-dbp7∆C636-742. A control transformed with an empty plasmid (dbp7∆) was also used. Strains were 5-fold serially diluted and spotted on SD-Trp plates, which were incubated at 30 °C for 3 days. Doubling times of the different strains grown in liquid SD-Trp medium at 30 °C are indicated. (B) The indicated strains were grown in liquid SD-Trp medium and harvested at an OD600 of 0.8; whole cell extracts were prepared and equivalent amounts of the different cell extracts were subjected to Western blotting analyses with antibodies against the HA epitope and Pgk1. We then examined the consequences of truncating the N-terminal extension of Dbp7 for ribosome biogenesis. To do so, we performed polysome and r-subunit profile analyses. As shown in Figure 3, the HA-dbp7∆N10 strain displayed a wild-type polysome profile; however, the HA-dbp7∆N162 mutant exhibited a mild reduction in the amount of free 60S r-subunits relative to free 40S r-subunits, a reduction in polysomes, and an accumulation of half-mer polysomes. Half-mer polysomes correspond to mRNAs associated with integral numbers of ribosomes plus a stalled 48S preinitiation complex at the initiation codon [46,47]. This profile was very similar to that obtained with an isogenic dbp7∆ strain, suggesting that the HA-dbp7∆N162 allele impairs 60S r-subunit production. To confirm this, we quantified total r-subunits by using run-off and low-Mg2+ sucrose gradients. We observed no significant reduction in the total 60S/40S r-subunit ratio in the HA-dbp7∆N10 strain, but a significant reduction of about 25% in the HA-dbp7∆N162 strain. This deficit was similar to that observed for the dbp7∆ strain. Altogether, we conclude that the N- terminal extension of Dbp7 is required for cell growth and optimal 60S r-subunit biogenesis, the impairments caused by the lack of the N-terminal extension being of the same magnitude as those resulting from the complete absence of the Dbp7 protein. Figure 2. Growth phenotype of the truncated dbp7 mutants at the N- and C-terminal extensions. ( A ) Growth analysis of the indicated strains compared to their isogenic wild-type control. Strain JuCY1 was transformed with different plasmid-borne DBP7 alleles: HA-DBP7 (wild-type control), HA-dbp7 ∆ N10, HA-dbp7 ∆ N162, HA-dbp7 ∆ C694-742, and HA-dbp7 ∆ C636-742. A control transformed with an empty plasmid (dbp7 ∆ ) was also used. Strains were 5-fold serially diluted and spotted on SD-Trp plates, which were incubated at 30 ◦ C for 3 days. Doubling times of the different strains grown in liquid SD-Trp medium at 30 ◦ C are indicated. ( B ) The indicated strains were grown in liquid SD-Trp medium and harvested at an OD 600 of 0.8; whole cell extracts were prepared and equivalent amounts of the different cell extracts were subjected to Western blotting analyses with antibodies against the HA epitope and Pgk1. We then examined the consequences of truncating the N-terminal extension of Dbp7 for ribosome biogenesis. To do so, we performed polysome and r-subunit profile analyses. As shown in Figure 3, the HA-dbp7 ∆ N10 strain displayed a wild-type polysome profile; however, the HA-dbp7 ∆ N162 mutant exhibited a mild reduction in the amount of free 60S r-subunits relative to free 40S r-subunits, a reduction in polysomes, and an accumulation of half-mer polysomes. Half-mer polysomes correspond to mRNAs associated with integral numbers of ribosomes plus a stalled 48S preinitiation complex at the initiation codon [ 46 , 47 ]. This profile was very similar to that obtained with an isogenic dbp7 ∆ strain, suggesting that the HA-dbp7 ∆ N162 allele impairs 60S r-subunit production. To confirm this, we quantified total r-subunits by using run-off and low-Mg 2+ sucrose gradients. We observed no significant reduction in the total 60S/40S r-subunit ratio in the HA-dbp7 ∆ N10 strain, but a significant reduction of about 25% in the HA-dbp7 ∆ N162 strain. This deficit was similar to that observed for the dbp7 ∆ strain. Altogether, we conclude that the N-terminal extension of Dbp7 is required for cell growth and optimal 60S r-subunit biogenesis, the impairments caused by the lack of the N-terminal extension being of the same magnitude as those resulting from the complete absence of the Dbp7 protein. Int. J. Mol. Sci. 2023,24, 3460 6 of 21 Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 6 of 20 Figure 3. The N- and C-terminal truncations of Dbp7 induce a deficit in 60S r-subunits. Strains described in the legend of Figure 2 were grown to mid-log phase in liquid SD-Trp medium at 30 °C. Cell extracts were prepared, and 10 A260 units were resolved on 7–50% sucrose gradients. The A254 was continuously measured during gradient fractionation. Sedimentation is from left to right. The peaks of free 40S and 60S r-subunits, 80S free couples/monosomes, and polysomes are indicated. Half-mers are indicated by arrows. 2.3. The N-Terminal Region of Dbp7 Contains a Functional Nuclear Localization Signal Dbp7 is a nucleolar trans-acting factor [37]. To explore the amino acid sequence of Dbp7 for signals targeting the protein to the nucle(ol)us, we used independent prediction methods, such as cNLS Mapper [48], ELM [49], or SeqNLS [50]. These methods predicted both monopartite and bipartite nuclear localization signals (NLSs), with significant high scores only within the N-terminal extension of Dbp7. We selected the region of 31 amino acids contained between residues V48 and S78, which all programs predicted to be part of a putative NLS of Dbp7. To experimentally validate whether or not the N-terminal extension of Dbp7 contained a bona fide NLS, we cloned the sequence corresponding to the first N-terminal 162 amino acids of Dbp7 into a CEN LEU2 plasmid (pADH111-(GA)5-3xyEGFP, see Table S2). In the resulting plasmid, the N-terminal sequence of Dbp7 was fused in frame via a (GA)5 decapeptide linker, with that corresponding to three tandem GFP monomers (3xyEGFP) at the C-terminus (construct hereafter named Dbp7.N162); the fusion construct was expressed from the strong ADH1 promoter. As a functional control, we fused to the 3xyEGFP reporter a