Tonic arterial contraction mediated by L-type Ca2+ channels requires sustained Ca2+ influx, G protein-associated Ca2+ release, and RhoA/ROCK activation

1 Tonic arterial contraction mediated by L-type Ca2+ channels requires sustained Ca2+ influx, G protein-associated Ca2+ release, and RhoA/ROCK activation Miguel Fernández-Tenorio**, Cristina Porras-González, Antonio Castellano, José López-Barneo and Juan Ureña* Instituto de Biomedicina de Sevilla (IBIS) and Departamento de Fisiología Médica y Biofísica, Hospital Universitario Virgen del Rocío/CSIC/Universidad de Sevilla, Sevilla, Spain ** Present address: Department of Physiology, University of Bern, Buehlplatz 5, CH- 3012 Bern, Switzerland *Corresponding author: Dr. Juan Ureña Instituto de Biomedicina de Sevilla Edificio IBiS. Campus Hospital Universitario Virgen del Rocío, Avenida Manuel Siurot s/n, E-41013, Sevilla, SPAIN Phone: (34)-955-923060 Email addresses: [email protected] ABSTRACT 2 KCl-evoked sustained contraction requires L-type Ca2+ channel activation, metabotropic Ca2+ release from the sarcoplasmic reticulum (mechanism denoted Calcium Channel-Induced Ca2+ Release) and RhoA/Rho associated kinase activation. Although high K+ solutions are used to depolarize myocytes, these solutions can stimulate other signalling pathways such as those triggered by the activation of muscarinic and purinergic receptors. The present study examines the functional role of Calcium Channel-Induced Ca2+ Release under pharmacological activation of L-type Ca2+ channel without significant membrane depolarization. It also analyzes the role of the “steady-state” Ca2+ influx through L-type Ca2+ channels on myocyte sustained contraction. Measurement of contractility in arterial rings was done on a vessel myograph. Membrane potential was measured by fluorescence techniques loading intact myocytes with a membrane potential sensitive dye, and a reversible permeabilization method was used to load myocytes in intact arteries with GDPS and Cav1.2 Small interfering RNA (siRNA). We conclude that similar to depolarization, FPL64176 (2,5- Dimethyl-4-[2-(phenylmethyl)benzoyl]-1H-pyrrole-3-carboxylic acid methyl ester), an L-type Ca2+ channel agonist without effect on membrane potential, evoked sustained contraction via G-protein induced Ca2+ release from the sarcoplasmic reticulum and RhoA/Rho associated kinase activation. Tonic myocyte contractions mediated by L- type Ca2+ channel activation required sustained Ca2+ influx through the channels and Ca2+ uptake by the sarcoplasmic reticulum. Because L-type Ca2+ channels participate in numerous pathophysiological processes mediated by maintained arterial contraction, our data could help to optimize therapeutic treatment of arterial vasospasm. Keywords: L-type Ca2+ channel, FPL64176, sarcoplasmic reticulum, basilar artery, vasoconstriction. 3 1. Introduction Elevation of intracellular calcium concentration ([Ca2+]i) is a major variable that regulates contraction of vascular smooth muscle (VSM). The rise of [Ca2+]i can be mediated by Ca2+ influx from the extracellular medium or Ca2+ release from the sarcoplasmic reticulum (SR) after activation of inositol 1,4,5-trisphosphate (InsP3) and ryanodine receptors (Bolton, 1979). The SR is also specialized in Ca2+ storage by removing Ca2+ from the cytoplasm via SR Ca2+-ATPase (SERCA). Besides exerting direct control of myosin light chain (MLC) phosphorylation, cytosolic Ca2+ also influences VSM contraction through enhancement of the sensitivity of the contractile apparatus, a process called “Ca2+ sensitization”, which is mediated by the small monomeric G-protein RhoA and its target Rho-associated