Differential Effect of the Overexpression of Rad2/XPG Family Endonucleases on Genome Integrity in Yeast and Human Cells

Depósito de investigación de la Universidad de Sevilla https://idus.us.es/ “This is an Accepted Manuscript of an article published by Elsevier in: DNA REPAIR on 2017, available at: https://doi.org/10.1016/j.dnarep.2017.06.030” 1 Differential effect of the overexpression of Rad2/XPG family endonucleases on genome integrity in yeast and human cells Sonia Jimeno*, Emilia Herrera-Moyano*, Pedro Ortega and Andrés Aguilera** Centro Andaluz de Biología Molecular y Medicina Regenerativa-CABIMER Universidad de Sevilla - CSIC - Universidad Pablo de Olavide Av. Américo Vespucio 24, 41092 SEVILLE, Spain * These authors contributed equally to this work ** Corresponding author: Phone: +34 954468372; Fax: +34 954461664 E-mail: [email protected] 2 ABSTRACT ___________________________________________________________________________ Eukaryotic cells possess several DNA endonucleases that are necessary to complete different steps in DNA metabolism. Rad2/XPG and Rad27/FEN1 belong to a group of evolutionary conserved proteins that constitute the Rad2 family. Given the important roles carried out by these nucleases in DNA repair and their capacity to create DNA breaks, we have investigated the effect that in vivo imbalance of these nucleases and others of the family have on genome integrity and cell proliferation. We show that overexpression of these nucleases causes genetic instability in both yeast and human cells. Interestingly, the type of recombination event and DNA damage induced suggest specific modes and timing of action of each nuclease that are beyond their known DNA repair function and are critical to preserve genome integrity. In addition to identifying new sources of genome instability, a hallmark of cancer cells, this study provides new genetic tools for studies of genome dynamics. ___________________________________________________________________________ Keywords: Rad2/XPG family; Rad27/FEN1; Genetic instability; Homologous recombination. 3 1. Introduction Single and double DNA strand breaks are among the most harmful forms of DNA damage. Studying the repair mechanisms of such damage is important in order to understand how cells maintain genome integrity. In Saccharomyces cerevisiae it is possible to induce a double strand break (DSB) via expression of either the HO or the I-SceI endonuclease, which cleave at specific DNA sequences creating a single DSB. In addition, other kinds of DNA damage can be induced using genotoxic agents such as methyl methanesulfonate (MMS) that methylates DNA and causes DNA fragmentation [1]; hydroxyurea (HU) that interferes with DNA replication; camptothecin (CPT) that inhibits the ligation step of the DNA topoisomerase I creating single and double strand breaks; 4-Nitroquinoline 1-oxide (4NQO) that mimics UV irradiation and causes DNA breaks [2] [3] [4]; high energy radiations such as gamma or X-rays, or UV irradiation that creates cyclobutane pyrimidine dimers (CPDs) that may evolve into DSBs [5] [6]. Eukaryotic cells possess several DNA endonucleases that work at different steps in DNA metabolism, including DSB repair by homologous recombination (HR), DNA replication or nucleotide excision repair (NER). Thus, the S. cerevisiae Rad1-Rad10 and Rad2 endonucleases are involved in the dual incision step of NER. The Rad1-Rad10 dimeric complex exhibits single strand DNA (ssDNA) endonuclease activity that cleaves 3’ ended ssDNA at the junction with the duplex DNA [7] [8]. Rad2 shows ssDNA endonuclease activity that cleaves 5´ended ssDNA at its junction with the duplex DNA [9]. For review see [10]. Rad2 (XPG in humans) gives the name to a family of evolutionary conserved proteins, Rad27 and Yen1 being two of its members. RAD27 (FEN1 in humans) encodes a 5' to 3' exonuclease and a 5' flap endonuclease involved in the processing of Okazaki fragments during DNA replication and in base excision repair (BER), thus having a crucial role in maintaining genome stability [11, 12] [13, 14]. It has also been shown to overlap functionally with Mus81 and to have a role in resolving HR intermediate structures such as Holliday junctions in mitosis and meiosis. Finally, Yen1 cleaves Holliday Junction (HJ)-like structures during DSB repair in anaphase [15-21]. Given the relevant functions of these nucleases and their capacity to create breaks on