variant of the latter sequence, which lacked the sequence corresponding to the selected 31 amino acids (from V48 to S78; hereafter named Dbp7.N162-∆NLS); this fusion was also cloned under the control of the ADH1 promoter in plasmid pADH111, as described above. As a positive control for nuclear targeting, we used the NLS of the SV40 large T-antigen fused similarly to 3xyEGFP. As a negative, primarily cytoplasmic control, we used a construct expressing the (GA)5-3xyEGFP alone. A triple rather than a single yEGFP fusion was used to increase the fluorescence intensity and to ensure dependence on an NLS-mediated transport, thus minimising the passive entry to the nucleus of the different constructs. Each construct was transformed into YKL500, a wild-type strain expressing the nucleolar marker protein Nop58-yEmCherry from its genomic locus. Transformants were grown on Figure 3. The N- and C-terminal truncations of Dbp7 induce a deficit in 60S r-subunits. Strains described in the legend of Figure 2were grown to mid-log phase in liquid SD-Trp medium at 30 ◦C. Cell extracts were prepared, and 10 A 260 units were resolved on 7–50% sucrose gradients. The A 254 was continuously measured during gradient fractionation. Sedimentation is from left to right. The peaks of free 40S and 60S r-subunits, 80S free couples/monosomes, and polysomes are indicated. Half-mers are indicated by arrows. 2.3. The N-Terminal Region of Dbp7 Contains a Functional Nuclear Localization Signal Dbp7 is a nucleolar trans-acting factor [ 37 ]. To explore the amino acid sequence of Dbp7 for signals targeting the protein to the nucle(ol)us, we used independent prediction methods, such as cNLS Mapper [ 48 ], ELM [ 49 ], or SeqNLS [ 50 ]. These methods predicted both monopartite and bipartite nuclear localization signals (NLSs), with significant high scores only within the N-terminal extension of Dbp7. We selected the region of 31 amino acids contained between residues V48 and S78, which all programs predicted to be part of a putative NLS of Dbp7. To experimentally validate whether or not the N-terminal extension of Dbp7 contained a bona fide NLS, we cloned the sequence corresponding to the first N-terminal 162 amino acids of Dbp7 into aCEN LEU2 plasmid (pADH111-(GA) 5 -3xyEGFP, see Table S2). In the resulting plasmid, the N-terminal sequence of Dbp7 was fused in frame via a (GA) 5 decapeptide linker, with that corresponding to three tandem GFP monomers (3xyEGFP) at the C-terminus (construct hereafter named Dbp7.N162); the fusion construct was expressed from the strong ADH1 promoter. As a functional control, we fused to the 3xyEGFP reporter a variant of the latter sequence, which lacked the sequence corresponding to the selected 31 amino acids (from V48 to S78; hereafter named Dbp7.N162- ∆ NLS); this fusion was also cloned under the control of the ADH1 promoter in plasmid pADH111, as described above. As a positive control for nuclear targeting, we used the NLS of the SV40 large T-antigen fused similarly to 3xyEGFP. As a negative, primarily cytoplasmic control, we used a construct expressing the (GA) 5 -3xyEGFP alone. A triple rather than a single yEGFP fusion was used to increase the fluorescence intensity and to ensure dependence on an NLS-mediated transport, thus minimising the passive entry to the nucleus of the different constructs. Each construct was transformed into YKL500, a wild-type strain expressing the nucleolar marker protein Nop58-yEmCherry from its genomic locus. Transformants were grown Int. J. Mol. Sci. 2023,24, 3460 7 of 21 on specific selective SD media to the mid-log phase, whole cell extracts were prepared for Western blot analysis of the expression levels of the constructs, and living cells were observed by fluorescence microscopy. As shown in Figure S4, the proteins corresponding to the different constructs were fairly well expressed in this strain. As shown in Figure 4, the Dbp7.N162-(GA) 5 -3xyEGFP construct displayed mainly a nucleoplasmic localization. This result indicates that the N-terminal domain of Dbp7 is sufficient to drive the nuclear import of the 3xyEGFP reporter, similarly to the NLS of the SV40 large T-antigen. The Dbp7.N162- ∆ NLS-(GA) 5 -3xyEGFP construct was inefficiently directed to the nucleus since the signal remained mostly cytoplasmic, similarly to the signal observed for (GA) 5 -3xyEGFP alone. Altogether, these experiments suggest that the N-terminal sequence of Dbp7, from V48 to S78, which was predicted to include a putative NLS, is indeed part of a bona fide NLS able to target the 3xyEGFP reporter to the nucleoplasm. However, the nucleolar accumulation of Dbp7 might depend on another part of the protein in the helicase core domain or the C-terminal extension. Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 7 of 20 specific selective SD media to the mid-log phase, whole cell extracts were prepared for Western blot analysis of the expression levels of the constructs, and living cells were observed by fluorescence microscopy. As shown in Figure S4, the proteins corresponding to the different constructs were fairly well expressed in this strain. As shown in Figure 4, the Dbp7.N162-(GA)5-3xyEGFP construct displayed mainly a nucleoplasmic localization. This result indicates that the N-terminal domain of Dbp7 is sufficient to drive the nuclear import of the 3xyEGFP reporter, similarly to the NLS of the SV40 large T-antigen. The Dbp7.N162-∆NLS-(GA)5-3xyEGFP construct was inefficiently directed to the nucleus since the signal remained mostly cytoplasmic, similarly to the signal observed for (GA)5- 3xyEGFP alone. Altogether, these experiments suggest that the N-terminal sequence of Dbp7, from V48 to S78, which was predicted to include a putative NLS, is indeed part of a bona fide NLS able to target the 3xyEGFP reporter to the nucleoplasm. However, the nucleolar accumulation of Dbp7 might depend on another part of the protein in the helicase core domain or the C-terminal extension. Figure 4. The N-terminal extension of Dbp7 contains a functional NLS sequence. (A) Strain YKL500, which expresses a yEmCherry-tagged