kinase (ROCK). An important pathway for Ca2+ influx in VSM are L-type voltage-dependent Ca2+ channels (VGCCs) which can interact with the SR. In recent years a new SR Ca2+ release mechanism, depolarization-induced Ca2+ release (DICR), has been described (del Valle- Rodríguez et al., 2003; Ganitkevich et al., 1993; Itoh et al., 1992; Liu et al., 2009; Mahaut-Smith et al., 1999). DICR refers to Ca2+ release from the SR in the absence of any transmembrane Ca2+ influx, and takes place by means of a metabotropic pathway that involves G-protein/phospholipase C (PLC) activation and subsequent synthesis of InsP3 (Araya et al., 2003; del Valle-Rodríguez et al., 2006). We have proposed that VGCCs play an important role in the metabotropic coupling of membrane depolarization to SR Ca2+ release in VSM cells (del Valle-Rodríguez et al., 2003; Fernández-Tenorio et al., 2010; Ureña et al., 2007). We have shown that this mechanism, denoted as CCICR (Calcium Channel-Induced Calcium Release), participates in the maintenance of the KCl-evoked contraction through activation of the RhoA/ROCK sensitization pathway (Fernández-Tenorio et al., 2011). In these 4 experiments a high KCl solution was used to depolarize myocytes and to activate VGCCs, hence it could be argued that some of the effects of high external K+ were due to stimulation of other complex cell signalling systems rather than to VGCCs activation. For instance, KCl can influence G-protein coupled receptors independently of the change in membrane potential (Pitt et al., 2005), and KCl-evoked depolarization can induce direct control of G-protein coupled receptors (Ben-Chaim et al., 2006; Mahaut- Smith et al., 2008). Here, we have studied the functional role of CCICR when VGCCs are activated pharmacologically, without the need of membrane depolarization, using FPL64176 (2,5-Dimethyl-4-[2-(phenylmethyl)benzoyl]-1H-pyrrole-3-carboxylic acid methyl ester) (Rampe and Lacerda, 1991), a Ca2+ channel agonist that facilitates CCICR in basilar arteries (del Valle-Rodríguez et al., 2003, 2006). Because at depolarized voltages (in a potential range intermediate between current activation and complete inactivation) a population of VGCC allows a “steady state” Ca2+ influx via a so-called VGCC window current (Fleischmann et al., 1994), we have also investigated whether this residual Ca2+ current influences sustained arterial contraction. We report that, as observed in the response to KCl, G-protein mediated Ca2+ release from the SR and RhoA/ROCK sensitization pathway participates in the sustained contraction evoked by pharmacological activation of VGCCs. Our results also show that long and maintained depolarization-evoked contractions require Ca2+ influx through VGCCs and Ca2+ uptake by the SR. 2. Materials and methods 2.1. Preparation of dispersed basilar myocytes Rats were housed in a temperature-controlled room on a 12 h light-dark cycle and provided with access to food and water ad libitum. All animals and experimental 5 protocols were in accordance with guidelines established by Spanish legislation (RD 1201/2005). Experiments were approved by the Ethics Committee of the University of Seville. Adult Wistar rats (250-300 g) were anesthetized, decapitated and the brains were rapidly extracted and placed in cold Hank’s solution. Basilar arteries were dissected, cut into pieces and incubated at 4°C for 3h and then in Hank’s solution containing 12.46 IU/ml papain, 620.4 IU/ml collagenase, and 1 mg/ml bovine serum albumin (BSA), at 37°C for 10 min. Cells were mechanically dispersed and plated on coverslips and stored at room temperature until use. 2.2. Confocal microscopy and