the DNA, it should be important for the cells to regulate their functions so that they only access their specific substrates. To further explore the specific in vivo roles and consequences of the Rad1-Rad10, Rad2, Rad27 and Yen1 nuclease activities we undertook a novel approach based on the analysis of the effect of overexpression of these proteins in yeast. We cloned these endonucleases under control of an inducible and strong promoter, later analyzing the impact of 4 their overexpression on genetic stability, DNA damage response (DDR) and cell cycle progression in yeast cells. In addition we used a similar approach in human cells. Our results reveal a differential effect of the overexpression of each nuclease that depends on its specific activities as well as the cell cycle stage at which they preferentially act. In addition, the study reveals that the cellular response of specific mutants to the overexpression of this group of nucleases provides a quick and reliable approach in understanding the DNA repair process in which the mutated genes are involved. Our study, therefore, not only identifies new possible intrinsic sources of genome instability, a hallmark of cancer cells, but also provides new genetic tools for studies of genome dynamics. 2. Materials and methods 2.1. Yeast strains and plasmids. Yeast strains used in this study are listed in Table 1. For use in yeast cells, plasmid pGAL-RAD2 was constructed by amplifying RAD2 using the primers 5 ´ATGCCAGGATCCATGGGTGTGCATTCATTTTGGGA 3´ and 5´ AGTCGATCTCGAGTTACATCTTTCTTTTCTTTAGT 3´ that introduce BamHI and XhoI restriction sites, respectively. The PCR product was cloned into the pRS414-GAL1 and pRS415-GAL1 plasmids (BamHI-XhoI). For plasmids pGAL-RAD1 and pGAL-RAD10, RAD1 was obtained from the plasmid pKJM358 [22] using BamHI and XhoI and was cloned into BamHI-XhoI sites of pRS414-GAL; whereas RAD10 was obtained from the plasmid pKJM353 [22] using BamHI and XhoI and was cloned into BamHI-XhoI sites of pRS413-GAL and pRS416-GAL plasmids. For plasmid pGAL-RAD27, RAD27 was obtained from the plasmid pRKY762 [23] using BamHI and HindIII and was cloned into XbaI-HindIII sites of pRS415GAL and pRS414-GAL plasmids. For pGAL-YEN1 genomic YEN1 was amplified using the primers 5 ´ GCGCGACCTATGGGATCCGCAATGGGTGTCTCACA 3´ and 5´ GACTGACGTACTGCAGAGCTTCATTCAATAGTGCT 3´ that introduce BamHI and PstI restriction sites, respectively. The PCR product was cloned into the pRS414-GAL1 and pRS415-GAL1 plasmids (BamHI-PstI). Plasmids containing the rad2E794A nuclease-dead mutant and its wild type control are described in [24]. For plasmids used in human cells, the XPG and FEN1 cDNAs were obtained by PCR from the RZPD/ImaGenes clones IRATp970CO437D and IRAUp969C102D (Berlin, Germany), respectively, with the primers 5´ CTAGTCTAGAATGGGGGTCCAGGGGCTCT 5 3´ and 5´ CCGGGGTACCTTAGGTTTTCCTTTTTCTT 3´, 5´ TCGCTACTCGAGATGGGAATTCAAGGCCTGG 3´ and 5´ CCGCGCGTCGACTTATTTTCCCCTTTTAAAC 3´. XPG cDNA sequence was cloned into the XbaI-KpnI sites of the pGCN vector [25] to generate pCGN-XPG plasmid. FEN1 cDNA was introduced into the pGEN-T-easy vector (Promega) and cloned into the KpnI-EcoRI sites of the pIRES2-EGFP vector (Clontech, Palo Alto, CA, USA) to generate pIRES2-EGFP-FEN1 plasmid. 2.2. Analysis of recombination and Rad52-GFP foci in yeast Recombination assays were performed as described previously [26] using 12 independent colonies for each strain studied. Yeast strains were grown on synthetic complete (SC) plates with 2% galactose with bases or amino acids omitted when indicated. After 4 days, independent colonies were picked, resuspended in water, and plated on SC+5-FOA (5-fluoro-orotic acid) plates for the direct-repeat leu2-k::URA3-ADE2::leu2-k system or in SC-His plates for the inverted-repeat his3p::INV recombination system [27]. The numbers of Uraor His+ recombinant colonies were quantified and the median frequency of recombination for each strain was calculated per viable cell number (determined on SC), as previously reported [28]. Rad52-YFP foci from mid-log-phase cells transformed with plasmid pWJ1344 and growing in galactose-containing media were visualized with a Leica DC 350F microscope as previously described [29]. 2.3. UV survival Yeast cells were cultured in SC medium with 2% galactose to an OD600 of 0.6. Plating, UV irradiation, and quantification were performed as described [30]. 