Nop58, was transformed with plasmids expressing from the ADH1 promoter (i) a (GA)5-3xyEGFP reporter alone (Vector). (ii) The NLS sequence of the SV40 large T-antigen fused to the (GA)5-3xyEGFP reporter (SV40-NLS). (iii) The first 162 amino acids of Dbp7 fused in frame to the (GA)5-3xyEGFP reporter (Dbp7.N162). (iv) The previous fragment, but lacking the segment from V48 to S78 (Dbp7.N162(∆NLS)). After transformation, cells were grown in liquid SD-Leu medium at 30 °C and the localisation of the GFP fusions was determined by fluorescence microscopy. Nucleoli were revealed by the nucleolar marker protein Nop58-yEmCherry. Cells were identified under bright field illumination (Visible). Approximately 200 cells were examined for each reporter, and practically all cells gave the same results as the selected cells shown in the pictures. (B) Magnified picture of selected cells expressing the Dbp7.N162 construct fused in frame to the (GA)5-3xyEGFP reporter. Note that the signal does not colocalise with the nucleolus, as was revealed by the Nop58-yEmCherry. The arrows pinpoint the nucleolus (red) and the nucleoplasm (green). Figure 4. The N-terminal extension of Dbp7 contains a functional NLS sequence. ( A ) Strain YKL500, which expresses a yEmCherry-tagged Nop58, was transformed with plasmids expressing from the ADH1 promoter (i) a (GA) 5 -3xyEGFP reporter alone (Vector). (ii) The NLS sequence of the SV40 large T-antigen fused to the (GA) 5 -3xyEGFP reporter (SV40-NLS). (iii) The first 162 amino acids of Dbp7 fused in frame to the (GA) 5 -3xyEGFP reporter (Dbp7.N162). (iv) The previous fragment, but lacking the segment from V48 to S78 (Dbp7.N162( ∆ NLS)). After transformation, cells were grown in liquid SD-Leu medium at 30 ◦ C and the localisation of the GFP fusions was determined by fluorescence microscopy. Nucleoli were revealed by the nucleolar marker protein Nop58-yEmCherry. Cells were identified under bright field illumination (Visible). Approximately 200 cells were examined for each reporter, and practically all cells gave the same results as the selected cells shown in the pictures. ( B ) Magnified picture of selected cells expressing the Dbp7.N162 construct fused in frame to the (GA) 5 -3xyEGFP reporter. Note that the signal does not colocalise with the nucleolus, as was revealed by the Nop58-yEmCherry. The arrows pinpoint the nucleolus (red) and the nucleoplasm (green). Int. J. Mol. Sci. 2023,24, 3460 8 of 21 2.4. The NLS (V48 to S78 Sequence) of Dbp7 Is Required for Optimal Growth but Its Deletion Does Not Affect Polysome Profiles To explore the functional relevance of the NLS present between V48 and S78 residues in Dbp7, we constructed an HA-tagged Dbp7 variant lacking this specific sequence (hereafter named HA-Dbp7 ∆ NLS), which was cloned in YCplac22 and expressed from the cognate promoter of DBP7 in a dbp7 ∆ strain. The protein was detected by Western blotting at levels similar to those of a full-length wild-type HA-Dbp7 (Figures S3 and S5). Then, we studied the growth phenotype of the HA-dbp7 ∆ NLS mutant. A very minor increase in the doubling time in liquid cultures was observed (1.7 h for the HA-dbp7 ∆ NLS strain compared to the 1.5 h for the wild-type HA-DBP7 strain, Figure 5A). Moreover, this strain showed wild-type polysome profiles (Figure 5B). We conclude that Dbp7 does not exclusively rely on the V48 to S78 sequence, predicted to contain an NLS, for nuclear import, as deletion of this sequence does not affect polysome profiles under laboratory conditions and leads only to a very minor effect on cell growth. Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 8 of 20 2.4. The NLS (V48 to S78 Sequence) of Dbp7 Is Required for Optimal Growth but Its Deletion Does Not Affect Polysome Profiles To explore the functional relevance of the NLS present between V48 and S78 residues in Dbp7, we constructed an HA-tagged Dbp7 variant lacking this specific sequence (hereafter named HA-Dbp7∆NLS), which was cloned in YCplac22 and expressed from the cognate promoter of DBP7 in a dbp7∆ strain. The protein was detected by Western blotting at levels similar to those of a full-length wild-type HA-Dbp7 (Figures S3 and S5). Then, we studied the growth phenotype of the HA-dbp7∆NLS mutant. A very minor increase in the doubling time in liquid cultures was observed (1.7 h for the HA-dbp7∆NLS strain compared to the 1.5 h for the wild-type HA-DBP7 strain, Figure 5A). Moreover, this strain showed wild-type polysome profiles (Figure 5B). We conclude that Dbp7 does not exclusively rely on the V48 to S78 sequence, predicted to contain an NLS, for nuclear import, as deletion of this sequence does not affect polysome profiles under laboratory conditions and leads only to a very minor effect on cell growth. Figure 5. The HA-dbp7∆NLS mutation slightly reduces growth but does not affect polysome profiles. (A) Growth of the mutant harbouring the HA-dbp7∆NLS allele as the sole source of Dbp7. Strain JuCY1 was transformed with a plasmid harbouring either the HA-DBP7 or the HA-dbp7∆NLS allele. Cells were grown in a liquid SD-Trp medium, and serial 5-fold dilutions were spotted onto SD-Trp plates, which were incubated at 30 °C for 3 days. The doubling times of the strains grown in liquid SD-Trp medium at 30 °C are indicated. (B) The above strains were grown in liquid SD-Trp to an OD600 of 0.8. Cell extracts were prepared and 10 A260 units of each extract were resolved on 7– 50% sucrose gradients. The A254 was continuously measured and recorded during gradient fractionation. Sedimentation is from left to right. The peaks of free 40S and 60S r-subunits, 80S free couples/monosomes, and polysomes are indicated. 