immunocytochemistry Isolated cells were placed on coverslips and fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) solution for 20 min. Subsequently, cells were rinsed in this solution and incubated 1 h in non-specific binding solution (PBS, 10% fetal bovine serum, 1 mg/ml BSA, 0.1% Triton X-100). We used mouse antiRhoA antibody (Santa Cruz, EE.UU) and rabbit anti-mouse conjugated to Fluorescein isothiocyanate (FITC) (Sigma-Aldrich, EE.UU) secondary antibody to stain RhoA. Cells were incubated for 1 h at room temperature in mouse anti-RhoA diluted 1:200 in non-specific binding solution. Cells were rinsed in PBS and incubated for 1 h in rabbit anti-mouse FITC diluted 1:1000 in non-specific binding solution. The cell nucleus was marked using propidium iodide (1 µg/ml). Finally, coverslips were rinsed in PBS and mounted onto slides with DPX(casa comercial ). Fluorescence was observed using a confocal microscope (TCS SP2, Leica). Excitation was done with an Argon-Kripton laser (488 nm) and the emitted fluorescence (500-535 nm) was recorded through an oil immersion objective (40x1.25). 6 2.3. Measurement of contractility in arterial rings Arteries were cleaned of connective tissue, cut in rings (~2 mm) and mounted on a small vessel myograph (Danish Myo Thecnology, Aarhus, Denmark), to measure isometric tension, connected to a digital recorder (AcqKnowledge 3.8.1, BIOPAC System). The rings were placed on a chamber filled with the Kreb´s solution and bubbled with 95% O2 and 5% CO2 at pH 7.4. Before the experiments, the segments were subjected to an optimal tension (90% of tension equivalent to an intramural pressure of 100 mm Hg) and stabilized for at least 1 h. All the drugs used were added directly to the chamber while vessel tension was monitored. Experiments were performed at 30 ºC. 2.4. Simultaneous measurement of intracellular [Ca2+] and arterial diameter. Experiments in intact arteries were done using rat basilar arteries incubated for 1 h in Hank´s solution containing 4 µM Fura-2 AM at room temperature. Arteries were cannulated at each end in a temperature-controlled perfusion chamber (Living Systems Instrumentation), pressurized to 60 mmHg, and perfused with standard Kreb´s solution (5 ml/min, 37 ºC) for 40 min to allow stabilization. An optical-based measuring system (Myocam, IonOptix Corporation), coupled to an inverted microscope (Axiovert 35 Zeiss), was used for simultaneous monitoring of Ca2+concentration and outer arterial diameter. The Fura-2 loaded artery was alternately excited at 340 or 380 nm and [Ca2+] was monitored by the 340/380 ratio of the fluorescence intensities measured at 510 nm. Fluorescence was background-corrected. Arterial diameter and [Ca2+] signals were digitized at 2 Hz and analyzed using IonWizard edge-detection software (IonOptix Corporation). 7 2.5. Reversible arterial permeabilization Reversible permeabilization was achieved by a modification of previous methods (Kobayashi et al., 1989; Lesh et al., 1995). To load arteries with the Cav1.2 Small interfering RNA (siRNA), vessels were incubated in the following sequence of solutions maintained at 4 ºC (in mM): 1) EGTA 10, KCl 120, ATP 5, MgCl2 2, TES (N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid ) 20 (pH 6.8; 20 min); 2) KCl 120, ATP 5, MgCl2 2, TES 20 and 20 nM of Cav1.2 siRNA (pH 6.8; 3 h); and 3) KCl 120, ATP 5, MgCl2 10, TES 20 and 20 nM of Cav1.2 siRNA (pH 6.8; 30 min). Subsequently, arteries were bathed in a fourth solution containing (in mM) NaCl 140, KCl 5, MgCl2 10, glucose 5, and MOPS (3-(N-morpholino)propanesulfonic acid) 2 (pH 7.1, 22°C) in which [Ca2+] was gradually increased from 0.01 to 0.1 to 1.8 mM every 15 min. The rings were then incubated for 1-7 days in DMEM/F-12 culture medium (supplemented with 1 mM L-glutamine, 50 U/ml penicillin, and 50 mg/ml streptomycin) and maintained at 37 °C, in a 5% CO2 atmosphere. The medium was changed every day. This reversible permeabilization method was also used to load arteries with GDPβS. In these experiments 10 mM GDPβS was used in 2) and 3), instead of the Cav1.2 siRNA. 