2.4. Western blot analyses For detection of phosphorylated histone H2A, yeast cells were inoculated in SC media, diluted in SG/L (Glycerol/lactate) and incubated overnight, after which 2% galactose or glucose was added, growing the cells then for 8h more. 10 ml of exponentially growing culture of each strain were used for protein extraction. Proteins were extracted and separated in a gradient 420% gel as described [5]. Antibody ab15083 against phosphorylated histone H2A (Abcam, 6 UK) was used at a 1:2000 dilution. Membranes were blocked with Odyssey Blocking Buffer (LI-COR) and blotted with the appropriate primary antibody and infra-red dyed secondary antibodies (LI-COR). Antibodies were prepared in blocking buffer supplemented with 0.1% Tween-20. Membranes were air-dried and scanned in an Odyssey Infrared Imaging System (LICOR), and images were analyzed and quantified with ImageStudio software (LI-COR). Actin is shown as a loading control and its levels were used to normalize the amount of phosphorylated histone H2A for each transformant. For detection of HA-XPG by western, proteins were extracted and separated in 8% PAGE and primary anti-XPG (ab46, Abcam) antibody was used at a 1:1000 dilution. For detection of FEN1, proteins were separated in 10% PAGE and anti-FEN1 antibody was used (ab462, Abcam) at a 1:10000 dilution. Antibodies conjugated with horseradish peroxidase were used as secondary antibodies. 2.5. Human cell cultures and transfection U2OS cells were cultured in DMEM (Gibco, NY) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and were maintained at 37ºC and 5% CO2. Cells were transfected with plasmid (2 μg/ml) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to manufacturer’s instructions. Immunostaining and single cell electrophoresis assays were performed 24 hours after the transfection as described [31]. 2.6. Immunofluorescence in human cells Cells were cultured on glass coverslips and transfected at 70-80% confluence. Cells were fixed in 2% formaldehyde in phosphate-buffered saline buffer (PBS) for 20 min and permeabilized with 70% ethanol for 5 min at -20ºC, 5 min at 4ºC, and washed twice in PBS. After blocking with 3% bovine serum albumin (BSA) in PBS, the coverslips were incubated with anti-53BP1 1:500 (NB100-304, Abyntec Biopharma) and anti-XPG 1:700 (ab46, Abcam) primary antibodies diluted in 3% BSA in PBS for 1h at room temperature. Secondary goat anti-rabbit antibody conjugated with Alexa-Fluor 568 (Invitrogen) and chicken anti-mouse conjugated with Alexa-Fluor 488 in 3% BSA in PBS were used. DNA was stained with DAPI. Images were captured with a Leica DM6000 microscope equipped with a DFC390 camera (Leica). Data acquisition was performed with LAS AF (Leica) and analyzed with the MetaMorph v7.5.1.0. software. At least 100 cells from each experiment were analyzed. Mean and standard 7 deviation (SD) of three independent experiments are shown. Only transfected cells were quantified: in the case of XPG by the inmunofluorescence of XPG and in the case FEN1 by the EGFP signal from the bicistronic pIRES2-EGFP-FEN1 plasmid. 2.7. Single cell electrophoresis of human cells Single cell electrophoreses (comet assays) were performed using a commercial kit (Trevigen, Gaithersburg, MD, USA) following the manufacturer’s protocol. Images were acquired as described above and analyzed with the Comet-score software (version 1.5). At least 100 cells from each experiment were scored. Mean and SD of three independent experiments are shown. Values are normalized with the control (empty plasmid) in each case. 2.8. RNA analysis RNA was analyzed in yeast cells by Northern performed according to standard procedures [32]. RNA was isolated from mid-log phase cells transformed either with RAD2, RAD1-10, RAD27 or YEN1 overexpressing plasmids, grown in SC with or without galactose. As 32P-labelled DNA probes we used the same DNA fragments used to clone RAD2, RAD1, RAD10, RAD27 and YEN1 and an internal 589-bp 28S rRNA fragment obtained by PCR. In human cells, RNA was analyzed by Reverse Transcription qPCR analysis (RTqPCR). cDNA was synthesized from total RNA extracted using Rnaeasy Mini Kit (Quiagen) (1 μg) by reverse transcription using QuantiTect Reverse Transcription kit (Quiagen) and random primers. RT-qPCR was performed with SYBR qPCR Mix and analyzed on an ABI Prism 7000 (Applied Biosystems, Carlsbad, CA). mRNA expression of the indicated genes was normalized with mRNA expression of the HPRT housekeeping