2.5. The N-Terminal Region of Dbp7 Is Necessary for Efficient Nuclear Import To further define the Dbp7 sequences within its N-terminal extension required for nuclear import, we fused different Dbp7 protein variants in frame with the triple yEGFP protein via a (GA)5 decapeptide linker at their C-terminal end and expressed the resulting Figure 5. The HA-dbp7 ∆ NLS mutation slightly reduces growth but does not affect polysome profiles. ( A ) Growth of the mutant harbouring the HA-dbp7 ∆ NLS allele as the sole source of Dbp7. Strain JuCY1 was transformed with a plasmid harbouring either the HA-DBP7 or the HA-dbp7 ∆ NLS allele. Cells were grown in a liquid SD-Trp medium, and serial 5-fold dilutions were spotted onto SD- Trp plates, which were incubated at 30 ◦ C for 3 days. The doubling times of the strains grown in liquid SD-Trp medium at 30 ◦ C are indicated. ( B ) The above strains were grown in liquid SD-Trp to an OD 600 of 0.8. Cell extracts were prepared and 10 A 260 units of each extract were resolved on 7–50% sucrose gradients. The A 254 was continuously measured and recorded during gradient fractionation. Sedimentation is from left to right. The peaks of free 40S and 60S r-subunits, 80S free couples/monosomes, and polysomes are indicated. Int. J. Mol. Sci. 2023,24, 3460 9 of 21 2.5. The N-Terminal Region of Dbp7 Is Necessary for Efficient Nuclear Import To further define the Dbp7 sequences within its N-terminal extension required for nuclear import, we fused different Dbp7 protein variants in frame with the triple yEGFP protein via a (GA) 5 decapeptide linker at their C-terminal end and expressed the resulting constructs from plasmids into the YKL500 strain. Then, the expression of the variants was analysed by Western blotting and their subcellular localisation by fluorescence microscopy. The selected Dbp7 protein variants were the following: a Dbp7 variant protein lacking the V48 to S78 sequence from its N-terminal extension (Dbp7 ∆ NLS) and a Dbp7 variant protein lacking its complete N-terminal extension (Dbp7 ∆ N162). Cells expressing the (GA) 5 -3xyEGFP-tagged wild-type Dbp7 and the (GA) 5 -3xyEGFP reporter alone were included in all analyses as controls. All proteins were expressed, as shown by Western blot analysis (Figure S6). When the subcellular localization of the Dbp7 protein variants was assessed (see Figure 6), we found that the full-length Dbp7-(GA) 5 -3xyEGFP construct was strongly enriched, as expected, in the nucle(ol)us. However, the Dbp7 ∆ NLS-(GA) 5 - 3xyEGFP was detected in both the nucleus and the cytoplasm, and some residual nucleolar localization was observed since the brightest nuclear GFP signals colocalised with the nucleoli stained with Nop58-yEmcherry. Interestingly, the Dbp7 ∆ N162-(GA) 5 -3xyEGFP was detected mainly in the cytoplasm, although some minor nuclear signal could also be observed. Altogether, our results suggest that the N-terminal extension of Dbp7 harbours the sequences required for efficient nuclear import; however, the rest of the protein also contains sequences allowing modest nuclear targeting capacity. Whether this is occurring directly or through a “piggy-back” import process must be clarified. Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 9 of 20 constructs from plasmids into the YKL500 strain. Then, the expression of the variants was analysed by Western blotting and their subcellular localisation by fluorescence microscopy. The selected Dbp7 protein variants were the following: a Dbp7 variant protein lacking the V48 to S78 sequence from its N-terminal extension (Dbp7∆NLS) and a Dbp7 variant protein lacking its complete N-terminal extension (Dbp7∆N162). Cells expressing the (GA)5-3xyEGFP-tagged wild-type Dbp7 and the (GA)5-3xyEGFP reporter alone were included in all analyses as controls. All proteins were expressed, as shown by Western blot analysis (Figure S6). When the subcellular localization of the Dbp7 protein variants was assessed (see Figure 6), we found that the full-length Dbp7-(GA)5-3xyEGFP construct was strongly enriched, as expected, in the nucle(ol)us. However, the Dbp7∆NLS-(GA)5-3xyE- GFP was detected in both the nucleus and the cytoplasm, and some residual nucleolar localization was observed since the brightest nuclear GFP signals colocalised with the nucleoli stained with Nop58-yEmcherry. Interestingly, the Dbp7∆N162-(GA)5-3xyEGFP was detected mainly in the cytoplasm, although some minor nuclear signal could also be observed. Altogether, our results suggest that the N-terminal extension of Dbp7 harbours the sequences required for efficient nuclear import; however, the rest of the protein also contains sequences allowing modest nuclear targeting capacity. Whether this is occurring directly or through a “piggy-back” import process must be clarified. Figure 6. Dbp7 lacking the N-terminal extension fails to accumulate in the nucleus. Strain YKL500, which expressed a yEmCherry-tagged Nop58, was transformed with different plasmids harbouring the (GA)5-3xyEGFP reporter: (i) the reporter alone (Vector), (ii) a full-length Dbp7 fused to the reporter at its C-terminal end (Dbp7), (iii) a Dbp7 variant protein lacking the 31 amino acids (V48 to S78) corresponding to the NLS (Dbp7∆NLS) fused to the reporter at its C-terminal end, and (iv) a Dbp7 variant protein lacking the first 162 amino acids from its N-terminal extension fused to the reporter at its C-terminal end (Dbp7∆N162). Transformants were grown in SD-Leu medium at 30 °C, and the localisation of the GFP-fused proteins was studied by fluorescence microscopy. The nucleolus was revealed by the nucleolar marker protein Nop58-yEmCherry. Cells were identified under bright field illumination (Visible). Approximately 200 cells were examined for each reporter, and practically all cells gave the same results as those selected and shown in the pictures. Figure 6. Dbp7 lacking the N-terminal extension fails to accumulate in the nucleus. Strain YKL500, which expressed a yEmCherry-tagged Nop58, was transformed with different plasmids harbouring the (GA) 5 -3xyEGFP reporter: (i) the reporter alone (Vector), (ii) a full-length Dbp7 fused to the reporter at its C-terminal end (Dbp7), (iii) a Dbp7 variant protein lacking the 31 amino acids (V48 to S78) corresponding to the NLS (Dbp7 ∆ NLS) fused to the reporter at its C-terminal end, and (iv) a Dbp 7 variant protein lacking the first 162 amino acids from its N-terminal extension fused to the reporter at its C-terminal end (Dbp7 ∆ N162). Transformants were grown in SD-Leu medium at 30 ◦ C, and the localisation of the GFP-fused proteins was studied by fluorescence microscopy. The nucleolus was revealed by the nucleolar marker protein Nop58-yEmCherry. Cells were identified under bright field illumination (Visible). Approximately 200 cells were examined for each reporter, and practically all cells gave the same results as those selected and shown in the pictures. Int. J. Mol. Sci. 2023,24, 3460 16 of 21 helicase into pre-ribosomal particles, which is only revealed experimentally in the harsh physicochemical conditions of immunoprecipitation experiments. The fact that the HA- dbp7 ∆ N162 mutant leads to a pre-rRNA processing defect different to that of the dbp7 null strain is consistent with this scenario; thus, binding of the HA-Dbp7 ∆ N162 protein to pre-60S r-particles might interfere differently with 60S r-subunit maturation than the absence of Dbp7. In summary, we have expanded the knowledge regarding Dbp7 function by showing that (i) the N-terminal extension of Dbp7 is required for its in vivo role and harbours at least one functional NLS; (ii) the C-terminal domain of Dbp7 is also required for ribosome biogenesis in vivo ; and (iii) the N- or C-terminal extensions play an important role in the association of Dbp7 with pre-ribosomal particles. We have previously shown that Dbp7 is involved in a functional interaction network comprising the uL3 r-protein and a set of other ribosome assembly factors, including the Npa1-subcomplex (Dbp6, Npa1, Npa2, Nop8, Rsa3) [ 70 , 71 ]. Recently, we have shown that Dbp7 promotes the release of snR190 from early pre-ribosomal particles [ 39 ]. Further studies on Dbp7 are needed to define whether or not its non-conserved extensions are involved in these specific functions. 4. Materials and Methods 4.1. Strains and Plasmids The relevant genotypes of the S. cerevisiae strains used in this study are listed in Supplementary Table S1. Unless otherwise indicated, the strains were derivatives of strain W303 [ 72 ]. Plasmids used in this study are listed in the Supplementary Table S2. Information regarding the construction of the different plasmids and the oligonucleotides that we used to generate them will be available upon request. Escherichia coli XL1-Blue was used for all recombinant DNA techniques. 4.2. Media and Culturing Yeast cells were routinely grown at 30 ◦ C in YPD (1% yeast extract, 2% peptone, 2% glucose) medium or in SD (0.15% yeast nitrogen base, 0.5% ammonium sulphate, 2% glucose) broth supplemented with the appropriate amino acids and bases as nutritional requirements [ 73 ]. All solid media contained 2% agar. Yeast was transformed using the lithium acetate method [ 74 ]. Bacteria were routinely grown in LB (0.5% yeast extract, 1% tryptone, 0.5% NaCl) broth with or without agar, in the presence of 100 µ g/mL ampicillin, when required. To test the in vivo function of the different truncated dbp7 alleles, a dbp7 ∆ strain harbouring plasmid YCplac33-DBP7 (CEN URA3 DBP7) was transformed with YCplac22 (CEN TRP1) plasmids carrying various dbp7 truncated alleles (see Table S2). Trp+transformants were selected and streaked out on plates containing 5-fluoroorotic acid (5-FOA) to counterselect for the URA3 plasmid [ 75 ]. Clones growing on these plates were recovered on fresh SD-Trp plates, and their growth was then assessed on YPD and selective SD-Trp media. 4.3. Nucleic Acid Manipulations DNA amplifications were carried out by PCR. Site-directed mutagenesis was performed following the previously described methodology [ 76 ] and using DNA constructions ligated in plasmid templates. 4.4. Protein Extraction and Western Blotting Analyses Total yeast protein extracts were prepared and analysed by western blotting according to standard procedures [ 77 ]. Different mouse monoclonal antibodies, at the dilutions recommended by the manufacturers, were used: anti-HA (Roche, Basel Switzerland), anti- Pgk1 (Invitrogen, Schwerte, Germany), and anti-GFP (Roche, Basel Switzerland). The Nhp2 protein was detected using a specific rabbit polyclonal antibody [ 78 ]. Secondary goat anti-mouse or anti-rabbit horseradish peroxidase conjugated antibodies (Bio-Rad, Int. J. Mol. Sci. 2023,24, 3460 17 of 21 Hercules, CA, USA) were also used. Protein–antibody complexes were revealed with a chemiluminescence detection kit (Super-Signal West Pico, Pierce, Waltham, MA, USA). 4.5. RNA Extraction and Northern Blotting Analyses Total RNA was prepared and analysed by Northern blotting, exactly as described in [ 78 ]. Immunoprecipitation experiments were performed exactly as described in [ 78 ] using anti-HA agarose beads (EZview TM Red Anti-HA Affinity Gel, Sigma-Aldrich, Burlington, MA, USA). The oligo probes used for Northern blotting were the following: 20S.3 (5 0 TTAAGCGCAGGCCCGGCTGG 3 0 ), 23S.1 (5 0 GATTGCTCGAATGCCCAAAG 3 0 ), and rRNA2.1 (50GGCCAGCAATTTCAAGTTA 3’). 4.6. Microscopy To study the nuclear localisation of Dbp7, the strain YKL500 [ 62 ], which expresses the red fluorescent protein yEmCherry fused to the nucleolar protein Nop58, was transformed with YCplac22-derived plasmids (see Tables S1 and S2) containing different constructs fused to a 3xyEGFP tag. Cells were visualised using an Olympus BX61 fluorescence microscope equipped with a digital camera. Images were analysed using the Cell Sens software (Olympus, Tokio, Japan) and processed with Adobe Photoshop CC 2017 (Adobe Systems Inc., San José, CA, USA). 4.7. Sucrose Gradient Centrifugation Cell extracts for polysome and r-subunit analyses were prepared as previously described [ 79 ], using an ISCO UA-6 system equipped to continuously monitor A 254 . When required, fractions of 0.5 mL were collected from the gradients, and proteins were extracted from each fraction [80] and analysed by Western blotting. 