2.6. Conventional and real time RT-PCR Total RNA was extracted, from at least 3 basilar arteries per experiment, using the Nucleospin RNA II kit (Macherey-Nagel). Total RNA was reverse transcribed (to obtain cDNA) using the Superscript II RNase H- RT kit (Invitrogen). Relative quantification of gene expression was performed by real-time PCR (qRT-PCR) using the SYBR Green Master Mix (Applied Biosystems) with the ABI Prism 7000 or 7500 Sequence Detection Systems (Applied Biosystems). Cycle threshold (Ct) values were 8 normalized to Ct values of the ribosomal RNA 18S, used as endogenous gene. Oligonucleotide sequences to Cav1.2 were: Forward 5’TCATCTTCAGCCCAAACAACAG3’ and Reverse 5’TTGGTGAAGATCGTGTCTTGAC3’. 2.7. Determination of membrane potential Changes in membrane potential were measured using the potentiometric fluorescence dye DiBAC4 (3) (bis-(1,3-dibutylbarbituric acid)trimethine oxonol). Membrane depolarization evokes the dye influx into the myocytes and an increase in emitted fluorescence. Isolated smooth muscle cells were loaded with the dye at 37 ºC for 10 min. After loading, cells were placed in a chamber filled with phosphate saline solution (PSS). Fluorescence intensities were recorded every 1 s and background signal was subtracted. Fluorescence intensities emitted at an excitation wavelength of 488 nm were obtained using an inverted microscope (Zeiss Axiovert 200). 2.8 Cytosolic Ca2+ measurements in isolated myocytes. Myocytes were incubated in Hanks’ solution with 1.4 µM Fura 2-AM for 15 min at room temperature. A coverslip with cells was placed on a recording chamber mounted on the stage of an inverted microscope (Axiovert35, Zeiss) equipped with epifluorescence and photometry. Alternating excitation wavelengths of 340 and 380 nm were used, and background fluorescence was subtracted before obtaining the F340/F380 ratio. Experiments were performed at room temperature (22°C). 2.9. Solutions The composition of Hank’s solution (in mM) was: NaCl 125, KCl 5.36, NaHCO3 5, Na2HPO4 0.34, KH2PO4 0.44, glucose 10, sucrose 1.45, and Hepes 10, pH 7.4. The 9 composition of PBS solution (in mM) was: NaCl 137, KCl 2.68, Na2HPO4 4.02, KH2PO4 1.76, pH 7.4. The composition of PSS solution (in mM) was: NaCl 140, KCl 5, CaCl2 2.5, MgCl2 1, Hepes 10, glucose 10, pH 7,4. The composition of Kreb´s solution (in mM) was: NaCl 119, KCl 4.7, KH2HPO4 1.17, NaHCO3 24, CaCl2 2.5, MgSO4 1.17, glucose 5.5. The 70 K+ (70K) and 120 K+ (120K) solution were obtained by replacing 70 mM and 120 mM of NaCl with KCl. In nominally 0Ca2+ solution CaCl2 was omitted ([Ca2+] ≈ 7 μM) and the 0Ca2+ solution was obtained by substituting Mg2+ for Ca2+ and with 1 mM EGTA added ([Ca2+]i < 100 nM). [Ca2+] contained in these solutions was measured using a calcium ion activity electrode (Orion Calcium Electrode, Thermo, Electron Corp., Beverly MA). 2.10. Statistical analysis Data are expressed as mean ± S.E.M. and the statistical significance was estimated using the Student’s t test. Values of P < 0.05 were considered significant. 