gene. Primers used were 5´ AGAGTCAAGGAGAGTGGTCTCTGAA 3´and 5´ CTGCAACTGTCTTAGCTTGAATACCT 3´for XPG, 5´ATCGTGCGGCGACTTGA 3´ and 5´ GCCTCCTTGTGGAGCCAAT 3´ for FEN1 and 5´ GGACTAATTATGGACAGGACTG 3´ and 5´ TCCAGCAGGTCAGCAAAGAA 3´ for HPRT. 3. Results 3.1. Overexpression of RAD2-family endonucleases impairs DNA repair in yeast 8 For further understanding of the in vivo role and consequences in genome dynamics of Rad110, Rad2, Rad27 and Yen1 in yeast cells, we cloned their genes under the control of the strong GAL1 promoter and confirmed by northern that the different nucleases were overexpressed in media containing galactose (Fig 1A). We also confirmed that Rad2 and Rad1-Rad10 overexpression plasmids were able to complement the UV sensitivity of the rad2∆, rad10∆ and rad1-1 mutants respectively, that the Rad27 construct was able to complement the thermosensitivity of the rad27∆ mutant and that Yen1 overexpression construct complemented the DNA damage sensitivity of the double mutant yen1∆ mus81∆ [17] (Fig S1). Analyses of sensitivity to several DNA damaging agents (UV, 4NQO, CPT and HU) of yeast cells in which RAD1-RAD10, RAD2, RAD27 or YEN1 were overexpressed, revealed an increase in sensitivity when either RAD2, RAD27 or YEN1 were overexpressed (Fig. 1B), but not when RAD1-RAD10 was overexpressed, with the exception of MMS. It is difficult to make definitive conclusions on the poor effect of Rad1-Rad10, since we do not know at which level both proteins are expressed as an active heterodimer. Therefore, we continued this study with the endonucleases Rad2, Rad27 and Yen1. We quantified the sensitivity to UV damage conferred by the overexpression of each of the endonucleases via UV-survival curves. Consistent with the previous results, overexpression of the three endonucleases decreased the viability of the wild type strain after UV irradiation (Fig. 1C), overexpression of Rad27 conferring the strongest sensitivity. Since it has been shown that Rad2 overexpression is able to suppress many of the rad27 mutant phenotypes [33] we wondered whether Rad27 could interfere with Rad2 function at UV-induced DNA lesions. As can be seen in Fig. 1C the viability of yeast cells overexpressing both Rad27 and Rad2 after 20 J/m2 of UV was 15 times higher than that of cells overexpressing only Rad27. To determine the impact of nuclease overexpression in cell cycle we analyzed S-phase progression upon release from G1 synchronized cells. Wild type cells overexpressing Rad2, Rad27 or Yen1 were synchronized in G1 with α-factor for 1 hour, and nuclease overexpression was induced with galactose for 2 more hours in the presence of the pheromone, after which the cultures were released into S-phase. We see a slight decrease in the G2 peak 40 minutes after release in cells overexpressing Rad2, Rad27 or Yen1 (Fig. S2A). However the differences were not statistically significant (Fig. S2B). Accordingly, doubling times of the cells were not significantly affected after overexpression of Rad2 or Rad27 (4.0 hours in wild-type controls, 3.7 and 4.4 hours in Rad2and Rad27-overexpressing cells, respectively) (Fig. S2C). 15 14. Shen, B., et al., Multiple but dissectible functions of FEN-1 nucleases in nucleic acid processing, genome stability and diseases. Bioessays, 2005. 27(7): p. 717-29. 15. Ip, S.C., et al., Identification of Holliday junction resolvases from humans and yeast. Nature, 2008. 456(7220): p. 357-61. 16. Tay, Y.D. and L. Wu, Overlapping roles for Yen1 and Mus81 in cellular Holliday junction processing. J Biol Chem, 2010. 285(15): p. 11427-32. 17. Blanco, M.G., et al., Functional overlap between the structure-specific nucleases Yen1 and Mus81-Mms4 for DNA-damage repair in S. cerevisiae. DNA Repair (Amst), 2010. 9(4): p. 394-402. 18. Ho, C.K., et al., Mus81 and Yen1 promote reciprocal exchange during mitotic recombination to maintain genome integrity in budding yeast. Mol Cell, 2010. 40(6): p. 988-1000. 19. Agmon, N., et al., The role of Holliday junction resolvases in the repair of spontaneous and induced DNA damage. Nucleic Acids Res, 2011. 39(16): p. 7009-19. 20. Matos, J., et al., Regulatory control of the resolution of DNA recombination intermediates during meiosis and mitosis. Cell, 2011. 147(1): p. 158-72. 21. Blanco, M.G. and J. Matos, Hold your horSSEs: controlling structure-selective endonucleases MUS81 and Yen1/GEN1. Front Genet, 2015. 6: p. 253. 