4.8. Reproducibility Unless otherwise specified, experiments were conducted at least three times (independent biological replicates) with at least two (normally three) technical replicates to give a sum of at least six to nine recordings, respectively. In figures, only a representative result is shown; the rest of the independent experiments showed the same results. Supplementary Materials: The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24043460/s1. References [ 81 – 83 ] are cited in the supplementary materials. Author Contributions: Conceptualization, O.H., Y.H., A.K.H., J.d.l.C. and E.V.; methodology, O.H., Y.H., A.K.H., J.d.l.C. and E.V.; software, J.C., O.H., Y.H., A.K.H., J.d.l.C. and E.V.; validation, J.C., Ó.R.-B., O.H., Y.H., A.K.H., J.d.l.C. and E.V.; formal analysis, J.C., O.H., Y.H., A.K.H., J.d.l.C. and E.V.; investigation, J.C., C.D., O.H., Y.H., A.K.H., J.d.l.C. and E.V; resources, Y.H., A.K.H., J.d.l.C. and E.V.; data curation, J.C., O.H., Y.H., A.K.H., J.d.l.C. and E.V.; writing—original draft preparation, J.d.l.C. and E.V.; writing—review and editing, J.C., Ó.R.-B., C.D., O.H., Y.H., A.K.H., J.d.l.C. and E.V.; visualization, J.C., C.D., Ó.R.-B., O.H., Y.H., A.K.H., J.d.l.C. and E.V; supervision, O.H., Y.H., A.K.H., J.d.l.C., and E.V.; project administration, O.H., Y.H., A.K.H., J.d.l.C. and E.V.; funding acquisition, Y.H., A.K.H., J.d.l.C. and E.V. All authors have read and agreed to the published version of the manuscript. Funding: This publication is part of the project R+D+i PID2019-103850-GB-I00, funded by MCIN/ AEI/10.13039/501100011033 to J.d.l.C. We also acknowledge the Andalusian Regional Government (Grant P20_00581, BIO-271 to J.d.l.C. and BIO-210 to E.V.) and the University of Seville (Grant US-1380394 to J.d.l.C.). Research in the Y.H. and A.H. laboratory was funded by ANR (ANR-20- CE12-0026). J.C. was supported by a Ph.D. fellowship (PIF) from the University of Seville. Ó.R.-B. acknowledges a Ph.D. contract (PREDOC PAIDI2020) from the Junta de Andalucía. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: Not applicable. Int. J. Mol. Sci. 2023,24, 3460 18 of 21 Acknowledgments: We thank members of our laboratories for critical reading of this manuscript, technical assistance, and helpful discussions. We also thank A. Díaz-Quintana for his help with the structural analysis of Dbp7. The Henry-Henras team is very grateful to J. Bourdeaux and C. Maheu for their crucial technical support. Conflicts of Interest: The authors declare no conflict of interest. References 1. Wilson, D.N.; Doudna Cate, J.H. The structure and function of the eukaryotic ribosome. Cold Spring Harb. Perspect. Biol. 2012 , 4, a011536. [CrossRef] 2. Kressler, D.; Hurt, E.; Bassler, J. Driving ribosome assembly. Biochim. Biophys. Acta 2010,1803, 673–683. [CrossRef] [PubMed] 3. Woolford, J.L., Jr.; Baserga, S.J. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.Genetics 2013,195, 643–681. [CrossRef] 4. Rodríguez-Galán, O.; García-Gómez, J.J.; de la Cruz, J. Yeast and human RNA helicases involved in ribosome biogenesis: Current status and perspectives. Biochim. Biophys. Acta-Gene Regul. Mech. 2013,1829, 775–790. [CrossRef] [PubMed] 5. Martin, R.; Straub, A.U.; Doebele, C.; Bohnsack, M.T. DExD/H-box RNA helicases in ribosome biogenesis. RNA Biol. 2012 ,10, 4–18. [CrossRef] 6. Mitterer, V.; Pertschy, B. RNA folding and functions of RNA helicases in ribosome biogenesis. RNA Biol. 2022 ,19, 781–810. [CrossRef] [PubMed] 7. Singleton, M.R.; Dillingham, M.S.; Wigley, D.B. Structure and mechanism of helicases and nucleic acid translocases. Annu. Rev. Biochem. 2007,76, 23–50. [CrossRef] 8. Jankowsky, E. RNA helicases at work: Binding and rearranging. Trends Biochem. Sci. 2011,36, 19–29. [CrossRef] 9. Fairman-Williams, M.E.; Guenther, U.P.; Jankowsky, E. SF1 and SF2 helicases: Family matters. Curr. Opin. Struct. Biol. 2010 ,2010, 313–324. [CrossRef] 10. Pyle, A.M. Translocation and unwinding mechanisms of RNA and DNA helicases. Annu. Rev. Biophys. 2008 ,37, 317–336. [CrossRef] 11. Bourgeois, C.F.; Mortreux, F.; Auboeuf, D. The multiple functions of RNA helicases as drivers and regulators of gene expression. Nat. Rev. Mol. Cell. Biol. 2016,17, 426–438. [CrossRef] [PubMed] 12. Jarmoskaite, I.; Russell, R. DEAD-box proteins as RNA helicases and chaperones. Wiley Interdiscip. Rev. RNA 2011 ,2, 135–152. [CrossRef] [PubMed] 13. Jarmoskaite, I.; Russell, R. RNA helicase proteins as chaperones and remodelers. Annu. Rev. Biochem. 2014 ,83, 697–725. [CrossRef] [PubMed] 14. Leitão, A.L.; Costa, M.C.; Enguita, F.J. Unzippers, resolvers and sensors: A structural and functional biochemistry tale of RNA helicases. Int. J. Mol. Sci. 2015,16, 2269–2293. [CrossRef] [PubMed] 15. Jankowsky, E.; Gross, C.H.; Shuman, S.; Pyle, A.M. Active disruption of an RNA-protein interaction by a DExH/D RNA helicase. Science 2000,291, 121–124. [CrossRef] 16. Linder, P.; Jankowsky, E. From unwinding to clamping-the DEAD box RNA helicase family. Nat. Rev. Mol. Cell. Biol. 2011 ,12, 505–516. [CrossRef] 17. Putnam, A.A.; Jankowsky, E. DEAD-box helicases as integrators of RNA, nucleotide and protein binding. Biochim. Biophys. Acta 2013,1829, 884–893. [CrossRef] 18. Schwer, B. A new twist on RNA helicases: DExH/D box proteins as RNPases. Nat. Struct. Biol. 2001,8, 113–116. [CrossRef] 19. Linder, P. Dead-box proteins: A family affair–active and passive players in RNP-remodeling. Nucleic Acids Res. 2006 ,34, 4168–4180. [CrossRef] 20. de la Cruz, J.; Kressler, D.; Linder, P. Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem. Sci. 1999,24, 192–198. [CrossRef] 21. Jankowsky, A.; Guenther, U.P.; Jankowsky, E. The RNA helicase database. Nucleic Acids Res. 2011 ,39, D338–D341. [CrossRef] [PubMed] 22. Rocak, S.; Linder, P. DEAD-box proteins: The driving forces behind RNA metabolism. Nat. Rev. Mol.Cell. Biol. 2004 ,5, 232–241. [CrossRef] [PubMed] 23. Gorbalenya, A.E.; Koonin, E.V. Helicases: Amino acid sequence comparisons and structure-function relationships. Curr. Opin. Struct. Biol. 1993,3, 419–429. [CrossRef] 24. Tanner, N.K.; Linder, P. DExD/H box RNA helicases: From generic motors to specific dissociation functions. Mol. Cell 2001 ,8, 251–262. [CrossRef] 25. Srikant, S. Evolutionary history of ATP-binding cassette proteins. FEBS Lett. 2020,594, 3882–3897. [CrossRef] 26. Sloan, K.E.; Bohnsack, M.T. Unravelling the Mechanisms of RNA Helicase Regulation. Trends Biochem. Sci. 2018 ,43, 237–250. [CrossRef] [PubMed] 27. Banroques, J.; Cordin, O.; Doere, M.; Linder, P.; Tanner, N.K. Analyses of the functional regions of DEAD-box RNA “helicases” with deletion and chimera constructs tested in vivo and In vitro. J. Mol. Biol. 2011,413, 451–472. [CrossRef] Int. J. Mol. Sci. 2023,24, 3460 19 of 21 28. Chang, L.C.; Lee, F.J. The RNA helicase Dhh1p cooperates with Rbp1p to promote porin mRNA decay via its non-conserved C-terminal domain. Nucleic Acids Res. 2012,40, 1331–1344. [CrossRef] 29. Wang, Y.; Guthrie, C. PRP16, a DEAH-box RNA helicase, is recruited to the spliceosome primarily via its nonconserved N-terminal domain. RNA 1998,4, 1216–1229. [CrossRef] 30. van Nues, R.W.; Beggs, J.D. Functional contacts with a range of splicing proteins suggest a central role for Brr2p in the dynamic control of the order of events in spliceosomes of Saccharomyces cerevisiae.Genetics 2001,157, 1451–1467. [CrossRef] 31. Mohr, G.; Del Campo, M.; Mohr, S.; Yang, Q.; Jia, H.; Jankowsky, E.; Lambowitz, A.M. Function of the C-terminal domain of the DEAD-box protein Mss116p analyzed in vivo and In vitro. J. Mol. Biol. 2008,375, 1344–1364. [CrossRef] [PubMed] 32. Mohr, G.; Del Campo, M.; Turner, K.G.; Gilman, B.; Wolf, R.Z.; Lambowitz, A.M. High-throughput genetic identification of functionally important regions of the yeast DEAD-box protein Mss116p. J. Mol. Biol. 2011,413, 952–972. [CrossRef] [PubMed] 33. Kudlinzki, D.; Schmitt, A.; Christian, H.; Ficner, R. Structural analysis of the C-terminal domain of the spliceosomal helicase Prp22. Biol. Chem. 2012,393, 1131–1140. [CrossRef] 34. Roychowdhury, A.; Joret, C.; Bourgeois, G.; Heurgué-Hamard, V.; Lafontaine, D.L.J.; Graille, M. The DEAH-box RNA helicase Dhr1 contains a remarkable carboxyl terminal domain essential for small ribosomal subunit biogenesis. Nucleic Acids Res. 2019 , 47, 7548–7563. [CrossRef] [PubMed] 35. Walbott, H.; Mouffok, S.; Capeyrou, R.; Lebaron, S.; Humbert, O.; van Tilbeurgh, H.; Henry, Y.; Leulliot, N. Prp43p contains a processive helicase structural architecture with a specific regulatory domain. EMBO J. 2010,29, 2194–2204. [CrossRef] 36. Jackson, R.N.; Klauer, A.A.; Hintze, B.J.; Robinson, H.; van Hoof, A.; Johnson, S.J. The crystal structure of Mtr4 reveals a novel arch domain required for rRNA processing. EMBO J. 2010,29, 2205–2216. [CrossRef] 37. Daugeron, M.-C.; Linder, P. Dbp7p, a putative ATP-dependent RNA helicase from Saccharomyces cerevisiae, is required for 60S ribosomal subunit assembly. RNA 1998,4, 566–581. [CrossRef] 38. Aquino, G.R.R.; Hackert, P.; Krogh, N.; Pan, K.T.; Jaafar, M.; Henras, A.K.; Nielsen, H.; Urlaub, H.; Bohnsack, K.E.; Bohnsack, M.T. The RNA helicase Dbp7 promotes domain V/VI compaction and stabilization of inter-domain interactions during early 60S assembly. Nat. Commun. 2021,12, 6152. [CrossRef] 39. Jaafar, M.; Contreras, J.; Dominique, C.; Martín-Villanueva, S.; Capeyrou, R.; Vitali, P.; Rodríguez-Galán, O.; Velasco, C.; Humbert, O.; Watkins, N.J.; et al. Association of snR190 snoRNA chaperone with early pre-60S particles is regulated by the RNA helicase Dbp7 in yeast. Nat. Commun. 2021,12, 6153. [CrossRef] 40. Bernstein, K.A.; Granneman, S.; Lee, A.V.; Manickam, S.; Baserga, S.J. Comprehensive mutational analysis of yeast DEXD/H box RNA helicases involved in large ribosomal subunit biogenesis. Mol. Cell. Biol. 2006,26, 1195–1208. [CrossRef] 41. Letunic, I.; Khedkar, S.; Bork, P. SMART: Recent updates, new developments and status in 2020. Nucleic Acids Res 2021 ,49, D458–D460. [CrossRef] [PubMed] 42. Ishida, T.; Kinoshita, K. PrDOS: Prediction of disordered protein regions from amino acid sequence. Nucleic Acids Res. 2007 ,35, W460–W464. [CrossRef] 43. Linding, R.; Jensen, L.J.; Diella, F.; Bork, P.; Gibson, T.J.; Russell, R.B. Protein disorder prediction: Implications for structural proteomics. Structure 2003,11, 1453–1459. [CrossRef] [PubMed] 44. Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Zidek, A.; Potapenko, A.; et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021,596, 583–589. [CrossRef] [PubMed] 45. Varadi, M.; Anyango, S.; Deshpande, M.; Nair, S.; Natassia, C.; Yordanova, G.; Yuan, D.; Stroe, O.; Wood, G.; Laydon, A.; et al. AlphaFold Protein Structure Database: Massively expanding the structural coverage of protein-sequence space with high-accuracy models. Nucleic Acids Res. 2022,50, D439–D444. [CrossRef] 46. Helser, T.L.; Baan, R.A.; Dahlberg, A.E. Characterization of a 40S ribosomal subunit complex in polyribosomes of Saccharomyces cerevisiae treated with cycloheximide. Mol. Cell. Biol. 1981,1, 51–57. 47. Rotenberg, M.; Moritz, M.; Woolford, J.L., Jr. Depletion of Saccharomyces cerevisiae ribosomal protein L16 causes a decrease in 60S ribosomal subunits and formation of half-mer polysomes. Genes Dev. 1988,2, 160–172. [CrossRef] 48. Kosugi, S.; Hasebe, M.; Tomita, M.; Yanagawa, H. Systematic identification of cell cycle-dependent yeast nucleocytoplasmic shuttling proteins by prediction of composite motifs. Proc. Natl. Acad. Sci. USA 2009,106, 10171–10176. [CrossRef] 49. Kumar, M.; Gouw, M.; Michael, S.; Samano-Sánchez, H.; Pancsa, R.; Glavina, J.; Diakogianni, A.; Valverde, J.A.; Bukirova, D.; Calyseva, J.; et al. ELM-the eukaryotic linear motif resource in 2020. Nucleic Acids Res. 2020,48, D296–D306. [CrossRef] 50. Lin, J.R.; Hu, J. SeqNLS: Nuclear localization signal prediction based on frequent pattern mining and linear motif scoring. PLoS One 2013,8, e76864. [CrossRef] 51. Tang, L.; Sahasranaman, A.; Jakovljevic, J.; Schleifman, E.; Woolford, J.L., Jr. Interactions among Ytm1, Erb1, and Nop7 required for assembly of the Nop7-subcomplex in yeast preribosomes. Mol. Biol. Cell 2008,19, 2844–2856. [CrossRef] [PubMed] 52. Wegrecki, M.; Rodríguez-Galán, O.; de la Cruz, J.; Bravo, J. The structure of Erb1-Ytm1 complex reveals the functional importance of a high-affinity binding between two beta-propellers during the assembly of large ribosomal subunits in eukaryotes. Nucleic Acids Res. 2015,43, 11017–11030. [CrossRef] [PubMed] 53. Cordin, O.; Banroques, J.; Tanner, N.K.; Linder, P. The