16 sustained component of the 70K-evoked contraction was markedly reduced, leaving unaffected the phasic component (Fig. 7B and C). The tonic component of the depolarization-evoked contraction was restored after SR refilling, once arterial rings were treated with an external solution containing 2.5 mM Ca2+. These results strengthen the idea that the sustained component of the depolarization-evoked contraction requires Ca2+ influx through VGCCs from the extracellular medium, and Ca2+ uptake and release from the SR (see Fernández-Tenorio et al., 2011). 17 4. Discussion In this paper we show that, similar to membrane depolarization with KCl, application of FPL64176, an agonist that activates VGCCs without changing the membrane potential in VSM cells, can induce sustained arterial contractions mediated by G-protein activation, Ca2+ release from the SR and RhoA/ROCK activation. Our results also suggest that the sustained contraction (induced either by FPL64176 or membrane depolarization) requires Ca2+ influx through VGCCs to refill intracellular stores. High KCl is often used as a tool to activate VGCCs by changing the K+ equilibrium potential and clamping membrane potential above resting level. However, the effect of KCl can be questionable because this solution can stimulate various membrane proteins independently of changes in membrane potential. It is known that Na+,K+-ATPase activity (Beaugé and Glynn, 1980) and ligand-dependent activation of P2Y receptors (Pitt et al., 2005) are regulated by membrane potential. It has also been shown that muscarinic receptors have intrinsic voltage dependence (Ben-Chaim et al., 2006; Liu et al., 2009), and that there are membrane voltage sensors which cause calcium release from intracellular stores mediated by G-protein/PLC/InsP3, independently of calcium influx (De Crescenzo et al., 2006; Ryglewski et al., 2007). Our results show that similar to KCl (Fernández-Tenorio et al., 2011), FPL64176, a VGCCs activator with no effect on membrane potential, can contract arterial rings by activating RhoA/ROCK through a metabotropic pathway. Several lines of evidence suggest that the FPL64176-evoked contraction is mediated by Ca2+channel-dependent metabotropic Ca2+ release from the SR (CCICR) and RhoA/ROCK activation: a) FPL64176-induced arterial ring contraction presents an initial and rapid (phasic) component followed by an almost sustained or tonic component. The latter component is reduced by SERCA and ryanodine receptor inhibitors, thus suggesting that SR Ca2+ 18 uptake and release participate in the maintenance of the FPL64176-evoked tonic contraction; b) FPL64176-evoked arterial ring contraction is reduced in reversibly permeabilized arteries loaded with GDPS, a G protein inhibitor, while caffeine-evoked contraction remains unaltered; c) In immunostained isolated myocytes, activated RhoA is redistributed and translocated to the plasma membrane after FPL64176 treatment; d) Pharmacological inhibition of ROCK (a downstream effector of RhoA) markedly inhibits the tonic phase of the FPL64176-evoked arterial rings contraction. Altogether these data support the view that, similar to KCl (Fernández-Tenorio et al., 2011), the FPL64176-evoked sustained contraction requires, at least in part, G-protein mediated Ca2+ release from the SR and RhoA/ROCK activation. As FPL64176 is a VGCCs agonist that potentiate CCICR (del Valle-Rodríguez et al., 2006), our results suggest that this mechanism play an important role in the maintenance of the depolarizationevoked contraction, minimizing the possible unspecific effects on vascular contraction of the depolarization-evoked by KCl solutions. Although in previous papers (Fernández-Tenorio et al., 2010, 2011) we suggested that Ca2+ influx through VGCCs was essential for the depolarization-evoked SR calcium release and arterial