22. Hwang, J.Y., S. Smith, and K. Myung, The Rad1-Rad10 complex promotes the production of gross chromosomal rearrangements from spontaneous DNA damage in Saccharomyces cerevisiae. Genetics, 2005. 169(4): p. 1927-37. 23. Chen, C. and R.D. Kolodner, Gross chromosomal rearrangements in Saccharomyces cerevisiae replication and recombination defective mutants. Nat Genet, 1999. 23(1): p. 81-5. 24. Kang, M.S., et al., Mitotic catastrophe induced by overexpression of budding yeast Rad2p. Yeast, 2010. 27(7): p. 399-411. 25. Tanaka, M. and W. Herr, Differential transcriptional activation by Oct-1 and Oct-2: interdependent activation domains induce Oct-2 phosphorylation. Cell, 1990. 60(3): p. 375-86. 26. Piruat, J.I. and A. Aguilera, A novel yeast gene, THO2, is involved in RNA pol II transcription and provides new evidence for transcriptional elongation-associated recombination. EMBO J, 1998. 17(16): p. 4859-72. 27. Malagon, F. and A. Aguilera, Yeast spt6-140 mutation, affecting chromatin and transcription, preferentially increases recombination in which Rad51p-mediated strand exchange is dispensable. Genetics, 2001. 158(2): p. 597-611. 28. Prado, F. and A. Aguilera, Role of reciprocal exchange, one-ended invasion crossover and single-strand annealing on inverted and direct repeat recombination in yeast: different requirements for the RAD1, RAD10, and RAD52 genes. Genetics, 1995. 139(1): p. 109-23. 29. Lisby, M., R. Rothstein, and U.H. Mortensen, Rad52 forms DNA repair and recombination centers during S phase. Proc Natl Acad Sci U S A, 2001. 98(15): p. 8276-82. 30. Gonzalez-Barrera, S., et al., Defective nucleotide excision repair in yeast hpr1 and tho2 mutants. Nucleic Acids Res, 2002. 30(10): p. 2193-201. 31. Herrera-Moyano, E., et al., The yeast and human FACT chromatin-reorganizing complexes solve R-loop-mediated transcription-replication conflicts. Genes Dev, 2014. 28(7): p. 735-48. 32. Chavez, S., et al., A protein complex containing Tho2, Hpr1, Mft1 and a novel protein, Thp2, connects transcription elongation with mitotic recombination in Saccharomyces cerevisiae. EMBO J, 2000. 19(21): p. 5824-34. 16 33. Sun, X., et al., Complementary functions of the Saccharomyces cerevisiae Rad2 family nucleases in Okazaki fragment maturation, mutation avoidance, and chromosome stability. DNA Repair (Amst), 2003. 2(8): p. 925-40. 34. Alvaro, D., M. Lisby, and R. Rothstein, Genome-wide analysis of Rad52 foci reveals diverse mechanisms impacting recombination. PLoS Genet, 2007. 3(12): p. e228. 35. Blanco, M.G., J. Matos, and S.C. West, Dual control of Yen1 nuclease activity and cellular localization by Cdk and Cdc14 prevents genome instability. Mol Cell, 2014. 54(1): p. 94-106. 36. Green, E.M., et al., Replication-independent histone deposition by the HIR complex and Asf1. Curr Biol, 2005. 15(22): p. 2044-9. 37. Schwabish, M.A. and K. Struhl, Asf1 mediates histone eviction and deposition during elongation by RNA polymerase II. Mol Cell, 2006. 22(3): p. 415-22. 38. Schultz, L.B., et al., p53 binding protein 1 (53BP1) is an early participant in the cellular response to DNA double-strand breaks. J Cell Biol, 2000. 151(7): p. 1381-90. 39. Prado, F., F. Cortes-Ledesma, and A. Aguilera, The absence of the yeast chromatin assembly factor Asf1 increases genomic instability and sister chromatid exchange. EMBO Rep, 2004. 5(5): p. 497-502. 40. Kim, J.A. and J.E. Haber, Chromatin assembly factors Asf1 and CAF-1 have overlapping roles in deactivating the DNA damage checkpoint when DNA repair is complete. Proc Natl Acad Sci U S A, 2009. 106(4): p. 1151-6. 41. Mousson, F., F. Ochsenbein, and C. Mann, The histone chaperone Asf1 at the crossroads of chromatin and DNA checkpoint pathways. Chromosoma, 2007. 116(2): p. 79-93. 42. Ashton, T.M. and I.D. Hickson, Yeast as a model system to study RecQ helicase function. DNA Repair (Amst), 2010. 9(3): p. 303-14. 43. Wagner, M., G. Price, and R. Rothstein, The absence of Top3 reveals an interaction between the Sgs1 and Pif1 DNA helicases in Saccharomyces cerevisiae. Genetics, 2006. 174(2): p. 555-73. 44. Symington, L.S., Homologous recombination is required for the viability of rad27 mutants. Nucleic Acids Res, 1998. 26(24): p. 5589-95. 45. Debrauwere, H., et al., Links between replication and recombination in Saccharomyces cerevisiae: a hypersensitive requirement for homologous recombination in the absence of Rad27 activity. Proc Natl Acad Sci U S A, 2001. 98(15): p. 8263-9. 