DEAD-box protein family of RNA helicases. Gene 2006 ,367, 17–37. [CrossRef] [PubMed] Int. J. Mol. Sci. 2023,24, 3460 20 of 21 54. Granneman, S.; Bernstein, K.A.; Bleichert, F.; Baserga, S.J. Comprehensive mutational analysis of yeast DEXD/H box RNA helicases required for small ribosomal subunit synthesis. Mol. Cell. Biol. 2006,26, 1183–1194. [CrossRef] 55. Tanner, N.K.; Cordin, O.; Banroques, J.; Doere, M.; Linder, P. The Q motif: A newly identified motif in DEAD box helicases may regulate ATP binding and hydrolysis. Mol. Cell 2003,11, 127–138. [CrossRef] 56. Rocak, S.; Emery, B.; Tanner, N.K.; Linder, P. Characterization of the ATPase and unwinding activities of the yeast DEAD-box protein Has1p and the analysis of the roles of the conserved motifs. Nucleic Acids Res. 2005,33, 999–1009. [CrossRef] 57. Schmid, S.R.; Linder, P. Translation initiation factor 4A from Saccharomyces cerevisiae: Analysis of residues conserved in the D-E-A-D family of RNA helicases. Mol. Cell. Biol. 1991,11, 3463–3471. 58. Hotz, H.-R.; Schwer, B. Mutational analysis of the yeast DEAH-box splicing factor Prp16. Genetics 1998 ,149, 807–815. [CrossRef] 59. Schwer, B.; Meszaros, T. RNA helicase dynamics in pre-mRNA splicing. EMBO J. 2000,19, 6582–6591. [CrossRef] 60. Kossen, K.; Karginov, F.V.; Uhlenbeck, O.C. The carboxy-terminal domain of the DExDH protein YxiN is sufficient to confer specificity for 23S rRNA. J. Mol. Biol. 2002,324, 625–636. [CrossRef] 61. Schneider, S.; Schwer, B. Functional domains of the yeast splicing factor Prp22p. J. Biol. Chem. 2001 ,276, 21184–21191. [CrossRef] 62. Pillet, B.; García-Gómez, J.J.; Pausch, P.; Falquet, L.; Bange, G.; de la Cruz, J.; Kressler, D. The dedicated chaperone Acl4 escorts ribosomal protein Rpl4 to its nuclear pre-60S assembly site. PLoS Genet. 2015,11, e1005565. [CrossRef] [PubMed] 63. Bordonné, R. Functional characterization of nuclear localization signals in yeast Sm proteins. Mol. Cell. Biol. 2000 ,20, 7943–7954. [CrossRef] [PubMed] 64. Huang, J.H.; Ku, W.C.; Chen, Y.C.; Chang, Y.L.; Chu, C.Y. Dual mechanisms regulate the nucleocytoplasmic localization of human DDX6. Sci. Rep. 2017,7, 42853. [CrossRef] [PubMed] 65. Edwalds-Gilbert, G.; Kim, D.H.; Silverman, E.; Lin, R.J. Definition of a spliceosome interaction domain in yeast Prp2 ATPase. RNA 2004,10, 210–220. [CrossRef] 66. Martin, A.; Schneider, S.; Schwer, B. Prp43 is an essential RNA-dependent ATPase required for release of lariat-intron from the spliceosome. J. Biol. Chem. 2002,277, 17743–17750. [CrossRef] 67. Mouffok, S.; Capeyrou, R.; Belhabich-Baumas, K.; Joret, C.; Henras, A.K.; Humbert, O.; Henry, Y. The G-patch activators Pfa1 and PINX1 exhibit different modes of interaction with the Prp43 RNA helicase. RNA Biol. 2021,18, 510–522. [CrossRef] 68. Absmeier, E.; Wollenhaupt, J.; Mozaffari-Jovin, S.; Becke, C.; Lee, C.T.; Preussner, M.; Heyd, F.; Urlaub, H.; Luhrmann, R.; Santos, K.F.; et al. The large N-terminal region of the Brr2 RNA helicase guides productive spliceosome activation. Genes Dev. 2015 ,29, 2576–2587. [CrossRef] 69. Silverman, E.J.; Maeda, A.; Wei, J.; Smith, P.; Beggs, J.D.; Lin, R.J. Interaction between a G-patch protein and a spliceosomal DEXD/H-box ATPase that is critical for splicing. Mol. Cell. Biol. 2004,24, 10101–10110. [CrossRef] 70. de la Cruz, J.; Lacombe, T.; Deloche, O.; Linder, P.; Kressler, D. The putative RNA helicase Dbp6p functionally interacts with Rpl3p, Nop8p and the novel trans-acting factor Rsa3p during biogenesis of 60S ribosomal subunits in Saccharomyces cerevisiae. Genetics 2004,166, 1687–1699. [CrossRef] 71. Rosado, I.V.; Dez, C.; Lebaron, S.; Caizergues-Ferrer, M.; Henry, Y.; de la Cruz, J. Characterization of Saccharomyces cerevisiae Npa2p (Urb2p) reveals a low-molecular-mass complex containing Dbp6p, Npa1p (Urb1p), Nop8p, and Rsa3p involved in early steps of 60S ribosomal subunit biogenesis. Mol. Cell. Biol. 2007,27, 1207–1221. [CrossRef] [PubMed] 72. Thomas, B.J.; Rothstein, R. Elevated recombination rates in transcriptionally active DNA. Cell 1989 ,56, 619–630. [CrossRef] [PubMed] 73. Burke, D.; Dawson, D.; Stearns, T. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2000. 74. Gietz, D.; St. Jean, A.; Woods, R.A.; Schiestl, R.H. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 1992,20, 1425. [CrossRef] [PubMed] 75. Sikorski, R.S.; Boeke, J.D. In vitro mutagenesis and plasmid shuffling: From cloned gene to mutant yeast. Methods Enzymol. 1991 , 194, 302–318. 76. Ho, S.N.; Hunt, H.D.; Horton, R.M.; Pullen, J.K.; Pease, L.R. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 1989,77, 51–59. [CrossRef] 77. Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989. 78. Joret, C.; Capeyrou, R.; Belhabich-Baumas, K.; Plisson-Chastang, C.; Ghandour, R.; Humbert, O.; Fribourg, S.; Leulliot, N.; Lebaron, S.; Henras, A.K.; et al. The Npa1p complex chaperones the assembly of the earliest eukaryotic large ribosomal subunit precursor. PLoS Genet. 2018,14, e1007597. [CrossRef] 79. Kressler, D.; de la Cruz, J.; Rojo, M.; Linder, P. Fal1p is an essential DEAD-box protein involved in 40S-ribosomal-subunit biogenesis in Saccharomyces cerevisiae.Mol. Cell. Biol. 1997,17, 7283–7294. [CrossRef] 80. de la Cruz, J.; Kressler, D.; Rojo, M.; Tollervey, D.; Linder, P. Spb4p, an essential putative RNA helicase, is required for a late step in the assembly of 60S ribosomal subunits in Saccharomyces cerevisiae.RNA 1998,4, 1268–1281. [CrossRef] 81. Gietz, R.D.; Sugino, A. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking sixbase pair restriction sites. Gene 1988,74, 527–534. [CrossRef] Int. J. Mol. Sci. 2023,24, 3460 21 of 21 82. Koch, B.; Mitterer, V.; Niederhauser, J.; Stanborough, T.; Murat, G.; Rechberger, G.; Bergler, H.; Kressler, D.; Pertschy, B. Yar1 protects the ribosomal protein Rps3 from aggregation. J. Biol. Chem. 2012,287, 21806–21815. [CrossRef] 83. Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera-a visualization system for exploratory research and analysis. J. Comput. Chem. 2004,25, 1605–1612. [CrossRef] [PubMed] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.