contraction, the role of depolarization level on arterial contraction was not tested. The results in this report show that long-lasting depolarizations of moderate amplitude (application of 70K external solution) can evoke prolonged and sustained arterial ring contraction. In contrast, isometric force markedly declines with time when myocytes or arterial rings were subjected to stronger depolarizations (application of 120K external solution). These results are in agreement with previous observations showing sustained rises in [Ca2+]i in voltage-clamped myocytes stimulated with long depolarizations of small amplitude, while larger depolarizations elicited transient changes in [Ca2+]i (Fleischmann et al., 1994). The role 19 of Ca2+ influx through VGCCs on the depolarization-evoked contraction has also been confirmed in reversibly permeabilized arteries treated with the Cav1.2 siRNA and in pharmacological experiments. In precontracted arterial rings a marked vasorelaxant effect was present when Ca2+ influx was inhibited with Ni2+, Cd2+ and nifedipine. These observations suggest that although VGCCs mainly become inactivated during sustained depolarizations, a small Ca2+ influx through VGCCs can still be present. Steady-state currents through VGCCs (“window currents”) have been reported at moderately depolarized membrane potentials in cerebral artery smooth muscle cells (Langton and Standen, 1993; Rubart et al., 1996). In agreement with this hypothesis, we have described distinct inhibitory effects of nifedipine on the phasic and tonic components of the depolarization-evoked contraction, suggesting that the affinity of dihydropyridines for the VGCCs depends on the channel conformational state (Fernández-Tenorio et al., 2011). When the channel is open, the antagonist concentration needed to block is much higher than when the channel is in the inactivated state or switching between the open and inactivated states (Bean, 1984). In addition, as the SR ATPase inhibition with CPA selectively reduced the sustained component of the depolarization-evoked contraction, our results suggest that Ca2+ entering through VGCCs during long depolarizations could be stored in the SR and, in turn, released by the CCICR mechanism. Therefore, it is possible that a residual transmembrane Ca2+ influx, without effect on the contractile machinery per se, contributes to the refilling of the peripherally located SR, regions where membranes of the plasmalemma and the superficial SR come close together (van Breemen et al., 1995). Accumulation of Ca2+ in the SR would then allow the subsequent release of enough Ca2+ to activate or sensitize the contractile apparatus. 20 5. Conclusion Our results indicate that depolarization or pharmacological VGCCs activation can evoke sustained arterial contraction through G-protein/SR release/RhoA/ROCK pathway. This mechanism requires continuous Ca2+ influx through VGCCs to maintain Ca2+ levels in the SR. As sustained VSM depolarization and VGCC activation mediate numerous pathophysiological processes, our data could help to optimize therapeutic treatment for clinical conditions where Ca2+ channels antagonists are recommended (Abernethy and Schwartz, 1999). Acknowledgements This work was supported by grant PI060137 and Red RECAVA of the Spanish Ministry of Health, and by the “Proyecto de Excelencia (P08-CTS-03530)” of the “Consejería de Innovación y Ciencia de la Junta de Andalucía" and European Union. We also acknowledge the support of the Botin Foundation. Authors wish to thank Dr. Konstantin Levitsky (Instituto de Biomedicina de Sevilla) for technical help with confocal microscopy. References Abernethy, D.R., Schwartz, J.B.,1999. Calcium-antagonist drugs. N. Engl. J. Med. 341, 1447-1457. Araya, R., Liberona, J.L., Cardenas, J.C., Riveros, N., Estrada, M., Powell, J.A., Carasco, M.A., Jaimovich, E., 2003. Dihydropyridine receptors as voltage sensors for a depolarization-evoked, IP3R-mediated, slow calcium signal in skeletal muscle cells. J. Gen. Physiol. 