46. Lee, M., et al., Rad52/Rad59-dependent recombination as a means to rectify faulty Okazaki fragment processing. J Biol Chem, 2014. 289(21): p. 15064-79. 47. Zhang, Y., et al., Regulation of repair choice: Cdk1 suppresses recruitment of end joining factors at DNA breaks. DNA Repair (Amst), 2009. 8(10): p. 1235-41. 48. Gobbini, E., et al., Functions and regulation of the MRX complex at DNA double-strand breaks. Microb Cell, 2016. 3(8): p. 329-337. 49. Chakraverty, R.K., et al., Topoisomerase III acts upstream of Rad53p in the S-phase DNA damage checkpoint. Mol Cell Biol, 2001. 21(21): p. 7150-62. 50. Segurado, M. and J.F. Diffley, Separate roles for the DNA damage checkpoint protein kinases in stabilizing DNA replication forks. Genes Dev, 2008. 22(13): p. 1816-27. 51. Aracil, M., et al., Expression of XPG protein in human normal and tumor tissues. Int J Clin Exp Pathol, 2013. 6(2): p. 199-211. 52. Deng, N., et al., Expression of XPG protein in the development, progression and prognosis of gastric cancer. PLoS One, 2014. 9(9): p. e108704. 53. Nikolova, T., M. Christmann, and B. Kaina, FEN1 is overexpressed in testis, lung and brain tumors. Anticancer Res, 2009. 29(7): p. 2453-9. 17 54. Hwang, J.C., et al., The Overexpression of FEN1 and RAD54B May Act as Independent Prognostic Factors of Lung Adenocarcinoma. PLoS One, 2015. 10(10): p. e0139435. 55. Santos-Rosa, H. and A. Aguilera, Isolation and genetic analysis of extragenic suppressors of the hyper-deletion phenotype of the Saccharomyces cerevisiae hpr1 delta mutation. Genetics, 1995. 139(1): p. 57-66. 56. Holmes, A. and J.E. Haber, Physical monitoring of HO-induced homologous recombination. Methods Mol Biol, 1999. 113: p. 403-15. 57. Munoz-Galvan, S., et al., Distinct roles of Mus81, Yen1, Slx1-Slx4, and Rad1 nucleases in the repair of replication-born double-strand breaks by sister chromatid exchange. Mol Cell Biol, 2012. 32(9): p. 1592-603. 58. Foiani, M., et al., Cell cycle-dependent phosphorylation and dephosphorylation of the yeast DNA polymerase alpha-primase B subunit. Mol Cell Biol, 1995. 15(2): p. 883-91. FIGURE LEGENDS Fig. 1. Characterization of the overexpression of Rad2, Rad27, Yen1 and Rad1-10 endonucleases. A. Northern analyses of the W303 strain transformed with plasmids harboring Rad2, Rad27, Yen1 or Rad1-Rad10 endonucleases genes. B. Sensitivity to DNA damaging agents of the W303 strain conferred by endonucleases overexpression. 10-fold serial dilutions of the wild type transformed either with the empty plasmid or with the ones bearing the constructs were cultured for four days at 30ºC in SC media supplemented with galactose either with or without 4NQO (0.1µg/ml), UV-C irradiation (10 J/m2), CPT (10 µg/ml), HU (150 mM) and MMS (0.005%). C. UV-C sensitivity curves of the W303 strain overexpressing Rad2, Rad27, Yen1 and Rad2 plus Rad27 endonucleases. W303 carrying the empty plasmid is used as control. The mean values and standard deviations (SD) from three independent experiments are plotted for each transformant. Fig. 2. Endonuclease overexpression causes DSB formation. A. Rad52 focus formation in asynchronously growing wild-type (BY4741) cells transformed either with the empty plasmid or with the plasmids overexpressing Rad2, Rad27 and Yen1 endonucleases. Mean and SEM of three experiments are shown. Statistical significance was determined with a Student’s t-test using PRISM software (Graphpad Software Inc.). Statistically significant differences were labelled with one or two asterisks for P < 0.05 or P < 0.01, respectively. B. Western blot against the phosphorylated form of histone H2A, used as a marker of DNA damage and its quantification. Wild type (W303-1AR5) transformed either with the empty plasmid or with the plasmids overexpressing Rad2, Rad27 and Yen1 endonucleases were used. Actin is shown as a 18 loading control. The results were analyzed and quantified with ImageStudio software. Mean and SEM of the signal quantification of three experiments are shown. Other details as in A. C. Recombination frequency using the direct-repeat system LK-AU (left) and in the invertedrepeat system his3Δ5′-his3Δ3′ (right). The AYW3-1B strain carrying the LK-AU system and the M137-11B strain carrying the his3Δ5′-his3Δ3′ system transformed either with the empty plasmid or with the plasmids harboring Rad2, Rad27 or Yen1 endonucleases were used. Error bars indicate SD of three independent experiments. Other details as in A. Fig. 3. Effect of the overexpression of Rad2 and Rad27 endonucleases on different mutants. The indicated strains were transformed with the plasmids overexpressing Rad2, Rad27 endonucleases or with the empty one. 10-fold serial dilutions were plated on SC supplemented with galactose. Fig. 4. Effect of the overexpression of Rad2 nuclease-dead mutant. The W303-1AR5 wildtype strain was transformed either with the empty plasmid, the plasmid overexpressing the wild type version of RAD2 or the rad2E794A nuclease-dead mutant. 