121, 3-16. Bean, B.P., 1984. Nitrendipine block of cardiac calcium channels: high-affinity binding 21 to the inactivated state. Proc. Natl. Acad. Sci. USA. 81, 6388-6392. Beaugé, L.A., Glynn, I.M., 1980. The equilibrium between different conformations of the unphosphorylated sodium pump: effects of ATP and of potassium ions, and their relevance to potassium transport. J. Physiol. 299, 367-383. Ben-Chaim, Y., Chanda, B., Dascal, N., Bezanilla, F., Parnas, I., Parnas, H., 2006. Movement of 'gating charge' is coupled to ligand binding in a G-protein-coupled receptor. Nature 444, 106-109. Bolton, T.B., 1979. Mechanisms of action of transmitters and other substances on smooth muscle. Physiol. Rev. 59, 606-718. Calderón-Sánchez, E., Fernández-Tenorio, M., Ordóñez, A., López-Barneo, J., Ureña, J., 2009. Hypoxia inhibits vasoconstriction induced by metabotropic Ca2+ channelinduced Ca2+ release in mammaliam coronary arteries. Cardiov. Res. 82, 115-124. Collier, M.L., Ji, G., Wang, Y., Kotlikoff, M.I., 2000. Calcium-induced calcium release in smooth muscle: loose coupling between the action potential and calcium release. J. Physiol. 115, 653-662. De Crescenzo, V., Fogarty, K.E., Zhuge, R., Tuft, R.A., Lifshitz, L.M., Carmichael, J., Bellvé, K.D., Baker, S.P., Zissimopoulos, S., Lai, F.A., Lemos, J.R., Walsh, J.V. Jr., 2006. Dihydropyridine receptors and type 1 ryanodine receptors constitute the molecular machinery for voltage-induced Ca2+ release in nerve terminals. J. Neurosci. 26, 7565-7574. del Valle-Rodríguez, A., López-Barneo, J., Ureña, J., 2003. Ca2+ channel-sarcoplasmic reticulum coupling: a mechanism of arterial myocyte contraction without Ca2+ influx. EMBO J. 22, 4337- 4345. del Valle-Rodríguez, A., Calderón, E., Ruiz, M., Ordóñez, A., López-Barneo, J., Ureña, J., 2006. Metabotropic Ca2+ channel-induced Ca2+ release and ATP-dependent 22 facilitation of arterial myocyte contraction. Proc. Natl. Acad. Sci. USA. 103, 4316- 4321. Fernández-Tenorio, M., González-Rodríguez, P., Porras, C., Castellano, A., Moosmang, S., Hofmann, F., Ureña, J., López-Barneo, J., 2010. Genetic ablation of L-type Ca2+ channels abolishes depolarization-induced Ca2+ release in arterial smooth muscle. Circ. Res. 106, 1285-1289. Fernández-Tenorio, M., Porras-González, C., Castellano, A., del Valle-Rodríguez, A., López-Barneo, J., Ureña, J., 2011. Metabotropic regulation of RhoA/Rhoassociated kinase by L-type Ca2+ channels: new mechanism for depolarizationevoked mammalian arterial contraction. Circ. Res. 108, 348-357. Fleischmann, B.K., Murray, R.K., Kotlikoff, M.I., 1994. Voltage-window for sustained elevation of cytosolic calcium in smooth muscle cells. Proc. Nat. Acad. Sci. USA. 91, 11914-11918. Ganitkevich, V.Ya., Isenberg, G., 1993. Membrane potential modulates inositol 1,4,5- trisphosphate-mediated Ca2+ transients in guinea-pig coronary myocytes. J. Physiol. 470, 35-44. Itoh, T., Seki, N., Suzuki, S., Ito, S., Kajikuri, J., Kuriyama, H., 1992. Membrane hyperpolarization inhibits agonist-induced synthesis of inositol 1,4,5-trisphosphate in rabbit mesentery artery. J. Physiol. 451, 307-328. Kobayashi, S., Kitazawa, T., Somlyo, A.V., Somlyo, A.P., 1989. Cytosolic heparin inhibits muscarinic and α-adrenergic Ca2+ release in smooth muscle. J. Biol. Chem. 264, 1797-1804. Langton, P.D., Standen, N.B., 1993. Calcium currents elicited by voltages steps and steady voltages in myocytes isolated from the basilar artery. J. Physiol. 469, 535- 548. 23 Lesh, R.E., Somlyo, A.P., Owens, G.K., Somlyo, A.V., 1995. Reversible permeabilization. A novel technique for the intracellular introduction of antisense oligodeoxynucleotides into intact smooth muscle. Circ. Res. 77: 220-230. Liu, Q.H., Zheng, Y.M., Korde, A.S., Yadav, V.R., Rathore, R., Wess, J., Wang Y.X., 2009. Membrane depolarization causes a direct activation of G protein-coupled receptors leading to local Ca2+ release in smooth muscle. Proc. Natl. Acad. Sci. USA. 106, 11418-11423. Mahaut-Smith, M.P., Hussain, J.F., Mason, M.J., 1999. Depolarization-evoked Ca2+ release in a non-excitable cell, the rat megakaryocyte. J. Physiol. 515, 385-390. Mahaut-Smith, M.P., Martinez-Pinna, J., Gurung, I.S., 2008. A role for membrane potential in regulating GPCRs? Trends Pharmacol. Sci. 29, 421-429. Mita, M., Yanagihara, H., Hishinuma, S., Saito, M., Walsh, M.P., 2002. Membrane depolarization-induced contraction of rat caudal arterial smooth muscle involves Rho-associated kinase. Biochem. J. 364, 431-440. Pitt, S.J., Martinez-Pinna, J., Barnard, E.A., Mahaut-Smith, M.P., 2005. Potentiation of P2Y receptors by physiological elevations of extracellular K+ via a mechanism independent of Ca2+ influx. Mol. Pharmacol. 67, 1705-1713. Rampe, D., Lacerda, A.E., 1991. A new site for the activation of cardiac calcium channels defined by the nondihydropyridine FPL64176. J. Pharmacol. Exp. Ther. 259, 982-987. Ratz, P.H., Berg, K.M., Urban, N.H., Miner, A.S., 2005. Regulation of smooth muscle calcium sensitivity: KCl as a calcium-sensitizing stimulus. Am. J. Physiol. 288, C769-C783. 24 Rubart, M., Patlak, J.B., Nelson, M.T., 1996. Ca2+ currents in cerebral artery smooth muscle cells of rat at physiological Ca2+ concentrations. J. Gen. Physiol. 107, 459- 472. Ryglewski, S., Pflueger, H.J., Duch, C., 2007. Expanding the neuron's calcium signaling repertoire: intracellular calcium release via voltage-induced PLC and IP3R activation. PLoS Biol. 5: e66. Sakurada, S., Takuwa, N., Sugimoto, N., Wang, Y., Seto, M., Sasaki, Y., Takuwa, Y., 2003. Ca2+-dependent activation of Rho and Rho-kinase in membrane depolarization induced and receptor stimulation-induced vascular smooth muscle contraction. Circ. Res. 93, 548-556. Seidler, N.W., Jona, I., Vegh, M., Martonosi, A., 1989. Cyclopiazonic acid is a specific inhibitor of the Ca2+-ATPase of sarcoplasmic reticulum. J. Biol. Chem. 264, 17816- 17823. Sutko, J.L., Airey, J.A., Welch, W., Ruest, L., 1997. The pharmacology of ryanodine and related compounds. Pharmacol. Rev. 49, 53-98. Thastrup, O., Cullen, P.J., Drobak, B.K., Hanley, M.R., Dawson, A.P., 1990. Thapsigargin, a tumor promoter, discharges intracellular Ca2+ stores by specific inhibition of the endoplasmic reticulum Ca2+-ATPase. Proc. Natl. Acad. Sci. USA. 87, 2466-2470. Uehata, M., Ishizaki, T., Satoh, H., Ono, T., Kawahara, T., Morishita, H., Tamakawa, H., Yamagami, K., Inui, J., Maekawa, M., Narumiya, S., 1997. Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 389; 990-994. Ureña, J., del Valle-Rodríguez, A., López-Barneo, J., 2007. Metabotropic Ca2+ channelinduced calcium release in vascular smooth muscle. Cell Calcium 42, 513-520. 25 van Breemen, C., Chen, Q., Laher, I., 1995. Superficial buffer barrier function of smooth muscle sarcoplasmic reticulum. Trends Pharmacol. Sci. 16, 98-105. Yanagisawa, T., Okada, Y., 1994. KCl depolarization increases Ca2+ sensitivity of contractile elements in coronary arterial smooth muscle. Am. J. Physiol. 267, H614-H621.