10-fold serial dilutions in SC and in SC containing 150 mM of HU are shown (in both cases media was supplemented with galactose). Fig. 5. Effect of XPG overexpression in U2OS cells. A. mRNA and protein levels detection of XPG by qPCR and western blot in U2OS cells after 24 h of transfection. B. Percentage of cells with 53BP1 foci 24 h after pCGN (Control) or pCGN-XPG (XPG) transfection in U2OS. (*, p-value < 0.05, t-student test). Mean and SD of three independent experiments are shown. Fig. 6. Effect of FEN1 overexpression in U2OS cells. A. mRNA and protein levels detection of FEN1 by qPCR and western blot in U2OS cells after 24 h of transfection. B. Percentage of cells with 53BP1 foci 24 h after pIRES2-EGFP (Control) or pIRES2-EGFP-FEN1 (FEN1) transfection in U2OS. (*, p-value < 0.05, t-student test). Mean and SD of three independent experiments are shown. Fig. 7. XPG and FEN1 overexpression generate DNA damage in U2OS cells. Comet tail moment of U2OS cells overexpressing XPG or FEN1 during 24 h. Values were normalized with respect to the control (empty plasmid) in each case. (*, p-value < 0.05, t-student test). Mean and SD of three independent experiments are shown. 19 Table 1. Yeast strains used in this study. Strain Genotype Reference AYW3-1B MATa ade2-1 can1-100 his3-11 trp1-1 ura3-1 leu2k::ADE3-URA3::leu2k [55] W303-1A MATa ade2-1 can1-100 his3-11 trp1-1 ura3-1 leu2-3,112 R. Rothstein BY4741 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 EUROSCARF W303-1AR5 MATa ade2-1 can1-100 his3-11 trp1-1 ura3-1 leu2-3,112 rad5∆ [5] Y06464 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 rad50∆::KanMX4 EUROSCARF Y06401 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 rad51∆::KanMX4 EUROSCARF Y00540 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 rad52∆::KanMX4 EUROSCARF Y04530 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 rad54∆::KanMX4 EUROSCARF Y00810 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 mre11∆::KanMX4 EUROSCARF Y03756 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 rad59∆::KanMX4 EUROSCARF Y04542 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 sae2∆::KanMX4 EUROSCARF Y00870 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 ku70∆::KanMX4 EUROSCARF Y06546 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 ku80∆::KanMX4 EUROSCARF Y13576 MAT a his3∆1 leu2∆0 met15∆0 ura3∆0 rad9∆::KanMX4 EUROSCARF Y04205 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 xrs2∆::KanMX4 EUROSCARF Y04222 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 mus81∆::KanMX4 EUROSCARF Y00775 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 sgs1∆::KanMX4 EUROSCARF Y01331 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 srs2∆::KanMX4 EUROSCARF Y05722 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 chk1∆::KanMX4 EUROSCARF Y01310 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 asf1∆::KanMX4 EUROSCARF W845-10C MATa ade2-1 can1-100 his3-11 trp1-1 ura3-1 leu2-3,112 top3∆::LEU2 A. Aguilera AMH5 MATa ade2-1 can1-100 his3-11 trp1-1 ura3-1 leu2-3,112 cdc44-8::URA3 [56] M137-11B MATa can1-100 his3p::INV leu2 lys2-128 trp1 ura3 [27] 20 SUPPLEMENTARY INFORMATION Table S1. Yeast strains used in this study Strain Genotype Reference WSR-7D MATa-inc trp1-1 ura3-1 ade2-1 his3-11,15 can1-100 ade3::GAL-HO leu2::SFA1 [57] WSR-M81 WSR-7D mus81∆::HphMX4 [57] WSR-M81Y1 WSR-7D mus81∆::HphMX4 yen1∆::KanMX4 [57] YGR258c MATa his3∆1 leu2∆0 met15∆0 ura3∆0 rad2∆::KanMX4 EUROSCARF YKL113c MATa his3∆1 leu2∆0 met15∆0 ura3∆0 rad27∆::KanMX4 EUROSCARF AWF-2D MAT a trp1-1 ura3-1 leu2::ADE2::leu2 rad1-1 A. Aguilera UWA-3C MATa leu2 his3 ade2 trp1 rad10∆::URA3 A. Aguilera YJT72 W303 background sml1∆::URA3 J. A. Tercero YJT75 W303 background sml1∆::URA3 rad53::∆LEU2 J. A. Tercero YJT74 W303 background sml1∆::URA3 mec1∆::LEU2 J. A. Tercero Yeast cell cycle synchronization and flow cytometry Strains bar1∆ were used for cell cycle synchronization to prevent adaptation to a-factor. Cells were inoculated in SC medium (2% glucose) and were diluted in SG/L (2% glycerol-lactate) and incubated overnight in order to exhaust glucose from the cultures. Then cells were arrested in G1 with 5 µg/ml of a-factor for 1 hour and incubated for 2 additional hours with 2% galactose and a-factor before release from G1-arrest. Cultures were transferred to galactosecontaining medium to allow synchronous progression into the S phase. Approximately 107 cells were collected at each of the indicated post-release time-points and processed by flowcytometry analysis. Samples were processed as described [58] and cell cycle distribution was determined using a FACSCalibur system (Becton-Dickinson). The percentage of cells in each cell cycle phase was calculated using the program ModFit LT 3.0. Determination of doubling times Wild-type cells (W303-1AR5) carrying the pGAL, the pGAL-RAD2 or the pGAL-RAD27 21 plasmids were grown at 30ºC to mid-log phase in SG/L (2% glycerol-lactate) and incubated overnight in order to exhaust glucose from the cultures. Gal promoter expression was induced by the addition of 2% galactose. After 2 hours of galactose addition samples were collected at indicated time points. Growth was determined by measuring the Optical Density at 660nm of each culture. Figure legends Fig. S1. Complementation of rad2∆, rad27∆, rad1-1, rad10∆ and yen1∆ mus81∆ mutants with plasmids overexpressing the respective wild-type endonucleases. A. pGAL-RAD2 complements UV sensitivity of the rad2∆ mutant. Zig-zags of rad2∆ mutant (YGR258c) transformed either with the empty plasmid or with the one overexpressing RAD2 were cultured for four days in SC media with galactose after 10 J/m2 UV-C irradiation or no irradiation. B. pGAL-RAD27 complements the thermosensitivity of the rad27∆ mutant. Zig-zags of rad27∆ mutant (YKL113c) transformed either with the empty plasmid or with the one overexpressing RAD27 were cultured for four days at either 30ºC or at 37ºC in SC media with galactose. C. pGAL-RAD1 and pGAL-RAD10 complement UV sensitivity of the rad1-1 and rad10∆ mutants, respectively. Zig-zags of rad1-1 (AWF-2D) and rad10∆ (UWA-3C) mutants transformed either with the empty plasmid or with the one overexpressing RAD1 or RAD10 were cultured for four days in SC media with galactose after the irradiation with 20 J/m2 or 10 J/m2, respectively or no irradiation. D. pGAL-YEN1 complements the sensitivity to MMS of the yen1∆ mus81∆ double mutant . 10-fold serial dilutions of the wild type (WSR-7D), the mus81∆ (WSR-M81) or the yen1∆ mus81∆ double mutant (WSR-M81Y1) transformed either with the empty plasmid or with the one overexpressing YEN1 were cultured for four days at 30ºC in SC media with galactose either with or without MMS (0.0012%). Fig. S2. Endonuclease overexpression effect in cell cycle progression. A. Cell cycle profile of wild type (W303, bar1Δ) transformed either with the empty plasmid or with the plasmids harboring Rad2, Rad27 and Yen1 endonucleases after G1 release. ‘Async.’ represents asynchronous cell populations prior to the addition of α-factor. B. Proportion of cells (W303, bar1∆) in G1 and G2 transformed either with the empty plasmid or with the plasmids harboring Rad2, Rad27 and Yen1 endonucleases after 40 minutes of G1 release. C. Growth curves of 22 wild-type cells carrying the pGAL, the pGAL-RAD2 or the pGAL-RAD27 plasmids. After 2 hours of the galactose addition, samples were collected at different time points and the optical density was determined at 660nm (O.D. 660). The mean and SEM of three independent experiments are shown. The doubling times of the cultures are shown on the rigth. Fig. S3. Effect of the overexpression of Rad27 endonucleases on rad53 and mec1 mutants. The wild type (YJT72) and the isogenic rad53∆ (YJT75) and mec1∆ (YJT74) strains were transformed with the plasmids overexpressing Rad27 endonuclease or with the empty plasmid. 10-fold serial dilutions were plated on SC supplemented with galactose are shown. 1 Highlights: - Imbalance of members of the Rad2 family of endonucleases causes different effects. - Overexpression of Rad2 and Rad27 causes genetic instability in yeast. - Overexpression of XPG and FEN1 causes genetic instability in human cells. - New genetic tools were generated to induce massive single-stranded DNA breaks. - Results suggest to explore endonuclease overexpression in cancer cells.